Ethanol-producing clostridium engineering strain for producing ethanol and acetic acid as well as construction method and application of ethanol-producing clostridium engineering strain
By using a gold nanoparticle-microbe coupling system and transcriptomics analysis, key functional genes and regulatory factors were systematically identified. A push-pull-resistance strategy was implemented to solve the problem of single-strain modification of ethanol-producing Clostridium, achieving efficient and stable production of ethanol and acetic acid and improving the overall performance of the strain.
Patent Information
- Application Number
- CN202610417043.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-01
- Publication Date
- 2026-05-01
AI Technical Summary
In existing technologies, metabolic modification of ethanol-producing Clostridium focuses on a single target, making it difficult to synergistically improve energy supply, optimize carbon flow distribution, and block byproduct synthesis, resulting in limited improvement in the overall performance of the strain.
By constructing a gold nanoparticle-microorganism coupling system to apply energy stress, key functional genes and regulatory factors are systematically discovered, and a synergistic metabolic engineering strategy of push (enhancing energy supply), pull (driving carbon metabolic flow), and block (blocking byproduct synthesis) is implemented to construct high-performance engineered strains.
The strain significantly increased the yield of ethanol and acetic acid during fermentation using syngas as a carbon source, while maintaining good growth characteristics and metabolic robustness, providing an efficient and stable autotrophic cell factory.
Smart Images

Figure CN121950883A_ABST
Abstract
Description
Ethanogenic Clostridium difficile strains producing ethanol and acetic acid, their construction methods and applications Technical Field
[0001] This invention relates to the fields of synthetic biology and metabolic engineering. More specifically, this invention relates to an engineered strain of Clostridium ethanoliferum that produces ethanol and acetic acid, its construction method, and its applications. Background Technology
[0002] Clostridium autoethanogenum is a type of anaerobic microorganism capable of growing using syngas components such as carbon monoxide, carbon dioxide, and hydrogen as carbon and energy sources. It fixes one-carbon compounds through a unique Wood-Ljungdahl pathway, producing valuable chemicals such as ethanol and acetic acid, thus demonstrating significant potential in the fields of industrial waste gas bioconversion and carbon-negative emission biomanufacturing.
[0003] However, in practical applications, the performance of these microbial cell factories is still constrained by a series of inherent metabolic bottlenecks. The primary bottleneck lies in the low energy metabolism efficiency of its core carbon fixation pathway. In the Wood-Ljungdahl pathway, the net production of adenosine triphosphate (ATP) during the conversion of syngas into acetyl-CoA is theoretically very limited. This energy balance, which is at the edge of biological thermodynamics, directly leads to slow cell growth and low cell density, thereby limiting the improvement of overall fermentation production intensity and product space-time yield.
[0004] Furthermore, even if byproduct synthesis is reduced through gene knockout and other methods, effectively redirecting the "saved" carbon metabolic flux and reducing power to drive the efficient synthesis of target products (especially highly reducing ethanol) remains a challenge. This involves precise regulation of key carbon metabolism nodes and reprogramming metabolic fluxes. For example, the pyruvate node is a crucial hub connecting gluconeogenesis, energy metabolism, and product synthesis; its flux allocation directly affects precursor supply and reducing power balance in subsequent pathways. However, there is a lack of effective endogenous regulatory strategies to stably and efficiently direct carbon flux towards the target direction without disrupting cellular energy and redox homeostasis. Traditional single-enzyme gene overexpression often has limited or unpredictable effects because it may be constrained by the complexities of upstream substrate supply, downstream product accumulation, and the global transcriptional regulatory network.
[0005] Clostridium ethanoliferum has a relatively weak endogenous energy supply system. Although it possesses mechanisms such as the Rnf complex that couple reducing power conversion with transmembrane ion gradients, the natural expression level of this system may not be sufficient to support the higher energy demands proposed when knocking out competing pathways and attempting to enhance product synthesis. Insufficient energy supply will become the ultimate bottleneck limiting the overall improvement of metabolic flux. Previous studies have attempted to introduce exogenous physical energy inputs (such as light and electricity) or heterologous energy metabolic pathways, but these strategies often face challenges in terms of host compatibility, system stability, or operating costs, making them difficult to implement simply and economically in industrial fermentation systems.
[0006] Furthermore, current research strategies are mostly limited to a single dimension, either focusing solely on the input of exogenous physical energy (such as light and electricity) or only performing isolated modifications of endogenous genes. There is a lack of research paradigms that systematically integrate 'exogenous energy input signals' with 'global responses of the endogenous metabolic network'. Therefore, how to accurately identify key regulatory elements of host endogenous energy metabolism through exogenous energy perturbation, and based on this, to perform rational multidimensional metabolic reprogramming, is a crucial but under-explored pathway for constructing efficient, energy-self-sufficient cell factories.
[0007] In summary, current technologies for modifying ethanol-producing Clostridium typically focus on solving single problems, such as knocking out a specific byproduct gene, expanding the product of the target strain, or overexpressing a specific energy-related enzyme. These strategies often fail to systematically coordinate the relationship between carbon flux redirection, energy enhancement, and global regulation, leading to potential problems such as impaired growth, metabolic imbalance, or insignificant overall performance improvement in the modified strain. Therefore, developing a comprehensive method that can synergistically address multiple bottlenecks such as byproduct diversion, directional carbon metabolic flux redirection, and enhanced endogenous energy supply is of practical significance for constructing efficient and stable ethanol-producing Clostridium cell factories and represents a major challenge in the development of this technology. Summary of the Invention
[0008] One object of the present invention is to solve at least the above-mentioned problems and to provide at least the advantages that will be described later.
[0009] Another objective of this invention is to provide an engineered strain of Clostridium ethanologenum that produces ethanol and acetic acid, as well as its construction method and application. This solves the technical problem that existing technologies for metabolic modification of Clostridium ethanologenum often focus on a single target, making it difficult to synergistically improve energy supply, optimize carbon flow distribution, and block byproduct synthesis, thus resulting in limited improvement in the overall performance of the strain.
[0010] This invention follows a closed-loop research path of exogenous energy supply → transcriptional response → endogenous modification. First, by constructing a gold nanoparticle-microorganism coupling system, energy stress was applied to Clostridium ethanoliferum and its enhanced energy metabolism was verified. Then, through comparative transcriptomics, key functional genes and regulatory factors upregulated by this energy stress were systematically identified. Finally, based on the screened key endogenous elements, a synergistic metabolic engineering strategy of push (enhancing energy supply) - pull (driving carbon metabolic flow) - block (blocking byproduct synthesis) was implemented to construct a high-performance engineered strain.
[0011] To achieve these objectives and other advantages of the present invention, a method for constructing an engineered strain of Clostridium ethanoliferum that produces ethanol and acetic acid is provided, comprising the following steps: Step 1, knocking out a byproduct synthesis gene in Clostridium ethanoliferum; Step 2, introducing and expressing a combination of functional genes for driving carbon metabolic flux at the knockout site of the strain obtained in Step 1, the combination of functional genes comprising: a) at least one endogenous transcription factor obtained through energy stress induction screening, the endogenous transcription factor being selected from Crp / Fnr family transcription factors and LysR family transcription factors, the Crp / Fnr family transcription factor being the protein encoded by the locus number CLAU_RS14020, and the LysR family transcription factor being the protein encoded by the locus number CLAU_RS08380; and b) a pyruvate phosphate dual kinase (PPDK) encoding gene; Step 3, introducing and expressing an energy metabolism enhancement gene in the strain obtained in Step 2.
[0012] Preferably, in the method for constructing the ethanol-producing and acetic acid-producing Clostridium engineered strain, in step one, the byproduct synthesis genes include the budA gene and the ldhA gene.
[0013] Preferably, in the method for constructing the ethanol-producing and acetic acid-producing Clostridium ethanoliferous engineered strains, in step two, endogenous transcription factors are obtained through screening using the following steps: S21, treating the starting ethanol-producing Clostridium ethanoliferous strains with an exogenous energy input system; S22, performing transcriptomics analysis on the treated strains to screen for transcription factors with significantly upregulated expression levels; S23, overexpressing the candidate transcription factors screened in step S22 in the starting ethanol-producing Clostridium ethanoliferous strains, and identifying the Crp / Fnr family transcription factor with locus number CLAU_RS14020 and the LysR family transcription factor with locus number CLAU_RS08380 through phenotypic analysis.
[0014] Preferably, in the method for constructing the ethanol-producing and acetic acid-producing Clostridium engineered strain, in step two, the gene encoding a LysR family transcription factor is integrated into the budA gene knockout site, and the gene encoding a Crp / Fnr family transcription factor and the gene encoding pyruvate phosphate dual kinase (PPDK) are jointly integrated into the ldhA gene knockout site.
