IFN-omega mRNA molecule, recombinant expression vector, lipid nanoparticle and application
The IFN-ω mRNA-LNP drug regimen addresses the stability and safety issues of IFN-ω protein preparations in the treatment of feline calicivirus and feline herpesvirus, achieving more efficient treatment results and lower safety risks.
Patent Information
- Application Number
- CN202610037565.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-13
- Publication Date
- 2026-05-01
AI Technical Summary
Existing IFN-ω protein formulations have limitations in treating feline calicivirus (FCV) and feline herpesvirus (FHV-1), including limited expression yield, complex purification, insufficient stability, high production costs, short in vivo half-life, and susceptibility to immunogenic reactions, as well as limited therapeutic efficacy.
A novel treatment regimen combining IFN-ω mRNA molecules with lipid nanoparticles (LNPs) involves adding elements such as the T7 promoter, 5'UTR, 3'UTR, and poly A to the mRNA molecule, preparing the mRNA using in vitro transcription technology, and then packaging it with lipid nanoparticles to form an IFN-ω mRNA-LNP drug, which is then administered via intramuscular or subcutaneous injection.
It improved the efficacy of anti-FCV and FHV-1 treatment, enhanced bioavailability and reduced safety risks, significantly improved clinical symptoms in cats and reduced relapse rate.
Smart Images

Figure CN121950818A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of therapeutic drug technology, and more particularly to an IFN-ω mRNA molecule, a recombinant expression vector, lipid nanoparticles, and their applications. Background Technology
[0002] Feline calicivirus (FCV) and feline herpesvirus-1 (FHV-1) are two major viral pathogens causing respiratory infections in cats. Both are prevalent in cat populations worldwide, and infection can lead to symptoms such as fever, rhinitis, conjunctivitis, oral ulcers, corneal lesions, and pneumonia; in severe cases, even fatal complications. Because these viruses easily spread in multi-cat environments and are prone to repeated reactivation under stress, they are frequently found in veterinary clinics, breeding farms, and stray cat populations.
[0003] Currently, the main treatments for FCV and FHV-1 include vaccination and antiviral / anti-inflammatory supportive therapy. For infected individuals, clinical treatment often involves antiviral small molecules, immunomodulators, antibiotics, and symptomatic therapy. However, these treatments are lengthy, have limited efficacy, and the metabolic characteristics of some drugs in cats result in narrow dosage windows and a high risk of adverse reactions. Furthermore, the persistent viral shedding and latent reactivation phenomena also pose challenges to treatment management.
[0004] Interferon (IFN), as an important component of the body's innate antiviral immunity, has been extensively studied in the veterinary field. In particular, interferon-ω derived from cats (IFN-ω) is considered a potential candidate molecule for treating various feline viral infections due to its excellent cross-viral antiviral activity. Most existing technologies involving IFN-ω utilize protein formulations. However, protein drugs typically suffer from limited expression yields, complex purification processes, insufficient stability, high production costs, and short in vivo half-lives. Furthermore, exogenous proteins are prone to inducing immunogenic reactions, affecting therapeutic efficacy and reusability.
[0005] In recent years, mRNA drug platforms have seen rapid development in vaccine and therapeutic protein expression. mRNA can transiently express target proteins without altering the host genome, offering advantages such as rapid preparation, high standardization of processes, tunable expression efficiency, and no risk of integration. To improve the stability and delivery efficiency of mRNA in vivo, lipid nanoparticles (LNPs) have been widely validated as a primary delivery system, effectively protecting mRNA from degradation, promoting its entry into host cells, and efficiently expressing the encoded protein.
[0006] Existing research on IFN-ω in the literature mainly focuses on the recombinant protein form, while IFN-ω mRNA-LNP technology is still in the exploratory stage. Summary of the Invention
[0007] To address the aforementioned technical problems, the present invention aims to provide an IFN-ω mRNA molecule, a recombinant expression vector, lipid nanoparticles, and their applications, in order to improve the therapeutic effects against FCV and FHV-1, enhance bioavailability, and reduce safety risks.
[0008] To achieve the technical objective, the technical solution adopted by this invention is as follows:
[0009] The present invention provides an IFN-ω mRNA molecule comprising an ORF sequence encoding an IFN-ω protein, the nucleotide sequence of which is shown in SEQ ID NO: 7.
