Compounds and application thereof in preparation of anti-inflammatory drugs

By providing novel small molecule compounds targeting the cGAS-STING pathway, the problem of excessive release of inflammatory factors in existing technologies has been solved, enabling effective treatment and prevention of diseases related to excessive release of inflammatory factors.

CN121990980APending Publication Date: 2026-05-08ARMY MEDICAL UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511613098.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2024-11-05
Filing Date
2025-11-05
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

Current technologies lack small molecule inhibitors that target the cGAS-STING pathway in diseases, leading to excessive synthesis and release of inflammatory factors, which in turn triggers autoimmune diseases, neurodegenerative diseases, and other conditions.

Method used

This study provides a class of compounds or their pharmaceutically acceptable salts as novel small molecule inhibitors that can reduce the release of inflammatory factors, particularly by targeting the cGAS-STING pathway and inhibiting the abnormal activation of the STING protein.

Benefits of technology

It effectively reduces the release of inflammatory factors, treats or prevents diseases associated with excessive release of inflammatory factors, including autoimmune diseases and neurodegenerative diseases, and inhibits the abnormal activation of the cGAS-STING pathway.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121990980A_ABST
    Figure CN121990980A_ABST
Patent Text Reader

Abstract

The present application provides a compound of formula (I) or a pharmaceutically acceptable salt thereof, and uses thereof in treating or preventing inflammation, reducing release of inflammatory factors (especially inflammatory factors of immune cells), treating or preventing diseases associated with excessive release of inflammatory factors, inhibiting a cGAS-STING pathway, or treating diseases associated with the cGAS-STING pathway. (I)
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of biomedicine, and more specifically to a class of compounds and their use in the preparation of anti-inflammatory drugs. Background Technology

[0002] Inflammation is an adaptive response of the body to harmful stimuli (such as infection, tissue damage, etc.). Under normal circumstances, the body precisely regulates the initiation and termination of the inflammatory response. After the harmful conditions are cleared, the inflammatory response terminates, and the tissue repair process begins. However, when the damaging stimuli persist for a long time or when immune regulation is defective, the body's regulation of the inflammatory response becomes unbalanced, resulting in the production of excessive cytokines, especially interleukin-6 (IL-6). These excessive cytokines can lead to damage to multiple organs.

[0003] However, there is still a lack of drug treatments for excessive inflammatory responses.

[0004] The cyclic GMP-AMP synthase-stimulator of interferon genes (cGAS-STING) signaling pathway is a crucial component of the human innate immune system. Within this pathway, cGAS acts as a unique pathogen recognition receptor, recognizing various exogenous and endogenous double-stranded DNAs. Upon binding to abnormal DNA, cGAS generates a second messenger cyclic dinucleotide (CDN). CDN then binds to STING, activating downstream signaling pathways such as NF-κB and interferon regulatory factor 3 (IRF3), thereby inducing the expression of inflammatory cytokines such as type I interferon and ultimately initiating an immune response.

[0005] The cGAS-STING pathway, when in a balanced state, is an important means for the body to resist exogenous pathogens. However, when the cGAS-STING pathway is abnormally activated, it leads to the excessive synthesis and release of inflammatory factors, which may promote the occurrence of autoimmune diseases and neurodegenerative diseases, such as STING-associated vasculopathy of infancy (SAVI) caused by gain-of-function mutations in the STING gene, Aicardi–Goutièress syndrome (AGS), systemic lupus erythematosus (SLE), and amyotrophic lateral sclerosis (ALS) caused by mutations in the TREX1 gene encoding the nuclease, which lead to the accumulation of autologous DNA.

[0006] STING protein is a key signaling molecule in the cGAS-STING pathway. Small molecule inhibitors targeting STING can be divided into two categories based on their mechanisms: the first category is inhibitors that occupy CDN binding sites, and the second category is inhibitors that bind to STING palmitoylation sites. However, current technologies still lack small molecule inhibitors that target the cGAS-STING pathway in diseases. Summary of the Invention

[0007] Provided are compounds of formula (I) or pharmaceutically acceptable salts thereof, or their use in the preparation of medicaments for the treatment or prevention of inflammation. (I) in, R 1 It can be selected from the group consisting of hydrogen, halogen, alkoxy, alkanoyl, alkoxycarbonyl, and heteroaryl; R 2 It can be selected from the group consisting of hydrogen, alkyl, alkenyl, alkynyl, azide alkyl, aryl alkyl, and heteroaryl alkyl; R 3 It can be an unsubstituted or substituted aryl or heteroaryl group, either substituted with halogen, alkyl, aryl, or haloalkyl groups; and R 4 It can be cyano, or unsubstituted or substituted with halogen, alkyl, or haloalkyl fatty acyl, fatty oxycarbonyl, arylcarboxyl, aryloxycarbonyl, heteroarylcarboxyl, heteroaryloxycarbonyl, and R 5 It can be cyano; or R 4 and R 5 It can also form indene-1,3(2H)-dione-2-idel.

[0008] The compounds in some embodiments of this application are novel small molecule inhibitors with therapeutic or preventative inflammatory activity, capable of effectively reducing the release of inflammatory factors and effectively treating inflammation. Attached Figure Description

[0009] Figure 1 (a) Mass spectrum of compound D1; (b) Mass spectrum of compound D1. 1 The 1H NMR spectrum and magnified images of several characteristic peaks.

[0010] Figure 2 (a) SDS-PAGE of bovine serum albumin (BSA) labeled with compound C0 using sodium dodecyl sulfate; (b) LC-MS / MS of BSA labeled with compound C0. (a) Top row: TAMRA fluorescent group; bottom row: Coomassie Brilliant Blue; from left to right: DMSO and compounds C0 at 0.5 µM, 1 µM, 2 µM, 5 µM, and 10 µM. (b) Vertical axis: Intensity (count, 10⁻⁶). 3 ).

[0011] Figure 3 (a) Flow cytometry plot, reflecting the release of inflammatory factors induced by treatment of primary mouse bone marrow neutrophils with lipopolysaccharide (LPS) and different concentrations of compound C1; (b) Percentage of IL-6 neutrophils in (b) of (a); (c) Percentage of TNF-α neutrophils in (c) of (a). (a) From left to right: LPS (without compound C1), LPS + 1 µM compound C1, LPS + 5 µM compound C1, LPS + 25 µM compound C1. (b, c) From left to right: Positive control group (only 500 ng / mL LPS), 1 µM group (500 ng / mL LPS and 1 µM compound C1), 5 µM group (500 ng / mL LPS and 5 µM compound C1), 25 µM group (500 ng / mL LPS and 25 µM compound C1). (bc) The vertical axis is (b) IL-6 + (c) TNF-α neutrophil percentage (%)

[0012] Figure 4The release of inflammatory factors in mouse primary bone marrow neutrophils treated with 500 ng / mL LPS and different concentrations of compound C (compounds C1–C37) was investigated. (a) Comparison of the negative control group, positive control group, and (5 µM and 10 µM) compound C1 groups; (b) Comparison among the 5 µM compound groups including the 10 µM compound C1 group; (c) Comparison among the 10 µM compound groups including the 10 µM compound C1 group; (d) Comparison of the concentration gradients (10 µM, 5 µM, 1 µM, 500 nM, 50 nM) of compounds C1, C3, C18, C20, C21, C22, and C23. The horizontal axis labeled "Ctrl" indicates the negative control group, i.e., no LPS treatment; labeled "LPS" indicates the positive control group, i.e., LPS treatment but no compound C treatment; labeled any one of C1–C38 and specifying a concentration (e.g., 5 µg / mL or 10 µg / mL) indicates the specified concentration of the compound group, i.e., treatment with 500 ng / mL LPS and the specified concentration of the specified compound (the labeled one in compound C). The vertical axis represents (a, d) the relative release (%) of cytokine IL-6 with the LPS group as 100%, and (b, c) the cytokine IL-6 release normalized to their respective compound C1 groups.

[0013] Figure 5 : Magnified images of hematoxylin-eosin (HE) staining of kidney sections from mice in each group of Experiment Example 3. From left to right: Sham group, IRI group, IRI+L group, IRI+H group. The staining scale bar is 50 µm.

[0014] Figure 6 Experiment 3: Results of serum creatinine (a) and blood urea nitrogen (BUN) measurements in each group of mice. The horizontal axis, from left to right, represents the Sham group, IRI group, IRI+L group, and IRI+H group; the vertical axis represents (a) creatinine concentration (mg / dL) and (b) BUN concentration (mg / dL), respectively. n=6, results are shown as mean ± SD; compared with the IRI group, **p<0.01, ***p<0.001.

[0015] Figure 7 Photographs of the appearance of kidney tissue in each group of mice in Experiment Example 4, and hematoxylin-eosin (HE) staining and magnified view of kidney sections. (a, b) are from left to right: Sham group, Sham+H group, IRI group, and IRI+H group.

[0016] Figure 8Example 4: Relative mRNA transcription levels of (a) KIM-1, (b) NGAL, (c) IL-β, (d) TNF-α, and (e) IL-6 in mouse samples from each group. The horizontal axis represents the Sham group, Sham+H group, IRI group, and IRI+H group from left to right. The vertical axis represents the relative mRNA transcription levels of (a) KIM-1, (b) NGAL, (c) IL-β, (d) TNF-α, or (e) IL-6, all normalized to the mRNA transcription level of β-actin. n=6, and the results are shown as mean ± SD. Compared with the IRI group, ***p<0.001.

[0017] Figure 9 (a–b) Relative protein content of (a) C-CASP3 and (b) C-CASP9 in mouse samples from each group in Experiment 4. (a–b) The horizontal axis, from left to right, represents the Sham group, Sham+H group, IRI group, and IRI+H group. (a–b) The vertical axis represents the relative protein content of (a) C-CASP3 and (b) C-CASP9, both normalized to the protein content of β-actin. (c) Immunoblot detection results for C-CASP3 and C-CASP9 in mouse samples from each group in Experiment 4. n=3, results are shown as mean ± SD, ***p<0.001 compared to the IRI group.

[0018] Figure 10 Gait analysis results of mice in each group in Experiment 5. The horizontal axis, from left to right, represents the Sham group (○), DMM group (◇), DMM+V group (□), and DMM+C group (▽). The vertical axis represents (a) swing speed (cm / s) and (b) average footprint intensity.

[0019] Figure 11 Example 5: Computed tomography (CT) scans, safranin O-fast green staining, and hematoxylin-eosin staining of mouse knee joint specimens in each group. From left to right, they are the Sham group, DMM group, DMM+V group, and DMM+C group.

[0020] Figure 12 Example 5: Evaluation of cartilage damage ((a) maximum score, (b) total score) and (c) synovial inflammation in knee joint specimens of mice in each group. The horizontal axis, from left to right, represents the Sham group (○), DMM group (◇), DMM+V group (□), and DMM+C group (▽); the vertical axis represents the scores. Detailed Implementation

[0021] To further illustrate the technical means and effects adopted by this application in order to achieve the intended purpose, the following detailed description of the specific implementation methods, structures, features and effects of this application is provided in conjunction with the accompanying drawings and preferred embodiments. Terms and Definitions

[0022] As used herein, singular terms refer to one or more. For example, "element" or "a single element" both refer to one or more elements. As used herein, the term "multiple" refers to at least two.

[0023] As used herein, the term “approximately” refers to an approximation, within or near a range. When the term “approximately” is used in conjunction with a numerical range, it modifies the range by extending the boundaries above or below the provided numerical value. Generally, this document uses the term “approximately” to mean a numerical value that varies by 10% above or below the provided value. On the other hand, the term “approximately” means adding or subtracting 20% ​​of the numerical value of the number it modifies. For example, “approximately 50%” means within the range of 45%–55%. Numerical ranges referred to in this document by endpoints include all integers and fractions contained within that range (e.g., “1 to 5” includes, but is not limited to, 1, 1.5, 2, 2.75, 3, 3.90, 4, and 5). It should also be understood that all integers and fractions are considered to be modified by the term “approximately”.