[0015] Preferably, in the method for constructing the ethanol-producing and acetic acid-producing Clostridium engineered strain, in step three, the energy metabolism enhancement gene is a gene cluster encoding the Rnf complex, and the Rnf complex gene cluster includes the RseC, rnfC, rnfD, rnfG, rnfE, rnfA and rnfB genes.
[0016] The present invention also provides an engineered strain of Clostridium ethanoligenin produced by constructing the above-mentioned engineered strain of Clostridium ethanoligenin producing ethanol and acetic acid, which is classified as Clostridium sp. and deposited as Clostridium ethanoligenin CAB181. This strain was deposited at the China General Microbiological Culture Collection Center (CGMCC) on February 5, 2026, with the accession number CGMCC NO:46923.
[0017] Preferably, the engineered Clostridium ethanoliferum strain has the genotype ∆budA::T5∆ldhA::ppdk::T2 and contains a recombinant expression vector containing the RseC and rnfCDGEAB gene clusters; wherein T5 represents LysR family transcription factors and T2 represents Crp / Fnr family transcription factors.
[0018] The present invention also provides the use of the engineered strain of Clostridium ethanoligenes described above in the fermentation production of ethanol and / or acetic acid.
[0019] The present invention also provides a method for producing ethanol and / or acetic acid, comprising: culturing the above-mentioned engineered strain of Clostridium ethanoligenes under the condition of syngas as a carbon source.
[0020] The present invention includes at least the following beneficial effects: 1. The ethanol-producing Clostridium engineered strain (such as CAB181) provided by the present invention achieves systematic optimization of the metabolic network through multiple genetic modifications, including blocking byproduct synthesis, guiding carbon metabolic flux, and enhancing energy supply. During fermentation using syngas as a carbon source, the strain can effectively direct more carbon flux and reducing power to the target product pathway, thereby significantly and synergistically increasing the yield of ethanol and acetic acid. Compared to wild-type strains or strains with only single modifications, this engineered strain maintains good growth characteristics while achieving high yields, exhibits no significant lag phase, and demonstrates higher carbon conversion efficiency and metabolic robustness, providing a high-performance cell factory for industrial syngas biofermentation.
[0021] 2. The construction method provided by this invention establishes a metabolic engineering research paradigm of energy stress-induced screening of key targets—multi-target synergistic rational reconstruction. This method is not limited to simple gene knockout or overexpression, but firstly, through transcriptome analysis induced by exogenous energy input, it identifies endogenous key elements (such as specific transcription factors) that have a positive regulatory effect on energy metabolism and carbon assimilation at a global level. Subsequently, a push-pull-block synergistic strategy is adopted to organically combine the three dimensions of modification: blocking (knocking out byproduct genes), pulling (integrating PPDK and screened transcription factors), and pushing (strengthening the Rnf energy complex). This method can systematically coordinate carbon flow allocation and energy supply, effectively avoiding metabolic imbalances or growth defects that may be caused by single modifications, and providing a replicable and scalable technical path for constructing efficient and stable autotrophic cell factories.
[0022] 3. The engineered bacterial strain and its construction method involved in this invention have clear application value in the field of biomanufacturing high-value-added chemicals using carbon-based gases (such as industrial waste gas and syngas). This strain can directly and efficiently produce ethanol and acetic acid using gases such as CO / CO2 / H2 as raw materials. This not only provides a new pathway for the green synthesis of biofuels and chemical raw materials, but also offers potential solutions for the resource utilization of industrial greenhouse gases and the development of carbon-negative emission technologies. Applying this strain and the corresponding fermentation process will help promote the development of the green biomanufacturing industry based on gas fermentation, and has significant environmental and economic benefits.
[0023] Other advantages, objectives and features of the present invention will become apparent in part from the following description, and in part from those skilled in the art through study and practice of the invention. Attached Figure Description
[0024] Figure 1 shows the scanning electron microscope (SEM) characterization of the AuNPs@BSA-C.autoethanogenum coupling system constructed in Example 1 of this invention, where (a) and (c) are low- and high-magnification images of wild-type C.autoethanogenum cells, and (b) and (d) are low- and high-magnification images of cells in the AuNPs@BSA-C.autoethanogenum coupling system; Figure 2 shows the performance and energy metabolism status evaluation of the AuNPs@BSA-C.autoethanogenum coupling system in the syngas fermentation process in Example 1 of this invention, where (a) is the cell growth (OD)... 600Figure 3 shows the performance and energy metabolism status evaluation of the AuNPs@BSA-C.autoethanogenum coupled system in Example 1 of this invention during syngas fermentation. (A) is the intracellular ATP level; (B) is the intracellular NAD⁺ / NADH ratio; and (C) is the intracellular NADP level. + / NADPH ratio; Figure 4 is an electrophoretic verification diagram of the overexpression of key enzymes in Example 3 of the present invention; Figure 5 is an electrophoretic verification diagram of the overexpression of Fdh-Hyt complex enzyme in Example 3 of the present invention; Figure 6 is an electrophoretic verification diagram of the overexpression of transcription factors in Example 3 of the present invention; Figure 7 is an electrophoretic verification diagram of the edited genotypes in Examples 4 and 5 of the present invention, where (a) is the verification of strains related to the budA site, and (b) is the verification of strains related to the ldhA site; Figure 8 is an electrophoretic verification diagram of the C. autoethanogenum-CAB-181 genotype in Example 6 of the present invention; Figure 9 is a phenotypic evaluation diagram of single gene overexpression strains in Example 3 of the present invention under syngas fermentation conditions, where (a) is the cell density (OD) 600 (a) represents ethanol yield, (b) represents acetic acid yield, and (d) represents total acid-alcohol yield (ethanol + acetic acid). Figure 10 is a comparison of product synthesis of engineered strain CAB181 and intermediate strain under syngas fermentation conditions in Example 7 of this invention, where (a) represents ethanol yield, (b) represents acetic acid yield, (c) represents total acid-alcohol yield (ethanol + acetic acid), and (d) represents cell density (OD). 600 ).
[0025] The ethanol-producing Clostridium engineered strain CAB181 of this invention, classified as Clostridium sp., was deposited on February 5, 2026, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC NO:46923. Detailed Implementation
[0026] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments, so that those skilled in the art can implement it based on the description.
[0027] It should be understood that terms such as “having,” “comprising,” and “including” as used herein do not exclude the presence or addition of one or more other elements or combinations thereof.
[0028] It should be noted that, unless otherwise specified, the experimental methods described in the following implementation plan are all conventional methods, and the reagents and materials described are all commercially available unless otherwise specified.
[0029] In the description of this invention, the terms "lateral", "longitudinal", "up", "down", "front", "back", "left", "right", "vertical", "horizontal", "top", "bottom", "inner", and "outer" indicate the orientation or positional relationship based on the orientation or positional relationship shown in the accompanying drawings. They are used only for the convenience of describing this invention and simplifying the description, and do not indicate or imply that the device or element referred to must have a specific orientation, or be constructed and operated in a specific orientation. Therefore, they should not be construed as limitations on this invention.
[0030] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below in conjunction with embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of this invention.
[0031] This invention systematically modifies the metabolic network of Clostridium ethanoliferum through a "push-pull-block" synergistic metabolic reprogramming strategy. This strategy integrates three dimensions: "block" involves knocking out byproduct synthesis genes to disrupt carbon diversion; "pull" involves introducing and expressing key transcription factors and metabolic enzymes to drive carbon metabolism; and "push" involves strengthening energy metabolism genes to enhance cellular energy supply. The following examples will detail the specific implementation process and effects of this strategy.
[0032] Experimental methods in the following examples, unless otherwise specified, were generally performed under conventional conditions in the art or as recommended by the manufacturer. All reagents and materials used, unless otherwise specified, were commercially available products. All operations involving anaerobic microorganisms were performed in an anaerobic workstation (ELECTROTEKAW500SG / TG) filled with a mixture of 10% H2 and 90% N2 gas.
