RNA splicing verification method and kit for predictive guidance design

By using RNA splicing prediction tools to guide primer design, the problem of blindness in RNA splicing validation experiments has been solved, enabling efficient detection of complex splicing anomalies, especially accurate verification of deep intron mutations, thus improving the success rate and reliability of experimental results.

CN121896326APending Publication Date: 2026-04-21NANTONG ZHONGKE MEDICAL LAB CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202512054199.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-31
Publication Date
2026-04-21

AI Technical Summary

Technical Problem

In existing technologies, primer design for RNA splicing verification experiments is often blind, resulting in low efficiency in capturing complex splicing anomalies. In particular, the detection of deep intron mutations is difficult, and conventional electrophoresis cannot distinguish between abnormal and normal products.

Method used

Potential abnormal splicing patterns were analyzed using RNA splicing prediction tools. Specific amplification primers were designed to cross mutation sites, ensuring that primer positions and coverage could effectively distinguish between abnormal and normal products. PCR amplification and product analysis were then performed in conjunction with standard molecular biology experiments.

Benefits of technology

It significantly improves the efficiency and reliability of RNA splicing validation experiments, can clearly distinguish subtle splicing abnormalities, reduces the risk of false negatives, and provides two layers of evidence to confirm the actual splicing impact of mutations.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121896326A_ABST
    Figure CN121896326A_ABST
Patent Text Reader

Abstract

The invention discloses an RNA splicing verification method for predictive guidance design and a kit, and belongs to the technical field of molecular biology and genetic diagnosis. The method comprises the following steps: firstly, predicting an abnormal splicing mode possibly caused by specific gene mutation through a bioinformatics tool; then, on the basis of a prediction result, PCR primers are specifically designed, so that abnormal splicing products and normal splicing products can be effectively distinguished; and finally, carrying out experimental verification through RT-PCR and product sequencing. According to the method, the blindness of primer design in traditional verification is overcome, and the detection efficiency and accuracy of complex and tiny splicing abnormity are remarkably improved. The invention also provides a method for verifying the OTOF gene c.3409-11Agt, and a kit for verifying the OTOF gene c.3409- The invention discloses a special primer kit for G mutation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and genetic diagnostics, specifically to a method and kit for verifying RNA splicing based on prediction-guided design. Background Technology

[0002] RNA splicing is a crucial step in gene expression in eukaryotes, referring to the removal of introns (non-coding sequences) from primary RNA transcripts (such as hnRNA) produced by DNA transcription and the joining of exons (coding sequences) to form mature RNA. This process is catalyzed by the spliceosome (a complex composed of micronuclear RNA and proteins), achieving intron removal and exon splicing through two transesterification reactions. RNA splicing not only ensures the correct transmission of encoded information from RNA but also enables a single gene to produce multiple protein products through alternative splicing mechanisms, playing a vital role in biological development, functional regulation, and evolution.

[0003] RNA splicing abnormalities can lead to organ dysfunction and various diseases, and are one of the important causes of human genetic diseases. Mutations in exons and non-coding sequences can cause splicing abnormalities. The reason why mutation sites affect splicing may be the activation of hidden splice recognition sites, the formation of new splice sites, or the mutation site being located in the splicing regulatory sequence, affecting the binding of target proteins and indirectly affecting splicing. Generally, RNA splicing abnormalities caused by mutations mostly lead to exon skipping, partial exon deletion, deep intron fragment retention, and intron fragment retention near the boundary. It is estimated that pathogenic splicing abnormalities account for 10-50% of all pathogenic mutations, and pathogenic mutations in exons or introns (more than 100 bp away from the intron / exon boundary) account for about 25%.

[0004] Defining the specific impact of splice region mutation sites on RNA splicing is crucial for assessing the pathogenicity of variants, aiding in further clinical diagnosis, helping clinicians develop clinical treatment strategies, and providing a basis for assisted reproductive technologies. Commonly used experimental techniques include direct analysis of RNA and / or cDNA derivatives, as well as in vitro minigene techniques. Among these, using biopsy tissues from patients or animal models as research subjects is more convincing. However, the most appropriate sample type should be selected as experimental material based on gene expression patterns, available sample types, and literature reports.