[0024] As used herein, the terms “comprising,” “including,” or “containing,” as non-exclusive or open-ended terms, are intended to indicate that a combination (e.g., apparatus, composition, method, etc.) includes the listed elements (e.g., units of an apparatus, components of a composition, substantial steps of a method, etc.), but does not exclude other elements. As used herein, the term “substantially composed of” when used to define compositions and methods means excluding other elements that have any substantial effect on the combination for the stated purpose, but does not exclude other elements that do not substantially affect the basic and novel features of the invention. As used herein, the term “composed of” means excluding combinations of other elements (units, components, substantial steps, etc.), but unless otherwise stated, does not mean excluding trace amounts of unavoidable impurities. Embodiments defined by each of these connecting terms are within the scope of the invention. As a particular embodiment, disclosure of technical solutions including the terms “comprising,” “including,” or “containing” should also be considered as simultaneous disclosure of corresponding technical solutions including the terms “substantially composed of” and “composed of.”

[0025] As used herein, the term "and / or" means and covers any and all possible combinations of one or more of the associated listed items. When used in a list of two or more items, the term "and / or" means that any one of the listed items may be included alone, or may include any combination of two or more listed items. For example, if a group, combination, or composition is described as including (or containing) components A, B, C, and / or D, then the composition may include A alone; include B alone; include C alone; include D alone; include a combination of A and B; include a combination of A and C; include a combination of A and D; include a combination of B and C; include a combination of B and D; include a combination of C and D; include a combination of A, B, and C; include a combination of A, B, and D; include a combination of A, C, and D; include a combination of B, C, and D; or include a combination of A, B, C, and D.

[0026] As used herein, the stereochemistry of chiral centers can be defined according to the conventions of those skilled in the art, i.e., using solid wedged bonds. "Indicate groups pointing outwards from the page (towards the reader) and use dashed wedge bonds." "Indicates a group that faces inwards (away from the reader). If such notation is used, it can be understood as indicating a specific, single stereoisomer of the group shown in the chemical structures herein. Any bond not specifically indicated by a solid or dashed wedge in this document should be considered as not specifically indicating whether the bond faces outwards, inwards, or on the page, but this does not preclude it from facing outwards or inwards where chemically permissible."

[0027] As used herein, the term "isomer" means a compound having the same molecular formula but differing in the bonding properties or sequence of its atoms or in the spatial arrangement of its atoms. Specifically, the term "stereoisomer" refers to isomers with different spatial arrangements of atoms; the term "enantiomer" refers to stereoisomers with one or more asymmetric centers, which are non-overlapping mirror images of each other; and the term "diastereomer" refers to stereoisomers that are not enantiomers but have opposite configurations at one or more asymmetric centers. When a compound has an asymmetric center, for example, if the carbon atom is bonded to four different groups, there can be a pair of enantiomers. Enantiomers can be characterized and designated as R-configuration or S-configuration by the absolute configuration of one or more asymmetric centers, or as dextrorotatory or levorotatory by the manner in which the molecule rotates in the plane of polarization. Chiral compounds can exist as individual enantiomers or as mixtures thereof, for example, as racemic mixtures. The compounds of this application may contain asymmetric or chiral centers and thus exist in different stereoisomeric forms. All stereoisomers of the compounds in this application, including but not limited to diastereomers, enantiomers, and transisomers, and mixtures thereof such as racemic mixtures, shall be considered as part of this application. Implementation

[0028] A compound of formula (I) or a pharmaceutically acceptable salt thereof is provided. Use of a compound of formula (I) or a pharmaceutically acceptable salt thereof in the treatment or prevention of inflammation is provided. Use of a compound of formula (I) or a pharmaceutically acceptable salt thereof in the preparation of a medicament for the treatment or prevention of inflammation is provided. Use of a compound of formula (I) or a pharmaceutically acceptable salt thereof for the treatment or prevention of inflammation is provided. A method of treating or preventing inflammation is provided, comprising administering a compound of formula (I) or a pharmaceutically acceptable salt thereof.

[0029] (I)

[0030] In some embodiments, formula (I) includes R on carbon 4 of its indoline ring. 1 In some embodiments, formula (I) includes R on the 5th carbon of its indoline ring. 1 In some embodiments, formula (I) includes R on carbon 6 of its indoline ring. 1 In some embodiments, formula (I) includes R on the 7th carbon of its indoline ring. 1 In some implementations, R 1 Located on carbon 4 of the indoline ring in formula (I), i.e., formula (I) is formula (I4). In some embodiments, R 1 Located on carbon 5 of the indoline ring in formula (I), i.e., formula (I) is formula (I5). In some embodiments, R 1Located on carbon 6 of the indoline ring in formula (I), i.e., formula (I) is formula (I6). In some embodiments, R 1 Located on carbon 7 of the indoline ring in formula (I), i.e., formula (I) is formula (I7).

[0031] (I4) (I5) (I6) (I7)

[0032] In some implementations, R 1 The group is selected from the group consisting of hydrogen, halogen, alkoxy, alkanoyl, alkoxycarbonyl, and heteroaryl. In some embodiments, R 1 The group is selected from the group consisting of hydrogen, fluorine, chlorine, bromine, iodine, methoxy, ethoxy, propoxy, formyl, acetyl, propionyl, methoxycarbonyl, ethoxycarbonyl, and propoxycarbonyl. In some embodiments, R 1 The group selected is free from the group consisting of hydrogen, fluorine, chlorine, bromine, iodine, methoxy, and formyl groups. In some embodiments, R 1 The halogen is selected from the group consisting of hydrogen, fluorine, chlorine, and methoxy. In some embodiments, the halogen is fluorine, chlorine, bromine, or iodine, particularly fluorine. In some embodiments, the alkoxy group is methoxy, ethoxy, or propoxy. In some embodiments, the alkanoyl group is formyl, acetyl, propionyl, n-butyryl, isobutyryl, n-valeryl, isovaleryl, or neovaleryl. In some embodiments, the alkoxycarbonyl group is methoxycarbonyl, ethoxycarbonyl, n-propoxycarbonyl, isopropoxycarbonyl, n-butoxycarbonyl, isobutoxycarbonyl, or tert-butoxycarbonyl.

[0033] In some implementations, R 2 The group is selected from the group consisting of hydrogen, alkyl, alkenyl, alkynyl, azide alkyl, aryl alkyl, and heteroaryl alkyl. In some embodiments, R 2 The group selected is free from the group consisting of hydrogen, methyl, ethyl, propyl, isopropyl, allyl, propargyl, azidomethyl, azidoethyl, azidopropyl, phenyl, and benzyl. In some embodiments, R 2 The alkyl group is selected from the group consisting of hydrogen, methyl, ethyl, allyl, propargyl, phenyl, and benzyl. In some embodiments, the alkyl group is methyl, ethyl, propyl, or isopropyl. In some embodiments, the alkenyl group is allyl. In some embodiments, the alkynyl group is propargyl. In some embodiments, the azidoalkyl group is azidomethyl, azidoethyl, or azidopropyl.

[0034] In some embodiments, the aryl group (including arylalkyl, alkylaryl, arylformyl, or aryloxycarbonyl) is phenyl, naphthyl, anthracenel, phenanthryl, or pyrene, particularly phenyl or naphthyl, and more particularly phenyl. In some embodiments, the heteroaryl group (including heteroarylalkyl, alkylheteroaryl, heteroarylformyl, or heteroaryloxycarbonyl) is pyrroleyl, furanyl, thiopheneyl, pyrazolyl, imidazolyl, pyrazolyl, isozolyl, thiazolyl, pyridinyl, pyranyl, thiaranyl, pyridazinyl, pyrazinyl, pyrazinyl, thiazolyl, indolyl, purinyl, quinolinyl, or isoquinolinyl.

[0035] In some embodiments, the aryl alkyl group is arylmethyl, arylethyl, or arylpropyl, particularly arylmethyl, and more particularly benzylmethyl. In some embodiments, the heteroaryl alkyl group is heteroarylmethyl, heteroarylethyl, or heteroarylpropyl. In some embodiments, the alkyl aryl group is methylaryl, ethylaryl, or propylaryl. In some embodiments, the alkyl heteroaryl group is methyl heteroaryl, ethyl heteroaryl, or propyl heteroaryl.

[0036] In some implementations, R 3 It is an unsubstituted or substituted aryl or heteroaryl group, either substituted with a halogen, alkyl, aryl, or haloalkyl group. In some embodiments, R 3 The aryl group is either unsubstituted or substituted with a halogen, alkyl, aryl, or haloalkyl group. In some embodiments, R 3 It is an unsubstituted or substituted phenyl or naphthyl group, either halogenated or substituted with halogen, alkyl, aryl, or haloalkyl groups. In some embodiments, R 3 Naphthyl groups that are unsubstituted or substituted with halogens, alkyl groups, aryl groups, or haloalkyl groups, especially R 3 It is a naphthyl group. In some embodiments, R 3 It is an unsubstituted or substituted phenyl group, particularly an unsubstituted or substituted phenyl group.

[0037] In some implementations, R 3 The phenyl group is a phenyl group substituted with a halogen or haloalkyl group, and more particularly a phenyl group substituted with a fluorine or fluoroalkyl group. In some embodiments, R 3 R is a halogen-substituted phenyl group. In some embodiments, R 3 The phenyl group is substituted with a haloalkyl group. In some embodiments, the haloalkyl group is particularly a trihalomethyl group, especially a trifluoromethyl group. In some embodiments, the substitution particularly includes meta-substitution or is composed of meta-substitution.

[0038] In some implementations, R 3 for , where X 1 X 2X 3 X 4 and X 5 Each is independently hydrogen, halogen, alkyl, or haloalkyl, especially hydrogen, halogen, or haloalkyl, more particularly hydrogen, halogen, or trihalomethyl, wherein the halogen is fluorine, chlorine, bromine, or iodine, especially fluorine, and especially X. 1 X 2 X 3 X 4 and X 5 In particular, X 2 X 3 and X 4 In particular, X 2 and X 4 In this context, at least one component is not hydrogen. In some embodiments, R... 3 It is 3-fluorophenyl or 3-(trifluoromethyl)phenyl.

[0039] In some implementations, R 4 It is a cyano group, or an unsubstituted or halogenated, alkyl, or haloalkyl-substituted fatty acyl group, fatty oxycarbonyl group, aryl carboxyl group, aryl oxycarbonyl group, heteroaryl carboxyl group, heteroaryl oxycarbonyl group, or R group. 4 and R 5 Together they form indene-1,3(2H)-dione-2,2-dimethyl group.

[0040] In some implementations, R 4 It is a cyano group, or an unsubstituted or halogenated, alkyl, or haloalkyl-substituted fatty acyl group. In some embodiments, R 4 It is an unsubstituted or substituted fatty acyl group with halogen, alkyl, or haloalkyl groups. In some embodiments, the fatty acyl group is selected from the group consisting of formyl, acetyl, propionyl, n-butyryl, isobutyryl, n-valeryl, isovaleryl, and neovaleryl.

[0041] In some implementations, R 4 It is an unsubstituted or substituted aliphatic oxycarbonyl group, or a substituted halogen, alkyl, or haloalkyl group. In some embodiments, the aliphatic oxycarbonyl group is selected from the group consisting of carboxyl, methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, isopropoxycarbonyl, n-butoxycarbonyl, isobutoxycarbonyl, and tert-butoxycarbonyl.

