Application of SNP (Single Nucleotide Polymorphism) molecular marker related to character of siniperca chuatsi in ingestion of artificial compound feed
SNP1 and SNP2 loci were screened through genome-wide association analysis and used for breeding of mandarin fish, which solved the problem of low domestication efficiency of mandarin fish, realized the breeding of mandarin fish with high efficiency of feeding on artificial compound feed, reduced breeding costs and improved economic benefits.
Patent Information
- Application Number
- CN202610425018.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-02
- Publication Date
- 2026-05-01
- Estimated Expiration
- 2046-04-02
AI Technical Summary
Traditional mandarin fish farming relies on live bait, resulting in high costs, frequent diseases, and serious environmental pollution. Furthermore, existing technologies lack effective SNP molecular markers for studying the traits of mandarin fish feeding on artificial formulated feeds, leading to low domestication efficiency.
We provide SNP molecular markers associated with the feeding of artificial compound feed on mandarin fish, and screen out SNP1 and SNP2 loci through genome-wide association analysis to assist in selective breeding, eliminate individuals that are difficult to tame, and select individuals that are easy to tame for breeding.
It significantly improved the breeding efficiency of the domestication trait of mandarin fish, reduced breeding costs, increased economic benefits, and established a high proportion of superior mandarin fish strains that are easy to domesticate.
Smart Images

Figure CN121951084A_ABST
Abstract
Description
Application of SNP molecular markers related to the trait of mandarin fish feeding on formulated feed Technical Field
[0001] This invention belongs to the fields of biotechnology and aquatic animal genetics and breeding, and in particular relates to the application of a SNP molecular marker related to the trait of mandarin fish feeding on artificial compound feed. Background Technology
[0002] The mandarin fish (Siniperca chuatsi), commonly known as the mandarin fish or osmanthus fish, belongs to the order Perciformes, family Serranidae, and genus Siniperca. It is a unique and valuable freshwater economic fish species endemic to my country. It is widely favored by consumers for its tender flesh, delicious taste, and lack of intramuscular bones. The mandarin fish is a typical carnivorous fish, feeding entirely on live fish and shrimp throughout its life. This unique feeding habit presents significant challenges to the aquaculture industry. Traditional mandarin fish farming relies mainly on live bait fish (such as mud carp), which not only leads to high farming costs but also suffers from unstable bait fish supply, a high risk of pathogen transmission causing frequent disease outbreaks, and severe pollution of the aquaculture water environment. To address these issues, feeding mandarin fish with formulated feed has become an inevitable trend for the industry's development. Significant progress has been made in the artificial domestication of mandarin fish to feed with formulated feed, but significant individual differences remain. In actual production, a considerable proportion of mandarin fish are difficult to domesticate, exhibiting behaviors such as refusing to eat formulated feed, stunted growth, or even starvation and death. This seriously affects the survival rate and economic benefits of the formulated feed farming model.
[0003] SNPs (single nucleotide polymorphisms) are the most abundant form of genetic variation in the genome. Genome-wide association studies (GWAS), as a highly efficient genetic tool, have been widely used to analyze complex traits in plants and animals. While molecular markers for traits such as growth and disease resistance have been reported in aquatic animals, research on SNP molecular markers related to the complex behavioral trait of largemouth bass feeding on formulated feed is relatively limited. Existing technologies, such as the invention patent with publication number CN107034307A, provide an SNP marker related to the growth traits of largemouth bass. This SNP marker can be used for screening or detection of largemouth bass, or for screening or detecting largemouth bass or their parents that are easily trained to eat formulated feed during the artificial breeding process. This has positive effects in the breeding and selection of largemouth bass. Furthermore, the invention patent with publication number CN114908175A discloses SNP markers related to the feeding domestication of largemouth bass and their applications. This molecular marker can serve as a reliable marker for the feeding domestication trait of largemouth bass, facilitating early selection, thereby improving the success rate of feeding domestication selection, increasing breeding efficiency and accuracy, and providing a theoretical basis for rapidly screening largemouth bass that are easily trained to eat formulated feed.
[0004] Traditional breeding methods for mandarin fish feeding habits mainly rely on phenotypic selection, which is time-consuming, highly susceptible to environmental influences, and inefficient. Therefore, identifying SNP molecular markers closely related to the feeding traits of mandarin fish on formulated feeds and developing marker-assisted selection (MAS) technology is of great significance for breeding new mandarin fish varieties that are easy to tame and grow quickly, and for promoting the green and sustainable development of the mandarin fish farming industry. Summary of the Invention
[0005] To address the shortcomings of existing technologies, this invention provides an application of SNP molecular markers related to the feeding of artificial compound feed on mandarin fish.