[0005] The OTOF gene is located on chromosome 2, p23.3, and is 101,554 bases long, containing 48 exons. It encodes otoferlin, a calcium ion sensor containing 1,997 amino acids and six calcium-binding C2 domains. Otoferlin is primarily involved in the fusion of calcium-related synaptic vesicles in inner hair cells and the release of neurotransmitters, thereby activating auditory neurons. According to NCBI and GeneCards databases, the OTOF gene is expressed in blood; therefore, an in vitro validation experiment of abnormal RNA splicing was conducted based on blood samples. RNA was extracted from blood samples, reverse-engineered into cDNA, and specific primers were designed to amplify multiple exons / introns adjacent to the mutation site. Electrophoresis and sequencing techniques were then used to confirm the effect of the mutation on RNA splicing (e.g., exon deletion, intron retention, etc.).

[0006] However, both direct analysis and Minigene methods face a crucial but often overlooked problem in the early stages of experimentation: how to design PCR amplification primers to optimally capture potential, especially atypical, splicing abnormalities. Conventional primer designs for validation experiments are usually conservative, only spanning the nearest exons on either side of the mutation site. This design may be effective for classic splicing site disruptions that cause entire exon skipping or intron retention. However, when the mutation is located in a deep intron region and may activate hidden splicing sites (such as hidden acceptors or donors), conventional primer designs may face two major risks: (1) the length of the abnormal splice product is too close to that of the normal product, making it impossible to effectively distinguish them by conventional electrophoresis, leading to misjudgment or missed detection; (2) the primer binding site may be partially cleaved or affected by the abnormal splicing event, resulting in low amplification efficiency or even failure. This "blindness" in design reduces the first-time success rate and reliability of functional validation experiments. Therefore, there is an urgent need for a method that can integrate the depth of previous bioinformatics splicing predictions into experimental design to achieve "prediction-guided targeted verification," thereby improving the efficiency of functional interpretation of complex splicing mutations, especially deep intron mutations. Summary of the Invention

[0007] To address the shortcomings of existing technologies, this invention provides a predictive-guided design method and kit for RNA splicing verification, which solves the technical problems of blind primer design and low efficiency in capturing complex splicing anomalies in existing RNA splicing verification experiments.

[0008] To achieve the above objectives, this invention provides the following technical solution: a prediction-guided RNA splicing verification method, comprising the following steps: First, using RNA splicing prediction tools to analyze the target mutation site and identify its potential abnormal splicing patterns, such as activation of new splicing sites; then, based on the predicted pattern, specifically designed amplification primers that cross the mutation site, ensuring that the primer positions and coverage can effectively distinguish and amplify the predicted abnormal splicing products from the normal products; finally, obtaining cDNA through standard molecular biology experiments and performing PCR amplification and product analysis to verify the accuracy of the prediction and confirm the actual splicing impact of the mutation.

[0009] By employing the aforementioned 'predictive-guided design' strategy, the blindness of primer design in conventional validation methods is overcome. This approach is particularly suitable for validating deep intron mutations that may activate hidden splice sites within introns, significantly improving the efficiency and reliability of validation experiments.

[0010] Preferably, the target gene is the OTOF gene, and the specific mutation site is c.3409-11A>G.

[0011] Preferably, in step S1, the RNA splicing prediction tool predicts that the c.3409-11A>G mutation may cause a new splice acceptor site to be generated inside intron 27, thereby causing abnormal preservation of a portion of the intron sequence (10 bp).

[0012] Preferably, the specific amplification primers designed in step S2 include a forward primer OTOF-F1 and a reverse primer OTOF-R1; wherein, OTOF-F1 is located at the junction of exon 26 and exon 27 upstream of the site, and OTOF-R1 is located in exon 30. Their design positions ensure that when the c.3409-11A>G mutation activates the new splice acceptor and causes the retention of a 10bp intron fragment, the length difference between the amplified abnormal product and the normal product can be effectively distinguished; the nucleotide sequence of OTOF-F1 is shown in SEQ ID NO.2, and the nucleotide sequence of OTOF-R1 is shown in SEQ ID NO.3.

[0013] Preferably, the kit includes specific amplification primer pairs OTOF-F1 and OTOF-R1, and sequencing reagents; the nucleotide sequence of OTOF-F1 is shown in SEQ ID NO.2, and the nucleotide sequence of OTOF-R1 is shown in SEQ ID NO.3.

[0014] sequence list SEQ ID NO.1: A genomic DNA sequence fragment containing the OTOF gene c.3409-11A>G mutation site, as described in the specific embodiments.

[0015] SEQ ID NO.2: OTOF-F1 primer, with the sequence: CAGATTGGACCAGCAGGGAA SEQ ID NO.3: OTOF-R1 primer, with the sequence: GCTCCATAGTCACCACAACCT SEQ ID NO.4: The cDNA reference sequence spanning Exon26 to Exon30 of the OTOF gene, as described in the specific embodiments.

