Strong promoter P7 suitable for streptomyces and application thereof

By developing the strong promoter P7 and its plasmid vector suitable for Streptomyces, the problems of insufficient activity and unstable host adaptability of existing promoters have been solved, and the high-efficiency expression of target genes in various Streptomyces has been achieved, which promotes the development of Streptomyces metabolic engineering and the discovery of natural drugs.

CN121852379APending Publication Date: 2026-04-14SHANGHAI JIAOTONG UNIV +1

Patent Information

Application Number
CN202512036523.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-31
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

Existing technologies have limited constitutive strong promoter resources for Streptomyces, which are insufficient in activity and have unstable host adaptability, making it difficult to meet the needs of efficiently activating silent gene clusters and increasing metabolite production.

Method used

A strong promoter P7 and its plasmid vector suitable for various Streptomyces are provided. By optimizing the nucleotide sequence through directed evolution and point mutation, the promoter ensures efficient expression of target genes in different Streptomyces, including the genes encoding catechol 2,3-dioxygenase and deep blue natural pigment. Efficient expression is achieved using an integrative vector.

Benefits of technology

The study achieved efficient expression of target genes in various streptomyces models, significantly increased the expression levels of catechol 2,3-dioxygenase and deep blue natural pigment, enhanced the tool capabilities of streptomyces metabolic engineering, and promoted the discovery and biomanufacturing of natural drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121852379A_ABST
    Figure CN121852379A_ABST
Patent Text Reader

Abstract

The invention relates to a strong promoter P7 suitable for streptomyces and application thereof, and relates to the field of genetic engineering and microbial metabolism engineering. The nucleotide sequence of the strong promoter P7 is as shown in SEQ ID No.1, and the strong promoter comprises a plasmid vector of the strong promoter; a host cell comprising the plasmid vector; the invention also discloses application of the strong promoter, the plasmid vector and the host cell in starting expression of a target gene. Compared with the prior art, the characterization of the strong promoter P7 provides an effective tool element for streptomyces strong promoter engineering and high-efficiency gene expression, and has important significance on streptomyces silent gene characterization, high-efficiency gene expression, metabolite synthesis, metabolic pathway reconstruction and the like. The strong promoter can be applied to common streptomyces type strains, and has important significance on high yield of important proteins including enzymes and important metabolites from actinomycetes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and microbial metabolic engineering, and in particular to a strong promoter suitable for Streptomyces. P7 And its applications. Background Technology

[0002] Natural products are an important source of drug molecules, with diverse functions including antibacterial, antiviral, antifungal, antiparasitic, antitumor, and immunosuppressive effects. Streptomyces are a group of Gram-positive bacteria with high-GC genomes, known for their ability to produce a variety of secondary metabolites. Genome sequencing studies have shown that a single Streptomyces genome typically contains 25-50 biosynthetic gene clusters. However, under standard laboratory culture conditions, the vast majority of these biosynthetic gene clusters remain silent, failing to synthesize the corresponding metabolites, which significantly limits the discovery of new compounds.

[0003] Heterologous expression is an effective strategy for activating silent gene clusters. This involves introducing target biosynthetic gene clusters into model Streptomyces hosts with well-defined genetic backgrounds, rapid growth, and ease of manipulation (such as...). Streptomyces albus J1074, S. coelicolor M1154, S. lividans TK24, etc., can break free from the complex transcriptional regulatory network of the original host, thereby activating recessive gene clusters in heterologous host strains, increasing the yield of low-level expressed gene clusters, and ultimately obtaining new metabolites. For example, the type II PKS gene cluster derived from *Streptomyces* HDN155000 can be used to... spi (GenBank login number OP009365) in S. albus Heterologous expression in J1074 successfully yielded eight angusticycline derivatives, including novel compounds containing rare thiomethyl groups and novel oxygen-bridged structures. This fully demonstrates the powerful potential of heterologous expression in discovering structurally novel and bioactive natural products.