[0006] On one hand, the present invention provides a SNP molecular marker related to the feeding of artificial compound feed on mandarin fish, the SNP molecular marker including at least one of the following SNP molecular markers: First, the nucleotide sequence containing the SNP1 molecular marker is shown in SEQ ID No. 1, the SNP1 molecular marker is located at the 301st position from the 5' end of SEQ ID No. 1, corresponding to the 29390304th position from the 5' end on chromosome 10 of the mandarin fish genome, and is a base A or a base T; Second, the nucleotide sequence containing the SNP2 molecular marker is shown in SEQ ID No. 2, the SNP molecular marker is located at the 301st position from the 5' end of SEQ ID No. 2, corresponding to the 1218488th position from the 5' end on chromosome 20 of the mandarin fish genome, and is a base T or a base A.
[0007] Among them, the sequence shown in SEQ ID No.1 is: AGGACGGGCGGCGCAGATCGGAGCGATATGCCCTCCTCAGACACACCTGTTAGAAGCGTGGGTCGGTCGGCCTGTCCCGTGGGGGATGTCGGTCACCGCCTCCCTTCTTGTATCACCTCCTCTTCCTCCTCTTGAGAGAGAAAGGCGAAAGCTGATGCGCGGCTCCCTATCTTCGCCTATTCTGCCTTAAAAAAAAAAACAACAACAAAAAAACAAGCGATTTGTGATGTTAAAAGACGGGGGTTCTCGCTGGTTTGGCGTCTCCAGCGCCGCTGAGCCGACGGAGCGCACGGTTTACAGXAATTATGGACACGTCCACATTAGCGGACAGATTTCCCCATTGACAGCGCTGTTTCTTGACAAATCTTCAGATTATTATCCCCCCCCCCACTCCTCGTTTTCTTGTTTTCCTCTTTGTCACCTTCCCTGTCTCTTCCTCCTCCGGGCCCGGGCTGATGGGAGACAACCGGACACCTGTTTGAATCCTGTTTATCCTTCTTCCTCTGGCACACTTAAAGCGCAACGCTACGCCTCATTTCCTCGCTCCTCAAATATATACGATTAGGTGATATCGCCTTCCCAACAGCAGCAGCAGCTGTAG, where X is base A or base T.
[0008] The sequence shown in SEQ ID No. 2 is: , where Y is base T or base A.
[0009] For SNP1, when the SNP molecular markers in the sequences shown in SEQ ID No. 1 on the two chromosomes of the mandarin fish are A and A respectively, it is called the AA homozygous genotype. Mandarin fish with the AA genotype have a strong ability to eat artificial feed (easy to train). When the SNP molecular markers in the sequences shown in SEQ ID No. 1 on the two chromosomes are A and T respectively, it is called the AT heterozygous genotype. Mandarin fish with the AT genotype have a weak ability to eat artificial feed (difficult to train). When the SNP molecular markers in the sequences shown in SEQ ID No. 1 on the two chromosomes are T and T respectively, it is called the TT homozygous genotype. Mandarin fish with the TT genotype have a weak ability to eat artificial feed (difficult to train).
[0010] For SNP2, when the SNP molecular markers in the sequences shown in SEQ ID No. 2 on the two chromosomes of mandarin fish are T and T respectively, it is called the TT homozygous genotype. Mandarin fish with the TT genotype have a strong ability to consume artificial compound feed. When the SNP molecular markers in the sequences shown in SEQ ID No. 2 on the two chromosomes are T and A respectively, it is called the TA heterozygous genotype. Mandarin fish with the TA genotype have a weak ability to consume artificial compound feed.
[0011] During breeding, if the SNP molecular marker is the first type, then in the mandarin fish breeding population, select the broodstock individuals with the AA genotype at the 301st locus from the 5' end of SEQ ID No.1, and eliminate the broodstock individuals with the AT or TT genotype at that locus.
[0012] If the SNP molecular marker is the second type, then in the mandarin fish breeding population, select the TT genotype at the 301st locus from the 5' end of SEQ ID No.2, and cull the TA genotype at that locus.
[0013] The present invention also provides a method for screening mandarin fish strains with strong ability to consume artificial compound feed. The method includes detecting the genotype of the SNP molecular markers described in the mandarin fish genome and selecting mandarin fish with specific genotypes for breeding.