[0033] The starting strain C. autoethanogenum DSM 10061 used in this invention was purchased from the German Microbial and Cell Culture Collection (DSMZ). It was subjected to strict anaerobic conditions in YTF (specific culture medium components: yeast extract 10 g / L, tryptone 16 g / L, fructose 10 g / L, NaCl 4 g / L, L-cysteine hydrochloride 0.5 g / L, pH 6.0) and YML (specific culture medium components: yeast extract 1 g / L, trace element solution 10 mL / L, vitamin solution 1 mL / L, MES buffer 20 mM, reducing agent solution, pH 6.0) media at 37°C and 100 rpm. Both anaerobic and autotrophic cultures were performed in YML medium (specifically composed of: yeast extract 1 g / L, trace element solution 10 mL / L, vitamin solution 1 mL / L, MES buffer 20 mM, reducing agent solution, pH 6.0). Syngas (40% CO2 / 40% CO / 20% H2) was used as the carbon source. Gas replacement was performed using a DLQ-120 intelligent anaerobic preparation system (Beijing Aispu Technology Co., Ltd.) with the following parameters: pre-evacuation for 50 s, evacuation for 50 s, aeration for 20 s, repeated 6 times, and a final aeration for 45 s to achieve a headspace pressure of 0.15 MPa. Transformants containing the target plasmid from *C. autoethanogenum* were cultured with thiamphenicol (5 µg / ml). Anaerobic operations were performed using a dedicated anaerobic workstation (AW500SG / TG, ELECTROTEK, UK), with a gas composition of 10% H2 and 90% N2. The light conditions used in the illuminated culture experiment were 100 µmol photons m −2 s −1 .
[0034] OD was performed using a multi-functional microplate reader (SYNERGY neo2, BioTek, USA). 600 For detection, 200 µL of freshly extracted fermentation broth was placed in an NESJ microplate, and absorbance was measured at 600 nm. Acetic acid and ethanol in the fermentation broth were detected using gas chromatography. After centrifuging the obtained sample at 13000 rpm for 10 minutes, the supernatant was collected and filtered through a 0.22 µm organic phase nylon filter (Jinlong). The filtered sample was mixed with an internal standard solution (specifically isobutanol internal standard solution) at a 4:1 ratio, and component analysis was performed using a Tianmei GC7900 gas chromatograph. The program used was: injection port temperature 200-230℃, detector temperature 230-250℃; column oven temperature program: initial column temperature 40℃ for 2 min, followed by increases of 5℃ / min. -1 The heating rate was increased to 60℃ and maintained for 3 minutes, then increased at a rate of 20℃·min. -1The temperature was increased to 230℃ and held for 2 minutes before sample injection and detection. The HP-FFAP 32m×0.30mm×0.25µm (Agilent Technologies) high-polarity capillary column with better separation performance was selected.
[0035] ATP and NAD were measured in samples from syngas fermentation at 72 h. + NADH, NADP + The NADPH content was detected. ATP was detected using the Beyotime ATP assay kit (S0026), and the specific method was performed according to the instructions. + NADH, NADP + NADPH was detected using liquid chromatography, following previous studies. The liquid chromatography instrument used was an Agilent, and the column used was a C18 reversed-phase HPLC column (PN58825-902).
[0036] Total RNA was extracted using the ZOMANBIO U-Fast bacterial RNA extraction kit, strictly following the manufacturer's instructions. Briefly, both the AuNPs@BSA-C. autoethanogenum treatment group (AuNPs@BSA at 6 mg / L) and the control group (C. autoethanogenum cultured under the same conditions) were inoculated into syngas fermentation medium and cultured for 72 h. Immediately afterwards, the cell pellet was collected by centrifugation at 12,000 g for 2 min at 4 °C. The pellet was resuspended in 500 µL LDPPC-treated water and washed once before RNA extraction. The integrity and quality of the extracted RNA were assessed by agarose gel electrophoresis. Qualified samples were sent to Shanghai Meiji Biopharmaceutical Technology Co., Ltd. for library construction, transcriptome sequencing, and bioinformatics analysis. The sequencing platform was Illumina NovaSeq 6000. The screening threshold for differentially expressed genes was set at |log2FC|>1 and P<0.05. Three independent biological replicates were set for each experimental group.
[0037] The transcriptional levels of differentially expressed genes (DEGs) obtained by transcriptome sequencing were validated using quantitative PCR (qPCR). cDNA was synthesized by reverse transcription using the M-MLV4 First-Strand cDNA Synthesis Kit with gDNA Eraser (Biomed, China), with gyrA used as an internal control gene. The program design and data processing followed the methods described in the previous study (J.Ma, Y.Cui, R.Zhou, F.Sun, H.Zhang, C.Meng, G.Chen, Z.Gao, Adaptive laboratory evolutionary strategies and mechanisms of synechococcus elongatu PCC7942 under high concentration of CO2, Bioresour. Technol. 434(2025)132789. https: / / doi.org / 10.1016 / j.biortech.2025.132789.). The enzyme used was 2xRealStarFast SYBR qPCR Mix (Low ROX), and the real-time quantitative PCR instrument used was an ABI 7500 FAST.
[0038] The plasmid construction method used was based on previous research (Y.Zhai,L.Chen,L.Ma,Y.Duan,W.Chen,L.Long,G.Wang,A.Shi,G.Chen,D.Li,Fluorescent protein-based anaerobic reporter for construction of promoter libraries inclostridium autoethanogenum,Int.J.Biol.Macromol.310(2025)143155.https: / / doi.org / 10.1016 / j.ijbiomac.2025.143155.). The method used to introduce the corresponding plasmid into cells was electroporation transformation, and the specific process was consistent with previous studies.
[0039] Example 1: Construction of an exogenous energy input system (AuNPs@BSA-C.autoethanogenum) and its effect on the energy metabolism of the strain.
[0040] This embodiment aims to construct an exogenous energy supply system to induce an energy stress response in the starting strain, providing a foundation for subsequent transcriptomic screening of key functional elements.
[0041] 1.1 Preparation and Characterization of AuNPs@BSA The gold nanoparticles (AuNPs) used in this embodiment were synthesized by the reduction reaction of HAuCl4 and citric acid. The specific method is as follows: (1) Weigh 0.05g of trisodium citrate and prepare 5mL of 1% (w / v) trisodium citrate solution with ultrapure water; (2) Put 100mL of 0.01% (w / v) HAuCl4 solution (Sigma-Aldrich, USA) into a clean 250ml Erlenmeyer flask; (3) Heat the Erlenmeyer flask, and after boiling, quickly add the trisodium citrate solution; (4) Boil for 15 minutes. When the color of the liquid in the flask changes from pale yellow to wine red, the gold nanoparticle solution (AuNPs) is ready. Subsequently, bovine serum albumin (BSA) was added to the prepared AuNPs to make the final concentration reach 10mg / L, and a red AuNPs@BSA solution was obtained. Finally, the prepared red AuNPs@BSA solution was placed in a brown glass bottle and stored at 4°C in the dark.
[0042] 1.2 Construction and Characterization of AuNPs@BSA-C. autoethanogenum: A glycerol-preserved strain (wild-type Clostridium autoethanogenum DSM10061, purchased from DSMZ) stored at −80℃ was streaked onto YTF agar plates and cultured anaerobically at 37℃ for 96 h until well-isolated single colonies formed. Single colonies were picked and inoculated into 2.5 mL of LYTF liquid medium for further cultivation; when the culture reached OD... 600 When the OD value reaches 0.8, transfer the culture to 30 mL of fresh YTF medium at a ratio of 1:100 (v / v) and continue culturing until OD value reaches 0.8. 600 =0.8. AuNPs@BSA solution was then added to the culture system, and incubation continued for 12 hours (overnight) to obtain the coupling between nanoparticles and cells. After culture, the bacterial culture was transferred to a 50 mL centrifuge tube, centrifuged at 6000 rpm for 5 min, and the bacterial pellet was collected; the resulting pellet was defined as the AuNPs@BSA-C. autoethanogenum coupling system. The control group (using wild-type Clostridium autoethanogenum as the control group) was operated identically except that the AuNPs@BSA solution was replaced with 10 mg / L BSA solution.
[0043] To confirm the successful loading of nanoparticles onto the cell surface, scanning electron microscopy (SEM) was performed on the coupled cells. First, the coupled cells were fixed overnight at 4°C with 2.5% glutaraldehyde. After fixation, the samples were washed three times with PBS buffer and twice with ultrapure water, 10 min each time. Subsequently, they were fixed with 1% osmium tetroxide at 4°C for 1 h, followed by three washes with PBS, 10 min each time. Next, the samples were sequentially dehydrated using 30%, 50%, 75%, 95%, and 100% ethanol, each treatment lasting 10 min. After dehydration, the samples were diluted with anhydrous ethanol, and 10 μL of the mixture was dropped onto aluminum foil and subjected to CO2 critical point drying. The dried samples were then platinum-sprayed at 15 mA for 30 s and finally observed and analyzed using a field emission scanning electron microscope (FESEM, SU8010, Hitachi, Japan).
[0044] The scanning electron microscopy (SEM) results are shown in Figure 1. Figures 1a and 1c are SEM images of untreated *C. autoethanogenum* cells, showing a smooth cell surface. Figures 1b and 1d are SEM images of the AuNPs@BSA-*C. autoethanogenum* coupling system, showing uniform granular material (AuNPs@BSA) attached to the cell surface. This indicates that the AuNPs@BSA-treated cells have uniformly attached granular material, while the control group (BSA-treated only) has a smooth cell surface. This confirms that AuNPs@BSA was successfully loaded onto the cell surface, and the coupling system was successfully constructed.