[0004] However, the expression efficiency of exogenous gene clusters in heterologous hosts is significantly influenced by the host's endogenous transcriptional regulatory mechanisms. Among these mechanisms, the promoter, as a key DNA sequence recognized and bound by RNA polymerase to initiate transcription, directly determines the transcriptional level of downstream genes (especially key enzyme genes in exogenous biosynthetic gene clusters), thus affecting the yield of target metabolites. Therefore, in metabolic engineering, overexpressing key enzyme genes of rate-limiting steps using strong constitutive promoters, or directly driving the transcription of the entire heterologous gene cluster, is one of the core strategies for increasing the yield of target compounds.

[0005] Currently, the resources of constitutive strong promoters available for Streptomyces are very limited. Modified promoters are currently the most widely used. ermEp* (derived from erythromycin resistance gene) ermE ) and kasOp* (from S. coelicolor Medium regulatory factor genes kasO However, these promoters still have significant limitations, mainly in the following aspects: (1) they are scarce, with few available tools; (2) their activity intensity is insufficient, making it difficult to meet the needs of high-energy-consuming metabolic pathways; and (3) their host adaptability is unstable, with varying expression performance in different Streptomyces hosts. These limitations directly restrict the further development of Streptomyces metabolic engineering. Therefore, it is urgent to discover and develop novel strong promoters with performance superior to existing Streptomyces promoter tools to meet the needs of heterologous expression, functional identification, and metabolic pathway construction.

[0006] Patent CN113667670B discloses a strong promoter suitable for Streptomyces and its application, including the sequence of the strong promoter, a plasmid vector, and its high-yield application in Streptomyces. (The text then mentions Streptomyces velutipes, but the connection to the previous sentence is unclear.) Streptomyces flocculus Using CGMCC 4.1223 as a template, a strong promoter sequence was amplified. xylE The promoter was evaluated as a reporter gene. The stnK4p promoter activity was higher than that of the four model strains. ermEp *and kasOp * This strong promoter can be found in various modes of Streptomyces, such as Streptomyces albopictus (…). Streptomyces albus ), Streptomyces cerevisiae ( Streptomyces lividans ), Streptomyces azureii ( Streptomyces coelicolor Streptomyces venezulatus ( Streptomyces venezuelae Efficient expression in )

[0007] Patent CN120060254A discloses a strong promoter for Streptomyces avermitosa and its application. The provided strong promoter for Streptomyces avermitosa can regulate the expression of key genes for the synthesis of target natural products by Streptomyces avermitosa, and its activity can remain stable during the 48 to 96-hour growth stage of Streptomyces avermitosa, thereby increasing the yield of target products through stable high expression of target genes.

[0008] As mentioned above, the existing constitutive strong promoters available for Streptomyces are very limited, and there are also problems such as insufficient activity and unstable host adaptability. Summary of the Invention

[0009] Existing technologies offer a limited number of constitutive strong promoters suitable for Streptomyces, and those that exist suffer from insufficient activity and unstable host adaptability. To address this, we need a highly efficient constitutive strong promoter applicable to various Streptomyces models, enriching the Streptomyces genetic manipulation toolkit, activating silent gene clusters, and promoting natural drug discovery and efficient biomanufacturing. This invention provides a strong promoter suitable for Streptomyces.P7 And its applications.

[0010] The objective of this invention can be achieved through the following technical solutions: This invention provides a highly efficient constitutive strong promoter suitable for various Streptomyces species. P7 The strong promoter is: (1) A promoter with a nucleotide sequence as shown in SEQ ID No. 1; (2) The nucleotides that have 75% or more, or 85% or more, or 90% or more, or 95% or more of the same nucleotide sequence as shown in SEQ ID No.1 and maintain the same strong promoter activity of the target gene as (1).