[0014] Preferably, if the SNP molecular marker is the first type, the specific genotype is AA; if the SNP molecular marker is the second type, the specific genotype is TT.
[0015] This invention also provides a method for marker-assisted selection breeding based on the strong ability of mandarin fish to consume artificial feed. The method includes: a) extracting DNA from the mandarin fish to be bred; b) performing genotyping on the extracted DNA to determine the genotype of the SNP molecular marker; c) selecting mandarin fish with a strong ability to consume artificial feed for breeding based on the identification results.
[0016] Furthermore, if the SNP molecular marker is of the first type, the mandarin fish with a strong ability to consume artificial feed is a mandarin fish with the AA type SNP molecular marker genotype; if the SNP molecular marker is of the second type, the mandarin fish with a strong ability to consume artificial feed is a mandarin fish with the TT type SNP molecular marker genotype.
[0017] For genetic improvement aimed at achieving the trait of easy domestication in mandarin fish, the method includes: determining the aforementioned SNP molecular markers of broodstock in the core group of mandarin fish, and making corresponding selections based on the SNP molecular markers: if the SNP molecular marker is SNP1, then in the core group of mandarin fish, broodstock individuals with the AA genotype at the 301st locus from the 5' end of SEQ ID No. 1 are selected, and broodstock individuals with the AT or TT genotypes at that locus are eliminated; if the SNP molecular marker is SNP2, then in the core group of mandarin fish, broodstock individuals with the TT genotype at the 301st locus from the 5' end of SEQ ID No. 2 are selected, and broodstock individuals with the TA genotype at that locus are eliminated.
[0018] Due to the adoption of the above technical solutions, the embodiments of the present invention have at least the following beneficial effects: the SNP molecular marker of the present invention is closely related to the ability of mandarin fish to consume artificial compound feed. Therefore, the SNP molecular marker of the present invention can be used to predict the domestication potential of mandarin fish in the early stage, or to carry out molecular marker-assisted breeding through this SNP molecular marker to increase the proportion of easily domesticated individuals in the population, thereby significantly reducing breeding costs and improving economic benefits. Attached Figure Description
[0019] Figure 1 is a comparison of the morphological characteristics of mandarin fish populations feeding on artificial feed in an embodiment of the present invention. The top part shows mandarin fish that are easy to train and feed on artificial feed, while the bottom part shows mandarin fish that are not easy to train and feed on artificial feed.
[0020] Figure 2 is a Manhattan plot of genome-wide association analysis in an embodiment of the present invention, where the horizontal line is the threshold line. Detailed Implementation
[0021] To facilitate understanding of the present invention, the present invention will be described more fully and in detail below with reference to the accompanying drawings and embodiments, but the scope of protection of the present invention is not limited to the following specific embodiments.
[0022] Example 1 Detection of SNP molecular markers related to artificial feed intake in mandarin fish 1. Domestication of diet and sample collection of juvenile mandarin fish In this example, all juvenile mandarin fish were purchased from the same breeding group in an aquaculture fry farm to control genetic background differences as much as possible. The initial size of the experimental fish was: weight 1.30±0.08 g, body length 5.05±0.24 cm, totaling 500 fish. The diet domestication experiment was conducted in an indoor recirculating aquaculture system (water temperature 25±1℃, dissolved oxygen >6 mg / L). The experiment was divided into two stages: Stage 1 (live bait fish + frozen bait fish, 3 days): live bait fish were fed, and the proportion of frozen bait fish was gradually increased until the fish were fully adapted to frozen bait fish.
[0023] Phase Two (Frozen Bait Fish + Formulated Feed, 9 days): After the experimental fish have adapted to the frozen bait fish, gradually increase the proportion of formulated feed until they are exclusively fed formulated feed. Feeding should be done at fixed times, locations, in fixed quantities, and with fixed signals, twice a day. The feed amount should be 1%-3% of the fish's body weight, and adjusted dynamically according to their feeding behavior. Each feeding session should last 30 minutes, and any uneaten feed should be removed promptly.
[0024] After the domestication period, strict phenotypic identification and grouping were conducted based on feeding behavior: The easily domesticated group: able to stably and actively float to the surface to feed on formulated feed, and intestinal contents examination confirmed that the feed was primarily formulated. A total of 140 fish were selected.