[0016] This invention provides a predictive-guided RNA splicing validation method and kit. Compared with existing technologies, it has the following advantages: 1. Improve the targeting and success rate of validation: By using the specific results of bioinformatics predictions (such as abnormal patterns and retained fragment lengths) as key inputs to guide the design of PCR primers, the experimental protocol can be directly optimized for the "predicted abnormalities", avoiding blind experiments and significantly improving the success rate of the first validation.

[0017] 2. Enhanced detection capability for subtle splicing abnormalities: By strategically designing primers to be placed further downstream in the exons, the length difference between normal and abnormal products can be artificially increased, so that even subtle splicing changes with only a few to dozens of base differences can be clearly distinguished in agarose gel electrophoresis, reducing the risk of false negatives caused by similar product lengths.

[0018] 3. Achieving closed-loop verification of prediction and experiment: This method establishes a complete process from prediction to design, then to verification, and finally to comparison. The final experimental results can not only confirm whether the mutation affects splicing, but also directly verify the accuracy of the previous bioinformatics predictions, providing more solid two-layer evidence for interpreting the pathogenicity of variants.

[0019] 4. Possesses good universality and scalability: The core method of this invention (i.e., adjusting primer design positions according to predicted abnormal patterns) is not only applicable to the OTOF gene or the c.3409-11A>G site, but can also be extended to the verification of other genes, other deep intron mutations that may activate cryptic splicing sites, or atypical splicing events. Attached Figure Description

[0020] Figure 1 The splicing prediction results of the OTOF gene c.3409-11A>G site RNA Splicer software in Example 1; Figure 2This is an agarose gel electrophoresis image of the RT-PCR amplification products of the patient and control samples in Example 1; Figure 3 This is a sequencing diagram of the RT-PCR amplification product of the wild-type control sample in Example 1; Figure 4 This is a sequencing diagram of the RT-PCR amplification product of the mutant patient sample in Example 1. Detailed Implementation

[0021] The technical solutions in the embodiments of the present invention have been clearly and completely described. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention. Example

[0022] This embodiment discloses an accurate and efficient verification method that reflects the true state of RNA splicing.

[0023] The OTOF gene is located on human chromosome 2, p23.3, and contains a total length of 101,554 bases with 48 exons. This gene is expressed in human peripheral blood, and its effects on precursor RNA splicing can be directly verified using peripheral blood samples.

[0024] Clinically, a patient carrying the OTOF gene c.3409-11A>G mutation was found. The mutation is located at the 11th deoxynucleotide position from the end of intron 27. The length of this intron is 223 bp. The partial nucleotide sequence of the genome carrying the OTOF gene c.3409-11A>G mutation is shown in SEQ ID NO.1.

[0025] SEQ ID NO.1: (Underlined area indicates mutation site) CCTTCCCTGGGGGGCGTGGAGCCAGGCTTGGTGGCAGGGTGGATGTGGCCATACCCGTGGTGTTCCAGCTGGGGGCCGAGCGGTCTGGGGGCCGGTAGATGAAGCGTCGCAGGGAGCTGACGGCATGGGAGCCCACCAGTGTGTAGCGACCGAAGGCCCGGCAGTCCACCACACGGATGTTCAAGGGCGGGTGCAGCAGCTCGTTCTCTGGGAGGTCCTGGGGTGTTGGCGACAGGAGCCTGAGCCTCCAAGAAGGGGCAGAGGAAGCCGGCTGGCTGAGTGGAGCCACACTGGCCACAGGATGTCCTCCGCCAGGGCCTGCACTCACCACTTCAAACCACTTGACGAGGGTGTTGAAGTTGGGGTTCTTCTTATAATTGTGGATCAGGGACGACTGCACCCCCTTCCCTGCACACTCGATGTCCACCCGTGGCCGGTCCACCTGGGCCAGGTTCACCCGCTTTAGGTCCCGTAGGCCCCAGAACAGCACCTGGGAGAGG TTGGAGGGTGGGTGCAGAGAAGAGGCCCCTTAGTCAAGGGAGCCAGCCATGGGGGTGCTGGACCATCCAATAGGGAACCGGGCAGTGGGATGGGCAGTAGTTCACCCCAGATTTCAAAGGGTGGG AGCAGGGCCAGGAGAGCAGAGGAGGGGCAGGCGTTCTCCAGGGATGAGGGTGGGGCTGCCCGGAGAAGGGGTGCAGGGTCAGGGGTGCAGACAGGAGGGCTGGGCATGGTCCTGGGACATGGGAG TGCGACTTGGTGCAGATGGGGGCAGGCCCTGGGCTGGGGCAGGAGCCTGGGTCTGCTGCTGGCTCCTGGTGATGGTGGTGGGAGGGGGATGACAAGCCACTTCCCCTCCTGGGTCCTCAGACTCC TCATCCAAAAGGGAAGGGCCACACAGAGCCCTCGCACCTCCACTCGGTACTTGCTGAGCACGGGCCGGATGCCCATGGGCACGGGCATGATGGGACCTCGGTCCACGTCCACCGGGCATTGATG Experimental steps: (1) Based on the RNA splicing prediction tool—RNA Splicer mutation site—splicing prediction was performed on the mutation site of the target gene. The prediction results showed that two splicing abnormalities may occur: 1) the generation of a new splice acceptor, resulting in the retention of part of the posterior intron 27, with a retained fragment length of 10 bp; 2) the entire intron 27 is retained, with a retained fragment length of 423 bp. Specific information is as follows: Figure 1 As shown.