[0011] SEQ ID No. 1: CGTTCCTGGAATCTTCCGCCGCTCTTGCCCACCGGGTTGCGCGACGCCGTCCGGAGGGCGGTGCCCGCGTCGAGCGTGCCGGACCGTGTCGGGCGCCGCGTCCGGTGAAGGGGGCTCCGGCCGGGGTGACCGGTGCGGACGCGTGGGCGG AGTGGGCGGAGGGCGTGCCGCGGCGAACGAGGACGGCCGGGAGGGCCCTGAGAGCGACGAGGGGCTCCCCCTCCCCGGTCGTGGGGCCCCCTTGGAGGCACGCCGTGCGCGATGGTTGGCAGCCCGTCCGCGGCGTGCTAGCTTGCTAGC Furthermore, this strong promoter P7 From Streptomyces Streptomyces pluripotens Strong promoters can be synthesized using conventional biosynthetic techniques.

[0012] The present invention also provides a solution containing the above-mentioned strong promoter. P7 The plasmid vector is an integrative vector.

[0013] Preferably, the integrative vector is a broad-host shuttle plasmid vector containing the phage integrase gene int site and the oriT gene.

[0014] Furthermore, integrative vectors include the pSET152 plasmid vector.

[0015] The present invention also provides a host cell containing the above-mentioned plasmid vector.

[0016] Preferably, the host cell is a Streptomyces, including Streptomyces albopictus (Streptomyces oryzae). Streptomyces albus Streptomyces limonene ( ),Streptomyces lividans Streptomyces azureus ( ), Streptomyces coelicolor ) and Streptomyces venezuelae ( Streptomyces venezuelae ).

[0017] Furthermore, the methods of directed evolution and point mutation are applied to the strong promoter of this invention. P7 Nucleotide sequences are mutated. Nucleotides that have been artificially modified and have 75% or higher identity with the strong promoter nucleotide sequence isolated in this invention, as long as they maintain the strong promoter activity of the target gene, are all derived from and equivalent to the nucleotide sequence of this invention.

[0018] Furthermore, "identity" originally refers to the similarity of natural nucleic acid sequences. In this invention, "identity" refers to a nucleotide sequence that has 75% or higher, 85% or higher, 90% or higher, or 95% or higher similarity to the strong promoter (a) sequence of this invention, whose nucleotide sequence is shown in SEQ ID No. 1 of the sequence listing. Identity can be evaluated by visual inspection or computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0019] The present invention also provides the above-described strong promoter. P7 Application in initiating target gene expression.

[0020] Furthermore, the target gene was selected from the gene encoding catechol 2,3-dioxygenase. xylE Or the IndC gene encoding the deep blue natural pigment indC The gene encoding catechol 2,3-dioxygenase xylE Or the IndC gene encoding the deep blue natural pigment indC A strong promoter is inserted at the beginning to initiate the expression of catechol 2,3-dioxygenase or the deep blue natural pigment.

[0021] The present invention also provides the application of the above-mentioned plasmid vector in initiating the expression of target genes.

[0022] Furthermore, including the aforementioned strong promoters P7 Application of plasmid vectors in heterologous strains with high protein expression. The target genes in the heterologous strains include the gene encoding catechol 2,3-dioxygenase. xylE Or the IndC gene encoding the deep blue natural pigment indC ; In the catechol 2,3-dioxygenase gene xylE Or the gene encoding the deep blue natural pigment indC Upstream insertion of strong promoter P7 The expression levels of proteins were measured at different time points during the growth of the strain.

[0023] The present invention also provides the application of the above-described host cells in initiating the expression of target genes.

[0024] Furthermore, the application of host cells containing the aforementioned plasmid vectors in heterologous strains expressing high levels of protein. Model Streptomyces for heterologous protein expression include *Streptomyces albopictus* (…). Streptomyces albus Streptomyces limonene ( ), Streptomyces lividans Streptomyces azureus ( ), Streptomyces coelicolor ) and Streptomyces venezuelae ( Streptomyces venezuelae The target genes include the gene encoding catechol 2,3-dioxygenase. xylE and the gene encoding the deep blue natural pigment indC Strong promoters include the aforementioned strong promoters. P7 Similar to Streptomyces velutipes from patent CN 116333958 A Streptomyces flocculus CGMCC 4.1223's promoter stnYp The gene encoding catechol 2,3-dioxygenase xylE and the gene encoding the deep blue natural pigment indC Upstream, insert a strong promoter P7 This allows for the large-scale expression of catechol 2,3-dioxygenase and the deep blue natural pigment IndC in Streptomyces white.

