Application of miR-377-3p in preparation of reagent for screening chronic obstructive pulmonary disease

By applying miR-377-3p circular RNA and its inhibitors, along with the ZFP36L1 gene, the problem of fibroblast senescence in chronic obstructive pulmonary disease (COPD) was addressed, enabling effective detection and treatment of COPD.

CN121874333APending Publication Date: 2026-04-17QUZHOU PEOPLES HOSPITAL (QUZHOU CENT HOSPITAL)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311751447.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-12-19
Publication Date
2026-04-17

AI Technical Summary

Technical Problem

The role of miR-377-3p in chronic obstructive pulmonary disease (COPD) is not yet clear in the current technology, and the increased senescence of fibroblasts promotes the development of COPD. There is a lack of effective detection and treatment methods.

Method used

The application of miR-377-3p circular RNA and its inhibitors in the preparation of reagents for screening and detecting chronic obstructive pulmonary disease (COPD) was explored. By inhibiting miR-377-3p activity or reducing its level, and in conjunction with the regulation of the ZFP36L1 gene, the pro-senescence activity of miR-377-3p in lung fibroblasts was interfered with.

Benefits of technology

Inhibiting miR-377-3p can improve chronic smoking-induced COPD, reduce lung fibroblast senescence, decrease inflammatory factor expression, and improve lung function, providing a new therapeutic target for chronic obstructive pulmonary disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121874333A_ABST
    Figure CN121874333A_ABST
Patent Text Reader

Abstract

The invention relates to an application of circular RNA (Ribonucleic Acid) in preparation of a reagent for screening chronic obstructive pulmonary disease. The circular RNA is miR-377-3p. The invention finds that miR-377-3p is up-regulated in chronic obstructive pulmonary disease patients, most of miR-377-3p is located in lung fibroblasts, and the chronic obstructive pulmonary disease can be improved by inhibiting miR-377-3p. The invention also finds that ZFP36L1 is a direct target of the miR-377-3p, and the ZFP36L1 mediates the senescence promoting activity of the miR-377-3p in the lung fibroblasts. The miR-377-3p is crucial to the attack of the chronic obstructive pulmonary disease and is expected to become a new target spot for treating the chronic obstructive pulmonary disease.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the pharmaceutical field, specifically to the application of miR-377-3p in the preparation of reagents for screening chronic obstructive pulmonary disease. Background Technology

[0002] Chronic obstructive pulmonary disease (COPD) is characterized by a combination of varying degrees of small airway disease and emphysema. COPD is a leading cause of death worldwide and its incidence continues to rise. Small airway narrowing is considered an important early mechanism in the development of COPD. While the underlying mechanisms and cells contributing to this pathological development are not fully understood, fibroblasts are considered a key cell type for airway repair, producing growth factors, cytokines, extracellular matrix (ECM), and metalloproteinases, thereby remodeling the airways.

[0003] Accelerated pulmonary aging is considered to be related to the pathophysiology of chronic obstructive pulmonary disease (COPD). Several mechanisms of accelerated aging have been identified in COPD, among which cellular senescence is the most prominent feature in the lung tissue of COPD patients. Cellular senescence is an irreversible state of cell cycle arrest, but it retains metabolic and secretory programs, known as the senescence-associated secretory phenotype (SASP). Key features of senescence include the activation of cell cycle regulatory pathways and the expression of senescence-associated β-galactosidase (SA-β-gal) activity. Increased cellular senescence in COPD-derived fibroblasts, and the accumulation of senescent fibroblasts promotes COPD development through abnormal ECM deposition and SASP.

[0004] MicroRNAs (miRNAs) are small non-coding RNAs, 20-25 nucleotides in length. miRNAs regulate gene expression in multicellular organisms by affecting mRNA stability and translation. They target the 3'-UTR of mRNA transcripts through complementary sequences and repress gene expression at the posttranscriptional level. Although miRNA dysregulation has been reported to be closely related to various pathogenesis mechanisms, including chronic obstructive pulmonary disease (COPD), our understanding of the role of miRNAs in COPD remains quite limited compared to that of miRNAs in tumors.

[0005] MiR-377-3p is a novel tumor-regulating miRNA whose biological function remains unclear. Studies have shown that MiR-377-3p has an inhibitory effect on clear cell renal cell carcinoma and hepatocellular carcinoma. Furthermore, it has been reported to inhibit cell metastasis and epithelial-mesenchymal transition in cervical cancer by targeting SGK3. Recent studies have shown that miR-377-3p downregulates EGR1 through Wnt / Beta-Catenin transduction and promotes benzo[a]pyrene-induced lung tumorigenesis. However, the effects of miR-377-3p on chronic obstructive pulmonary disease (COPD) have not been reported. Summary of the Invention

[0006] To solve the above-mentioned technical problems, the present invention includes the following aspects:

[0007] A first aspect of the present invention provides the use of a circular RNA in the preparation of a reagent for screening chronic obstructive pulmonary disease, wherein the circular RNA is miR-377-3p.