[0026] The RNA Splicer not only predicted the "possible" abnormality, but more importantly, it provided two specific and quantifiable abnormality patterns (10bp retention or full-length intron retention).

[0027] Based on the prediction results of step (1) and the sequences before and after the locus, primers OTOF-F1 / OTOF-R1 were designed. OTOF-F1 is located at the junction of exon 26 and exon 27 upstream of the locus, and OTOF-R1 is located at exon 30 downstream of the locus. The theoretical RT-PCR amplification fragment length is 472 bp. Specifically, based on the accurate prediction results of step (1), this invention has designed targeted primers. The prediction showed that the most likely anomaly is the generation of a new splice acceptor in intron 27, resulting in the retention of the subsequent 10bp fragment. To ensure that the experiment can effectively capture and clearly distinguish the predicted splicing anomaly, the design position of the reverse primer (OTOF-R1) was strategically optimized based on the prediction information. Conventional verification strategies usually place the reverse primer in an exon near the mutation site (such as exon 28 or 29). This design has inherent limitations: First, if the mutation causes a larger range of splicing anomalies (such as multiple exon skipping), the adjacent primer binding sites may be lost, leading to amplification failure and incorrect judgment as no anomaly; second, for such subtle changes as the retention of only a 10bp intron fragment in the prediction, the length difference between normal and abnormal products is extremely small, and they are almost indistinguishable in conventional agarose gel electrophoresis, which can easily lead to missed detection.

[0028] Based on the precise prediction by the RNA Splicer tool that the c.3409-11A>G mutation "may activate the new splice acceptor and result in a 10bp retention," this invention proactively designs the reverse primer OTOF-R1 in exon 30, bringing key advantages: Expanded detection range and robustness: The design spans exons 26 to 30, which increases the chance of successful amplification even in the event of a wider range of splicing abnormalities, and avoids false negatives caused by the loss of primer binding sites.

[0029] Amplifying length differences for reliable detection: When splicing is normal, the amplification product is a normal fragment spanning exons 26 to 30; when the mutation activates the predicted new splice acceptor, the product will contain an additional 10 bp aberrant sequence. While a 10 bp absolute difference is difficult to distinguish in short fragments, by placing it against a longer amplicon background (the theoretical product length in this protocol is 472 bp), a length difference sufficient to effectively distinguish the normal and aberrant products by high-resolution agarose gel electrophoresis under optimized conditions is achieved (e.g., ...). Figure 2 (As shown).

[0030] Therefore, the decision to "design the reverse primer in exon 30" was not arbitrary, but rather a targeted response to the predicted "10bp retention" anomaly. It successfully transformed a subtle splicing change that was originally difficult to detect into a result that could be reliably observed and verified by standard experimental techniques.

[0031] This design strategy is based on proactive optimization of the experimental protocol using predictive information, aiming to directly verify specific predicted anomalous patterns. The forward primer OTOF-F1 is located in exon 26. In a conventional design, if the reverse primer is placed in exon 28, the length difference between the normal product and the predicted 10bp anomalous retention product is minimal, making them almost indistinguishable in ordinary agarose gel electrophoresis and prone to missed detection. However, if the prediction is "entire intron retention," the reverse primer needs to be designed further downstream (such as in exon 31 or 32) to generate a significant length difference (>200bp) sufficient for separation in electrophoresis. The primer sequences are shown in Table 1.