[0025] In a preferred embodiment of the present invention, a detailed description is provided of the strong promoter. P7 The construction method of plasmid vectors; In another preferred embodiment of the present invention, a strong promoter is described in detail. P7 Construction method, detection method and results of strain expressing high levels of the deep blue natural pigment IndC; In another preferred embodiment of the present invention, a strong promoter is described in detail. P7 Construction and detection methods of strains expressing catechol 2,3-dioxygenase; In another preferred embodiment of the present invention, a strong promoter is described in detail. P7 Tests and results on the expression of catechol 2,3-dioxygenase in different Streptomyces strains.

[0026] Compared with the prior art, the present invention has the following beneficial effects: The strong promoter provided by this invention P7 Contains the strong promoter P7 Plasmid vectors, host cells, and their application in Streptomyces. Promoters. P7 From Streptomyces Streptomyces pluripotens The promoter is obtained through gene synthesis, in order to xylE and indC The promoter was evaluated for use as a reporter gene.P7 Strong promoter activity was higher in all four model strains than in Streptomyces velutipes. Streptomyces flocculus CGMCC 4.1223's promoter stnYp This strong promoter can be found in various modes of Streptomyces, such as Streptomyces albopictus (Streptomyces oryzae). Streptomyces albus Streptomyces limonene ( ), Streptomyces lividans Streptomyces azureus ( ), Streptomyces coelicolor Streptomyces venezulatus ( Streptomyces venezuelae Efficiently initiate gene transcription and expression in [the context of gene transcription].

[0027] A promoter was inserted upstream of the gene encoding catechol 2,3-dioxygenase and the deep blue natural pigment IndC. P7 This method enables the large-scale expression of catechol 2,3-dioxygenase and the deep blue natural pigment IndC in the heterologous expression model strain Streptomyces white J1074.

[0028] This strong promoter P7 The characterization provides an effective tool for the engineering of strong promoters and efficient gene expression in Streptomyces, and is of great significance for the characterization of silent genes, efficient gene expression, metabolite synthesis and metabolic pathway reconstruction in Streptomyces.

[0029] This strong promoter P7 It can be applied to commonly used Streptomyces model strains and is of great significance for the high production of important proteins, including enzymes and important metabolites, derived from actinomycetes. Attached Figure Description

[0030] Figure 1 The plasmid vector pSET152- from Example 1 P7-indC A schematic diagram of the spectrum.

[0031] Figure 2 The plasmid vector pSET152- from Example 1 P7-xylE A schematic diagram of the spectrum.

[0032] Figure 3 The strong promoter of Example 2 P7 A schematic diagram illustrating the effect of expressing the deep blue natural pigment IndC in the model strain Streptomyces white J1074.

[0033] Figure 4 The strong promoter of Example 4 P7 A schematic diagram illustrating the effects of expressing catechol 2,3-dioxygenase in different Streptomyces strains. Detailed Implementation

[0034] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. These embodiments are based on the technical solution of the present invention and provide detailed implementation methods and specific operating procedures. However, the scope of protection of the present invention is not limited to the following embodiments.

[0035] Unless otherwise specified, the experimental techniques and methods used in this embodiment are conventional. Unless otherwise specified, all materials and reagents used in this example can be obtained through legitimate commercial channels.

[0036] Example 1 Includes strong promoter P7 Construction of plasmid vectors (1) Strong promoter P7 The sequence information comes from Streptomyces. Streptomyces pluripotens The strong promoter sequence was synthesized by Jiutian Gene Technology (Tianjin) Co., Ltd. The gene for the biosynthesis of catechol 2,3-dioxygenase. xylE It comes from the integrative plasmid pDR3.