[0010] Preferably, the mRNA molecule further includes a T7 promoter, a 5'UTR (5' untranslated region), a 3'UTR (3' untranslated region), and a poly A (polyadenylated tail). The nucleotide sequence of the T7 promoter is shown in SEQ ID NO.4, the nucleotide sequence of the 5'UTR is shown in SEQ ID NO.1, the nucleotide sequence of the 3'UTR is shown in SEQ ID NO.2, and the nucleotide sequence of the poly A is shown in SEQ ID NO.3.
[0011] Preferably, the nucleotide sequence of the mRNA molecule is shown in SEQ ID NO.6.
[0012] The present invention also provides a recombinant expression vector comprising the mRNA molecule described above.
[0013] The present invention also provides a lipid nanoparticle comprising the mRNA molecule as described above.
[0014] Preferably, the lipid nanoparticles further comprise an encapsulation carrier composed of cationic lipids, phospholipids, cholesterol, and PEG-modified lipids. More preferably, the molar ratio of each component is 50:10:38.5:1.5.
[0015] The present invention further provides the use of the mRNA molecules described above, the recombinant expression vectors described above, or the lipid nanoparticles described above in the preparation of therapeutic drugs for feline calicivirus and / or feline herpesvirus.
[0016] Preferably, the therapeutic drug is delivered by intramuscular or subcutaneous injection; the single dose of the therapeutic drug is 10-500 μg / kg body weight.
[0017] The present invention also provides a pharmaceutical composition for treating feline calicivirus and / or feline herpesvirus, comprising lipid nanoparticles as described above.
[0018] Preferably, it also contains a sucrose stabilizer at a final concentration of 5-15%.
[0019] Compared with the prior art, the technical solution of the present invention has the following technical effects:
[0020] 1. The gene sequence is based on IFN-ω, with the T7 promoter, 5'UTR, and "Cap 101" structure added to the front end of the sequence, and elements such as 3'UTR and polyadenylate tail (poly A) added to the back end of the mRNA sequence encoding IFN-ω protein.
[0021] 2. Plasmids were converted into mRNA using in vitro transcription. The mRNA drug was then packaged using lipid nanoparticles. The constructed candidate mRNA drug was used to immunize cats infected with feline herpesvirus and feline calicivirus. Results showed that immunization led to the resolution of symptoms associated with feline calicivirus and feline herpesvirus infections.
[0022] This invention develops a novel antiviral treatment regimen that utilizes mRNA-LNP to express IFN-ω in vivo, aiming to improve the therapeutic efficacy against FCV and FHV-1, enhance bioavailability, and reduce safety risks. This has significant clinical implications and application value. Attached Figure Description
[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the structures shown in these drawings without creative effort.
[0024] Figure 1 This is an electrophoresis result of in vitro transcribed mRNA (Marker: RNA marker 6000; 1: IFN-ω mRNA).
[0025] Figure 2 This is a graph showing the particle size analysis results of IFN-ω LNP-mRNA after packaging;
[0026] Figure 3 This is a diagram showing the results of in vitro transcribed mRNA protein expression validation (Marker: protein marker; 1: blank control; 2: intracellular detection of IFN-ω mRNA; 3: detection of IFN-ω mRNA in culture medium supernatant).
[0027] Figure 4The changes in serum cytokine levels in mice are: A: IFN-γ; B: IL-1β; C: IL-6; D: TNF-α.
[0028] Figure 5 This refers to the clinical therapeutic effect of IFN-ω mRNA-LNP against feline calicivirus;
[0029] Figure 6 This refers to the clinical therapeutic effect of IFN-ω mRNA-LNP against feline herpesvirus. Detailed Implementation
[0030] The present invention will now be described in detail with reference to specific embodiments. The following specific embodiments will help those skilled in the art to further understand the present invention, but do not limit the present invention in any way.
[0031] Example
[0032] I. Construction of IFN-ω mRNA drug expression vector
[0033] The method for constructing antigen expression vector plasmids is as follows:
[0034] (1) The following gene sequences were synthesized using Shanghai Sangon Biotech Co., Ltd.:
[0035] From 5' to 3', the sequence is T7 promoter (SEQ ID NO. 4), 5'UTR (SEQ ID NO. 1), IFN-ω sequence (SEQ ID NO. 5), 3'UTR (SEQ ID NO. 2), and polyA (SEQ ID NO. 3).