[0045] 1.3 Assessment of the Energy Metabolic State of the Coupled System The AuNPs@BSA-C. autoethanogenum coupled system cells constructed above, and the control group (BSA treatment only) cells, were seeded into YML fermentation medium with syngas (CO:CO2:H2=4:4:2) as the carbon source and cultured under light conditions (100µmol photons m -2 s -1 Shake-flask fermentation was carried out (37°C, 100 rpm). Samples were taken at 72 hours of fermentation to detect key intracellular energy metabolism indicators.
[0046] The results are shown in Figures 2-3: Compared with the control group, the AuNPs@BSA treatment group showed significantly higher cell growth (OD). 600Both ATP and ethanol production were significantly increased (Figures 2a and 2b). More importantly, the intracellular ATP level in the treatment group reached approximately 60 nM, significantly higher than that in the control group (p < 0.001) (Figure 3A); simultaneously, the coenzyme ratios NAD⁺ / NADH and NADP⁺ / NADPH, reflecting redox status, also increased by approximately 23% and 11%, respectively (Figures 3B and 3C). These data directly demonstrate that the AuNPs@BSA coupling system can provide energy / electron signals to Clostridium ethanoligenin under light irradiation, effectively increasing its intracellular energy (ATP) level and the proportion of oxidized coenzymes, creating a stress state with enhanced energy metabolism.
[0047] Example 2: Transcriptomic mining and screening of key functional elements in energy stress response.
[0048] This embodiment is based on the energy stress model constructed in Example 1. Through transcriptomics analysis, it systematically mines key genes that are upregulated in response to energy input and screens out core components that can be used for metabolic engineering.
[0049] 2.1 Sample Preparation and Transcriptome Sequencing AuNPs@BSA-C. autoethanogenum cells from Example 1, cultured for 72 hours under syngas conditions, and the control group were used to extract total RNA using the ZOMANBIO U-Fast bacterial RNA extraction kit. After passing quality testing, transcriptome sequencing was performed on the Illumina NovaSeq 6000 platform by Shanghai Meiji Biotechnology Co., Ltd. Three biological replicates were set up for each group.
[0050] 2.2 Differential Expression Analysis and Key Gene Identification: Bioinformatics analysis showed that compared with the control group, 691 genes were significantly upregulated in the treatment group (|log2FC|>1 and P<0.05), and 48 genes were significantly downregulated. Ten differentially expressed genes were randomly validated by qPCR, and the results were consistent with the sequencing data, confirming the reliability of the data.
[0051] Through in-depth analysis of differential expression data, a series of gene clusters directly related to energy metabolism and redox balance were identified, and their upregulation folds are shown in Table 1: Table 1 Key functional elements significantly upregulated under energy stress Functional enrichment analysis (COG and KEGG) of the upregulated genes revealed a large number of genes enriched in pathways related to "energy production and conversion". A core gene network highly associated with energy metabolism and redox balance was identified, including: the complete Rnf complex gene cluster (RseC, rnfC, rnfD, rnfG, rnfE, rnfA, rnfB): expression levels were upregulated by 3.47 to 8.61 times.
[0052] The complete F1F0-ATP synthase gene cluster (atpBEFHAGDC`) was upregulated by 2.72 to 4.46 times.
[0053] Pyruvate phosphate dual kinase (PPDK) gene (ppdk): expression level upregulated by 2.60-fold.
[0054] Hydrogenase (Hyt) and formate dehydrogenase (Fdh) related subunit genes.
[0055] Several significantly upregulated transcription factors included the Fur family (T1, CLAU_RS06995), the Crp / Fnr family (T2, CLAU_RS14020), the Rrf2 family (T3, CLAU_RS16115), and two LysR family members (T4, CLAU_RS02880; T5, CLAU_RS08380).
[0056] Among them, the expression of Rnf complex gene was upregulated by 3.47 to 8.61 times, F1F0-ATP synthase gene by 2.72 to 4.46 times, PPDK gene by 2.60 times, and transcription factors T2 and T5 by approximately 4.08 and 3.10 times, respectively.
[0057] Example 3: Single-gene functional verification of key energy metabolism elements. In this example, key metabolic enzymes / complexes screened from the transcriptome were overexpressed as single genes to evaluate the effect of their individual modification on the strain phenotype, providing a basis for subsequent combination strategies.
[0058] 3.1 Construction and Validation of Overexpression Strains for Key Energy Metabolism Enzymes: Rnf complex (containing RseC) and F1F were constructed respectively. o - ATP synthase, PPDK, Hyt, Fdh, and the overexpression plasmid of the Hyt-Fdh fusion (pMTL83151-P) thl -Rnf, -ATP, -PPDK, -Hyt, -Fdh, -Hyt-Fdh), and transformed into wild-type C. autoethanogenum to obtain the corresponding strains CAB-Rnf, CAB-ATP, CAB-PPDK, CAB-Hyt, CAB-Fdh, and CAB-Hyt-Fdh.
[0059] To verify the successful construction and expression of key enzyme overexpression plasmids in the host bacteria, PCR verification was performed on the transformants, and the results are shown in Figure 4. M is a 1kb Plus DNA Ladder; lanes 1-4 correspond to transformant C. autoethanogenum-CAB-Rnf and plasmid pMTL83151-P, respectively. thl- Rnf, wild-type control, and water control: Transformants and plasmids amplified the expected Rnf gene fragment (approximately 6.5 kb), while the wild-type showed no band. Lanes 5-8 corresponded to ATP synthase overexpression strains, plasmids, wild-type, and water; both transformants and plasmids amplified the atp gene cluster fragment. Lanes 9-12 corresponded to Hyt overexpression strains, plasmids, wild-type, and water. Lanes 13-16 corresponded to Fdh overexpression strains, plasmids, wild-type, and water. Lanes 17-20 corresponded to PPDK overexpression strains, plasmids, wild-type, and water. All transformants amplified the target band consistent with the plasmid, while the wild-type and water controls showed no band, indicating that each overexpression plasmid was successfully introduced and stably exists in the host.
[0060] Figure 5 shows the validation results of the Hyt-Fdh fusion complex overexpression strain. M is the 1 kb Plus DNA Ladder; lane 1 is the transformant C. autoethanogenum-CAB-Hyt-Fdh (using primers YpMTL-F / Y-fdhA-R), and lane 2 is the plasmid pMTL83151-P. thl Lane 3 of the Hyt-Fdh fusion expression cassette was wild-type, lane 4 was another transformant (using primers hyt14-14 / YpMTL-R), lane 5 was the plasmid, lane 6 was wild-type, and lanes 7-8 were water controls. All transformants amplified the target fragment consistent with the corresponding plasmid, and the size was as expected. No bands were observed in the wild-type and water controls, confirming that the Hyt-Fdh fusion expression cassette had been successfully introduced into the host.
[0061] 3.2 Construction and Validation of Transcription Factor Overexpression Strains To validate the functions of the above candidate transcription factors, overexpression plasmids were constructed. Using wild-type *C. autoethanogenum* genomic DNA as templates, the coding sequences of T1 to T5 (T1: Fur family, CLAU_RS06995; T2: Crp / Fnr family, CLAU_RS14020; T3: Rrf2 family, CLAU_RS16115; T4: LysR family, CLAU_RS02880; T5: LysR family, CLAU_RS08380) were amplified by PCR and cloned into the strong constitutive promoter P of the *E. coli*-*Clolastia* shuttle vector pMTL83151. thl Downstream, plasmid pMTL83151-P was obtained. thl -T1 to T5. These plasmids were electroporated into wild-type C. autoethanogenum to obtain overexpression strains CAB-T1 to CAB-T5.
[0062] Figure 6 shows the validation results of strains overexpressing five transcription factors (T1-T5). M represents a 1 kb Plus DNA Ladder; lanes 1-4 are T1 transformant, T1 plasmid, wild-type, and water, respectively; lanes 5-8 are T2 transformant, T2 plasmid, wild-type, and water; lanes 9-12 are T3 transformant, T3 plasmid, wild-type, and water; lanes 13-16 are T4 transformant, T4 plasmid, wild-type, and water; and lanes 17-20 are T5 transformant, T5 plasmid, wild-type, and water. Each transformant amplified the target band consistent with the corresponding plasmid, and the size was consistent with expectations (T1-T5 gene lengths are approximately 600 bp, 900 bp, 700 bp, 1200 bp, and 900 bp, respectively). No bands were observed in the wild-type and water strains, indicating that all five transcription factor overexpression plasmids were successfully transformed and expressed in the host.