[0008] A second aspect of the present invention provides the application of a circular RNA in the preparation of a reagent for detecting the degree of aging of lung fibroblasts, wherein the circular RNA is miR-377-3p.

[0009] A third aspect of the present invention provides the use of the ZFP36L1 gene in the preparation of reagents for screening chronic obstructive pulmonary disease.

[0010] A fourth aspect of the present invention provides the application of the ZFP36L1 gene in the preparation of reagents for detecting the degree of aging of lung fibroblasts.

[0011] A fifth aspect of the present invention provides the use of a circular RNA inhibitor in the preparation of a medicament for treating chronic obstructive pulmonary disease, wherein the circular RNA inhibitor is a miR-377-3p inhibitor.

[0012] Preferably, the miR-377-3p inhibitor is a substance that inhibits miR-377-3p activity or a substance that reduces miR-377-3p levels.

[0013] Preferably, the substance that inhibits miR-377-3p activity is hsa-miR-377-3p antagomir (purchased from MedChemExpress LLC, catalog number HY-RI00842A).

[0014] Preferably, the substance that reduces miR-377-3p levels is selected from interfering RNA, microRNA, or gene knockout materials, etc.

[0015] The technical effects of this invention are as follows:

[0016] 1. This invention unexpectedly discovered that miR-377-3p is upregulated in patients with chronic obstructive pulmonary disease (COPD), with most of it located in lung fibroblasts. Inhibition of miR-377-3p can improve COPD induced by chronic smoking in mice. Mechanistic studies show that miR-377-3p promotes the senescence of lung fibroblasts, and knockout of miR-377-3p alleviates bleomycin-induced senescence of lung fibroblasts.

[0017] 2. This invention also discovered that ZFP36L1 is a direct target of miR-377-3p, mediating the pro-senescence activity of miR-377-3p in lung fibroblasts. The results show that miR-377-3p is crucial to the pathogenesis of chronic obstructive pulmonary disease (COPD) and holds promise as a novel therapeutic target for COPD. Attached Figure Description

[0018] Figure 1 This study measured the expression of miR-377-3p in patients and model mice with chronic obstructive pulmonary disease, as well as in vitro primary human and mouse lung epithelial cells and lung fibroblasts.

[0019] Figure 2 This is the protective effect of miR-377-3p antagonists on mice with chronic obstructive pulmonary disease;

[0020] Figure 3 It is the induction of senescence in lung fibroblasts by overexpression of miR-377-3p;

[0021] Figure 4 It inhibits the miR-377-3p effect on bleomycin-induced senescence of lung fibroblasts;

[0022] Figure 5 This is the molecular mechanism by which miR-377-3p induces the senescence phenotype of lung fibroblasts at the cellular level by directly targeting ZFP36L1 mRNA;

[0023] Figure 6 Animal-level miR-377-3p exacerbates fibroblast senescence during COPD by inhibiting ZFP36L1. Detailed Implementation

[0024] The embodiments of the present invention are described in detail below. These embodiments are implemented based on the technical solution of the present invention, and provide detailed implementation methods and specific operation processes. However, the scope of protection of the present invention is not limited to the following embodiments.

[0025] Unless otherwise specified, data in the accompanying figures of this invention are expressed as mean ± SD, where * represents p < 0.05 and ** represents p < 0.01. Statistical analysis in the experimental examples of this invention was performed using GraphPad Prism 7.0 (GraphPad Software, La Jolla, California, USA). Differences between groups were assessed using Student's t-test or one-way ANOVA, followed by Dunnett's multiple comparison test. Table 1 lists the primers used in the experimental examples of this invention. β-actin was used as the internal reference gene for mRNA expression levels, and U6 was used as the internal reference gene for miRNA expression levels.

[0026] Table 1 Primer sequences for qRT-PCR

[0027]

[0028]

[0029] The miR-377-3p agonist miR-377-3p agomir (#HY-R00842A) used in this invention is a complex of RNA (AUCACACAAAGGCAACUUUUGU, SEQ ID NO.29) and RNA (AAAAGUUGCCUUUGUGUGAUNN, SEQ ID NO.30) in a 1:1 ratio. It is a miRNA mimic that has undergone special chemical modification. The mature miRNA strand is fully methoxylated, with 2 and 4 thiocarbonyl modifications at the 5' and 3' ends, respectively, and a high-affinity cholesterol modification is attached to the 3' end. It can mimic endogenous miRNA and upregulate miRNA activity.

[0030] The miR-377-3p antagomir (#HY-RI00842A) used in this invention is an RNA (ACAAAAGUUGCCUUUGUGUG, SEQ ID NO.31), which is a complementary single strand of a mature miRNA that has undergone special chemical modification. The entire strand is modified with methoxy groups, and there are 2 and 4 thiocarbonyl modifications at the 5' and 3' ends, respectively. A high-affinity cholesterol modification is attached to the 3' end. It inhibits the function of miRNA by specifically binding to mature miRNA and preventing the complementary pairing of miRNA with its target gene.