[0042] In some implementations, R 4 It is a cyano group, or an unsubstituted or halogenated, alkyl, or haloalkyl-substituted arcarboxyl group, aryloxycarbonyl group, heteroarylcarboxyl group, or heteroaryloxycarbonyl group. In some embodiments, R 4 It is a cyano group, or an unsubstituted or halogenated or haloalkyl-substituted arcarboxyl group, aryloxycarbonyl group, heteroarylcarboxyl group, or heteroaryloxycarbonyl group. In some embodiments, R 4It is a cyano group, or an unsubstituted or halogenated or haloalkyl-substituted arethaneyl or heteroarethaneyl group. In some embodiments, R 4 It is a cyano group, or an unsubstituted or halogenated, alkyl, or haloalkyl-substituted arethaneyl group. In some embodiments, R 4 It is a cyano group, or an unsubstituted or substituted benzoyl group, either halogenated, alkyl, or haloalkyl. In some embodiments, R 4 It is a cyano group, or an unsubstituted or halogenated or haloalkyl-substituted benzoyl group. In some embodiments, R 4 It is a cyano group.

[0043] In some embodiments, the heteroaryl group is pyrrolocarboxyl, furanocarboxyl, thiophenecarboxyl, pyrazolecarboxyl, imidazolecarboxyl, pyrazolyl, isopyrazolyl, thiazolecarboxyl, pyridinecarboxyl, pyrrolocarboxyl, thiophenecarboxyl, pyridazinecarboxyl, pyrimidinecarboxyl, pyrazazinecarboxyl, pyrazazinecarboxyl, thiazinecarboxyl, indolecarboxyl, purinecarboxyl, quinolinecarboxyl, or isoquinolinecarboxyl, particularly pyrrolocarboxyl, furanocarboxyl, or thiophenecarboxyl, and more particularly thiophenecarboxyl.

[0044] In some embodiments, the heteroaryloxycarbonyl group is pyrrolooxycarbonyl, furanoxycarbonyl, thiophenoxycarbonyl, pyrazoloxycarbonyl, imidazoleoxycarbonyl, sulfazoloxycarbonyl, isosulfazoloxycarbonyl, thiazolyloxycarbonyl, pyridineoxycarbonyl, pyranoxycarbonyl, thiophenoxycarbonyl, pyridazinoxycarbonyl, pyrimidineoxycarbonyl, pyrazinoxycarbonyl, sulfazinoxycarbonyl, thiazolyloxycarbonyl, indoleoxycarbonyl, purineoxycarbonyl, quinolineoxycarbonyl, or isoquinolineoxycarbonyl, particularly pyrrolooxycarbonyl, furanoxycarbonyl, or thiophenoxycarbonyl, and more particularly thiophenoxycarbonyl.

[0045] In some implementations, R 4 The benzoyl group is unsubstituted or substituted with a halogen, alkyl, or haloalkyl group. In some embodiments, R 4 The benzoyl group is either unsubstituted or substituted with halogen or haloalkyl groups.

[0046] In some implementations, R 4 The benzoyl group is substituted with a halogen or haloalkyl group, and more particularly with a fluorinated or fluoroalkyl group. In some embodiments, R 4 The benzoyl group is substituted with a halogen. In some embodiments, R 4 The benzoyl group is substituted with a haloalkyl group. In some embodiments, the haloalkyl group is particularly a trihalomethyl group, especially a trifluoromethyl group. In some embodiments, the substitution particularly includes meta-substitution or is composed of meta-substitution.

[0047] In some implementations, R 4 for , where X 1 X 2 X 3 X 4 and X 5 Each is independently hydrogen, halogen, or haloalkyl, particularly hydrogen, halogen, or trihalomethyl, wherein the halogen is fluorine, chlorine, bromine, or iodine, particularly fluorine, and especially X. 1 X 2 X 3 X 4 and X 5 In particular, X 2 X 3 and X 4 In particular, X 2 and X 4 In this context, at least one component is not hydrogen. In some embodiments, R... 4 It is 3-fluorobenzoyl or 3-(trifluoromethyl)benzoyl.

[0048] In some implementations, R 5 It is cyano, or R 4 and R 5 Together, they form indene-1,3(2H)-diketone-2,2-dimethyl group. In some embodiments, R 5 It is cyano. In some embodiments, R 4 and R 5 Together they form indene-1,3(2H)-dione-2,2-dimethyl group.

[0049] In some embodiments, the compound of formula (I) is one or more of the compounds of formula (Ia), formula (Ib), formula (Ic), formula (Id), formula (Ie), formula (If), formula (Ig), or formula (Ih).

[0050] (Ia) (Ib) (Ic) (Id) (Ie) (If) (Ig) (Ih)

[0051] Use of a compound of formula (I) or a pharmaceutically acceptable salt thereof in reducing the release of inflammatory factors (particularly those released by immune cells), or in the preparation of a medicament for reducing the release of inflammatory factors (particularly those released by immune cells). Use of a compound of formula (I) or a pharmaceutically acceptable salt thereof in reducing the release of inflammatory factors (particularly those released by immune cells). A method for reducing the release of inflammatory factors (particularly those released by immune cells) is provided, comprising administering a compound of formula (I) or a pharmaceutically acceptable salt thereof.

[0052] Use of a compound of formula (I) or a pharmaceutically acceptable salt thereof in the treatment or prevention of diseases associated with excessive release of inflammatory factors, or in the preparation of a medicament for the treatment or prevention of diseases associated with excessive release of inflammatory factors. Use of a compound of formula (I) or a pharmaceutically acceptable salt thereof in the treatment or prevention of diseases associated with excessive release of inflammatory factors. A method of treating or preventing diseases associated with excessive release of inflammatory factors is provided, comprising administering a compound of formula (I) or a pharmaceutically acceptable salt thereof.

[0053] Use of a compound of formula (I) or a pharmaceutically acceptable salt thereof in inhibiting the cGAS-STING pathway or treating diseases associated with the cGAS-STING pathway, or in the preparation of a medicament for inhibiting the cGAS-STING pathway or treating diseases associated with the cGAS-STING pathway. Use of a compound of formula (I) or a pharmaceutically acceptable salt thereof in inhibiting the cGAS-STING pathway or treating diseases associated with the cGAS-STING pathway. A method of inhibiting the cGAS-STING pathway or treating diseases associated with the cGAS-STING pathway is provided, comprising administering a compound of formula (I) or a pharmaceutically acceptable salt thereof.

[0054] In some implementations, the inflammation may be gastritis, appendicitis, bursitis, duodenitis, jejunitis, ileitis, colitis, cystitis, dermatitis, epididymitis, encephalitis, gingivitis, meningitis, myelitis, myocarditis, nephritis, neuritis, pancreatitis, periodontitis, pharyngitis, phlebitis, prostatitis, rhinitis, sinusitis, tendinitis, tonsillitis, urethritis, vasculitis, vaginitis, keratitis, conjunctivitis, otitis media, pneumonia, hepatitis (e.g., viral hepatitis, such as hepatitis A, hepatitis B, hepatitis C, hepatitis D, hepatitis E, or hepatitis G), endometritis, cervicitis, pelvic inflammatory disease, paronychia, osteoarthritis, inflammation caused by acute kidney injury, or autoinflammatory or autoimmune diseases.

[0055] In some implementations, the inflammatory cytokine is IL-6, TNF-α, or type I interferon, especially IL-6. Example

[0056] Compound Synthesis

[0057] Compound A reacts with compound B to give compound C (compound (I)), as shown in reaction (1).

[0058] (1)

[0059] Among them, the R of compound A and compound B can be selected according to the specific compound C to be synthesized. 1 R 2 R 3 R 4 and R 5 Group.

[0060] The synthesis of the compound can be carried out in the presence of a catalyst. The catalyst can be a chiral thiourea catalyst derived from cinchona bark, such as 1-(3,5-bis(trifluoromethyl)phenyl)-3-((1S)-(6-methoxyquinoline-4-yl)(5-vinylquinoline-2-yl)methyl)thiourea or 3-((3,5-bis(trifluoromethyl)phenyl)amino)-4-(((1S)-(6-methoxyquinoline-4-yl)(5-vinylquinoline-2-yl)methyl)amino)cyclobut-3-ene-1,2-dione.

[0061] The synthesis of the compound can be carried out in the presence of a base. The base can be selected from sodium carbonate, potassium carbonate, sodium bicarbonate, potassium bicarbonate, cesium carbonate, and triethylamine, as well as combinations thereof.

[0062] The synthesis of compounds can be carried out in the presence of molecular sieves. The molecular sieves can be 3A, 4A, 5A, 10Z, or Y-type molecular sieves.

[0063] The synthesis of the compound can be carried out in the presence of a solvent. The solvent may be selected from aliphatic hydrocarbon solvents, aromatic hydrocarbon solvents, haloalkanes solvents, alcohol solvents, ester solvents, ketone solvents, sulfoxide solvents, amide solvents, nitrile solvents, and heterocyclic solvents, as well as combinations thereof, particularly from chloroform, dichloromethane, ethyl acetate, toluene, and acetonitrile, as well as combinations thereof.

[0064] The preparation of the compound can be referred to Chinese Patent Application Publication CN 115028573 A, published on September 9, 2022, and Na Wang, published on November 15, 2022. et al. , Org. Lett. 2022, 24, 8553–8558, and may be modified as necessary based on these prior disclosures. All of these prior disclosures are incorporated herein by reference.

[0065] This application synthesized several compounds C, such as those shown in Table 1, wherein R is indicated. 1 The positions of the groups forming the indoline ring in compound C are indicated by the conventional numbering of the atoms on the indoline ring. For example, R in Table 1 1 The "5-fluorine" designation indicates that there is a fluorine substituent on the 5th carbon of the indoline ring in compound C. In some embodiments, X is chlorine or bromine.

[0066] Table 1

[0067] compound <![CDATA[R 1 ]]> <![CDATA[R 2 ]]> <![CDATA[R 3 ]]> <![CDATA[R 4 ]]> <![CDATA[R 5 ]]> C0 hydrogen propargyl Phenyl benzoyl cyano C1 hydrogen methyl Phenyl benzoyl cyano C2 hydrogen methyl Phenyl 2-Methylbenzoyl cyano C3 hydrogen methyl Phenyl 3-Fluorobenzoyl cyano C4 hydrogen methyl Phenyl Thiophene-3-formyl cyano C5 hydrogen methyl Phenyl Neopentanoyl cyano C6 hydrogen methyl 3-Methylphenyl benzoyl cyano C7 hydrogen methyl 4-Chlorophenyl benzoyl cyano C8 hydrogen methyl 3-Chlorophenyl benzoyl cyano C9 hydrogen methyl 4-(trifluoromethyl)-phenyl benzoyl cyano C10 hydrogen methyl 3,4-Dichlorophenyl benzoyl cyano C11 hydrogen methyl 1-Naphthyl benzoyl cyano C12 5-Methoxy methyl Phenyl benzoyl cyano C13 5-Fluorine methyl Phenyl benzoyl cyano C14 6-Chloro methyl Phenyl benzoyl cyano C15 hydrogen hydrogen Phenyl benzoyl cyano C16 hydrogen Ethyl Phenyl benzoyl cyano C17 hydrogen benzyl Phenyl benzoyl cyano C18 hydrogen Ethyl Phenyl <![CDATA[Indene-1,3(2H)-dione-2,2-ylidene (together with R 5 )]]> C19 hydrogen methyl Phenyl cyano cyano C20 hydrogen methyl 3,4-Dichlorophenyl 3-Fluorobenzoyl cyano C21 hydrogen methyl 4-Chlorophenyl 3-Fluorobenzoyl cyano C22 hydrogen methyl 4-Bromophenyl 3-Fluorobenzoyl cyano C23 hydrogen methyl 3,5-Dichlorophenyl 3-Fluorobenzoyl cyano C24 hydrogen Phenyl Phenyl benzoyl cyano C25 hydrogen Allyl Phenyl benzoyl cyano C26 hydrogen propargyl 3,4-Dichlorophenyl 3-Fluorobenzoyl cyano C27 hydrogen methyl 3-Fluorophenyl 3-Fluorobenzoyl cyano C28 7-Fluorine methyl 3,4-Dichlorophenyl 3-Fluorobenzoyl cyano C29 7-Methoxy methyl 3,4-Dichlorophenyl 3-Fluorobenzoyl cyano C30 hydrogen methyl 3-Chloro-4-(trifluoromethyl)phenyl 3-Fluorobenzoyl cyano C31 hydrogen methyl 3-Chloro-4-(trifluoromethyl)phenyl 3-(trifluoromethyl)benzoyl cyano C32 hydrogen methyl 2-Isopropylphenyl benzoyl cyano C33 hydrogen Isopropyl Phenyl benzoyl cyano C34 hydrogen methyl Phenyl ethoxycarbonyl cyano C35 hydrogen methyl Phenyl cyano cyano C36 hydrogen methyl furan-2-yl benzoyl cyano C37 hydrogen methyl Phenyl tert-Butoxycarbonyl cyano C38 hydrogen methyl 2,4,5-Trifluorophenyl 3-(trifluoromethyl)benzoyl cyano

[0068] Some of the representative compound structures are shown below.