[0063] 3.3 Evaluation of Syngas Fermentation Phenotyps of Single-Gene Overexpression Strains Based on the successful construction of each single-gene overexpression strain, the effects on growth and product synthesis were systematically evaluated under standard syngas shake flask fermentation conditions. The results are shown in Figure 9.
[0064] Compared to the wild type, AuNPs@BSA–C. autoethanogenum showed significant upregulation of 671 genes, including key enzymes involved in energy metabolism: all subunits of the NADH: ferroredoxin oxidoreductase complex (Rnf) and its regulatory protein RseC, the complete FOF1-ATP synthase gene cluster, all subunits of Hyt hydrogenase, and multiple subunits of formate dehydrogenase (Fdh). Furthermore, pyruvate phosphate dual kinase (PPDK) was also significantly upregulated. These expression changes are consistent with previous reports on anaerobic energy conservation and electron bifurcation. Specifically, Rnf creates an ion gradient across the membrane by transferring electrons from NADH / donor to ferroredoxin; FOF1-ATP synthase then utilizes this gradient to synthesize ATP to meet cellular energy needs. Electron bifurcation hydrogenase (Hyt) enhances energy utilization efficiency, and Hyt may form a coupling complex with Fdh to synergistically regulate electron allocation and one-carbon metabolic flux. Upregulation of PPDK may reprogram carbon flux at the pyruvate-phosphoenolpyruvate node, altering the supply and demand of NADH and ferricoxin-based reducing power, thereby helping to maintain redox balance and meet increased energy demands.
[0065] Overexpression strains of Rnf, FOF1-ATP synthase, PPDK, Hyt, Fdh, and the Hyt-Fdh complex were constructed from wild-type strains (genotypes verified by PCR, Figures 4–6), and their phenotypes were characterized under standard synthetic gas shake-flask fermentation conditions (Figure 9). Compared with the wild-type strain, Rnf overexpression increased OD... 600 An increase of 12.2% was achieved by overexpressing FOF1-ATP synthase, which led to an increase in OD.600 The ethanol yield increased by 27.1% (Fig. 9a). Simultaneously, ethanol titers significantly increased by 54.8% (Rnf) and 136.9% (ATP synthase), respectively (Fig. 9b), while acetic acid concentrations decreased by 50.0% and 48.0%, respectively (Fig. 9c). PPDK overexpression also increased ethanol production by 23.5% (Fig. 9b) and decreased acetic acid production by 12.7% (Fig. 9c). However, compared to the wild type, none of these single-gene overexpression strategies significantly altered total ethanol and acetic acid production (Fig. 9d).
[0066] Conversely, overexpression of Hyt and Fdh, alone or in combination, failed to enhance the phenotype and instead led to OD. 600 The growth rate and ethanol titer decreased. This indicates that, without synergistic optimization of substrate supply, electron acceptor, or membrane coupling, simply enhancing a specific redox module may lead to an imbalance in electron allocation or an increased metabolic burden.
[0067] To further identify potential regulatory elements, five candidate transcription factors were screened based on differential expression and functional annotation: Fur family members (T1, CLAU_RS06995), Crp / Fnr family members (T2, CLAU_RS14020), Rrf2 family members (T3, CLAU_RS16115), and two LysR family members (T4, CLAU_RS02880; T5, CLAU_RS08380). The phenotypes of these strains were evaluated in standard synthetic gas shake-flask fermentation, and the results are shown in Figure 9: Overexpression of T2 (Crp / Fnr family) significantly promoted growth, with its OD... 600 Compared with the wild type, it increased by 23.7% (Figure 9a) and ethanol production increased by 11.3% (Figure 9b).
[0068] Overexpression of T5 (LysR family) significantly increased ethanol production by 139.0% compared to wild type (Figure 9b), while reducing OD... 600 No significant effect (Figure 9a).
[0069] Overexpression of T1, T3, and T4 has limited promoting effect on growth or product synthesis, and may even show an inhibitory effect.
[0070] Regarding acetic acid concentration, overexpression of T2 and T5 reduced acetic acid by 26.0% and 28.0%, respectively (Figure 9c).
[0071] It is noteworthy that, under the experimental conditions and sampling time points, overexpression of any transcription factor did not significantly change the total acid alcohol concentration compared to the wild type (Figure 9d).
[0072] Therefore, T2 and T5 were selected as key endogenous transcriptional regulatory elements that can effectively drive carbon metabolism flow and promote product synthesis.
[0073] High-level overexpression of a single gene can often alter the distribution of a specific product (such as ethanol), but it is difficult to significantly increase the total acid-alcohol yield (titer or total carbon flux). The fundamental reason is that the overall productivity of syngas fermentation is limited by multiple interrelated factors, rather than a single metabolic node. First, the Wood-Yondar pathway (WLP), which supports CO / CO2 fixation, may itself have inherent kinetic or thermodynamic limitations; enhancing downstream enzyme activity usually only redistributes flux among products without overcoming bottlenecks in the upstream pathway. Second, plasmid maintenance and high-level heterologous expression impose a metabolic burden, consuming ATP, reducing power, and transcription / translation capacity, thereby reducing the net resources available for carbon fixation and product synthesis. Third, anaerobic metabolic networks are highly sensitive to redox balance; upregulation of individual components may be offset by compensatory cellular responses (such as downregulation of related genes or activation of alternative pathways) or disrupt the homeostatic expression of key pathway enzymes, ultimately limiting overall productivity.
[0074] Therefore, improving syngas fermentation performance typically requires synergistic and multi-module engineering modifications. Based on the above validation results, the Rnf complex, PPDK, transcription factors T2 and T5 were selected as core components of the subsequent "push-pull-resistance" strategy. A summary of the key plasmids used in this embodiment is shown in Table 2.
[0075] Table 2 List of key plasmids Example 4, “Block” Strategy: Knockout of budA Gene and Integration with T5 (Construction of strain CAB-1) This example implements the “block” step in the “push-pull-block” strategy, which concentrates carbon flow by knocking out key genes in the competitive byproduct pathway and integrating transcription factors.
[0076] A specific sgRNA targeting the budA gene (CAETHG_2932) was designed using the CRISPR / Cas9 gene editing system, and an integration plasmid pMTL83151-Cas9-∆budA::T5 was constructed. This plasmid carries the sgRNA targeting the budA gene locus, as well as donor DNA flanking the upstream and downstream homologous arms (approximately 1 kb each) of the budA gene. The donor DNA contains the strong promoter PackA and the coding sequence of the T5 gene (CLAU_RS08380).
[0077] The plasmid was electroporated into wild-type *C. autoethanogenum* DSM 10061, and the T5 expression cassette was integrated into the budA site via homologous recombination, achieving budA knockout and stable T5 expression. Transformants were screened and verified by PCR (results shown in Figure 7a, lanes 1-3 correspond to CAB-1), yielding a strain with the budA gene replaced by the T5 expression cassette, named CAB-1, with the genotype ΔbudA::T5.
[0078] Example 5: "Pull" Strategy: Genomic Integration of Carbon Metabolic Flow Driving Elements. This example implements a "pull" strategy based on the initial modification of the "block" strategy, to stably integrate the selected effective transcription factors and metabolic enzyme genes into the genome, thereby guiding the carbon metabolic flow towards the target product synthesis pathway.
[0079] 5.1. Based on the CAB-1 strain (genotype ΔbudA::T5) constructed in Example 4, the ppdk gene was integrated at the ΔbudA site to further enhance the carbon flow traction ability of the pyruvate node.
[0080] First, the genome integration plasmid pMTL83151-Cas9-ΔbudA::ppdk was constructed. This plasmid carries an sgRNA targeting the budA gene locus, as well as a donor DNA fragment flanked by upstream and downstream homologous arms of the budA gene. The donor contains the strong promoter P. thl The coding sequence of the ppdk gene (CLAU_RS14230).
[0081] The plasmid was electroporated into the CAB-1 strain. Using CRISPR / Cas9-mediated homologous recombination, the ppdk expression cassette was integrated into the budA site, replacing the original T5 expression cassette. Transformants were plated on YTF plates containing 5 μg / mL thiamphenicol and anaerobically cultured at 37°C for 96 hours. Single clones were picked and validated by PCR using primers specific to the budA site. The validation results are shown in Figure 7a. Lanes 4-6 correspond to CAB-2; positive clones amplified bands of the expected size, while the wild-type control (lanes 22-23) amplified the original gene fragment, proving that the ppdk gene had been successfully integrated into the budA site. The obtained strain was named CAB-2, with the genotype ΔbudA::ppdk.