[0031] The negative control miR-377-3p agonist MicroRNA Agomir Negative Control (#HY-R04602A) used in this invention is a complex of RNA (UUGUACUACACAAAAGUACUG, SEQ ID NO.32) and RNA (GUACUUUUGUGUAGUACAANN, SEQ ID NO.33) in a 1:1 ratio. The mature miRNA strand is fully methoxylated, with 2 and 4 thiocarbonyl modifications at the 5' and 3' ends, respectively, and a high-affinity cholesterol modification is attached to the 3' end.

[0032] The negative control miR-377-3p antagonist used in this invention, MicroRNAAntagomir NegativeControl (#HY-RI04602A), is an RNA (CAGUACUUUUGUGUAGUACAA, SEQ ID NO.34) whose entire chain is methoxylated, with two and four thiocarbonyl modifications at the 5' and 3' ends, respectively, and a high-affinity cholesterol modification linked at the 3' end.

[0033] The miR-377-3p agomir, miR-377-3p antagomir, MicroRNAAgomirNegativeControl, and MicroRNAAntagomir Negative Control mentioned above were all purchased from MedChemExpress LLC (Shanghai, China). Compared with common mimics / inhibitors, miR-377-3p agomir and miR-377-3p antagomir exhibited higher stability and inhibitory activity in animal experiments, and were more likely to cross cell membranes and interstitial spaces to accumulate in target cells.

[0034] Example 1: Determination of miR-377-3p expression in in vivo and in vitro lung fibroblasts and lung epithelial cells of patients with chronic obstructive pulmonary disease.

[0035] 1. Test Methods

[0036] 1.1 Expression of miR-377-3p in patients with chronic obstructive pulmonary disease

[0037] Blood and lung tissue samples from patients with chronic obstructive pulmonary disease (COPD) were obtained from lung cancer patients who underwent lobectomy or pneumonectomy at the Affiliated Quzhou Hospital of Wenzhou Medical University, with six patients in each group. COPD was determined based on a combination of medical history and physical examination (including pulmonary function tests using a spirometer). Informed consent was obtained from all participants. All studies were approved by the Institutional Review Board of the Affiliated Quzhou Hospital of Wenzhou Medical University.

[0038] Real-time PCR was used to determine miR-377-3p expression in blood and lung tissue samples from healthy individuals and patients with chronic obstructive pulmonary disease (COPD). Total RNA was extracted using Trizol reagent and conventional chloroform liquid chromatography. RNA samples were reverse transcribed using an RT mixing kit (Takara, RR036A) with random primers or gene-specific RT primers to generate complementary DNA (cDNA). Real-time PCR experiments were performed using SGExcel FastSYBR Master premix (Sangon Biotech, B532955-0005) under standard reaction conditions, utilizing 2...-ΔΔCt The method measures the relative expression level of the target gene or miRNA.

[0039] 1.2 Expression of miR-377-3p in isolated primary human lung fibroblasts and lung epithelial cells

[0040] Lung tissue specimens from lung cancer patients who underwent lobectomy or lung resection were cut into small pieces and incubated at 37°C for 1 hour with digestion buffer (0.1% collagenase, 0.05% trypsin, and 100 mg / mL DNase, Hanks' balanced salt solution). The digested tissue suspension was filtered through a 40 μm cell filter, centrifuged at 500 × g for 5 minutes, and the particles were collected. After erythrocyte lysis, the cells were resuspended and incubated with biotin-bound anti-CD16 / 32, anti-CD45, and anti-CD31 antibodies for 1 hour. The cells were then rinsed, resuspended, and incubated with streptavidin magnetic beads for 30 minutes. The tubes containing the incubated cells were then placed on a magnet to remove endothelial cells, lymphocytes, monocytes / macrophages, natural killer (NK) cells, neutrophils, and other hematopoietic cells. The supernatant was collected and placed in a tissue culture plate. After incubation at 37°C for 1 hour, the suspended lung epithelial cells were harvested for experiments. Adherent lung fibroblasts were grown in MEM medium supplemented with 10% FBS. Fibroblasts aged 3-5 years were used in the experiments. The expression of miR-377-3p in isolated primary human lung epithelial cells and lung fibroblasts was determined by real-time PCR using the method described above.

[0041] 2. Test Results

[0042] Real-time PCR testing confirmed the upregulation of miR-377-3p in blood and lung samples from patients with chronic obstructive pulmonary disease (COPD). Figure 1 (A and 1B). Furthermore, in lung fibroblasts of patients with chronic obstructive pulmonary disease (COPD), miR-377-3p expression was significantly higher than in healthy individuals; however, in lung epithelial cells, miR-377-3p expression did not differ significantly between COPD patients and healthy individuals. Figure 1 (C and 1D).

[0043] Experiment 2: Determination of miR-377-3p expression in mouse lung fibroblasts and lung epithelial cells induced by chronic smoking in vivo and in vitro.