[0069] C1 C3 C18 C20 C21 C22 C23 C0

[0070] The following illustrates the specific preparation methods for some of the compounds in this application. Those skilled in the art should be able to deduce and implement the specific preparation methods for the compounds in the various embodiments of this application by analogy with the specific preparation methods below and the prior disclosures mentioned above.

[0071] Preparation of compound C1 (Example 1)

[0072] 0.01 mmol of 1-(3,5-bis(trifluoromethyl)phenyl)-3-((1S)-(6-methoxyquinoline-4-yl)(5-vinylquininyl-2-yl)methyl)thiourea, 10 mg of 4A molecular sieve, potassium carbonate, 0.1 mmol of 3-chloro-1-methylindol-2-one (compound A1) and 0.13 mmol of (E)-2-benzoyl-3-phenylacrylonitrile (compound B1) were dissolved in 3 mL of chloroform and the reaction was carried out with stirring at room temperature.

[0073] After the reaction was monitored to be complete by thin-layer chromatography (TLC), the reaction solution was concentrated by rotary evaporation. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 10:1 to 5:1) to give 34 mg of white solid, which was compound C1. Yield: 91%.

[0074] 1H NMR (600MHz, CDCl3) δ 7.74(d, J=7.6Hz, 2H), 7.55–7.50(m, 1H), 7.41–7.34(m, 7H), 7.28(d, J=7.8Hz, 1H), 6.94(d, J=7.9Hz, 1H), 6.88(t, J=7.7Hz,1H), 6.77(d, J=7.7Hz, 1H), 4.41(s, 1H), 3.41(s, 3H).

[0075] 13 C NMR (151MHz, CDCl3) δ 187.19, 167.70, 143.97, 134.64, 134.20,133.99, 129.52, 129.48, 129.43, 129.36, 129.25, 128.86, 128.62, 128.39,122.70, 122.22, 121.49, 114.07, 108.71, 42.16, 39.56, 37.80, 27.12.

[0076] HRMS (ESI) m / z: C 25 H 18 N₂NaO₂, [M+Na] + Calculated value: 401.1261; Actual value: 401.1243.

[0077] Preparation of compound C2 (Example 2)

[0078] 0.01 mmol of 1-(3,5-bis(trifluoromethyl)phenyl)-3-((1S)-(6-methoxyquinoline-4-yl)(5-vinylquininyl-2-yl)methyl)thiourea, 10 mg of 4A molecular sieve, potassium carbonate, 0.1 mmol of 3-chloro-1-methylindol-2-one (compound A2) and 0.13 mmol of (E)-2-(2-methylbenzoyl)-3-phenylacrylonitrile (compound B2) were dissolved in 3 mL of chloroform and the reaction was carried out with stirring at room temperature.

[0079] After the reaction was monitored to be complete by thin-layer chromatography (TLC), the reaction solution was concentrated by rotary evaporation. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 10:1 to 5:1) to give 36 mg of white solid, which was compound C2. Yield: 91%.

[0080] 1H NMR (600MHz, CDCl3) δ 7.41(q, J=7.9, 7.5Hz, 4H), 7.38–7.32(m, 3H), 7.28–7.25(m, 1H), 7.10(d, J=6.6Hz, 2H), 7.00(d, J=7.9Hz, 1H), 6.96(t, J=7.6Hz, 1H), 6.92(d, J=7.5Hz, 1H), 4.50(s, 1H), 3.41(s, 3H), 2.55(s, 3H).

[0081] 13 C NMR (151MHz, CDCl3) δ 188.89, 167.61, 144.11, 139.91, 134.10,133.02, 132.23, 129.57, 129.51, 129.27, 128.60, 128.34, 125.94, 122.79,122.48, 122.15, 114.21, 108.72, 43.53, 41.57, 38.02, 29.70, 29.03, 27.12,20.83.

[0082] HRMS (ESI) m / z: C 26 H 20 N₂NaO₂, [M+Na] + Calculated value: 415.1417; Actual value: 415.1400.

[0083] Preparation of compound C3 (Example 3)

[0084] 0.01 mmol of 1-(3,5-bis(trifluoromethyl)phenyl)-3-((1S)-(6-methoxyquinoline-4-yl)(5-vinylquininyl-2-yl)methyl)thiourea, 10 mg of 4A molecular sieve, potassium carbonate, 0.1 mmol of 3-chloro-1-methylindol-2-one (compound A2) and 0.13 mmol of (E)-2-(3-fluorobenzoyl)-3-phenylacrylonitrile (compound B3) were dissolved in 3 mL of chloroform and the reaction was carried out with stirring at room temperature.

[0085] After the reaction was monitored to be complete by thin-layer chromatography (TLC), the reaction solution was concentrated by rotary evaporation. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 10:1 to 5:1) to give 33 mg of white solid, which was compound C3. Yield: 83%.

[0086] 1H NMR (600MHz, CDCl3) δ 7.49 (d, J = 7.7 Hz, 1H), 7.45 (d, J = 8.8Hz, 1H), 7.40 (d, J = 3.8 Hz, 4H), 7.38 – 7.35 (m, 1H), 7.35 – 7.32 (m, 1H),7.30 (t, J = 7.8 Hz, 1H), 7.25 – 7.21 (m, 1H), 6.96 (d, J = 7.8 Hz, 1H), 6.90(t, J = 7.6 Hz, 1H), 6.75 (d, J = 7.6 Hz, 1H), 4.41 (s, 1H), 3.41 (s, 3H).

[0087] 13 C NMR (151MHz, CDCl3) δ 186.2 (d, 4JC-F = 2.3 Hz), 167.5, 162.5 (d,1JC-F = 249.5 Hz), 144.0, 135.9 (d, 3JC-F = 6.7 Hz), 130.7 (d, 3JC-F = 7.6Hz), 129.6, 129.5, 129.1, 128.7, 128.5, 125.0 (d, 4JC-F = 3.1 Hz), 122.8,121.8 (d, 2JC-F = 21.4 Hz), 121.4, 115.9 (d, 2JC-F = 22.8 Hz), 113.8, 108.9, 42.3, 39.6, 37.8, 27.2, 22.7.

[0088] HRMS (ESI) m / z: C 25 H 17 FN2NaO2, [M+Na] + Calculated value: 419.1166; Actual value: 419.1150.

[0089] Preparation of compound C5 (Example 5)

[0090] 0.01 mmol of 1-(3,5-bis(trifluoromethyl)phenyl)-3-((1S)-(6-methoxyquinoline-4-yl)(5-vinylquininyl-2-yl)methyl)thiourea, 10 mg of 4A molecular sieve, potassium carbonate, 0.1 mmol of 3-chloro-1-methylindol-2-one (compound A5) and 0.13 mmol of (E)-2-neovaleryl-3-phenylacrylonitrile (compound B5) were dissolved in 3 mL of chloroform and the reaction was carried out with stirring at room temperature.

[0091] After the reaction was monitored to be complete by thin-layer chromatography (TLC), the reaction solution was concentrated by rotary evaporation. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 10:1 to 5:1) to give 30 mg of white solid, which was compound C5. Yield: 85%.

[0092] 1 H NMR (600MHz, CDCl3) δ 7.37(dd, J=13.3, 7.2Hz, 3H), 7.33(t, J=7.0Hz, 3H), 7.03(s, 1H), 6.97(d, J=7.8Hz, 1H), 6.75(d, J=7.6Hz, 1H), 4.29(s, 1H), 3.33(s, 3H), 1.11(s, 9H).

[0093] 13 C NMR (151MHz, CDCl3) δ 200.86, 167.53, 144.35, 130.19, 129.66,129.51, 129.39, 129.25, 128.66, 128.54, 128.24, 125.37, 122.36, 122.31,122.03, 114.03, 108.65, 45.54, 41.68, 40.11, 37.50, 29.69, 27.36, 27.01,26.53, 26.11, 1.03.

[0094] HRMS (ESI) m / z: C 23 H 22 N₂NaO₂, [M+Na] + Calculated value: 381.1574; Actual value: 381.1559.

[0095] Preparation of compound C6 (Example 6)

[0096] 0.01 mmol of 1-(3,5-bis(trifluoromethyl)phenyl)-3-((1S)-(6-methoxyquinoline-4-yl)(5-vinylquininylcyclo-2-yl)methyl)thiourea, 10 mg of 4A molecular sieve, potassium carbonate, 0.1 mmol of 3-chloro-1-methylindol-2-one (compound A6) and 0.13 mmol of (E)-2-benzoyl-3-(3-methylphenyl)acrylonitrile (compound B6) were dissolved in 3 mL of chloroform and the reaction was carried out with stirring at room temperature.

[0097] After the reaction was monitored to be complete by thin-layer chromatography (TLC), the reaction solution was concentrated by rotary evaporation. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 10:1 to 5:1) to give 37 mg of white solid, which was compound C6. Yield: 94%.

[0098] 1 H NMR (600MHz, CDCl3) δ 7.75–7.71(m, 2H), 7.51(t, J=7.5Hz, 1H), 7.35(t, J=7.7Hz, 2H), 7.26(dt, J=7.4, 3.9Hz, 2H), 7.19(d, J=9.1Hz, 2H), 7.15(d, J=7.6Hz, 1H), 6.94(d, J=7.8Hz, 1H), 6.87(t, J=7.7Hz, 1H), 6.76(d, J=7.6Hz,1H), 4.36(s, 1H), 3.40(s, 3H), 2.35(s, 3H).

[0099] 13 C NMR (151MHz, CDCl3) δ 187.29, 167.69, 143.99, 138.26, 134.61,134.41, 134.03, 130.15, 129.40, 129.25, 129.22, 128.85, 128.47, 126.47,122.65, 122.30, 121.45, 114.10, 108.70, 42.19, 39.54, 37.81, 29.70, 29.46,29.37, 29.27, 29.08, 27.12, 21.45, 21.07.

[0100] HRMS (ESI) m / z: C 26 H 20 N₂NaO₂, [M+Na] + Calculated value: 415.1399; Actual value: 415.1417.

[0101] Preparation of compound C11 (Example 11)

[0102] 0.01 mmol of 1-(3,5-bis(trifluoromethyl)phenyl)-3-((1S)-(6-methoxyquinoline-4-yl)(5-vinylquininyl-2-yl)methyl)thiourea, 10 mg of 4A molecular sieve, potassium carbonate, 0.1 mmol of 3-chloro-1-methylindol-2-one (compound A11) and 0.13 mmol of (E)-2-benzoyl-3-(1-naphthyl)acrylonitrile (compound B11) were dissolved in 3 mL of chloroform and the reaction was carried out with stirring at room temperature.