[0036] (2) Primers were synthesized by Beijing Qingke Biotechnology Co., Ltd., as shown in Table 1.
[0037] Table 1 Primer Sequences
[0038]
[0039] The IFN-ω gene sequence was obtained by PCR amplification using a plasmid containing the target sequence synthesized by Shanghai Sangon Biotech as a template. The enzyme used in the reaction system was PrimeSTAR Max DNA Polymerase from TAKARA. The reaction system is shown in Table 2.
[0040] Table 2 PCR reaction system
[0041]
[0042] Reaction procedure:
[0043]
[0044] (3) The PCR products were subjected to 1% agarose gel electrophoresis, and the DNA of the PCR products was recovered using the TransGen gel recovery kit.
[0045] (4) The DNA fragment and the vector were double-digested using Xho I and Kpn I enzymes from TransGen, and the DNA fragment of the target gene and the pUC57 vector fragment were recovered by agarose gel electrophoresis.
[0046] (5) Homologous recombination was performed using Takara's T4 DNA ligase. The pUC57 vector fragment recovered in (4) was ligated with the fragment recovered in (4) at 16°C overnight. After the reaction, the fragment was added to TransGen's DH5α competent cells, incubated on ice for 30 min, heat-shocked at 42°C for 90 s, and incubated on ice for 2 min. After the reaction, 1 mL of antibiotic-free LB medium was added, and the cells were shaken at 200 rpm for 30 min at 37°C, centrifuged at 2000 rpm for 10 min, and finally resuspended in 100 μL of LB medium and spread on Cannabis-resistant solid agar plates. The cells were incubated at 37°C for 16 hours, and colonies were picked and cultured overnight.
[0047] (6) The bacterial culture was subjected to plasmid extraction using the TransGen DNA mini extraction kit. The extracted plasmid was identified by double digestion with XhoI and KpnI restriction endonucleases. The recombinant plasmid sequence was further confirmed to be correct by sequencing by Beijing Qingke Company.
[0048] 2. Synthesis of IFN-ω mRNA
[0049] The plasmids obtained above were digested with Bsa I restriction endonuclease from Yisheng Biotechnology Co., Ltd. to prepare linearized plasmids. The reaction system is shown in Table 3. After reacting at 37°C for 1 hour, DNA was recovered using a DNA recovery kit from TransGen Co., Ltd.
[0050] Table 3. Plasmid linearization reaction system
[0051]
[0052] In vitro transcription was performed using the T7 Transcription Kit from Yisheng Biotechnology Co., Ltd., and the reaction system is shown in Table 4. A cap analogue (Cap101) from Cangzhou Weikexin Biotechnology Co., Ltd. was added to the reaction system to add a cap structure to the synthesized mRNA. The synthesis conditions were set at 37℃ for 2 hours. After the reaction, 1.5 times the reaction volume of 7.5M lithium chloride was added to the synthesized product, and the mRNA was precipitated by centrifugation at 12000 rpm for 20 minutes. The mRNA was resuspended in DEPC water, and the RNA concentration was measured. The final mRNA product was stored below -70℃.
[0053] Table 4 In vitro transcription reaction system
[0054]
[0055] The quality of in vitro transcribed mRNA was verified by 1% agarose gel electrophoresis. Results are as follows: Figure 1 As shown, the mRNA bands transcribed in vitro are of the correct size and are clear and uniform, proving that the synthesized mRNA is of good quality.
[0056] The DNA sequence of the 5' untranslated region (5'UTR) is shown in SEQ ID NO.1:
[0057] GAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACCGCTAGCCTCGAG.
[0058] The DNA sequence of the 3' untranslated region (3'UTR) is shown in SEQ ID NO.2:
[0059] GATATCTGATAATAGGCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTG.
[0060] Polyadenylate (poly A) has the sequence shown in SEQ ID NO.3 and contains 104 bases A:
[0061] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA.
[0062] The DNA sequence of the T7 promoter is shown in SEQ ID NO.4:
[0063] TAATACGACTCACTATAGG.