[0044] 1. Test Methods

[0045] 1.1 Expression of miR-377-3p in mice induced by chronic smoking

[0046] Male WT C57BL / 6 mice (8-10 weeks old) were purchased from Life River Laboratory Animal Technology Co., Ltd. They were housed under sterile conditions (12-hour light / dark cycle) with an acclimatization period of one week. The model group mice were exposed nasally to cigarette smoke (Chinese Lion brand) for 75 minutes twice daily, 5 days a week, for 24 weeks to induce experimental chronic obstructive pulmonary disease (COPD). The blank control group mice were exposed to normal air for an extended period. Body weight was measured weekly. Starting on day 7 under isoflurane anesthesia, mice were intranasally injected with miR-377-3p antagomir (#HY-RI00842A) to inhibit miR-377-3p, once weekly (2.5 mg / kg body weight). The animal experimental protocol was reviewed and approved by the Laboratory Animal Management and Ethics Committee of Hangzhou Medical College, Zhejiang Province. The expression of miR-377-3p in blood and lung samples from the control group (Air) and the experimental COPD model (CS) mice was determined using real-time PCR using the above methods.

[0047] 1.2 Expression of miR-377-3p in isolated mouse lung fibroblasts and lung epithelial cells

[0048] Lung tissue from euthanized mice was cut into small pieces and incubated at 37°C for 1 hour with digestion buffer (0.1% collagenase, 0.05% trypsin, and 100 mg / mL DNase, Hanks' balanced salt solution). The digested tissue suspension was filtered through a 40 μm cell filter, centrifuged at 500 × g for 5 minutes, and the particles were collected. After erythrocyte lysis, the cells were resuspended and incubated with biotin-bound anti-CD16 / 32, anti-CD45, and anti-CD31 antibodies for 1 hour. The cells were then rinsed, resuspended, and incubated with streptavidin magnetic beads for 30 minutes. The tubes containing the incubated cells were then placed on a magnet to remove endothelial cells, lymphocytes, monocytes / macrophages, natural killer (NK) cells, neutrophils, and other hematopoietic cells. The supernatant was collected and placed in a tissue culture plate. After incubation at 37°C for 1 hour, the suspended lung epithelial cells were harvested for experiments. Adhering lung fibroblasts were grown in MEM medium supplemented with 10% FBS. The experiment used 3-5 year old fibroblasts. The expression of miR-377-3p in isolated primary mouse lung fibroblasts and epithelial cells was determined using real-time PCR using the method described above.

[0049] 2. Test Results

[0050] To determine whether this change is consistent across species, the abundance of miR-377-3p in mouse serum and lungs was examined. It was found that the levels of miR-377-3p in the serum and lungs of mice with chronic obstructive pulmonary disease induced by chronic smoking (CS) were significantly higher than those in normally ventilated control mice, similar to observations in humans. Figure 1 E and 1F).

[0051] Notably, in isolated primary mouse lung fibroblasts, the expression level of miR-377-3p in CS-treated mice was 6.3 times that in the normally ventilated group. Figure 1 G), while the proportion in the whole lung tissue of mice was 3.3 (G). Figure 1 F). In isolated mouse lung epithelial cells, there was no significant difference between the control group and the CS model mice, suggesting that the upregulation of miR-377-3p expression in the lungs of COPD mice may mainly originate from lung fibroblasts.

[0052] Experiment 3: Protective effect of miR-377-3p antagonist on mice with chronic obstructive pulmonary disease.

[0053] 1. Test Methods

[0054] 1.1 Animal Model Construction and Drug Administration

[0055] Male WT C57BL / 6 mice (8-10 weeks old) were purchased from Life River Laboratory Animal Technology Co., Ltd. and housed under sterile conditions (12-hour light / dark cycle) for a one-week acclimatization period. Twenty-four mice were randomly divided into three groups: a normal control group (Air + Scr), a model group (CS + Scr), and a drug group (CS + anti-miR), with eight mice in each group. Mice in the model and drug groups were exposed nasally to a cigarette (China Lion) atmosphere for 75 minutes twice daily for 5 days a week for 24 weeks to induce experimental chronic obstructive pulmonary disease (COPD). Mice in the normal control group were exposed to normal air. Under isoflurane anesthesia, mice in the normal group, model group, and drug group were intranasally injected with either the miR-377-3p antagomir (#HY-RI00842A, anti-miR) or the control miR-377-3p antagomir (#HY-RI04602A, Scr) once a week starting from day 7, at a dose of 2.5 mg / kg mouse body weight.

[0056] 1.2. Measure weight

[0057] The weight of mice was measured once a week during the experimental period, and the weekly weight changes of mice in each experimental group were recorded.

[0058] 1.3 Lung tissue staining

[0059] Lung tissue samples were fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned (3 μm thick). Longitudinal sections of the left unilobe lung were stained with hematoxylin and eosin. Alveolar enlargement was assessed by measuring the mean alveolar diameter in 10 viable images (magnification ×40).

