Construction method and application of bladder activity deficiency and fibrosis animal model
The Krt20-Cre-tdTomato mouse strain was constructed using CRISPR/Cas9-mediated homologous recombination technology, solving the problem of constructing models for bladder insufficiency and fibrosis, and realizing an animal model that provides a basis for elucidating the pathogenesis of LUTS and screening therapeutic targets.
Patent Information
- Application Number
- CN202610005607.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-05
- Publication Date
- 2026-04-17
AI Technical Summary
Existing technologies make it difficult to effectively construct animal models of bladder insufficiency and fibrosis, which makes it difficult to elucidate the pathogenesis of LUTS and explore therapeutic targets. Existing treatments cannot completely stop disease progression and have toxic side effects.
Using CRISPR/Cas9-mediated homologous recombination technology, the Cre-2A-tdTomato-Wpre-pA sequence was inserted before the first exon of the Krt20 gene to construct the Krt20-Cre-tdTomato mouse strain, which serves as an animal model of bladder insufficiency and fibrosis.
Animal models of bladder inactivity and fibrosis were successfully constructed, providing a basis for screening drug targets for the treatment of bladder fibrosis, overcoming the problem of insufficient model types, and providing preclinical animal model support.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, and more specifically, relates to a method for constructing and applying an animal model of bladder insufficiency and fibrosis. Background Technology
[0002] The appearance of lower urinary tract symptoms (LUTS) indicates dysfunction of the lower urinary tract, a progressive disease affecting approximately 2.3 billion people worldwide. Age, neurological disorders, metabolic syndrome, benign prostatic hyperplasia (BPH) in men, and inflammatory responses are all risk factors for LUTS, making the elucidation of its pathogenesis and clinical treatment extremely challenging. Furthermore, low awareness and treatment consciousness regarding LUTS greatly increase its risk of developing into severe lower urinary tract dysfunction (LUTD), potentially leading to urinary organ failure. Currently, the main clinical treatments for LUTS are lower urinary tract neuromodulation drugs and surgery. However, these interventions cannot completely halt disease progression and fail to meet clinical needs; many neuromodulation drugs have limited efficacy and significant side effects. Therefore, there is an urgent need to explore the pathogenesis of LUTS and discover potential therapeutic targets.
[0003] The common pathological feature of LUTS is generally bladder fibrosis. Currently, clinical studies have found bladder fibrosis in patients with neurogenic overactive bladder (OAB), underactive bladder (UAB), bladder outlet obstruction (BOO), and acute urinary retention (AUR). Simultaneously, bladder fibrosis has also been observed in preclinical animal models of partial bladder outlet obstruction (pBOO), neurogenic underactive bladder (UAB), radiation cystitis (RC), and ketamine-induced cystitis (KC). Furthermore, accumulated evidence from clinical samples and animal models indicates that extracellular matrix (ECM) remodeling, elevated TGF-β1 and HIF-1α levels are common molecular characteristics of bladder fibrosis remodeling. Therefore, targeting the bladder fibrosis process may offer new insights for the prevention and treatment of LUTS.
[0004] Therefore, developing novel LUTS and bladder fibrosis models is of great significance for elucidating the pathogenesis of LUTS and discovering new therapeutic targets. Summary of the Invention
[0005] To overcome the technical problems existing in the background art, this invention provides a method for constructing and applying an animal model of bladder insufficiency and fibrosis. A mouse strain with a Krt20 gene mutation, Krt20-Cre-tdTomato, is constructed using gene editing technology. This mouse strain is generated by knocking Cre-2A-tdTomato-Wpre-pA into the pre-exon 1 of the Krt20 gene. This Krt20 gene-deficient mouse model is a novel animal model of bladder insufficiency and fibrosis, which can be used to screen drug targets for the treatment of bladder fibrosis and for preclinical drug trials.
[0006] To achieve the above objectives, the present invention is implemented through the following technical solution:
[0007] A method for constructing an animal model of bladder insufficiency and fibrosis, wherein the method involves constructing a mouse strain Krt20-Cre-tdTomato with the Krt20 gene deleted using gene editing technology.