[0037] (2) Utilizing enzyme cleavage sites Spe I. The synthesized strong promoter P7 The sequence was inserted at the corresponding restriction site on the plasmid vector pSET152, encoding the gene for the deep blue natural pigment. indC lie in P7 Downstream, plasmid pSET152- was obtained. P7- indC The gene for the biosynthesis of catechol 2,3-dioxygenase is located at P7 Downstream, plasmid pSET152- was obtained. P7-xylE The two plasmid maps are as follows: Figure 1 , Figure 2 As shown, strong promoter P7 The nucleotide sequence is shown in SEQ ID No. 1.

[0038] Example 2 strong starter P7 Construction and detection of strains expressing high levels of deep blue natural pigment (IndC) (1) The control promoter is from Streptomyces velutipes in patent CN 116333958 A. Streptomyces flocculus CGMCC 4.1223's promoter stnYp(Its sequence is gcatccggtccgcgaaggatggccggaaccttctccatgaggtcgccgcggcggGCATGCttggcgtgcgacggctagcctgctaGCATGCtcacatgactgctgaagag), the plasmid vector expressing the deep blue natural pigment IndC via the control promoter was constructed in the same manner as in Example 1. The recombinant plasmid pSET152- P7 - indC Or plasmid pSET152- stnYp-indC Transformed into *E. coli* ET12567 / pUZ8002, the culture was plated on LB agar plates (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 15 g / L agar powder) containing 50 mg / L apopramine, 50 mg / L kanamycin, and 25 mg / L chloramphenicol for screening positive clones. After clones grew, single clones were picked and cultured at 37°C to the stationary phase in LB medium containing 50 mg / L apopramine, 50 mg / L kanamycin, and 25 mg / L chloramphenicol, yielding *E. coli* ET12567 / pUZ8002 (containing recombinant plasmid pSET152-). P7-indC or pSET152- stnYp-indC ).

[0039] (2) Escherichia coli ET12567 / pUZ8002 (containing recombinant plasmid pSET152- P7-indC or pSET152- stnYp-indC Inoculate 1% of the solution into 20 mL of LB liquid medium containing 50 mg / L apopramycin, 50 mg / L kanamycin and 25 mg / L chloramphenicol, and incubate at 37°C for 3-6 hours until the OD600 reaches 0.6.

[0040] (3) Inoculate Streptomyces white J1074 into YEME medium (3 g / L yeast extract, 5 g / L tryptone, 3 g / L malt extract, 10 g / L glucose, 103 g / L sucrose) and culture at 30°C until the logarithmic growth phase (about 36 hours).

[0041] (4) Take 10 mL of Escherichia coli ET12567 / pUZ8002 cultured to the logarithmic growth phase (containing recombinant plasmid pSET152- P7 - indC or pSET152- stnYp - indCAfter centrifugation to remove the supernatant, wash three times with LB broth to remove the supernatant. Take 1 mL of *Streptomyces albopictus* J1074 in logarithmic growth phase and mix with *Escherichia coli*. Spread the mixture onto MS plates containing 10 mM MgCl2 (15 g / L agar powder, 20 g / L mannitol, 20 g / L soybean meal). Incubate at 30°C for 10-14 hours. Cover with sterile water containing apopramine and trimethoprim (900 µL sterile water with 25 µL of 50 mg / L apopramine and 50 µL of 100 mg / L trimethoprim). Continue incubation at 30°C for approximately 4-5 days. Pick the grown conjugates, verify by PCR, and name the positive bacteria. S. albus J1074 / pSET152- P7 - indC or S. albus J1074 / pSET152- stnYp - indC .

[0042] (5) The white Streptomyces strain that expresses the deep blue natural pigment IndC using this strong promoter. S. albus J1074 / pSET152- P7 - indC and S. albus J1074 / pSET152- stnYp - indC Inoculate the culture into YEME medium and incubate at 30°C until the stationary phase. Transfer 250 µL of the bacterial culture to 25 mL of YEME medium and incubate at 30°C for 4 consecutive days, taking samples every 24 hours.