[0103] After the reaction was monitored to be complete by thin-layer chromatography (TLC), the reaction solution was concentrated by rotary evaporation. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 10:1 to 5:1) to give 40 mg of a pale yellow solid, which was compound C11. Yield: 92%.

[0104] 1 H NMR (600MHz, CDCl3) δ 7.96(s, 1H), 7.87(s, 3H), 7.78(d, J=7.6Hz,2H), 7.53(s, 1H), 7.49(d, J=3.2Hz, 2H), 7.45(d, J=8.4Hz, 1H), 7.38(d, J=7.8Hz, 2H), 7.29(s, 1H), 6.97(d, J=7.9Hz, 1H), 6.91(d, J=7.6Hz, 1H), 6.83(d,J=7.6Hz, 1H), 4.57(s, 1H), 3.42(s, 3H).

[0105] 13C NMR (151MHz, CDCl3) δ 187.28, 167.72, 144.05, 134.70, 134.02,133.82, 133.22, 133.07, 130.02, 129.53, 129.29, 128.98, 128.91, 128.39,128.13, 127.93, 127.76, 126.87, 126.41, 126.29, 122.74, 122.22, 121.53,114.18, 108.82, 42.29, 39.73, 37.89, 35.77, 31.95, 29.73, 29.55, 29.40, 29.35, 29.28, 29.21, 29.16, 27.17, 25.61, 25.50, 24.98, 22.73, 14.19.

[0106] HRMS (ESI) m / z: C 29 H 20 N₂NaO₂, [M+Na] + Calculated value: 451.1417; Actual value: 451.1397.

[0107] Preparation of compound C12 (Example 12)

[0108] 0.01 mmol of 1-(3,5-bis(trifluoromethyl)phenyl)-3-((1S)-(6-methoxyquinoline-4-yl)(5-vinylquininyl-2-yl)methyl)thiourea, 10 mg of 4A molecular sieve, potassium carbonate, 0.1 mmol of 3-chloro-5-methoxy-1-methylindol-2-one (compound A12) and 0.13 mmol of (E)-2-benzoyl-3-phenylacrylonitrile (compound B12) were dissolved in 3 mL of chloroform and the reaction was carried out with stirring at room temperature.

[0109] After the reaction was monitored to be complete by thin-layer chromatography (TLC), the reaction solution was concentrated by rotary evaporation. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 10:1 to 5:1) to give 35 mg of a pale yellow solid, which was compound C12. Yield: 86%.

[0110] 1H NMR (600MHz, CDCl3) δ 7.76(d, J=7.8Hz, 2H), 7.53(s, 1H), 7.38(dd, J=16.9, 7.1Hz, 7H), 6.84(d, J=8.5Hz, 1H), 6.80(d, J=2.2Hz, 1H), 6.39(d, J=2.1Hz, 1H), 4.36(s, 1H), 3.64(s, 3H), 3.38(s, 3H).

[0111] 13 C NMR (151MHz, CDCl3) δ 187.17, 167.48, 155.77, 137.43, 134.66,134.05, 129.52, 129.41, 129.28, 128.88, 128.61, 128.37, 123.38, 114.23,114.08, 109.19, 108.63, 55.74, 42.37, 39.60, 37.95, 29.70, 29.60, 29.45,29.36, 29.26, 29.08, 27.18, 26.71.

[0112] HRMS (ESI) m / z: C 26 H 20 N₂NaO₃, [M+Na] + Calculated value: 431.1366; Actual value: 431.1347.

[0113] Preparation of compound C13 (Example 13)

[0114] 0.01 mmol of 1-(3,5-bis(trifluoromethyl)phenyl)-3-((1S)-(6-methoxyquinoline-4-yl)(5-vinylquininyl-2-yl)methyl)thiourea, 10 mg of 4A molecular sieve, potassium carbonate, 0.1 mmol of 3-chloro-5-fluoro-1-methylindol-2-one (compound A13) and 0.13 mmol of (E)-2-benzoyl-3-phenylacrylonitrile (compound B13) were dissolved in 3 mL of chloroform and the reaction was carried out with stirring at room temperature.

[0115] After the reaction was monitored to be complete by thin-layer chromatography (TLC), the reaction solution was concentrated by rotary evaporation. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 10:1 to 5:1) to give 29 mg of white solid, which was compound C13. Yield: 73%.

[0116] 1H NMR (600MHz, CDCl3) δ 7.77(d, J=7.7Hz, 2H), 7.56(t, J=7.4Hz, 1H), 7.39(d, J=6.3Hz, 7H), 6.98(td, J=8.8, 2.3Hz, 1H), 6.87(dd, J=8.5, 4.1Hz, 1H), 6.56(dd, J=8.2, 2.2Hz, 1H), 4.38(s, 1H), 3.39(s, 3H).

[0117] 13 C NMR (151MHz, CDCl3) δ 186.86, 167.43, 159.61, 158.01, 140.00,139.99, 134.84, 133.86, 129.47, 129.29, 129.02, 128.94, 128.67, 128.52,123.79, 123.74, 115.94, 115.78, 113.81, 110.07, 109.90, 109.30, 109.25,42.05, 42.04, 39.72, 38.18, 29.69, 29.66, 29.59, 29.44, 29.36, 29.25, 29.06, 27.25.

[0118] HRMS (ESI) m / z: C 25 H 17 FN2NaO2, [M+Na] + Calculated value: 419.1166; Actual value: 419.1150.

[0119] Preparation of compound C14 (Example 14)

[0120] 0.01 mmol of 1-(3,5-bis(trifluoromethyl)phenyl)-3-((1S)-(6-methoxyquinoline-4-yl)(5-vinylquininylcyclo-2-yl)methyl)thiourea, 10 mg of 4A molecular sieve, potassium carbonate, 0.1 mmol of 3,6-dichloro-1-methylindol-2-one (compound A14) and 0.13 mmol of (E)-2-benzoyl-3-phenylacrylonitrile (compound B14) were dissolved in 3 mL of chloroform and the reaction was carried out with stirring at room temperature.

[0121] After the reaction was monitored to be complete by thin-layer chromatography (TLC), the reaction solution was concentrated by rotary evaporation. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 10:1 to 5:1) to give 27 mg of white solid, which was compound C14. Yield: 65%.

[0122] 1 H NMR (600MHz, CDCl3) δ 7.74(d, J=7.6Hz, 2H), 7.56(s, 1H), 7.39(dd, J=9.7, 5.9Hz, 7H), 6.94(s, 1H), 6.86(d, J=8.2Hz, 1H), 6.69(d, J=8.2Hz, 1H), 4.40(s, 1H), 3.38(s, 3H).

[0123] 13 C NMR (151MHz, CDCl3) δ 186.98, 167.60, 145.10, 135.53, 134.86,133.86, 129.46, 129.23, 129.01, 128.98, 128.68, 128.52, 122.61, 122.50,120.58, 113.82, 109.51, 41.83, 39.66, 37.89, 29.70, 27.23, 1.02.

[0124] HRMS (ESI) m / z: C 25 H 17 ClN2NaO2, [M+Na] + Calculated value: 435.0871; Actual value: 435.0853.

[0125] Preparation of compound C15 (Example 15)

[0126] 0.01 mmol of 1-(3,5-bis(trifluoromethyl)phenyl)-3-((1S)-(6-methoxyquinoline-4-yl)(5-vinylquininyl-2-yl)methyl)thiourea, 10 mg of 4A molecular sieve, potassium carbonate, 0.1 mmol of 3-chloroindol-2-one (compound A15) and 0.13 mmol of (E)-2-benzoyl-3-phenylacrylonitrile (compound B15) were dissolved in 3 mL of chloroform and the reaction was carried out with stirring at room temperature.

[0127] After the reaction was monitored to be complete by thin-layer chromatography (TLC), the reaction solution was concentrated by rotary evaporation. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 10:1 to 5:1) to give 24 mg of white solid, which was compound C15. Yield: 66%.

[0128] 1 H NMR (600MHz, CDCl3) δ 8.04(s, 1H), 7.81–7.77(m, 2H), 7.57(tt, J=7.4, 1.3Hz, 1H), 7.44–7.35(m, 6H), 7.28(ddd, J=6.9, 3.0, 1.1Hz, 2H), 7.02(d,J=7.8Hz, 1H), 6.98(td, J=7.8, 1.1Hz, 1H), 6.47(d, J=7.6Hz, 1H), 4.27(s, 1H).

[0129] 13 C NMR (151MHz, CDCl3) δ 185.51, 171.35, 140.67, 134.60, 133.04,130.21, 129.51, 129.11, 129.05, 128.85, 128.82, 128.69, 125.80, 122.70,120.38, 114.29, 110.41, 43.22, 38.82, 37.39, 31.91, 29.69, 23.08, 14.13.

[0130] HRMS (ESI) m / z: C 24 H 16 N₂NaO₂, [M+Na] + Calculated value: 387.1104; Actual value: 387.1089.

[0131] Preparation of compound C16 (Example 16)

[0132] 0.01 mmol of 1-(3,5-bis(trifluoromethyl)phenyl)-3-((1S)-(6-methoxyquinoline-4-yl)(5-vinylquininyl-2-yl)methyl)thiourea, 10 mg of 4A molecular sieve, potassium carbonate, 0.1 mmol of 3-chloro-1-ethylindol-2-one (compound A16) and 0.13 mmol of (E)-2-benzoyl-3-phenylacrylonitrile (compound B16) were dissolved in 3 mL of chloroform and the reaction was carried out with stirring at room temperature.

[0133] After the reaction was monitored to be complete by thin-layer chromatography (TLC), the reaction solution was concentrated by rotary evaporation. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 10:1 to 5:1) to give 33 mg of white solid, which was compound C16. Yield: 84%.

[0134] 1 H NMR (600MHz, CDCl3) δ 7.72(d, J=7.7Hz, 2H), 7.52(s, 1H), 7.39(d, J=3.9Hz, 4H), 7.35(t, J=7.7Hz, 3H), 7.26(d, J=4.0Hz, 1H), 6.95(d, J=7.9Hz, 1H),6.86(d, J=7.6Hz, 1H), 6.76(d, J=7.6Hz, 1H), 4.38(s, 1H), 3.96(q, J=7.2Hz,2H), 1.38(t, J=7.2Hz, 3H).

[0135] 13 C NMR (151MHz, CDCl3) δ 186.73, 166.83, 142.14, 134.82, 133.88,129.46, 129.35, 129.24, 129.00, 128.92, 128.66, 128.52, 127.96, 124.13,122.23, 113.68, 109.69, 41.65, 39.94, 38.13, 36.07, 29.69, 12.85, 1.01.

[0136] HRMS (ESI) m / z: C 26 H 20 N₂NaO₂, [M+Na] + Calculated value: 415.1417; Actual value: 415.1400.

[0137] Preparation of compound C17 (Example 17)

[0138] 0.01 mmol of 1-(3,5-bis(trifluoromethyl)phenyl)-3-((1S)-(6-methoxyquinoline-4-yl)(5-vinylquininyl-2-yl)methyl)thiourea, 10 mg of 4A molecular sieve, potassium carbonate, 0.1 mmol of 3-chloro-1-benzylindol-2-one (compound A17) and 0.13 mmol of (E)-2-benzoyl-3-phenylacrylonitrile (compound B17) were dissolved in 3 mL of chloroform and the reaction was carried out with stirring at room temperature.

[0139] After the reaction was monitored to be complete by thin-layer chromatography (TLC), the reaction solution was concentrated by rotary evaporation. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 10:1 to 5:1) to give 32 mg of a pale yellow-white solid, which was compound C17. Yield: 71%.