[0082] 5.2 Integration of ppdk::T2 gene cassette at ΔldhA site (construction strain CAB-18) In order to achieve synergistic traction of carbon metabolic flux while blocking the byproduct pathway, CAB-1 (ΔbudA::T5) was used as the starting strain. The tandem expression cassette of ppdk and transcription factor T2 was integrated at the ldhA site to construct the chassis strain for energy enhancement.
[0083] First, the genome integration plasmid pMTL83151-Cas9-ΔldhA::ppdk::T2 was constructed. This plasmid carries an sgRNA targeting the ldhA gene locus, as well as donor DNA flanked by upstream and downstream homologous arms of the ldhA gene. The donor contains the strong promoter P. thlThe ppdk gene, linker peptide sequence, and T2 gene (CLAU_RS14020) are driven to form a ppdk-T2 co-expression unit.
[0084] The plasmid was electroporated into the CAB-1 strain, and the ppdk::T2 expression cassette was integrated into the ldhA site via homologous recombination. After antibiotic selection, the transformants were double-validated by PCR using primers spanning both the ldhA and budA sites: ldhA site validation: As shown in Figure 7b, lanes 20-21 correspond to CAB-18. The positive clone amplified the characteristic band (approximately the expected size) integrating ppdk::T2, while the wild-type control (lanes 22-23) amplified the original ldhA gene fragment, proving that the ldhA site had been successfully modified.
[0085] BudA site verification: As shown in Figure 7a, lanes 19-21 correspond to CAB-18. Positive clones still retain the characteristic band of ΔbudA::T5, which is consistent with the genetic background of CAB-1, proving that the integration of the budA site was not affected.
[0086] Based on the verification results of Figures 7a and 7b, the target strain was successfully obtained. This strain was named CAB-18, and its complete genotype is ΔbudA::T5 ΔldhA::ppdk::T2.
[0087] CAB-18 achieved the blocking of the byproduct pathway (2,3-butanediol and lactate) and stably integrated carbon flow traction elements (PPDK and transcription factor T2), laying the foundation for the subsequent introduction of the "push" strategy (energy metabolism enhancement). During the construction process, other intermediate strains with different genotypes were also obtained (as shown in Table 3, including CAB-4, CAB-5, CAB-6, CAB-7, CAB-8, CAB-9, CAB-10, CAB-17, CAB-110, etc.), and their PCR verification results are shown in the corresponding lanes in Figures 7a and 7b, respectively. All strains were consistent with the expected design.
[0088] Example 6, "Push" Strategy: Introduction of Energy Metabolism Enhancement Gene (Rnf Complex) and Construction of Final Engineered Strains CAB181. This example completes the "push" step. Based on the "pull-resistance" modification, an exogenous energy enhancement module is introduced to construct the final engineered strain.
[0089] 6.1 Construction of the Rnf complex overexpression plasmid: Using wild-type C. autoethanogenum genomic DNA as a template, a DNA fragment containing the regulatory gene RseC and the complete rnfCDGEAB operon (approximately 6.5 kb) was amplified by PCR. This fragment was then cloned into the shuttle vector pMTL83151. thlDownstream of the promoter, an overexpression plasmid pMTL83151-P was constructed. thl -Rnf.
[0090] 6.2 Obtaining the final engineered strain CAB181: The plasmid pMTL83151-P thl -Rnf electroporation was performed on strain CAB18 obtained in Example 5. Transformants were plated on YTF plates containing 5 μg / mL thiamphenicol and cultured anaerobically. Single colonies were picked, plasmids were extracted and verified by restriction enzyme digestion, confirming the plasmid's correctness. The resulting engineered strain was named CAB181. The complete genotype of this strain is: ΔbudA::T5ΔldhA::ppdk::T2, and it contains the recombinant expression vector pMTL83151-P thl -Rnf (carrying the RseC and rnfCDGEAB gene clusters). This strain CAB181 is classified as Clostridium sp., and its preservation name is Clostridium ethanoliferum CAB181. This strain was deposited on February 5, 2026 at the China General Microbiological Culture Collection Center (CGMCC) with the accession number CGMCC NO:46923.
[0091] To systematically verify the effectiveness and combined effect of each step in the "push-pull-resistance" strategy, a series of intermediate engineered strains were constructed and evaluated according to the strategy's decomposition steps before constructing the final strain CAB181. The construction methods for these strains were as described in Examples 4 (knockout), 5 (integration), and 6 (plasmid transformation), and their specific genotypes are shown in Table 3.
[0092] Table 3. Strains and their genotypes. Strains and genotypes: C. autoethanogenum DSM 10061 Wild-type C. autoethanogenum-CAB-Rnf C. autoethanogenum DSM 10061, pMTL83151::P thl -RseCrnfCDGEABC.autoethanogenum-CAB-ATPC. autoethanogenum DSM 10061, pMTL83151::P thl -atpBEFHAGDCC.autoethanogenum-CAB-HytC. autoethanogenum DSM 10061, pMTL83151::P thl-hytCBDE1AE2C.autoethanogenum-CAB-FdhC. autoethanogenum DSM 10061, pMTL83151::P thl -fdhADC.autoethanogenum-CAB-PPDKC. autoethanogenumDSM 10061, pMTL83151::P thl -ppdkC.autoethanogenum-CAB-Hyt-FdhC. autoethanogenumDSM 10061, pMTL83151::P thl -hyt-fdhC.autoethanogenum-CAB-T1C. autoethanogenumDSM 10061, pMTL83151::P thl -T1C.autoethanogenum-CAB-T2C. autoethanogenumDSM 10061, pMTL83151::P thl -T2C.autoethanogenum-CAB-T3C. autoethanogenumDSM 10061, pMTL83151::P thl -T3C autoethanogenum-CAB-T4C. autoethanogenumDSM 10061, pMTL83151::P thl -T4C autoethanogenum-CAB-T5C. autoethanogenumDSM 10061, pMTL83151::P thl-T5C.autoethanogenum-CAB-1C. autoethanogenumDSM 10061, ∆budA::T5C.autoethanogenum-CAB-2C. autoethanogenumDSM 10061, ∆budA::ppdkC. autoethanogenum-CAB-4C. autoethanogenumDSM 10061, ∆budA::ppdk::T2C. autoethanogenum-CAB-5C. autoethanogenumDSM 10061, ∆budA::T5::T2C.autoethanogenum-CAB-6C. autoethanogenumDSM 10061, ∆ldhA::T5C.autoethanogenum-CAB-7C. autoethanogenumDSM 10061, ∆ldhA::ppdkC autoethanogenum-CAB-8C. autoethanogenumDSM 10061, ∆ldhA::ppdk::T2C.autoethanogenum-CAB-9C. autoethanogenumDSM 10061, ∆ldhA::ppdk::T5C. autoethanogenum-CAB-10C. autoethanogenumDSM 10061, ∆ldhA::T5::T2C. autoethanogenum-CAB-17C. autoethanogenumDSM 10061, ∆budA::T5∆ldhA::ppdkC.autoethanogenum-CAB-18C. autoethanogenumDSM 10061, ∆budA::T5∆ldhA::ppdk::T2C autoethanogenum-CAB-110C. autoethanogenumDSM 10061, ∆budA::T5∆ldhA::T5::T2C.autoethanogenum-CAB-181C. autoethanogenumDSM 10061, ∆budA::T5∆ldhA::ppdk::T2pMTL83151::P thl -RseCrnfCDGEAB The final engineered strain CAB181 was validated by PCR, and the results are shown in Figure 8. M is a 1 kb Plus DNA Ladder; lane 1 is CAB181 (using primers to verify genome integration), lane 2 is wild-type, lane 3 is water control; lane 4 is CAB181 (using another pair of primers), lane 5 is wild-type, lane 6 is water; lane 7 is CAB181 (verifying plasmid presence), lane 8 is the plasmid pMTL83151-Pthl-Rnf positive control, lane 9 is wild-type, and lane 10 is water. CAB181 amplified a band of the expected size at the genome integration site, and the Rnf gene fragment on the plasmid was detected simultaneously. Wild-type only amplified the original gene fragment or did not amplify the plasmid band, and the water control showed no band. The results indicate that the genotype of CAB181 is ΔbudA::T5 ΔldhA::ppdk::T2, and it successfully carries the Rnf overexpression plasmid.
[0093] Example 7: Fermentation performance evaluation of engineered strain CAB181 This example quantitatively evaluates the performance of the final engineered strain CAB181, which does not rely on any external energy supply system, in producing ethanol and acetic acid under standard syngas fermentation conditions.
[0094] The fermentation culture method is as follows: wild-type C. autoethanogenum DSM10061, intermediate strain CAB18, and final engineered strain CAB181 were subjected to standard batch synthetic gas shake flask fermentation. All fermentation experiments were carried out under conventional conditions without light and without the addition of any nanomaterials (such as AuNPs@BSA).