[0008] Preferably, the gene editing technology used is CRISPR / Cas9-mediated homologous recombination technology, which inserts the Cre-2A-tdTomato-Wpre-pA sequence before the first exon of the Krt20 gene to construct the Krt20-Cre-tdTomato mouse strain.
[0009] The aforementioned animal models of bladder inactivity and fibrosis were used in drug screening studies to treat bladder inactivity and bladder fibrosis.
[0010] The beneficial effects of this invention are:
[0011] This invention employs CRISPR / Cas9-mediated homologous recombination technology to insert the Cre-2A-tdTomato-Wpre-pA sequence before the first exon of the Krt20 gene, constructing the Krt20-Cre-tdTomato mouse strain. This strain can serve as an animal model of bladder insufficiency and fibrosis, overcoming the problems of complex lower urinary tract symptom modeling processes and insufficient model types in existing methods. It provides a basis for screening potential drug targets and a preclinical animal model. Attached Figure Description
[0012] Figure 1 A schematic diagram of the construction scheme for the Krt20 gene deletion model;
[0013] Figure 2 The results of RT-qPCR detection of Krt20 and ZO1 genes in the Krt20 gene deletion model;
[0014] Figure 3The results of immunofluorescence (IF) detection of Krt20 and Upk3a proteins in the Krt20 gene deletion model;
[0015] Figure 4 Images of bladder retention in a Krt20 gene deletion model;
[0016] Figure 5 A statistical graph showing the probability of urinary retention in a Krt20 gene deletion model;
[0017] Figure 6 The image shows the results of bladder urodynamic testing in a Krt20 gene deletion model.
[0018] Figure 7 Volcano plot of differential gene expression in urothelial, stromal and muscular tissues in a Krt20 gene deletion model;
[0019] Figure 8 The results are from the immunofluorescence (IF) assay of type I collagen.
[0020] Figure 9 A statistical analysis chart showing the percentage of collagen I coverage area in the bladder muscle layer;
[0021] Figure 10 The image shows the results of Sirius red / Fix green collagen staining in a Krt20 gene deletion model.
[0022] Figure 11 A statistical analysis chart showing the percentage of collagen coverage area stained with Sirius Red in the bladder muscle layer. Detailed Implementation
[0023] The present invention will be further described in detail below with reference to specific embodiments, but the scope of protection of the present invention is not limited to the content described.
[0024] Example 1
[0025] A method for constructing an animal model of bladder insufficiency and fibrosis is proposed. Using CRISPR / Cas9-mediated homologous recombination technology, the Cre-2A-tdTomato-Wpre-pA sequence is inserted before the first exon of the Krt20 gene (after the 5' untranslated region) to construct the Krt20-Cre-tdTomato mouse strain. The construction protocol is as follows: Figure 1 As shown.
[0026] The simplified procedure is as follows: Cas9 mRNA and gRNA were obtained through in vitro transcription; a homologous recombination vector (donor vector) containing a 2.7 kb 5' homologous arm, Cre-2A-tdTomato-Wpre-pA, and a 2.5 kb 3' homologous arm was constructed using in-fusion cloning. Cas9 mRNA, gRNA, and the donor vector were microinjected into fertilized eggs of C57BL / 6J mice to obtain F0 generation mice. PCR amplification and sequencing identification of positive F0 generation mice were followed by mating with C57BL / 6J mice to obtain positive F1 generation mice.
[0027] gRNA sequence information:
[0028] gRNAsSequence(5'-3')
[0029] gRNA1TTTGACGACTGAAATCCATCTGG
[0030] Example 2
[0031] The animal model of bladder insufficiency and fibrosis constructed in Example 1 was applied to drug target screening.