[0140] 1 H NMR (600MHz, CDCl3) δ 7.72–7.66(m, 2H), 7.52(td, J=7.5, 1.3Hz, 1H), 7.44–7.37(m, 9H), 7.34(td, J=5.9, 2.3Hz, 1H), 7.30(t, J=7.8Hz, 2H), 7.25(s,1H), 7.12(dd, J=8.4, 2.0Hz, 1H), 6.78(dd, J=8.4, 1.6Hz, 1H), 6.73(d, J=2.0Hz,1H), 5.18(d, J=15.4Hz, 1H), 4.92(d, J=15.4Hz, 1H), 4.40(s, 1H).

[0141] 13 C NMR (151MHz, CDCl3) δ 186.63, 167.40, 141.50, 135.39, 134.84,133.78, 129.51, 129.36, 129.24, 129.06, 128.92, 128.91, 128.71, 128.59,128.24, 128.19, 127.63, 123.86, 122.10, 122.08, 113.67, 110.58, 44.44, 41.71,40.16, 38.06, 29.70, 1.02.

[0142] HRMS (ESI) m / z: C 31 H 22 N₂NaO₂, [M+Na] + Calculated value: 477.1574; Actual value: 477.1552.

[0143] Preparation of compound C18 (Example 18)

[0144] 0.01 mmol of 1-(3,5-bis(trifluoromethyl)phenyl)-3-((1S)-(6-methoxyquinoline-4-yl)(5-vinylquininylcyclo-2-yl)methyl)thiourea, 10 mg of 4A molecular sieve, potassium carbonate, 0.1 mmol of 3-chloro-1-ethylindol-2-one (compound A18) and 0.13 mmol of 2-(phenylmethylene)indene-1,3-dione (compound B18) were dissolved in 3 mL of chloroform and the reaction was carried out with stirring at room temperature.

[0145] After the reaction was monitored to be complete by thin-layer chromatography (TLC), the reaction solution was concentrated by rotary evaporation. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 10:1 to 5:1) to give 33 mg of white solid, which was compound C18. Yield: 85%.

[0146] 1 H NMR (600MHz, CDCl3) δ 7.92 (d, J = 7.3 Hz, 1H), 7.88 (d, J = 7.4Hz, 1H), 7.84 (d, J = 7.7 Hz, 1H), 7.75 (dt, J = 18.3, 7.2 Hz, 2H), 7.36 –7.30 (m, 4H), 7.25 (d, J = 6.1 Hz, 2H), 7.11 (t, J = 7.7 Hz, 1H), 6.85 (d, J= 7.8 Hz, 1H), 4.56 (s, 1H), 3.75 (qd, J = 7.1, 3.7 Hz, 2H), 1.22 (t, J = 7.2Hz, 3H).

[0147] 13 C NMR (151MHz, CDCl3) δ 193.4, 188.1, 167.3, 143.4, 143.1, 140.7,135.4, 134.7, 134.7, 130.1, 129.7, 128.8, 128.0, 127.7, 125.4, 124.2, 123.4,122.9, 121.7, 107.8, 50.9, 48.9, 41.7, 35.0, 12.7.

[0148] HRMS (ESI) m / z: C 26 H 19 NNaO3, [M+Na] + Calculated value: 416.1257; Actual value: 416.1241.

[0149] Preparation of compound C20 (Example 20)

[0150] 0.01 mmol of 1-(3,5-bis(trifluoromethyl)phenyl)-3-((1S)-(6-methoxyquinoline-4-yl)(5-vinylquininylcyclo-2-yl)methyl)thiourea, 10 mg of 4A molecular sieve, potassium carbonate, 0.1 mmol of 3-chloro-1-methylindol-2-one (compound A20) and 0.13 mmol of (E)-2-(3-fluorobenzoyl)-3-(3,4-dichlorophenyl)acrylonitrile (compound B20) were dissolved in 3 mL of chloroform and the reaction was carried out with stirring at room temperature.

[0151] After the reaction was monitored to be complete by thin-layer chromatography (TLC), the reaction solution was concentrated by rotary evaporation. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 10:1 to 5:1) to give 28 mg of white solid, which was compound C20. Yield: 60%.

[0152] 1 H NMR (600MHz, CDCl3) δ 7.51 – 7.45 (m, 3H), 7.43 (ddd, J = 8.8, 2.6,1.6 Hz, 1H), 7.36 – 7.31 (m, 1H), 7.31 – 7.27 (m, 2H), 7.25 (ddd, J = 8.2,2.6, 1.0 Hz, 1H), 6.97 (d, J = 7.9 Hz, 1H), 6.90 (td, J = 7.7, 1.0 Hz, 1H), 6.72 (dd, J = 7.7, 1.3 Hz, 1H), 4.30 (d, J = 1.0 Hz, 1H), 3.41 (s, 3H).

[0153] 13C NMR (151MHz, CDCl3) δ 185.7 (d, 4JC-F = 2.4 Hz), 167.2, 162.6 (d,1JC-F = 250.1 Hz), 144.0, 135.7 (d, 3JC-F = 6.5 Hz), 132.9, 132.8, , 131.6,130.7 (d, 3JC-F = 7.9 Hz), 130.7, 129.9, 129.4, 128.8, 125.0 (d, 4JC-F = 2.9Hz), 122.9, 122.0 (d, 2JC-F = 21.6 Hz), 121.4, 121.3, 115.9 (d, 2JC-F = 23.0Hz), 113.3, 109.0, 42.2, 39.4, 36.2, 27.2.

[0154] MS (ESI) m / z:C 25 H 15 ClFN2NaO2, [M+Na] + Calculated value: 487.1; Actual value: 487.4.

[0155] Preparation of compound C21 (Example 21)

[0156] 0.01 mmol of 1-(3,5-bis(trifluoromethyl)phenyl)-3-((1S)-(6-methoxyquinoline-4-yl)(5-vinylquininylcyclo-2-yl)methyl)thiourea, 10 mg of 4A molecular sieve, potassium carbonate, 0.1 mmol of 3-chloro-1-methylindol-2-one (compound A21) and 0.13 mmol of (E)-2-(3-fluorobenzoyl)-3-(4-chlorophenyl)acrylonitrile (compound B21) were dissolved in 3 mL of chloroform and the reaction was carried out with stirring at room temperature.

[0157] After the reaction was monitored to be complete by thin-layer chromatography (TLC), the reaction solution was concentrated by rotary evaporation. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 10:1 to 5:1) to give 29 mg of white solid, which was compound C21. Yield: 69%.

[0158] 1H NMR (600MHz, CDCl3) δ 7.47 (ddd, J = 7.8, 1.6, 1.0 Hz, 1H), 7.44 (ddd, J = 8.8, 2.6, 1.6 Hz, 1H), 7.39 – 7.35 (m, 2H), 7.35 – 7.32 (m, 3H), 7.30 (td, J = 7.8, 1.2 Hz, 1H), 7.24 (tdd, J = 8.2, 2.6, 1.0 Hz, 1H), 6.97 –6.95 (m, 1H), 6.90 (td, J = 7.7, 1.0 Hz, 1H), 6.73 (dd, J = 7.6, 1.2 Hz, 1H), 4.34 (s, 1H), 3.41 (s, 3H).

[0159] 13 C NMR (151MHz, CDCl3) δ 186.0 (d, 4JC-F = 2.3 Hz), 167.4, 162.6 (d,1JC-F = 249.7 Hz), 144.0, 135.8 (d, 3JC-F = 6.5 Hz), 134.6, 130.9, 130.6 (d,3JC-F = 7.9 Hz), 129.7, 128.9, 127.7, 125.0 (d,4JC-F = 3.0 Hz), 121.9 (d,2JC-F = 21.4 Hz), 121.8, 121.6, 121.4, 115.9 (d, 2JC-F = 23.0 Hz), 113.5,108.9, 42.2, 39.6, 37.0, 27.1.

[0160] MS (ESI) m / z:C 25 H 17 ClFN3O2, [M+H] + Calculated value: 431.1; Actual value: 431.4.

[0161] Preparation of compound C22 (Example 22)

[0162] 0.01 mmol of 1-(3,5-bis(trifluoromethyl)phenyl)-3-((1S)-(6-methoxyquinoline-4-yl)(5-vinylquininyl-2-yl)methyl)thiourea, 10 mg of 4A molecular sieve, potassium carbonate, 0.1 mmol of 3-chloro-1-methylindol-2-one (compound A22) and 0.13 mmol of (E)-2-(3-fluorobenzoyl)-3-(4-bromophenyl)acrylonitrile (compound B22) were dissolved in 3 mL of chloroform and the reaction was carried out with stirring at room temperature.

[0163] After the reaction was monitored to be complete by thin-layer chromatography (TLC), the reaction solution was concentrated by rotary evaporation. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 10:1 to 5:1) to give 36 mg of white solid, which was compound C22. Yield: 76%.

[0164] 1 H NMR (600MHz, CDCl3) δ 7.54 – 7.50 (m, 2H), 7.47 (dt, J = 7.8, 1.3Hz, 1H), 7.44 (ddd, J = 8.9, 2.6, 1.7 Hz, 1H), 7.34 (td, J = 8.0, 5.3 Hz,1H), 7.30 (td, J = 7.8, 1.2 Hz, 1H), 7.28 (d, J = 0.9 Hz, 1H), 7.26 (d, J =0.9 Hz, 1H), 7.25 – 7.21 (m, 1H), 6.96 (d, J = 7.9 Hz, 1H), 6.90 (td, J =7.7, 1.0 Hz, 1H), 6.73 (dd, J = 7.7, 1.2 Hz, 1H), 4.32 (s, 1H), 3.41 (s, 3H).

[0165] 13C NMR (151MHz, CDCl3) δ 186.0 (d, 4JC-F = 2.4 Hz), 167.4, 162.6 (d,1JC-F = 249.8 Hz), 144.0, 135.8 (d, 3JC-F = 6.5 Hz), 131.9, 131.2, 130.6 (d,3JC-F = 7.7 Hz), 129.8, 128.2, 125.0 (d, 4JC-F = 3.0 Hz), 122.8, 122.8, 121.9(d, 2JC-F = 21.7 Hz), 121.6, 121.4, 115.9 (d, 2JC-F = 22.7 Hz), 113.5, 108.9,42.2, 39.5, 37.1, 27.1.

[0166] MS (ESI) m / z:C 25 H 16 FN2NaO2, [M+Na] + Calculated value: 497.0; Actual value: 497.4.

[0167] Preparation of compound C23 (Example 23)

[0168] 0.01 mmol of 1-(3,5-bis(trifluoromethyl)phenyl)-3-((1S)-(6-methoxyquinoline-4-yl)(5-vinylquininyl-2-yl)methyl)thiourea, 10 mg of 4A molecular sieve, potassium carbonate, 0.1 mmol of 3-chloro-1-methylindol-2-one (compound A23) and 0.13 mmol of (E)-2-(3-fluorobenzoyl)-3-(3,5-dichlorophenyl)acrylonitrile (compound B23) were dissolved in 3 mL of chloroform and the reaction was carried out with stirring at room temperature.

[0169] After the reaction was monitored to be complete by thin-layer chromatography (TLC), the reaction solution was concentrated by rotary evaporation. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 10:1 to 5:1) to give 31 mg of white solid, which was compound C23. Yield: 67%.

[0170] 1H NMR (600MHz, CDCl3) δ 7.46 (dq, J = 7.9, 1.5, 1.1 Hz, 1H), 7.43 (ddd, J = 8.8, 2.5, 1.6 Hz, 1H), 7.36 (ddd, J = 5.1, 3.8, 2.5 Hz, 1H), 7.34 –7.32 (m, 1H), 7.30 (dt, J = 7.8, 1.6 Hz, 1H), 7.29 – 7.22 (m, 3H), 6.97 (dd,J = 8.0, 2.5 Hz, 1H), 6.90 (ddt, J = 8.6, 7.6, 1.7 Hz, 1H), 6.71 (dt, J =7.9, 1.9 Hz, 1H), 4.29 (qd, J = 1.9, 1.1 Hz, 1H), 3.43 (d, J = 1.9 Hz, 3H).