[0095] Strain activation: The glycerol-preserved strain was streaked onto YTF agar plates and anaerobically cultured at 37°C until a single colony was formed.
[0096] Seed culture preparation: Pick a single colony and inoculate it into a test tube containing 2.5 ml of LYTF liquid medium, and incubate until OD500. 600 ≈0.6. Transfer the inoculum at a 1:10 ratio to a 100 mL anaerobic flask containing 30 mL of LYTF medium, and continue culturing for 24-48 hours until OD (Organic Depth) reaches 0.6. 600 =0.6-0.8, as the primary seed solution.
[0097] Fermentation inoculation: Transfer the primary seed culture to a 100 mL anaerobic flask containing 30 mL of LYML syngas fermentation medium at a 1:10 inoculation rate. For strain CAB181 carrying the plasmid, add thiamphenicol to the medium at a final concentration of 5 µg / mL to maintain the plasmid.
[0098] Anaerobic digestion and aeration: Immediately use the intelligent anaerobic digestion system to replace the headspace gas in the bottle with syngas (CO:CO2:H2=4:4:2). The program is set as follows: pre-evacuate for 60 seconds, evacuate for 50 seconds, aerate for 60 seconds, cycle 3 times, and finally aerate for 65 seconds to bring the headspace pressure in the bottle to 0.15 MPa.
[0099] Fermentation culture: The anaerobic bottles were placed in a constant temperature shaker at 37℃ and 100 rpm for batch fermentation, with a culture period of 7 days. Except for the endpoint sampling, no feeding or gas replacement was performed during the fermentation period.
[0100] Three independent biological replicates were set up for each strain. After fermentation was completed (day 7), samples were taken uniformly to determine the cell density (OD). 600 ), ethanol and acetic acid concentrations.
[0101] Based on the previously constructed endogenous engineering target map, this study established a logic-driven metabolic regulation strategy named 'Push–Pull–Block', which synergistically optimizes intracellular carbon flux and energy flux through three complementary modules.
[0102] Push: To overcome the energy limitations often associated with high-yield phenotypes, a replicative plasmid system was used to overexpress Rnf. In acetic acid-producing bacteria, Rnf couples NADH oxidation with ferredoxin reduction, accompanied by proton transmembrane transport, thereby forming a transmembrane electrochemical gradient to provide energy for ATP synthesis. Enhancing this energy-conserving module aims to alleviate the energy bottleneck while supporting cell growth and product synthesis.
[0103] Pull: Achieves stable expression of key metabolic enzymes and transcription factors through genome integration, building a continuous downstream metabolic demand and thereby increasing pathway throughput. Targets include PPDK (pyruvate phosphate dual kinase) and two screened transcription factors, T2 (Crp / Fnr family) and T5 (LysR family).
[0104] PPDK catalyzes the reversible interconversion of pyruvate and phosphoenolpyruvate (PEP) and directly affects cellular energy homeostasis through coupling with ATP / AMP and pyrophosphate (PPi) libraries. Therefore, it is regarded as a key node connecting energy metabolism and carbon metabolism.
[0105] Crp / Fnr family regulator T2 and LysR family regulator T5 are believed to be able to perform global transcriptional regulation, synergistically upregulate gene programs related to carbon fixation and energy metabolism, and jointly promote growth and synthesis efficiency.
[0106] Block: Knocking out key enzymes in the main byproduct pathway maximizes flux allocation to the target product. Specifically, knocking out budA and ldhA blocks the synthesis of 2,3-butanediol and lactate, respectively. This metabolic blockade reduces carbon diversion to competing pathways, increases the proportion of carbon flowing to ethanol, and alleviates NADH competitive consumption, thus benefiting the synthesis of the target product overall.
[0107] Guided by this strategy, a series of engineered strains were constructed and systematically evaluated, with CAB181 as the target strain.
[0108] Under syngas shake flask fermentation conditions, the ethanol and acetic acid titers of CAB181 were increased by 46.5% and 35.0% respectively compared with the wild type, and the total acid and alcohol yield was increased by 34.2% (Figure 10a–d).
[0109] The results confirm that synergistic metabolic reprogramming can effectively improve overall pathway throughput.
[0110] Ethanol titers showed a gradual increasing trend among the intermediate strains: compared with the wild type, the representative strains showed increases of 26.1% (CAB4), 23.7% (CAB6), 39.4% (CAB8), and 42.6% (CAB18), respectively. Acetic acid production was significantly increased across the entire series of strains, with increases ranging from 29.6% to 74.7%.
[0111] Gene sequence SEQ ID of transcription factor T1 NO:1:ATGGATAATTTAACTTCTATTTTTAGAGAAAAAAAGCTAAAACTTAACCCCACAGCGTATTGCTGTATATAAATATTTACAATCTACCAAGAAGCATCCTTCGGTTGAAACCATATATAAAGCCCTTCAGCTAGAATATCCTACTATGAGCCTAGCAACTGTTTATAAGGCTCTAAAAACTTTAGTTGATGTAAATTTAGTACAGGAAAT CAATATAGGAGAAAGCAACTTTAGATATGATGGAAATGTTCATCCTCATTCTCATATACAGTGTATAGTTTGTGAGAAAGTAGATGACGTAGAAGGAATTTGTTTTTCTAATTTAAATGATAAAATTAAAGATTGTGTTGACTACGAAGTATTAAGTAATCAAGTTTATTTTTACGGCATATGTAAAGACTGCCAAAAAAATTCTAAAGAATAA.
[0112] The gene sequence of transcription factor T2, SEQ ID NO:2: ATGTTTAAAAAATATGTGGATATATTATCAAAAATTAGCTTATTTCAGGATATTACCAAAGAAGATATTACTATCATGTTAAATTGCATTAAACCTAAAATCAGTCAATTCAAGAAAAATGATTTGATTGCTATAAGTGGAGATGAATTTAAAAGCGTTGGAATTGTAATATCCGGGAAAGCTGTTGTAGTAAAGGAAAATGCTGCAGGAAACAGAATGTTTATGACAAATTTAAATCCAGGAGATATGTTTGGTGAAATGGCCGTTTTTTCAGGAAAATCTGTACTTCCAGCTACCGTTGAAGCTCAAGATAAGTGTACAGTTTTATTTTTACCTGGTGAAAAAATTATAGGTGAATGTAAAAACATGTGCTCATGGCACCGCCCTCTCATTCGCAATATGTTTAAAATTATATCTAATAGGGCGCTAGTGCTAAACAAACATGTAGAGTATTTAAATATCAAAAACTTAAGAGGTAAAATAAGTACCTTTTTAATAGAACAATATAAAAAATCAGGAAAAAGTACTTTCAAACTTCCCTTAAAACGAAATGAATTAGCTGAATTTTTAAATGTTTCAAGACCTTCCCTTTCACGGGAAATGTGTCATATGAGAGATGAAGGGCTTATTGATTTTAACAGATCATCTTTTCATATTAAGGATATTGAAGGATTAAAAAATATGTCAGAGTAA。
[0113] The gene sequence of transcription factor T3, SEQ ID NO:3: TTGAAGCTATCCACAAAAGGAAGATATGGGGTAAAAGCTATGGTAGATTTAGCTATTCACTATAGTGATGAGCCGTCATCTATAAAAAGTATATCGGAAAGACAAAATATATCAGAATATTATTTAGAACAGTTATTTTCGAACCTTAGAAAATCTAATTTAGTAAAAAGTATTAGGGGAGCACAAGGTGGGTATATTTTAAACAGAGAACCCAAAGATATAACTGTAGCTGATATAATGAAAGTTTTAGAAGGACCTATAGAAATATCAGATTGTGTAGATGAAAATAATGAAAATTCTTGCAGTAATATGGACTGCTGTGCTACTAGGCTTTTATGGAGTAGAATTAAAGAAAGTATAGAACAGGTTATGAAGTCTACAACTTTACAAGACATGGTAGATGATTATATTCAAATGAAACAAGAAAAAACGAAAGGGGATATATAA。
[0114] The gene sequence of transcription factor T4, SEQ ID NO:4: ATGACAGAAGAACAATTAAAATATTTTATAACTGTAGTAGATACTGGCAGTTATATGGAAACTGCCTTAGAGCTAAATATTACTCAATCTTCTGTTAGTAAACAAATACAAGCATTAGAACATGAATTAGGTGTTCAACTCTTTAATCGTAAACATAGACGTGTAAAATTAACAATTGAAGGAAAACGATTATTACCTCAAGCTAGGCACACATTAGACGAGATTTATCGTTTAGAATATATGTCCAAAAAACTACAGCCTGGATATAAAGATAAAATAACAGTACTTTCTTTACCTATTATTGGTAACTTTGATTTGTATATTCCAATGAGTCGCTTTGAATTAGAGAATCCTTCTTTTCTAATCAATTTAGTAGAACTAGAAGAACCACGACTATTTCATAGATTGCAAAATAATAGTTTTGATATAGCACTAACTTATTGGTATGGAGAAAATCTAGCTAATAGTAAAACTCTTTTTATTCCTGCTGCTGAAGATGAAATTGTTTTAGCTGTCCACAAAGATACTCCTTTAGCAAAATTGCATTTTATTTTTCCAGAACAATTAAAAAATTCTTCTCTTATGTTAATGGAACCCTATACATGTATATCTAACTTATGTATGGCTTTCTTTGATGAACATGATATTGCTCCAGATATTATATTTAGAGGAAGACCCGAAACTATTTTGAGTGGTGTAGAAGCTAACTATGGTGCTGCTTTAATAACACGTAAGCTAGCAAGTAATTCATCATTTAATAATGTTGTTTTAATACCATTTTCACCTAGTATTTCAATTACACTAGGTGCATTTATTAATAAACATAGTCAAAAGAATCCTAAGATTAACGAACTAGTCAATATGTTAATAGCTAAAATGGCAAATGACAAAAATAAATCTTAG。