[0064] The IFN-ω amino acid sequence is shown in SEQ ID NO.5:
[0065] MALLLPLLTALALLTCRPGGSLGCALPGSHAQVSRDNLVLLGQMRRLSPFLCLRARKDFRFPREMLEGGQLREAQAAAAVLRELLQQTFNLLHTERSSAAWSPAPLHGLRSGLHRQLEALDACLLQATGEGERATGEGERAPGMHGPVLAIKRYFQDIRVYLEDEGYSDCAWEIVRLEIMRALSSSATLQDSLAIKDGDLGSS.
[0066] The IFN-ω mRNA sequence is shown in SEQ ID NO. 6:
[0067] GAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACCGCUAGCCUCGAGGCCACCAUGGACGCCAUGAAACGCGGAUUGUGCUGUGUCUUGCUGCUGUGUGGAGCUGUCUUCGUCUCCGCAAGCUGUGCACUACCAGGCUCUCACGCACAGGUGAGCAGAGACAACCUGGUGCUGCUGGGUCAGAUGAGAAGGCUGAGUCCAUUUCUGUGCCUAAGAGCCAGAAAAGACUUCAGGUUUCCAAGGGAGAUGUUGGAGGGUGGACAGCUGAGAGAAGCACAAGCCGCAGCUGCCGUGCUGAGAGAGCUACUGCAGCAAACCUUCAACCUGCUGCACACCGAAAGAUCCAGCGCCGCAUGGUCACCAGCUCCACUGCACGGACUCAGAUCCGGAUUACACAGGCAGCUCGAAGCACUGGACGCAUGUUUGCUCCAGGCAACCGGAGAAGGUGAGAGAGCAACAGGCGAGGGAGAAAGAGCACCAGGCAUGCACGGACCAGUGUUGGCCAUUAAGCGCUACUUUCAGGACAUUAGGGUGUACCUGGAAGACGAGGGAUACAGCGACUGUGCAUGGGAGAUCGUGAGACUGGAAAUCAUGAGAGCACUCUCCAGCAGCGCUACUCUCCAAGACAGCCUAGCCAUUAAAGACGGUGACCUGGGAAGCUCCUAAGGUACCGAUAUCUGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAUCUAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA。
[0068] The IFN-ω DNA sequence is shown in SEQ ID NO.7:
[0069] .
[0070] 3. Preparation of mRNA drugs
[0071] The mRNA molecules synthesized in step 2 were packaged into lipid nanoparticles to prepare LNP-mRNA drugs. The experimental procedures are as follows:
[0072] Alcohol phase preparation: Lipids were dissolved in anhydrous ethanol at a molar ratio of cationic lipid (SM102):distearate phosphatidylcholine (DSPC):cholesterol:DMG-PEG2000 = 50:10:38.5:1.5. Aqueous phase preparation: mRNA was diluted with citrate buffer (50 mM) at pH 4.0. The mRNA was packaged using a microfluidic device at an alcohol-to-aqueous phase volume ratio of 1:3. After packaging, the encapsulation solution was diluted with RNase-free PBS (pH 7.4), concentrated using a 30 kDa ultrafiltration tube, and finally replaced with RNase-free PBS (pH 7.4). Finally, an equal volume of 20% sucrose PBS solution was added to adjust the mRNA concentration to 100 μg / ml and the sucrose concentration to 10%. The mixture was filtered through a 0.22 μm membrane to obtain the IFN-ω LNP-mRNA drug, which was then aliquoted and stored at -20°C.
[0073] Dynamic optical particle size distribution analysis showed that the prepared IFN-ω mRNA-LNP drug particles were uniform in size, with a particle size of approximately 100 nm. Figure 2 ).
[0074] Expression and validation of IFN-ω protein: The prepared IFN-ω mRNA-LNP was added to HEK-293T cells for expression validation. 293T cells were evenly seeded in 24-well plates, and 10 μL of mRNA was added to each well. After 48 h, transfected cells and supernatant were collected, and the samples were treated with loading buffer. SDS-PAGE electrophoresis was performed, followed by incubation with TransGen mouse anti-FLAG tag antibody and HRP-labeled goat anti-mouse antibody, respectively. After incubation, color development was performed to obtain Western blotting results. Results are as follows: Figure 3 As shown, after the mRNA-LNP expressing the fusion protein was added to the cell, a band of the same size as the target protein appeared in the cell, indicating that IFN-ω mRNA-LNP can be expressed in the cell.