[0171] 13 C NMR (151MHz, CDCl3) δ 185.6 (d, 4JC-F = 2.4 Hz) 167.0, 162.6 (d,1JC-F = 249.8 Hz), 144.1, 135.7 (d, 3JC-F = 6.5 Hz), 135.2, 132.6, 130.7 (d,3JC-F = 7.7 Hz), 130.0, 128.9, 128.1, 126.1, 125.0 (d, 4JC-F = 3.1 Hz), 122.9, 122.0 (d, 2JC-F = 21.4 Hz), 121.4, 121.2, 115.9 (d, 2JC-F = 22.8 Hz),113.1, 109.0, 42.2, 39.26, 36.1, 27.2.

[0172] MS (ESI) m / z:C 25 H 16 Cl2FN2O2, [M+H] + Calculated value: 465.1; Actual value: 465.3.

[0173] Preparation of compound C32 (Example 32)

[0174] 0.01 mmol of 1-(3,5-bis(trifluoromethyl)phenyl)-3-((1S)-(6-methoxyquinoline-4-yl)(5-vinylquininylcyclo-2-yl)methyl)thiourea, 10 mg of 4A molecular sieve, potassium carbonate, 0.1 mmol of 3-chloro-1-methylindol-2-one (compound A32) and 0.13 mmol of (E)-2-benzoyl-3-(2-isopropylphenyl)acrylonitrile (compound B32) were dissolved in 3 mL of chloroform and the reaction was carried out with stirring at room temperature.

[0175] After the reaction was monitored to be complete by thin-layer chromatography (TLC), the reaction solution was concentrated by rotary evaporation. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 10:1 to 6:1) to give 28 mg of a pale yellow solid, which was compound C32. Yield: 67%.

[0176] 1 H NMR (600 MHz, CDCl3) δ 7.76 (dt, J = 8.4, 1.4 Hz, 2H), 7.58 (td, J= 7.5, 1.4 Hz, 1H), 7.40 (tt, J = 9.7, 5.8 Hz, 5H), 7.31 (d, J = 7.8 Hz, 1H),7.25–7.21 (m, 1H), 7.07–6.96 (m, 2H), 6.51 (d, J = 7.6 Hz, 1H), 4.16 (s, 1H),3.19 (d, J = 1.4 Hz, 3H), 2.73 (p, J = 6.9 Hz, 1H), 1.15 (dd, J = 6.8, 1.3Hz, 3H), 0.71 (dd, J = 6.8, 1.3 Hz, 3H).

[0177] 13 C NMR (151 MHz, CDCl3) δ 192.02, 169.49, 148.21, 139.73, 136.48,136.30, 132.13, 130.04, 129.45, 129.24, 129.14, 128.74, 128.66, 127.66,126.72, 126.38, 126.17, 115.10, 114.46, 55.58, 52.17, 43.56, 31.10, 30.43,24.10.

[0178] HRMS (ESI-TOF) m / z: C 28 H 25N2O2 + [M+H] + Calculated value: 421.1911; Actual value: 421.1913.

[0179] Preparation of compound C33 (Example 33)

[0180] 0.01 mmol of 1-(3,5-bis(trifluoromethyl)phenyl)-3-((1S)-(6-methoxyquinoline-4-yl)(5-vinylquininylcyclo-2-yl)methyl)thiourea, 10 mg of 4A molecular sieve, potassium carbonate, 0.1 mmol of 3-chloro-1-isopropylindol-2-one (compound A33) and 0.13 mmol of (E)-2-benzoyl-3-phenylacrylonitrile (compound B33) were dissolved in 3 mL of chloroform and the reaction was carried out with stirring at room temperature.

[0181] After the reaction was monitored to be complete by thin-layer chromatography (TLC), the reaction solution was concentrated by rotary evaporation. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 10:1 to 7:1) to give 32 mg of yellow solid, which was compound C33. Yield: 79%.

[0182] 1 H NMR (600 MHz, CDCl3) δ 7.73–7.68 (m, 2H), 7.51 (tt, J = 7.3, 1.3Hz, 1H), 7.40–7.37 (m, 4H), 7.36–7.32 (m, 3H), 7.22 (td, J = 7.8, 1.3 Hz,1H), 7.09 (d, J = 8.0 Hz, 1H), 6.84 (td, J = 7.6, 0.9 Hz, 1H), 6.75 (dd, J =7.6, 1.3 Hz, 1H), 4.82 (hept, J = 7.1 Hz, 1H), 4.35 (s, 1H), 0.07 (s, 6H).

[0183] 13 C NMR (151 MHz, CDCl3) δ 192.86, 169.48, 140.61, 138.09, 136.30,132.13, 130.58, 129.52, 129.45, 129.17, 128.81, 128.66, 127.38, 126.35,126.11, 116.72, 113.49, 58.09, 50.74, 47.51, 47.47, 21.74.

[0184] HRMS (ESI-TOF) m / z: C 27 H 23 N2O2 + [M+H] + Calculated value: 407.1754; Actual value: 407.1756.

[0185] Preparation of compound C34 (Example 34)

[0186] 0.01 mmol of 1-(3,5-bis(trifluoromethyl)phenyl)-3-((1S)-(6-methoxyquinoline-4-yl)(5-vinylquininylcyclo-2-yl)methyl)thiourea, 10 mg of 4A molecular sieve, potassium carbonate, 0.1 mmol of 3-chloro-1-methylindol-2-one (compound A34) and 0.13 mmol of (E)-2-cyano-3-phenylacrylate (compound B34) were dissolved in 3 mL of chloroform and the reaction was carried out with stirring at room temperature.

[0187] After the reaction was monitored to be complete by thin-layer chromatography (TLC), the reaction solution was concentrated by rotary evaporation. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 8:1 to 5:1) to give 24 mg of white solid, which was compound C34. Yield: 69%.

[0188] 1 H NMR (600 MHz, CDCl3) δ 7.40–7.32 (m, 4H), 7.24–7.18 (m, 2H), 6.97 (d, J = 7.8 Hz, 1H), 6.89 (td, J = 7.7, 1.0 Hz, 1H), 6.28 (d, J = 7.6 Hz,1H), 4.35 (qt, J = 6.9, 3.5 Hz, 2H), 4.17 (s, 1H), 3.33 (s, 3H), 1.34 (t, J =7.2 Hz, 3H).

[0189] 13 C NMR (151 MHz, CDCl3) δ 172.03, 165.98, 138.05, 136.53, 130.42,129.14, 128.72, 128.65, 127.38, 127.19, 126.53, 115.66, 115.41, 61.51, 55.41,51.54, 47.93, 30.20, 14.04.

[0190] HRMS (ESI-TOF) m / z: C 21 H19 N2O3 + [M+H] + Calculated value: 347.1390; Actual value: 347.1392.

[0191] Preparation of compound C35 (Example 35)

[0192] 0.01 mmol of 1-(3,5-bis(trifluoromethyl)phenyl)-3-((1S)-(6-methoxyquinoline-4-yl)(5-vinylquininylcyclo-2-yl)methyl)thiourea, 10 mg of 4A molecular sieve, potassium carbonate, 0.1 mmol of 3-chloro-1-methylindol-2-one (compound A35) and 0.13 mmol of 2-benzylmalonium (compound B35) were dissolved in 3 mL of chloroform and the reaction was carried out with stirring at room temperature.

[0193] After the reaction was monitored to be complete by thin-layer chromatography (TLC), the reaction solution was concentrated by rotary evaporation. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 10:1 to 5:1) to give 25 mg of white solid, which was compound C35. Yield: 84%.

[0194] 1 H NMR (600 MHz, CDCl3) δ 7.48–7.38 (m, 4H), 7.24–7.19 (m, 2H), 7.04(d, J = 7.9 Hz, 1H), 6.95 (td, J = 7.7, 1.0 Hz, 1H), 6.36–6.27 (m, 1H), 4.05(s, 1H), 3.42 (s, 3H).

[0195] 13 C NMR (151 MHz, CDCl3) δ 169.32, 139.24, 135.76, 129.14, 128.87,128.85, 128.80, 127.44, 126.53, 126.13, 115.31, 113.53, 61.23, 44.57, 39.52,30.40.

[0196] HRMS (ESI-TOF) m / z: C 20 H 13 N3O + [M+H] + Calculated value: 300.1311; Actual value: 300.1313.

[0197] Preparation of compound C36 (Example 36)

[0198] 0.01 mmol of 1-(3,5-bis(trifluoromethyl)phenyl)-3-((1S)-(6-methoxyquinoline-4-yl)(5-vinylquininyl-2-yl)methyl)thiourea, 10 mg of 4A molecular sieve, potassium carbonate, 0.1 mmol of 3-chloro-1-methylindol-2-one (compound A36) and 0.13 mmol of (E)-2-benzoyl-3-(furan-2-yl)acrylonitrile (compound B36) were dissolved in 3 mL of chloroform and the reaction was carried out with stirring at room temperature.

[0199] After the reaction was monitored to be complete by thin-layer chromatography (TLC), the reaction solution was concentrated by rotary evaporation. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 9:1 to 4:1) to give 31 mg of a pale yellow solid, which was compound C36. Yield: 84%.

[0200] 1 H NMR (600 MHz, CDCl3) δ 7.80–7.76 (m, 2H), 7.59 (tt, J = 7.3, 1.3Hz, 1H), 7.49–7.39 (m, 4H), 7.09 (td, J = 7.6, 1.0 Hz, 1H), 6.68 (dt, J =3.4, 1.1 Hz, 1H), 6.45 (dd, J = 3.3, 1.9 Hz, 1H), 4.07 (d, J = 1.3 Hz, 1H), 3.15 (s, 3H).

[0201] 13 C NMR (151 MHz, CDCl3) δ 191.03, 170.60, 148.49, 143.39, 140.28,135.39, 132.13, 129.71, 129.49, 129.14, 128.64, 126.67, 126.53, 115.57,114.25, 113.10, 112.19, 53.72, 52.13, 46.32, 30.49.

[0202] HRMS (ESI-TOF) m / z: C 23 H 17 N2O3 + [M+H] + Calculated value: 369.1234; Actual value: 369.1236.

[0203] Preparation of compound C37 (Example 37)

[0204] 0.01 mmol of 1-(3,5-bis(trifluoromethyl)phenyl)-3-((1S)-(6-methoxyquinoline-4-yl)(5-vinylquininylcyclo-2-yl)methyl)thiourea, 10 mg of 4A molecular sieve, potassium carbonate, 0.1 mmol of 3-chloro-1-methylindol-2-one (compound A37) and 0.13 mmol of (E)-2-cyano-3-phenyl tert-butyl acrylate (compound B37) were dissolved in 3 mL of chloroform and the reaction was carried out with stirring at room temperature.

[0205] After the reaction was monitored to be complete by thin-layer chromatography (TLC), the reaction solution was concentrated by rotary evaporation. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 10:1 to 6:1) to give 27 mg of a pale yellow solid, which was compound C37. Yield: 72%.

[0206] 1 H NMR (600 MHz, CDCl3) δ 7.41–7.30 (m, 6H), 7.05 (td, J = 7.7, 1.1Hz, 1H), 6.95 (d, J = 7.8 Hz, 1H), 5.29 (s, 1H), 4.16 (s, 1H), 3.29 (s, 3H),1.42 (s, 9H).

[0207] 13 C NMR (151 MHz, CDCl3) δ 172.03, 165.38, 138.05, 136.53, 130.42,129.14, 128.74, 128.72, 127.38, 127.19, 126.53, 115.41, 114.53, 81.99, 57.69,54.13, 46.08, 30.20, 28.14.