[0115] The gene sequence of transcription factor T5, SEQ ID NO:5: ATGATAAATTTTCTTAATTTGGAATACTTTTTAGTTGCATCAGAAGAATTAAACTTTACTAAGGCAGCAAAAAGACTGTTTATCTCTCAACAATCATTAAGTTCTCATATTTCAAAGTTAGAGCTTGACTTAAATGTCACATTATTTAATCGTACCTCACCTTTGACATTGACACCAGAAGGAAAAAGTTTGGCAAAAAACACTATAAAGATACTGAACTTAAAAAAACAATCTCTAAAAGAACTGTCAGATATCAAAGATTTTAAACGAGGTGACTTATATATTGGTATATCCCCTACAAGAGGACTATCATTTTTGCCAGAGATACTGCCTGACTACAGCGAAAAATTTCCTAATATTCATCTACATTTATTCGAAGGTAATTCAAAAGAATTAGACCTTGCATTACTTAACGGTGATGTAGATTTAATAGTTGCAATGTTACCTTTCCATGTAGAAAATGTAGAAACAATACCTCTTTGTAATGAAGAAGTTCTTATGATCGTTCCAGATAGTATATTAGTAAAATACTTTCCTAATAACTATGATAAAGTTAAAGCACAACTTGAAAAAGATGTAGATTTAGCTTTATTGAAAGATTGCCCTTTTTTAATGTTTAACACAAGACATATGGTTAGGCTTATTGCAGATGAAATGTTTAGTAAAAAACAGATAAAGCCTAATATTATTTTAGAAACAGATAGTATTGAAACAGCCTTAGCACTTTCAGTAAAAGGAATGGGAATTACTTTTTACCCTAAAACTCTAATGAGTAACAAGAATTTAGTATTTGATAAAGACTCCTTTGCAAGTACTAACATATACCATATGAGATATAATAAAACTCATAGAACGCTGGCCATCGGCTATCAAAAAAATCGCTATATATCTCAAGCAGTAAAGGAGTTTATCAAGCTAGCAAAAGAAAAATATGAAAATTTAATTCAATGA。
[0116] This invention systematically optimizes the metabolic network of ethanol-producing Clostridium by integrating a multi-push-pull-resistance strategy. The resulting engineered strain CAB181, in standard synthetic gas shake-flask fermentation, significantly increased the yield of ethanol and acetic acid per unit OD by 46.5% ± 5.8% and 35.0% ± 4.0%, respectively, compared to the wild type, without exhibiting a significant growth lag phase, achieving a synergistic improvement in carbon conversion efficiency and metabolic robustness.
[0117] This invention establishes a research paradigm of "exogenous energy supply perturbation → transcriptional response analysis → rational reconstruction of endogenous targets". For the first time, through energy stress mediated by nanomaterials, key endogenous transcription factors (T2 and T5) with positive regulatory effects on energy metabolism and carbon assimilation are screened from the global transcriptome, and these factors are rationally combined with key metabolic enzymes (PPDK) and energy complexes (Rnf) to facilitate metabolic engineering of autotrophic microorganisms.
[0118] Although the present invention has been described in detail through the above embodiments, those skilled in the art will understand that various changes, modifications, and substitutions can be made to these embodiments without departing from the principles and spirit of the invention, all of which fall within the protection scope of the invention as defined by the appended claims. The number of devices and processing scale described herein are for the purpose of simplifying the description of the invention. Applications, modifications, and variations of the present invention will be readily apparent to those skilled in the art.
[0119] Although embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. They can be applied to various fields suitable for the present invention. For those skilled in the art, other modifications can be easily made. Therefore, without departing from the general concept defined by the claims and their equivalents, the present invention is not limited to the specific details and illustrations shown and described herein.
Claims
1. A method for constructing an engineered strain of Clostridium ethanoliferum that produces ethanol and acetic acid, characterized in that, Includes the following steps: Step 1: Knock out the byproduct synthesis gene in Clostridium ethanologenetics; Step 2: Introduce and express a combination of functional genes for driving carbon metabolic flux at the knockout site of the strain obtained in Step 1. The functional gene combination includes: a) at least one endogenous transcription factor obtained through energy stress induction screening, the endogenous transcription factor being selected from Crp / Fnr family transcription factors and LysR family transcription factors, the Crp / Fnr family transcription factor being the protein encoded by the locus number CLAU_RS14020, and the LysR family transcription factor being the protein encoded by the locus number CLAU_RS08380; and b) a pyruvate-phosphokinase dual kinase gene; Step 3: Introduce and express an energy metabolism enhancement gene in the strain obtained in Step 2.
2. The method for constructing an engineered strain of Clostridium ethanoliferum that produces ethanol and acetic acid as described in claim 1, characterized in that, In step one, the byproduct synthesis genes include the budA gene and the ldhA gene.
3. The method for constructing an engineered strain of Clostridium ethanoliferum that produces ethanol and acetic acid as described in claim 2, characterized in that, In step two, endogenous transcription factors were obtained through screening using the following steps: S21, treating Clostridium ethanoliferum with an exogenous energy input system; S22, performing transcriptomics analysis on the treated strains to screen for transcription factors with significantly upregulated expression levels; S23, overexpressing the candidate transcription factors screened in step S22 in Clostridium ethanoliferum, and identifying the Crp / Fnr family transcription factor with locus number CLAU_RS14020 and the LysR family transcription factor with locus number CLAU_RS08380 through phenotypic analysis.
4. The method for constructing an engineered strain of Clostridium ethanoliferum that produces ethanol and acetic acid as described in claim 3, characterized in that, In step two, the gene encoding a LysR family transcription factor is integrated into the budA gene knockout site, and the gene encoding a Crp / Fnr family transcription factor and the gene encoding pyruvate phosphate dual kinase are jointly integrated into the ldhA gene knockout site.
5. The method for constructing an engineered strain of Clostridium ethanoliferum that produces ethanol and acetic acid as described in claim 1, characterized in that, In step three, the energy metabolism enhancement genes are gene clusters encoding the Rnf complex, which includes the RseC, rnfC, rnfD, rnfG, rnfE, rnfA, and rnfB genes.
6. An engineered strain of Clostridium ethanoliferum constructed using the method described in any one of claims 1 to 5, characterized in that, It is classified as Clostridium sp., and its preservation name is Clostridium ethanoliferum CAB181. It is deposited at the China General Microbiological Culture Collection Center with the accession number CGMCC NO:46923.
7. The engineered strain of Clostridium ethanoliferum as described in claim 6, characterized in that, The strain has the genotype ∆budA::T5∆ldhA::ppdk::T2 and contains a recombinant expression vector containing the RseC and rnfCDGEAB gene clusters; where T5 represents LysR family transcription factors and T2 represents Crp / Fnr family transcription factors.
8. Use of the engineered strain of Clostridium ethanoliferum as described in claim 7 in the fermentation production of ethanol and / or acetic acid.
9. A method for producing ethanol and / or acetic acid, characterized in that, include: The engineered strain of Clostridium ethanoliferum described in claim 7 is cultured under the condition that syngas is used as a carbon source.
Citation Information
Patent Citations
Recombinant microorganisms and uses therefor
CN104919037A
Microorganism with modified aldehyde,ferredoxin oxidoreductase activity and related methods
CN109477063A
Recombinant clostridium aerovorans as well as construction method and application thereof
CN118685338A
Method for improving yield of ethanol synthesized by gas fermentation of clostridium perdaendum
CN121628939A