[0043] (6) Product detection: Take 1 mL of fermentation broth, centrifuge at 12,000 rpm for 10 min, take 20 μL of supernatant, add 180 μL of methyl sulfoxide and mix thoroughly, then determine its OD600. Figure 3 As shown, the gene encoding the deep blue natural pigment IndC... indC Upstream insertion of strong promoter P7 This method enables rapid and high-level expression of the deep blue natural pigment IndC in Streptomyces whiteifolia J1074, with expression levels significantly higher than those of the promoter. stnYp Expression levels of the deep blue natural pigment IndC.

[0044] Example 3 promoter P7 Construction of strains expressing catechol 2,3-dioxygenase Plasmid pSET152- P7 - xylEThe bacteria were transformed into *E. coli* strain ET12567 / pUZ8002 and plated on LB agar plates (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 15 g / L agar powder) containing 50 mg / L apopramine, 50 mg / L kanamycin, and 25 mg / L chloramphenicol. After colonies emerged, single colonies were picked and cultured at 37°C to the stationary phase in LB medium containing 50 mg / L apopramine, 50 mg / L kanamycin, and 25 mg / L chloramphenicol to obtain recombinant *E. coli* ET12567 / pUZ8002 (containing plasmid pSET152-). P7 - xylE ).

[0045] Recombinant Escherichia coli ET12567 / pUZ8002 (containing plasmid pSET152-) P7 - xylE Inoculate at a ratio of 1% into LB liquid medium containing 50 mg / L apopramycin, 50 mg / L kanamycin, and 25 mg / L chloramphenicol, and incubate at 37°C for 3–6 hours until OD (occurrence zone) reaches zero. 600 Approximately 0.6.

[0046] Streptomyces whiteiformis J1074 was inoculated into YEME medium (3 g / L yeast extract, 5 g / L tryptone, 3 g / L malt extract, 10 g / L glucose, 103 g / L sucrose) and cultured at 30°C until the logarithmic growth phase (approximately 36 hours), after which mycelial conjugation transfer was performed.

[0047] Collect 10 mL of *E. coli* ET12567 / pUZ8002 cultured to the logarithmic growth phase, wash three times with LB broth, and discard the supernatant. Mix 1 mL of *Streptomyces albopictus* J1074 culture in the logarithmic growth phase with the *E. coli*, and spread the mixture onto MS plates containing 10 mM MgCl2 (15 g / L agar powder, 20 g / L mannitol, 20 g / L soybean meal). Incubate at 30°C for 10-14 hours, then cover with sterile water containing apopramine and trimethoprim (900 µL sterile water with 25 µL of 50 mg / L apopramine and 50 µL of 100 mg / L apopramine). Continue incubation at 30°C for approximately 4-5 days. Select well-grown conjugates, verify by PCR, and name the positive bacteria accordingly. S. albus J1074 / pSET152- P7 - xylE .

[0048] Example 4 strong starter P7 Determination of catechol 2,3-dioxygenase expression in different Streptomyces strains The gene encoding catechol 2,3-dioxygenase xylE For reporter genes, evaluate strong promoters P7 Gene expression in different Streptomyces species. Four Streptomyces model strains ( Streptomyces albus J1074, Streptomyces cerevisiae ( Streptomyces lividans TK24, Streptomyces azureense ( Streptomyces coelicolor M1154, Streptomyces venezuelae ( Streptomyces venezuelae ISP5230. Contains plasmid pSET152- P7 - xylE The strains of *Streptomyces cyanobacterium*, *Streptomyces azure*, and *Streptomyces venezulata* were constructed in the same manner as in Example 3. The control promoter was... stnYp The plasmid vector containing the control promoter was constructed in the same manner as in Example 1.

[0049] The plasmid pSET152- P7 - xylE Four Streptomyces model strains were inoculated into YEME medium (3 g / L yeast extract, 5 g / L tryptone, 3 g / L malt extract, 10 g / L glucose, 103 g / L sucrose) and cultured at 30°C until the stationary phase. 250 μL of the bacterial culture was transferred to 25 mL of YEME medium and cultured at 30°C for 24, 48, and 72 hours, with 1 mL samples taken each time. After washing and resuspending the cells, they were sonicated for 2 min (2 s on, 4 s off). The sonicated bacterial culture was centrifuged at 12,000 rpm for 15 min at 4°C, and the supernatant was collected to obtain the cell supernatant.