[0060] 1.4 Determination of the number of inflammatory cells in bronchoalveolar lavage fluid (BALF)

[0061] Airway inflammation was assessed by differential counting of inflammatory cells in bronchoalveolar lavage fluid (BALF). BALF was prepared by inserting a 20G intravenous catheter into the trachea, adding 1 mL of PBS, centrifuging at 1,000g for 3 minutes, and then resuspending the particles in 1 mL of PBS. The total cell count and difference were assessed using a hemocytometer and a Diff-Quick staining kit (Sysmex, Kobe, Japan).

[0062] 1.5. Measurement of expression levels of inflammatory cytokines and chemokines in lung tissue

[0063] Quantitative analysis of TNFα and CXCL1 protein levels in mouse lung tissue homogenates was performed using an anti-mouse ELISA kit ordered from R&D Systems, and measurements were taken according to the manufacturer's instructions.

[0064] 1.6 Lung function assessment

[0065] Lung function tests, including FEV100 / FVC and forced residual capacity (FRC), were performed in a forced vital capacity system (Shanghai Yuyan Instrument Co., Ltd.) according to the manufacturer's instructions. Mice were anesthetized with ketamine (100 mg / kg) and toluidine (10 mg / kg) and intubated. All procedures were performed at least three times, and the average value was calculated.

[0066] 2. Test Results

[0067] To further elucidate the role of miR-377-3p in the pathogenesis of chronic obstructive pulmonary disease (COPD), experimental COPD mice were constructed through chronic smoking exposure. Figure 2 As shown in A and 2B, CS exposure limited weight gain, while the use of antithrombin to inhibit miR-377-3p alleviated the limitation of weight gain.

[0068] From a histopathological perspective, such as Figure 2 As shown in C (lung histological staining results, scale line: 80 micrometers) and 2D (mean linear intercept of lung tissue calculated from histopathological results), inhibition of miR-377-3p can significantly improve the damage of smoking to lung parenchyma.

[0069] Regarding lung inflammation, inhibiting miR-377-3p can reduce the total number of white blood cells in bronchoalveolar lavage fluid. Figure 2E). CS increased the expression of inflammatory cytokines TNF-α and chemokine CXCL1 proteins in whole lung homogenates, while inhibition of miR-377-3p significantly reduced the expression of TNF-α and CXCL1 proteins in lung tissue. Figure 2 F and 2G).

[0070] In terms of lung function FEV100 / FVC and forced residual capacity (FRC), miR-377-3p inhibition significantly reduced smoking-induced lung function impairment. Figure 2 The above results indicate that miR-377-3p is not only a biomarker in the blood of patients with chronic obstructive pulmonary disease (COPD), but also plays an important role in the pathological process of COPD.

[0071] Experimental Example 4: The Inducing Effect of miR-377-3p Overexpression on Lung Fibroblast Senescence

[0072] 1. Test Methods

[0073] 1.1 Ectopic expression of miR-377-3p in human lung fibroblasts

[0074] Human lung fibroblasts MRC-5 were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and cultured in DMEM medium containing 10% FBS and antibiotics, humidified at 37°C with 5% CO2. Following the manufacturer's instructions, MRC-5 cells were transfected in 6-well plates using RNAiMAX transfection reagent (Life Technologies, Thermo Fisher Scientific) and OptiMEM medium with 50 nM of the negative control miR-377-3p agonist MicroRNA Agomir Negative Control (#HY-R04602A, Ctrl group) and the miR-377-3p agonist miR-377-3p agomir (#HY-R00842A, miR group), respectively. Cell senescence was measured three days after transfection.

[0075] 1.2 SA-β-gal staining

[0076] SA-β-gal activity was detected and senescent cells were identified using the SA-β-gal staining kit (Beyotime, C0602) according to standard instructions. Tissue sections were reverse-stained with eosin for easy observation. After imaging with a Nikon inverted microscope, SA-β-gal positive cells were counted using ImageJ.

[0077] 1.3 Measurement of p53 and p21 protein levels

[0078] Cells were washed with 1×PBS and lysed in 1×SDS buffer containing protease inhibitors. The lysates were collected, boiled at 100°C for 10 minutes, and then centrifuged to remove cell debris. Equal volumes of proteins were separated by SDS-PAGE and transferred to a PVDF membrane. The membrane was blocked with 0.1% casein at room temperature for 60 minutes, then incubated overnight at 4°C with the appropriate primary antibodies (including p53 (Abcam, ab26), p21 (Abcam, ab109199), and β-actin (Cell Signaling Technology, 3700). The membrane was then incubated with HRP-bound secondary antibody at room temperature for approximately 60 minutes, and protein bands were detected using ECL Western blot substrate; band intensity was quantified using ImageJ software.