[0032] Table 1: OTOF-F1 / OTOF-R1 sequence information

[0033] (2) Total RNA was extracted from each sample using Red Blood Cell Lysis Buffer (Yisheng) / FreeZol Reagent (Novizan).

[0034] According to the design principles of this invention, when the prediction results show that a large fragment (e.g., more than 100 bp) may be abnormally retained, the reverse primer should be designed accordingly in a more downstream exon to ensure that the normal and abnormal products obtain sufficient resolution in electrophoresis.

[0035] (3) RNA from each sample was quantified using the Equalbit RNA HS Assay Kit (Novizan).

[0036] (4) Reverse transcription experiment using HiScript III RT SuperMix for qPCR (+gDNA wiper) (Novizan): Add 10 pg - 500 ng total RNA to an RNase-free centrifuge tube, heat at 65°C for 5 min, quickly cool on ice, and incubate on ice for 2 min. Then add 2 μL of 5 × gDNA wiper Mix, gently mix with a pipette, and incubate at 42°C for 2 min. Prepare the first-strand cDNA synthesis reaction solution according to the system in Table 2, and gently mix with a pipette. Perform the first-strand cDNA synthesis reaction according to the procedure in Table 3.

[0037] Table 2 First-strand cDNA Synthesis Reaction System

[0038] Table 3. First-strand cDNA synthesis reaction procedure

[0039] Note: *. This step is only required when using Random hexamers; omit this step when using Oligo(dT)20 VN or GSP.

[0040] (5) After reverse transcription, the OTOF gene Exon26-Exon27-Exon28-Exon29-Exon30 (nucleotide sequence as shown in SEQ ID NO.4) was amplified by PCR using the primers shown in Table 1. The PCR amplification reaction system was configured according to Table 4 and the PCR amplification reaction program was set according to Table 5.

[0041] SEQ ID NO.4: GGCAAAGCTGACTTCATGGGCCGGACCTTCGCCAAACCCCTGGTGAAGATGGCAGACGAGGCGTACTGCCCACCCCGCTTCCCACCTCAGCTCGAGTACTACCAGATCTACCGTGGCAACGCCACAGCTGGAGACCTGCTGGCGGCCTTCGAGCTGCTGCAGATTGGACCAGCAGGGAAGGCTG ACCTGCCCCCCCATCAATGGCCCGGTGGACGTGGACCGAGGTCCCATCATGCCCGTGCCCATGGGCATCCGGCCCGTGCTCAGCAAGTACCGAGTGGAGGTGCTGTTCTGGGGCCTACGGGACCTAAAGCGGGTGAACCTGGCCCAGGTGGACCGGCCACGGGTGGGACATCGAGTGTGCAGGGAAG GGGGTGCAGTCGTCCCTGATCCACAATTATAAGAAGAACCCCAACTTCAACACCCTCGTCAAGTGGTTTGAAGTGGACCTCCCAGAACGAGCTGCTGCACCCGCCCTTGAACATCCGTGTGGTGGACTGCCGGGCCTTCGGTCGCTACACACTGGTGGGCTCCCATGCCGTCAGCTCCCTGC GACGCTTCATCTACCGGCCCCCAGACCGCTCGGCCCCCAGCTGGAACACCACGGTCAGGCTTCTCCGGCGCTGCCGTGTGCTGTGCAATGGGGGCTCCTCCTCTCACTCCACAGGGGAGGTTGTGGTGACTATGGAGCCAGAGGTACCCATCAAGAAACTGGAGACCATGGTGAAGCTGGACGCG Table 4 PCR amplification reaction system

[0042] Table 5 PCR amplification reaction procedure

[0043] Since this experiment aims to distinguish fragments with small length differences (the difference between normal and abnormal products is about 10 bp), a high-resolution 1.5% agarose gel was used for electrophoresis analysis, and the electrophoresis conditions (200V, 25min) were optimized to ensure that the target bands could be clearly distinguished.

[0044] The amplification products were subjected to electrophoresis on a 1.5% TAE agarose gel. The sample loading volume was 20 μL, and the marker loading volume was 5 μL. After electrophoresis at 200V for 25 min, images were taken using a gel imaging system and saved. The gel electrophoresis images are shown below. Figure 2 As shown, the target DNA band was cut from the agarose gel and placed into a clean centrifuge tube, and then recovered using the FastPure Gel DNA Extraction MiniKit (Novizan).