[0050] The total protein concentration in the cell supernatant was determined. A reaction buffer (10 mM PBS, pH 7.5, 0.2 mM catechol) was prepared. The mixture was added to 200 μL of reaction buffer and 4 μL of cell supernatant, and reacted at 30°C for 10 minutes. The absorbance at 375 nm was then measured.

[0051] The activity of catechol-2,3-dioxygenase was calculated using the formula: mU [nmol / min]≈(30.03×Δ375) / (time [min]).

[0052] The formula for calculating normalized enzyme activity is: XylE activity=( XylE Enzyme activity (nmol / min) / (total protein added (mg)).

[0053] like Figure 4 As shown, among the four commonly used Streptomyces model strains, strong promoters... P7p-Cephanoquinone 2,3-dioxygenase XylE The expression levels of both were significantly higher than those of the promoter. stnYp The expression level of this enzyme indicates the strength of the promoter. P7 It has higher activity.

[0054] The preferred embodiments of the present invention have been described in detail above. It should be understood that those skilled in the art can make numerous modifications and variations based on the concept of the present invention without creative effort. Therefore, all technical solutions that can be obtained by those skilled in the art based on the concept of the present invention through logical analysis, reasoning, or limited experimentation on the basis of existing technology should be within the scope of protection defined by the claims.

Claims

1. A strong promoter suitable for Streptomyces P7 Its characteristics are, The strong promoter is: (1) A promoter with a nucleotide sequence as shown in SEQ ID No. 1; (2) The nucleotides that have 75% or more, or 85% or more, or 90% or more, or 95% or more of the same nucleotide sequence as shown in SEQ ID No.1 and maintain the same strong promoter activity of the target gene as (1).

2. A plasmid vector, characterized in that, Includes the strong promoter as described in claim 1 P7 .

3. A plasmid vector according to claim 2, characterized in that, The plasmid vector is an integrative vector, which is a broad host shuttle plasmid vector containing the phage integrase gene int site and the oriT gene.

4. A plasmid vector according to claim 3, characterized in that, The integrative vector is the pSET152 plasmid vector.

5. A host cell comprising the plasmid vector as described in claims 2-4, characterized in that, The host cell is Streptomyces, which is selected from Streptomyces alba, Streptomyces cerevisiae, Streptomyces cerevisiae, or Streptomyces venezulatus.

6. The strong promoter suitable for Streptomyces as described in claim 1 P7 Applications in initiating the expression of target genes.

7. The application according to claim 6, characterized in that, The target gene is selected from the catechol 2,3-dioxygenase encoding gene. xylE Or the gene encoding the deep blue natural pigment indC Insert the strong promoter upstream of the target gene P7 To activate the catechol 2,3-dioxygenase encoding gene xylE Or the gene encoding the deep blue natural pigment indC The expression.

8. The application of the plasmid vector according to any one of claims 2 to 4 in heterologous strains with high protein expression, characterized in that, The target genes in the heterologous strains include the gene encoding catechol 2,3-dioxygenase. xylE Or the IndC gene encoding the deep blue natural pigment indC ...

9. The application of the host cell as described in claim 5 in heterologous strains with high protein expression.

10. The application according to claim 9, characterized in that, The model Streptomyces for heterologous protein expression include *Streptomyces white*, *Streptomyces cerevisiae*, *Streptomyces azure*, and *Streptomyces venezulata*, with the target gene including the catechol 2,3-dioxygenase encoding gene. xylE and the gene encoding the deep blue natural pigment indC .

Citation Information

Patent Citations

  • A strong promoter suitable for Streptomyces and its application

    CN113667670B

  • Streptomyces avermitilis strong promoter and application thereof

    CN120060254A

Cited By

  • Streptomyces promoter selection marker and application

    CN122081356A