[0079] 1.4 Determination of SASP molecule mRNA expression level

[0080] Total RNA was extracted using Trizol reagent and conventional chloroform liquid chromatography. RNA samples were reverse transcribed using an RT mixing kit (Takara, RR036A) with random primers or gene-specific RT primers to generate complementary DNA (cDNA). Real-time PCR experiments were performed under standard reaction conditions using SGExcel FastSYBR Master premix (Sangon Biotech, B532955-0005) to determine the mRNA expression levels of several SASP molecules, including IL-1β, MCP-1, MMP9, and PAI-1. Primers used in the experiments are listed in Table 1.

[0081] 1.5,5-Ethynyl-2'-deoxyuridine (EdU) Immunofluorescence Assay

[0082] Use the EdU-488 cell proliferation assay kit (Beyotime, C0071) according to the standard instructions. Add an equal volume of the prepared EdU working solution (20 μM) to a 6-well plate, bringing the final concentration to 10 μM. Then culture the cells for another 6 hours. Fix, wash, permeabilize, and stain the cells sequentially. After imaging with a Nikon inverted fluorescence microscope, assess the EdU incorporation using a microscope at 200x magnification, observing at least 10 fields of view. Transfect cells in a 24-well plate with the negative control miR-377-3p agonist MicroRNAAgomir Negative Control (#HY-R04602A) or the miR-377-3p agonist miR-377-3p agomir (#HY-R00842A, miR group). At specified time points, trypsin digest and count the cells (n=3). Calculate the percentage of EdU-positive cells using ImageJ.

[0083] 2. Test Results

[0084] Chronic obstructive pulmonary disease (COPD) is associated with cellular senescence. To explore the mechanism by which miR-377-3p affects COPD progression, miR-377-3p was ectopically expressed in human lung fibroblasts (MRC-5). The results showed that overexpression of miR-377-3p significantly induced cellular senescence, as evidenced by senescence-related β-galactosidase (SA-β-gal) activity. Figure 3 A and 3B, Figure 3 (Grade A is 100μm).

[0085] The protein levels of p53 and p21 were determined by Western blotting (n=3). The results showed that overexpression of miR-377-3p increased the abundance of both p53 and p21, indicating that miR-377-3p activated DNA damage response signals. Figure 3 C and 3D).

[0086] Senescent lung fibroblasts exhibit a pro-fibrotic phenotype, secreting higher levels of senescence-associated secretory phenotype (SASP) proteins and promoting airway remodeling in chronic obstructive pulmonary disease (COPD). Real-time PCR was used to detect the levels of IL-1β, MCP-1, MMP9, and PAI-1 (n=4). The results showed that expression of miR-377-3p significantly increased the mRNA expression of several SASP molecules, including IL-1β, MCP-1, MMP9, and PAI-1. Figure 3 E).

[0087] Furthermore, miR-377-3p can also reduce fibroblast proliferation by assessing EdU binding and cell growth curves. Figure 3 These results demonstrate that upregulation of miR-377-3p induces senescence in lung fibroblasts.

[0088] Experimental Example 5: The alleviating effect of inhibiting miR-377-3p on bleomycin-induced senescence of lung fibroblasts.

[0089] 1. Test Methods

[0090] Human lung fibroblasts (MRC-5) were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and cultured in DMEM medium containing 10% FBS and antibiotics, humidified at 37°C with 5% CO2. To induce cell senescence, MRC-5 cells were treated with 0.01 U / mL DMSO (Con group) or bleomycin (Bleo group) for 12 hours, and then cultured in fresh medium for 2 days. The level of miR-377-3p was detected by real-time PCR (n=4).

[0091] MRC-5 cells treated with DMSO (Con+Scr group) were transfected in 24-well plates using the control miR-377-3p antagonist MicroRNAAntagomirNegative Control (#HY-RI04602A, Scr). MRC-5 cells treated with bleomycin (Bleo+Scr group and Bleo+anti-miR group) were transfected in 24-well plates using the control miR-377-3p antagomir MicroRNAAntagomirNegative Control (#HY-RI04602A, Scr) and the miR-377-3p antagomir (#HY-RI00842A, anti-miR), respectively. The SA-β-gal activity of the transfected MRC-5 cells was measured by X-gal staining, and the levels of p21 and PAI-1 proteins, the mRNA expression of SASP molecules, and EdU immunofluorescence were also measured. The specific methods are as described in Experiment 4.