[0075] 4. Effects of IFN-ω mRNA-LNP in mice
[0076] Fifteen 8-week-old female Balb / c mice were randomly divided into three groups of five each. One group received 100 μl of PBS as a blank control, another group received 100 μl of IFN-ω mRNA-LNP as an intervention group, and the positive control group received an equal volume of a commercially available product (Repbio, a recombinant protein). Twenty-four hours after intervention, mouse serum was separated, and the levels of various cytokines in the serum were detected using an ELISA kit. Results are as follows: Figure 4As shown, after IFN-ω mRNA-LNP intervention, the levels of four cytokines IFN-γ, IL-1β, IL-6, and TNF-α in mouse serum all increased significantly, and the increase in the mRNA group was significantly higher than that in the commercially available control group.
[0077] 5. Verify the therapeutic effect of IFN-ω mRNA-LNP
[0078] The prepared IFN-ω mRNA-LNP was used in a clinical trial. Domestic cats aged 3 months or older and weighing 1.0–6.0 kg, either naturally infected or clinically diagnosed with feline calicivirus (FCV) and / or feline herpesvirus (FHV-1), were recruited, excluding individuals with severe systemic diseases. At least three cats were infected with each virus and randomly assigned to:
[0079] Treatment group: Injection of IFN-ω mRNA-LNP;
[0080] Negative control group: injected with an equal volume of PBS or blank LNP;
[0081] Positive control group: Injected with an equal volume of commercially available product (Repbio, recombinant protein).
[0082] The treatment group and the negative control group received intramuscular injections of 100 μg mRNA drug or 100 μL PBS in the leg, while the positive control group received intraperitoneal injections of a commercially available product (Repbio). The intervention was performed once a day.
[0083] Before treatment, FCV-infected cats presented with significant oral ulcers, drooling, conjunctivitis, and increased eye discharge; FHV-1-infected cats presented with conjunctivitis and / or ulcerative keratitis. In the treatment group, clinical symptoms significantly improved within 1-3 days after intramuscular injection of IFN-ω mRNA-LNP, and oral ulcers and conjunctivitis improved within 5-7 days. Figure 5 and Figure 6 The disease has largely subsided or healed; compared with the PBS control group, the recovery is faster and the recurrence rate is lower, and the mRNA treatment group is more effective than existing commercially available recombinant protein products.
[0084] The above description is merely a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.
Claims
1. An IFN-ω mRNA molecule comprising an ORF sequence encoding an IFN-ω protein, the nucleotide sequence of said ORF sequence being shown in SEQ ID NO:
7.
2. The mRNA molecule according to claim 1, characterized in that, The mRNA molecule further includes a T7 promoter, a 5'UTR, a 3'UTR, and a poly A. The nucleotide sequence of the T7 promoter is shown in SEQ ID NO.4, the nucleotide sequence of the 5'UTR is shown in SEQ ID NO.1, the nucleotide sequence of the 3'UTR is shown in SEQ ID NO.2, and the nucleotide sequence of the poly A is shown in SEQ ID NO.
3.
3. The mRNA molecule according to claim 1, characterized in that, The nucleotide sequence of the mRNA molecule is shown in SEQ ID NO.
6.
4. A recombinant expression vector comprising the mRNA molecule as described in any one of claims 1 to 3.
5. A lipid nanoparticle comprising the mRNA molecule as described in any one of claims 1 to 3.
6. The lipid nanoparticles according to claim 5, characterized in that, The lipid nanoparticles also include an encapsulation carrier composed of cationic lipids, phospholipids, cholesterol, and PEG-modified lipids.
7. The use of the mRNA molecule according to any one of claims 1 to 3, the recombinant expression vector according to claim 4, or the lipid nanoparticles according to claim 5 or 6 in the preparation of therapeutic drugs for feline calicivirus and / or feline herpesvirus.
8. The application according to claim 7, characterized in that, The therapeutic drug is delivered via intramuscular or subcutaneous injection; the single dose of the therapeutic drug is 10-500 μg / kg body weight.
9. A pharmaceutical composition for treating feline calicivirus and / or feline herpesvirus, comprising the lipid nanoparticles of claim 5 or 6.
10. The pharmaceutical composition according to claim 9, characterized in that, It also contains a sucrose stabilizer with a final concentration of 5-15%.