[0025] The group that is difficult to train: consistently avoids formulated feed, only consuming feed pellets that sink to the bottom or are accidentally ingested, or vomiting them after eating; intestinal examination shows an empty intestine or very little formulated feed. A total of 60 tails were selected.
[0026] The morphological characteristics of easily tamed and difficult-to-tamed mandarin fish are shown in Figure 1. Muscle tissue was taken from each experimental fish and stored at -20℃.
[0027] 2. Screening of SNPs Related to the Taming Trait in Mandarin Fish using Whole-Genome Resequencing (GWAS) This invention successfully screened and obtained molecular markers closely linked to the taming trait in mandarin fish using a genome-wide association analysis (GWAS) strategy based on whole-genome resequencing of 200 individuals. The specific steps are as follows: First, high-quality genomic DNA was extracted from independent individuals (140 easily tamed and 60 difficult to tamed) that underwent rigorous phenotypic identification, and sequencing libraries were constructed for each individual. Subsequently, whole-genome resequencing at a depth of at least 15× was performed on each individual using the Illumina NovaSeq platform. After obtaining the raw data, quality control and alignment to a reference genome were performed, and individual-level single nucleotide polymorphism (SNP) calling was conducted using the GATK standard workflow to obtain a high-confidence variant dataset. Based on this individual genotype matrix and corresponding phenotypic data, an efficient mixed linear model was used for genome-wide association analysis to correct for the influence of population structure and accurately identify SNPs that achieved significant association at the genome level between the two groups. Strict significance thresholds were set, and functional annotation of the sites was comprehensively considered.
[0028] GWAS analysis identified 32 SNP loci significantly associated with the domestication of mandarin fish. Figure 2 shows the Manhattan plot of genome-wide association analysis in this embodiment of the invention. Ultimately, two SNP loci associated with the domestication of mandarin fish were identified.
[0029] The first type, denoted as SNP1, contains a nucleotide sequence with an SNP molecular marker as shown in SEQ ID No. 1. The SNP molecular marker is located at the 301st position from the 5' end of SEQ ID No. 1, corresponding to the 29390304th position from the 5' end on chromosome 10 of the mandarin fish genome, and is either A or T. The second type, denoted as SNP2, contains a nucleotide sequence with an SNP molecular marker as shown in SEQ ID No. 2. The SNP molecular marker is located at the 301st position from the 5' end of SEQ ID No. 2, corresponding to the 1218488th position from the 5' end on chromosome 20 of the mandarin fish genome, and is either T or A.
[0030] 3. Genotyping of SNPs 1 and 2, which may be related to domestication traits in step 2, was performed by allele-specific PCR detection of domestication-related SNPs in mandarin fish. The allele and genotype information for the SNP loci in easily domesticated and difficult-to-domesticate mandarin fish populations is shown in Table 1.
[0031] Table 1. Distribution of alleles and genotypes in easily domesticated and difficult-to-domesticate mandarin fish populations
[0032] Note: One of the 200 mandarin fish was missing the SNP1 site, and its genotype was not detected.
[0033] Table 1 shows a significant correlation between the polymorphisms at SNP1 and SNP2 loci and the ease with which mandarin fish can be domesticated by artificial feed. Specifically, the AA genotype at SNP1 is a favorable genotype for easy domestication. In breeding, selecting individuals with the AA genotype and eliminating those with the AT and TT genotypes can significantly improve the domestication success rate of the population. Similarly, the TT genotype at SNP2 is also a favorable genotype for easy domestication. Selecting individuals with the TT genotype and eliminating those with the TA genotype (AA was not observed in this experiment, but theoretically should also be eliminated) helps improve the ease of domestication. Using these two molecular markers for assisted breeding allows for the genetic differentiation of juvenile fish with indistinguishable phenotypes. By eliminating individuals carrying unfavorable alleles (T in SNP1 and A in SNP2), a high proportion of easily domesticated superior strains of mandarin fish can be rapidly established.
[0034] In summary, on the one hand, the SNP loci discovered in this application are of great significance in the aquaculture industry of mandarin fish, mainly in two aspects: 1. They are significant for continuous optimization through generations. For example, when SNP1 is of the AA genotype, the number of easily domesticated mandarin fish is 137, while the number of difficult-to-domesticate mandarin fish is 43. Obviously, the AA genotype mandarin fish individuals have an easily domesticated phenotype. In the breeding process, this difference can be continuously reduced through multiple generations and screening, ultimately significantly optimizing the domestication ability of the mandarin fish population; 2. In genetic breeding, finding alleles is an important method. The significance of this patent application lies in the fact that it is the first time that a molecular marker highly associated with the domestication traits of mandarin fish has been discovered at the genomic level, locating complex feeding behavior traits to specific genomic loci, which is an important breakthrough in basic research.