[0092] 2. Test Results

[0093] This study investigated whether inhibiting miR-377-3p would have the opposite effect to overexpression on senescence in lung fibroblasts. Bleomycin treatment was used to induce senescence in MRC-5 cells, a commonly used cell model for senescence research. In bleomycin-induced senescent fibroblasts, miR-377-3p expression was significantly increased (…). Figure 4 A), which means that miR-377-3p plays an important role in the regulation of aging. More importantly, knocking out miR-377-3p reduces the bleomycin-induced aging phenotype, as evidenced by a decrease in SA-β-gal positive cells in miR-377-3p knockout cells (A). Figure 4 B and 4C, Figure 4 B scale line is 100μm), the expression of aging markers p21 and plasminogen activator inhibitor 1 (PAI-1) is decreased. Figure 4 D, n=4). After miR-377-3p knockout, the mRNA expression of SASP molecules IL-1β and MCP-1 also decreased. Figure 4 E). Furthermore, the anti-aging effect of miR-377-3p inhibition was confirmed by measuring cell proliferation and growth. Cell proliferation expressed as EdU binding degree and cell growth measured by cell count-based growth curves both indicated that miR-377-3p knockout significantly blocked bleomycin-induced cell cycle arrest and promoted cell proliferation (E). Figure 4 F and 4G).

[0094] Experimental Example 6: miR-377-3p induces senescence phenotype in lung fibroblasts by directly targeting ZFP36L1 mRNA.

[0095] 1. Test Methods

[0096] TargetScan and the miRDB database were used to screen for potential targets of miR-377-3p in regulating senescence. Top-ranked candidate mRNAs were selected and further screened based on their relevance to cellular senescence using existing research literature, confirming the binding sequences of miR-377-3p to potential targets.

[0097] To overexpress ZFP36L1 in MRC-5 cells, a flag-tagged ZFP36L1 vector (Cat#HG19776-CF) was purchased from Sino Biological. The ZFP36L1 cDNA ORF subcloning was then performed into the pCDH-CMV-puro lentiviral expression vector. The pMirTarget 3'UTR detection vector for the ZFP36L1 miRNA 3'UTR clone (#MiUTR3H-03855) was ordered from Creative Biogene. 3'UTR mutations in ZFP36L1 were performed using HieffMut TM The Site-Directed Mutagenesis Kit was produced by Shanghai Yesheng Biotechnology Co., Ltd. Transfection was performed using Lipofectamine 3000 reagent according to the manufacturer's (Invitrogen) instructions.

[0098] MRC-5 cells overexpressing ZFP36L1 were transfected with the negative control miR-377-3p agonist MicroRNA Agomir Negative Control (#HY-R04602A, Con group) and the miR-377-3p agonist miR-377-3p agomir (#HY-R00842A, miR group), respectively. Twenty-four hours after transfection, the mRNA level of ZFP36L1 was detected by real-time PCR (n=3), and the dose-dependent effect of the miR-377-3p agonist on ZFP36L1 protein abundance was investigated.

[0099] Human lung fibroblasts (HEK 293T) were purchased from the Cell Bank of the Chinese Academy of Sciences and cultured in DMEM medium containing 10% FBS and antibiotics, humidified at 37°C with 5% CO2. HEK 293T cells were transfected with 50 ng of pMirTarget vector carrying ZFP36L1 WT or a mutant 3'UTR, with or without transfection using 50 nM miR-377-3p agonist miR-377-3p agomir (#HY-R00842A) or the negative control miR-377-3p agonist MicroRNAAgomir Negative Control (#HY-R04602A). Luciferase activity was measured 24 hours after transfection.

[0100] Primary lung fibroblasts (n=3) from normal or chronic obstructive pulmonary disease (COPD) lung tissue were transfected with a luciferase reporter gene carrying the ZFP36L1 WT or MT 3'UTR. Luciferase activity was measured 24 hours after transfection. RNA levels were measured 2 days after transfection of primary lung fibroblasts with 50 nM miR-377-3p antagomir (#HY-RI00842A, anti-miR) or the control miR-377-3p antagomir (#HY-RI04602A, Scr).

[0101] 2. Test Results

[0102] miRNAs typically bind to the 3'-UTR (untranslated region) of target mRNAs, inhibiting protein production by disrupting mRNA stability and / or silencing translation. In humans and mice, miR-377-3p predicts a seed region targeting the 3'UTR of ZFP36L1, and experimental results show that the seed region of miR-377-3p in both humans and mice closely matches the 3'-UTR of ZFP36L1 mRNA. Figure 5 A). Overexpression of miR-377-3p agomir in MRC-5 significantly inhibited the expression of ZFP36L1 mRNA. Figure 5 B), this inhibitory effect is dose-dependent. Figure 5 C).

[0103] To further identify the direct regulation of ZFP36L1 by miR-377-3p, luciferase expression plasmids containing the 3'-UTR region of wild-type (WT) or mutant (MT) ZFP36L1 mRNA were constructed. Figure 5D). The results showed that miR-377-3pagomir effectively inhibited luciferase expression in the WT 3'-UTR, but had no effect on the MT 3'-UTR, indicating that regulation depends on the seed region sequence (D). Figure 5 E).

[0104] The luciferase plasmid was introduced into primary lung fibroblasts from healthy individuals or patients with chronic obstructive pulmonary disease to detect the effect of endogenous miR-377-3p on ZFP36L1 expression. Figure 5 As shown in Figure F, compared with normal fibroblasts, only COPD fibroblasts showed significantly inhibited luciferase expression of the WT 3'-UTR, indicating that endogenous miR-377-3p is higher under COPD conditions. Furthermore, the experiment found that inhibiting miR-377-3p in primary lung fibroblasts more effectively promoted ZFP36L1 expression in COPD fibroblasts. Figure 5 G).