[0032] Experimental Analysis
[0033] I. Results of Krt20 gene deletion model construction
[0034] The knockout of Krt20 mRNA and KRT20 protein in the Krt20 mutant model was verified by RT-qPCR and immunofluorescence. The results are as follows: Figure 2 , 3 As shown, Figure 2 The results showed that, compared with wild-type (WT) bladder tissue samples without Krt20 knockout, Krt20 mRNA was significantly reduced in mutant (MUT) bladder tissue samples with Krt20 knockout, while ZO1 mRNA expression was not affected by the mutation. Figure 3 The results showed that the fluorescence signal of Krt20 almost disappeared in the MUT sample, while Upk3a still had a fluorescence signal, indicating that Krt20 mRNA and KRT20 protein were completely knocked out in the model constructed in this invention.
[0035] II. Krt20 gene deletion leads to urinary retention and insufficient bladder activity in mice.
[0036] The Krt20 gene-deficient mice constructed in this invention exhibited urinary retention in the bladder, such as... Figure 4 As shown, urinary retention was evident in the MUT samples, and as... Figure 5As shown, the probability of urinary retention is significantly higher in the MUT sample compared to the WT sample.
[0037] Through urodynamic analysis, such as Figure 6 As shown, compared with WT mice, the urine volume of Krt20-deficient mice significantly decreased from 54.73±5.958 μl to 32.27±4.962 μl, while the post-void residual urine volume significantly increased from 6.40±2.414 μl to 9.36±2.063 μl. These data indicate that Krt20 deficiency in mice leads to decreased bladder voiding pressure and urine volume, while increasing voiding frequency and post-void residual urine volume. This voiding dynamic characteristic is highly similar to that of clinical underactive bladder (UAB), suggesting that Krt20-deficient mice can serve as a preclinical research model for UAB.
[0038] III. Krt20 gene deletion leads to bladder fibrosis in mice
[0039] Tgfβ signaling pathway-related genes are enriched in the urothelial (Ur), lamina propria (LP), and smooth muscle (SM) layers of tissue, such as Figure 7 As shown, the expression levels of Tgfβ signaling pathway-related genes in the urothelium (Ur) and lamina propria (LP) of Krt20-deficient mice generally showed an upward trend, while the expression levels of genes such as Tgfb3 in the smooth muscle (SM) layer showed a downward trend.
[0040] Because the Tgfβ signaling pathway is highly correlated with tissue fibrosis, bladder retention and insufficient bladder activity are often molecular characteristics of tissue fibrosis. Immunofluorescence staining analysis, such as... Figure 8 As shown, it was found that type I Collagen protein significantly increased its coverage area in the bladder muscle layer, and statistical analysis revealed that the proportion of its coverage area also significantly increased (e.g., Figure 9 As shown in the figure), this is consistent with the increased Tgfb1 transcription level in the muscle layer. To further assess bladder fibrosis in Krt20-deficient mice, Sirius red & Fast green staining analysis revealed that the total collagen content in the bladder muscle layer of Krt20-deficient mice was also increased (as shown in the figure). Figure 10 , 11 (As shown). The aforementioned results all indicate that Krt20 deficiency leads to Tgfb1 signal-driven tissue fibrosis in the bladder muscle layer.
[0041] This invention utilizes CRISPR / Cas9-mediated homologous recombination technology to insert the Cre-2A-tdTomato-Wpre-pA sequence before the first exon of the Krt20 gene, successfully constructing an animal model of bladder insufficiency and fibrosis. This can provide a basis for screening potential drug targets and a preclinical animal model.
[0042] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made to it in form and detail without departing from the scope defined by the claims of the present invention.
Claims
1. A method for constructing a model of underactive bladder and fibrosis in an animal, the method comprising: The construction method described above involves using gene editing technology to construct a mouse strain with the Krt20 gene deletion, Krt20-Cre-tdTomato. 2. The method for constructing an animal model of bladder insufficiency and fibrosis according to claim 1, characterized in that: The gene editing technology described uses CRISPR / Cas9-mediated homologous recombination technology to insert the Cre-2A-tdTomato-Wpre-pA sequence before the first exon of the Krt20 gene, thereby constructing the Krt20-Cre-tdTomato mouse strain.
3. The application of the animal model of bladder insufficiency and fibrosis according to claim 1, characterized in that: The animal model described above was used in a study to screen drugs for the treatment of bladder insufficiency and bladder fibrosis.