[0035] On the other hand, this marker can be directly used to construct a marker-assisted selection system, rapidly accumulating beneficial genes by selecting parents carrying superior alleles, thereby achieving genetic improvement of domestication traits. This is a crucial first step in realizing "genomic selection" and "precision breeding" of mandarin fish.
Claims
1. A SNP molecular marker associated with the trait of mandarin fish feeding on formulated feed, characterized in that, The SNP molecular marker includes at least one of the following SNP molecular markers: First, the nucleotide sequence containing the SNP molecular marker is shown in SEQ ID No. 1, wherein the SNP molecular marker is located at position 301 from the 5' end of SEQ ID No. 1, corresponding to position 29390304 from the 5' end of chromosome 10 of the mandarin fish genome, and is A or T; Second, the nucleotide sequence containing the SNP molecular marker is shown in SEQ ID No. 2, wherein the SNP molecular marker is located at position 301 from the 5' end of SEQ ID No. 2, corresponding to position 1218488 from the 5' end of chromosome 20 of the mandarin fish genome, and is T or A.
2. The SNP molecular marker according to claim 1, characterized in that, If the SNP molecular marker is the first type, the feeding trait of the mandarin fish on artificial feed is as follows: the AA genotype mandarin fish has a strong ability to feed on artificial feed, while the AT or TT genotype mandarin fish has a weak ability to feed on artificial feed.
3. The SNP molecular marker according to claim 1, characterized in that, If the SNP molecular marker is the second type, the feeding trait of the mandarin fish on artificial feed is as follows: the TT genotype mandarin fish has a strong ability to feed on artificial feed, while the TA genotype mandarin fish has a weak ability to feed on artificial feed.
4. The application of the SNP molecular marker as described in any one of claims 1 to 3 in screening for mandarin fish strains with strong ability to consume artificial compound feed.
5. The application according to claim 4, characterized in that, When applying the SNP molecular marker, if the marker is the first type, then in the mandarin fish breeding population, select the broodstock individuals with the AA genotype at the 301st locus from the 5' end of SEQ ID No. 1, and cull the broodstock individuals with the AT or TT genotype at that locus.
6. The application according to claim 4, characterized in that, When applying the SNP molecular marker, if the marker is the second type, then in the Mandarin fish breeding population, select the TT genotype at the 301st locus from the 5' end of SEQ ID No. 2, and cull the TA genotype at that locus.
7. A method for screening mandarin fish strains with strong ability to consume formulated feed, characterized in that, The method includes detecting the genotype of the SNP molecular markers as described in any one of claims 1 to 3 in the genome of mandarin fish, and selecting mandarin fish with specific genotypes for breeding.
8. The method according to claim 7, characterized in that, If the SNP molecular marker is the first type, the specific genotype is AA; if the SNP molecular marker is the second type, the specific genotype is TT.
9. A method for marker-assisted selection breeding based on the strong ability of mandarin fish to consume formulated feed, characterized in that, The method includes: a) extracting DNA from the mandarin fish to be bred; b) performing genotyping on the extracted DNA to determine the genotype of the SNP molecular marker as described in any one of claims 1 to 3; c) selecting mandarin fish with a strong ability to consume artificial compound feed for breeding based on the identification results.
10. The method according to claim 9, characterized in that, If the SNP molecular marker is of the first type, the mandarin fish with a strong ability to consume artificial feed is a mandarin fish with the AA type SNP molecular marker genotype; if the SNP molecular marker is of the second type, the mandarin fish with a strong ability to consume artificial feed is a mandarin fish with the TT type SNP molecular marker genotype.
Citation Information
Patent Citations
SNP marker related to growth trait of largemouth bass and application thereof
CN107034307A
SNP marker related to feeding habitual domestication of micropterus salmoides and application thereof
CN114908175A
SNP molecular marker easy to domesticate artificial feed mandarin fish related gene
CN102653757A
Siniperca chuatsi liquid-phase breeding chip and application thereof
CN118006736A
Marker combination for mandarin fish genotyping and whole genome liquid phase chip applying marker combination
CN118389706A
Cited By
SNP molecular marker related to mandarin fish feeding habit and application
CN122326770A