[0105] Experimental Example 7: miR-377-3p exacerbates fibroblast senescence during COPD by inhibiting ZFP36L1.

[0106] 1. Test Methods

[0107] MRC-5 cells were transfected with 50 nM miR-377-3p antagomir (#HY-RI00842A, anti-miR) or the control miR-377-3p antagomir microRNAAntagomirNegative Control (#HY-RI04602A, Scr). After transfection, cells were treated with DMSO or bleomycin, and the mRNA level of ZFP36L1 was detected by real-time PCR.

[0108] MRC-5 cells were transfected with GFP (control group) or ZFP36L1-expressing lentivirus. Forty-eight hours after transfection, cells were treated with DMSO or bleomycin. SA-β-gal activity in cells was measured by X-gal staining, and the mRNA expression of p21 in MRC-5 cells (n=4) and the mRNA expression of SASP (IL-6, IL-8, and CCL20) in MRC-5 cells after bleomycin treatment were also measured.

[0109] MRC-5 cells were transduced with GFP (control group) or ZFP36L1-expressing lentivirus. One day after transfection, cells were transfected with either the 50 nM negative control miR-377-3p agonist MicroRNA Agomir Negative Control (#HY-R04602A) or the miR-377-3p agonist miR-377-3p agomir (#HY-R00842A). SA-β-gal activity was measured by X-gal staining. Real-time PCR was used to detect the mRNA expression of p53 and p21 in MRC-5 cells (n=4), as well as the mRNA levels of IL-1β and MCP-1 (n=4). Cells were cultured in EdU-containing medium for 6 hours (n=4). Cells were transfected with either the 50 nM negative control miR-377-3p agonist MicroRNAAgomir Negative Control (#HY-R04602A) or the miR-377-3p agonist miR-377-3p agomir (#HY-R00842A). Cells were digested with trypsin and counted at specified time points (n=3). The percentage of EdU-positive cells was calculated using ImageJ.

[0110] 2. Test Results

[0111] To further determine whether miR-377-3p regulates lung fibroblast senescence by inhibiting ZFP36L1, this study inhibited miR-377-3p in bleomycin-induced senescent fibroblasts. The results showed that inhibiting miR-377-3p largely restored the bleomycin-induced reduction in ZFP36L1. Figure 6 A). By analyzing SA-β-gal staining and the expression of p21 and SASP molecules (IL-6, IL-8, and CCL20), the introduction of ZFP36L1 into bleomycin-treated senescent fibroblasts significantly reduced cell senescence. Figure 6 B, 6C, and 6D).

[0112] ZFP36L1 was expressed in miR-377-3p-induced senescent cells. Studies found that overexpression of ZFP36L1 resulted in an increase in the proportion of SA-β-gal-positive fibroblasts. Figure 6 The expression of E and 6F) and the key regulators of aging, p53 and p21 ( Figure 6 Both G) decreased. The conclusion that ZFP36L1 expression leads to reduced cellular senescence was also confirmed by measuring SASP expression (IL-1β and MCP-1). Figure 6 H) and EdU binding test ( Figure 6I) has been confirmed. In summary, this evidence suggests that increased intracellular miR-377-3p induces senescence by inhibiting ZFP36L1 expression.

[0113] Although specific embodiments of the invention have been described, those skilled in the art will recognize that various changes and modifications can be made to the invention without departing from its scope or spirit. Therefore, the invention is intended to cover all such changes and modifications falling within the scope of the appended claims and their equivalents.

Claims

1. The application of a circular RNA in the preparation of a reagent for screening chronic obstructive pulmonary disease, characterized in that, The circular RNA is miR-377-3p.

2. The application of a circular RNA in the preparation of a reagent for detecting the senescence degree of lung fibroblasts, characterized in that, The circular RNA is miR-377-3p.

3. Application of ZFP36L1 gene in the preparation of reagents for screening chronic obstructive pulmonary disease.

4. Application of ZFP36L1 gene in the preparation of reagents for detecting the degree of senescence of lung fibroblasts.

5. The use of a circular RNA inhibitor in the preparation of a medicament for treating chronic obstructive pulmonary disease, characterized in that, The circular RNA inhibitor is a miR-377-3p inhibitor.

6. The application according to claim 5, characterized in that, The miR-377-3p inhibitor is a substance that inhibits the activity of miR-377-3p or reduces the level of miR-377-3p.

7. The application according to claim 6, characterized in that, The substance that inhibits miR-377-3p activity is hsa-miR-377-3p antagomir from MedChemExpress LLC (catalog number HY-RI00842A).

8. The application according to claim 6, characterized in that, The substance that reduces miR-377-3p levels is selected from interfering RNA, microRNA, or gene knockout materials.