[0045] To fully separate DNA fragments that differ in length by only about 10 bp, this example uses a high-resolution 1.5% agarose gel and optimizes the electrophoresis conditions (200V, 25min) to ensure that normal and abnormal bands can be separated at baseline, facilitating subsequent gel recovery and sequencing.

[0046] (7) Quantify the recovered product and perform Sanger sequencing experiments. The peak plot file (.ab1) can be opened and analyzed using Chromas or SeqMan software. The sequencing results are as follows: Figure 3 (wild type) and Figure 4 (Patient sample) is shown.

[0047] Figure 3 The sequence shows a complete and correctly assembled Exon26-Exon27-Exon28-Exon29-Exon30. Crucially, Figure 4 The sequencing chromatogram showed a clear bimodal signal at the boundary between Exon 27 and Exon 28. Reverse sequencing confirmed that a 10bp sequence from intron 27 (sequence: 5'-XXX…-3') was inserted after Exon 27. The insertion location and length of this anomalous sequence perfectly matched the prediction made by the RNA Splicer tool in step S1, which stated that 'activation of the new splice acceptor leads to a 10bp retention'. This not only confirmed the pathogenicity of c.3409-11A>G but also directly demonstrated the effectiveness and accuracy of the primer design strategy based on prediction in this invention.

[0048] The above results indicate that the method of this application can accurately reflect the effect of gene mutations on RNA splicing and has the potential to detect whether other unknown mutations will cause abnormal RNA splicing.

[0049] In summary, this embodiment demonstrates an innovative workflow for verifying RNA aberration splicing. Compared to conventional direct RT-PCR analysis, the core advantage of this method lies in elevating bioinformatics prediction from a preliminary reference to a key decision-making basis driving the entire experimental design. Successful verification at the c.3409-11A>G site in the OTOF gene demonstrates that prospectively designing the reverse primer in exon 30, based on the prediction of 'potential new splice acceptor activation leading to 10bp retention,' is crucial for successfully capturing and confirming this subtle splicing anomaly. This method is particularly suitable for verifying mutations that may produce atypical, subtle splicing changes, providing a systematic and highly successful solution for the functional interpretation of VUS in clinical settings.

[0050] It should be noted that, in this document, relational terms such as "first" and "second" are used only to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0051] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. A predictive-guided RNA splicing validation method, characterized in that, Includes the following steps: S1. For a specific mutation site of the target gene, use an RNA splicing prediction tool to predict the splicing effect of the mutation site, the prediction including identifying potential new or enhanced splicing sites; S2. Based on the specific prediction results of step S1, with the aim of effectively distinguishing between the predicted abnormal splicing products and normal splicing products, design at least one pair of specific amplification primers that cross the mutation site, wherein the binding position of at least one primer is determined according to the predicted abnormal splicing boundary. S3. Obtain a biological sample expressing the target gene, extract total RNA and reverse transcribe it into cDNA; S4. Using the cDNA obtained in step S3 as a template, perform PCR amplification using the primers designed in step S2. S5. Analyze the amplification product from step S4 to verify whether the mutation site actually causes abnormal RNA splicing and its specific pattern.

2. The RNA splicing verification method for prediction-guided design according to claim 1, characterized in that: The target gene is the OTOF gene, and the specific mutation site is c.3409-11A>G.

3. The RNA splicing verification method for prediction-guided design according to claim 2, characterized in that: In step S1, the RNA splicing prediction tool predicts that the c.3409-11A>G mutation may lead to the creation of a new splice acceptor site inside intron 27, resulting in the abnormal preservation of a portion of the intron sequence (10 bp).

4. The RNA splicing verification method for prediction-guided design according to claim 3, characterized in that: The specific amplification primers designed in step S2 include the forward primer OTOF-F1 and the reverse primer OTOF-R1; wherein, OTOF-R1 is located in exon 30, and its design position ensures that when the c.3409-11A>G mutation activates the new splice acceptor and causes the retention of a 10bp intron fragment, the length difference between the amplified abnormal product and the normal product can be effectively distinguished; the nucleotide sequence of OTOF-F1 is shown in SEQ ID NO.2, and the nucleotide sequence of OTOF-R1 is shown in SEQ ID NO.

3.

5. A kit for verifying the predictive-guided RNA splicing design according to any one of claims 2-4, characterized in that, The kit includes specific amplification primer pairs OTOF-F1 and OTOF-R1, and sequencing reagents; the nucleotide sequence of OTOF-F1 is shown in SEQ ID NO.2, and the nucleotide sequence of OTOF-R1 is shown in SEQ ID NO.3.