[0208] HRMS (ESI-TOF) m / z: C 23 H 23 N2O3 + [M+H] + Calculated value: 375.1703; Actual value: 375.1705.

[0209] Preparation of compound C38 (Example 38)

[0210] 0.01 mmol of 1-(3,5-bis(trifluoromethyl)phenyl)-3-((1S)-(6-methoxyquinoline-4-yl)(5-vinylquininyl-2-yl)methyl)thiourea, 10 mg of 4A molecular sieve, triethylenediamine, 0.1 mmol of 3-chloro-1-methylindol-2-one (compound A38) and 0.13 mmol of (E)-2-(3-(trifluoromethyl)benzoyl)-3-(2,4,5-trifluorophenyl)acrylonitrile (compound B38) were dissolved in 3 mL of chloroform and the reaction was carried out with stirring at room temperature.

[0211] After the reaction was monitored to be complete by thin-layer chromatography (TLC), the reaction solution was concentrated by rotary evaporation. The crude product was purified by column chromatography (petroleum ether:ethyl acetate = 10:1 to 5:1) to give 4 g of product, which was compound C38. Yield: 62%.

[0212] 1 H NMR (600 MHz, CDCl3) δ 7.95 (s, 1H), 7.90 - 7.83 (m, 2H), 7.61 -7.55 (m, 1H), 7.54 - 7.47 (m, 1H), 7.26 - 7.20 (m, 1H), 7.13 - 7.06 (m,2H),7.05 - 6.97 (m, 1H), 6.63 (d, J = 7.6 Hz, 1H), 4.05 (s, 1H), 3.17 (s, 3H).

[0213] 13 C NMR (151 MHz, CDCl3) δ 185.7, 167.3, 156.8 (ddd, 1 J C-F = 246.8,9.6, 2.8 Hz), 150.4 (ddd, 1 J C-F = 253.3, 14.2, 12.3 Hz), 146.8 (ddd, 1 J C-F =246.2, 12.6, 3.6 Hz), 144.2, 134.4, 132.0, 131.8 (q, 2 J C-F = 33.3 Hz), 131.0(q, 3 J C-F = 3.5 Hz), 130.1, 129.6, 126.0 (q, 3 J C-F= 4.0 Hz), 123.1 (d, 1 J C-F =272.8 Hz), 122.85, 121.35, 120.86, 118.94 (ddd, 2 J C-F = 20.8, 4.3, 1.5 Hz),113.2 (ddd, 2 J C-F = 27.0, 10.2, 1.8 Hz), 112.9, 109.9, 105.9 (dd, 2 J C-F = 27.3, 21.2 Hz), 41.9 (d, 3 J C-F = 1.7 Hz), 38.8, 30.8, 27.0.

[0214] MS (ESI) m / z:C 26 H 15 F6N2O2, [M+H] + Calculated value: 501.1; Actual value: 501.14.

[0215] Covalent reactivity of compounds

[0216] Covalent reactivity of compounds with amino acids

[0217] Compound C1 was mixed with a nucleophilic amino acid, AcNH–CH2R–COOMe, whose amino group is protected by an acetyl group and whose carboxyl group is protected by a methyl group, in a PBS buffer and dimethyl sulfoxide (DMSO) solution at pH 7.6 and stirred overnight at 37°C. The amino acid can be any one of cysteine, aspartic acid, arginine, lysine, or histidine.

[0218] The results showed that, among the protected amino acids, compound C1 reacted only with protected cysteine ​​(AcNH–CH2(CH2SH)–COOMe), as shown in reaction (2). The product obtained from this reaction was compound D1, with a yield of 62.11%. Compound C1 did not react with protected aspartic acid, protected arginine, protected lysine, or protected histidine.

[0219] (2)

[0220] In reaction (2), the cyclopropane moiety in compound C1 undergoes ring opening and covalently binds to the thiol group of the cysteine ​​moiety. The indoline group in compound C1 bonds to the thiol group of the cysteine ​​moiety to form compound D1, while the other parts of compound C1 act as leaving groups and do not bond to the cysteine ​​moiety.

[0221] Figure 1 (a) is the mass spectrum of compound D1. Figure 1 (b) is compound D1 1 The 1H NMR spectrum and magnified images of several characteristic peaks are shown. It can be seen that the two diastereomers of compound D1 have hydrogen H atoms in one of their chiral centers. A The spectrum shows two characteristic peaks located at 4.31 and 4.42, respectively.

[0222] Covalent binding activity of compounds with amino acids in proteins

[0223] Compound CO(R) at different concentrations 1 For hydrogen, R 2 It is propargyl, R 3 It is a phenyl group, R 4 It is benzoyl, and R 5 The protein was incubated with BSA for 2 hours. Then, the fluorescent group 5-carboxytetramethylrhodamine (TAMRA) was introduced via a click chemistry reaction using azid-5-carboxytetramethylrhodamine (TAMRA-azide). The protein was then separated by SDS-PAGE gel electrophoresis.

[0224] The results of SDS-PAGE are as follows: Figure 2 (a) shows that compound C0 labels BSA in a concentration-dependent manner, producing a relatively clear labeled band at a concentration of 2 µM. Furthermore, the labeled band gradually deepens with increasing compound C0 concentration. This demonstrates the good labeling ability of compound C0 for proteins.

[0225] To further confirm the amino acid selectivity of compound C0, proteomic analysis was performed. Different concentrations of compound C0 were incubated with BSA for 2 hours to label compound C0 with BSA, followed by mass spectrometry analysis by LC-MS / MS. The peptide matching maps are shown in Table 2, and the secondary mass spectrometry results are as follows: Figure 2 As shown in (b), compound C0 can label cysteine ​​at a concentration of 10 µM. Besides cysteine, compound C0 also labeled other nucleophilic amino acids such as aspartic acid, glutamic acid, and lysine, but the labeling sites for these other nucleophilic amino acids were fewer than those for cysteine. Furthermore, secondary mass spectrometry (MS / MS) showed that... Figure 2In (b), the b and y ion peaks can be used to further confirm that the main modification site of compound C0 is a cysteine ​​residue.

[0226] Table 2

[0227] amino acids number of peptides Peptide Matching Map (PSM) Cysteine 24 506 Aspartic acid 11 38 glutamic acid 17 38 Lysine 13 24 other 6 8

[0228] The therapeutic or preventative inflammatory activity of the compound

[0229] Experimental Example 1: Inhibition of Inflammatory Factor Secretion by Primary Mouse Bone Marrow Neutrophils

[0230] Primary mouse bone marrow neutrophils were incubated for 6 hours with 500 ng / mL LPS and different concentrations (0, 1 µM, 5 µM, 25 µM) of compound C1, followed by flow cytometry analysis to detect the release of inflammatory factors. Results are as follows: Figure 3 (a)–(b), where (a) is a flow cytometry plot, and (b) and (c) are the percentages of IL-6 and TNF-α in neutrophils, respectively. Figure 3 (b) and (c) show that compound C1 inhibits the release of IL-6 and TNF-α from LPS-stimulated mouse primary bone marrow neutrophils in a concentration-dependent manner.

[0231] Experimental Example 2: Evaluation of the therapeutic or preventive inflammatory activity of the compound

[0232] The structure-activity relationship of compounds C1–C38 (see Table 1 for details) was studied.

[0233] Primary mouse bone marrow neutrophils were incubated with 500 ng / mL LPS and different concentrations of compound C1–C38 for 6 hours, and the release of inflammatory factors was then detected by ELISA. Results are as follows: Figure 4 As shown.

[0234] from Figure 4 As shown in (a), (b), and (c), compared to the positive control, compounds C1–C38 significantly reduced the release of inflammatory factors; among them, from Figure 4 As shown in (b) and (c), compounds C3, C20, C22, C26, and C29 significantly reduce the release of inflammatory factors. This implies that compounds of formula (I) can reduce the release of inflammatory factors and possess therapeutic or preventative inflammatory activity. The different substituents on the compounds affect their therapeutic or preventative inflammatory activity.

[0235] For example, for compounds of formula (I), the compound exhibits outstanding therapeutic or preventative anti-inflammatory activity when the following conditions are met: R 1Choose from the group consisting of hydrogen, halogen, alkoxy, alkanoyl, alkoxycarbonyl, heteroaryl, and sulfonyl. R 2 Choose free hydrogen, C 1-3 Alkyl, C 1-3 alkenyl, C 1-3 Alkyne group, azide C 1-3 Alkyl, aryl C 1-3 Alkyl and heteroaryl C 1-3 The group consisting of alkyl groups; R 3 It is an unsubstituted or substituted aryl or heteroaryl group, either substituted with halogen, alkyl, aryl, or haloalkyl groups; and R 4 It is a cyano group, or an unsubstituted or halogenated, alkyl, or haloalkyl-substituted fatty acyl group, fatty oxycarbonyl group, aryl carboxyl group, aryl oxycarbonyl group, heteroaryl carboxyl group, heteroaryl oxycarbonyl group, and R 5 It is cyano; or R 4 and R 5 Together they form indene-1,3(2H)-dione-2-idel.

[0236] Furthermore, when R 3 for And / or R 4 for , where X 1 X 2 X 3 X 4 and X 5 Each is independently hydrogen, halogen, or haloalkyl, particularly hydrogen, halogen, or trihalomethyl, wherein the halogen is fluorine, chlorine, bromine, or iodine, particularly fluorine, and X 1 X 2 X 3 X 4 and X 5 In China, especially X 2 X 3 and X 4 In particular, X 2 and X 4 When at least one of the components is not hydrogen, the compound exhibits particularly significant therapeutic or preventative anti-inflammatory activity. When R... 4 When the compound is 3-fluorobenzoyl or 3-(trifluoromethyl)benzoyl, its therapeutic or preventative inflammatory activity is further significantly enhanced.

[0237] On the other hand, from Figure 4As can be further seen in (d), the compound of this application can reduce the release of inflammatory factors even at a low concentration of 50 nM; and at a compound concentration of about 1–5 µM, it can reduce the release of inflammatory factors by at least half, and the degree of reduction in the release of inflammatory factors is more obvious as the compound concentration increases.

[0238] Experimental Example 3: The therapeutic effect of the compound on inflammation caused by acute kidney injury.

[0239] Acute kidney injury (AKI) is a common clinical critical condition characterized by uncontrolled inflammatory response and programmed cell death. Renal ischemia-reperfusion injury (IRI) is caused by insufficient renal perfusion due to various reasons, accompanied by a series of sequential cellular events, including reactive oxygen species release, apoptosis, necrosis, infiltration of inflammatory cells, and release of reactive mediators, leading to tissue damage. It is commonly seen in various types of shock, acute renal artery occlusion, or kidney transplantation and is the most common cause of AKI in clinical practice.

[0240] Experimental animal grouping

[0241] C57BL / 6J mice were randomly divided into four groups: sham surgery group, ischemia-reperfusion injury (IRI) group, ischemia-reperfusion injury + low-dose compound (IRI+L) group, and ischemia-reperfusion injury + high-dose compound (IRI+H) group.

[0242] - Sham group: sham surgery was performed during modeling, and solvent was administered during drug administration.

[0243] - IRI group: The solvent was administered at the time of administration.

[0244] - IRI+L group: The ischemia-reperfusion injury model was established normally, and compound C1 was administered at a dose of 30 mg per kg of mouse body weight.

[0245] - IRI+H group: The ischemia-reperfusion injury model was established normally, and compound C1 was administered at a dose of 60 mg per kg of mouse body weight.

[0246] Animal modeling and drug administration

[0247] A mouse model of acute kidney injury was established by ischemia-reperfusion injury.

[0248] Mice were anesthetized with 1% pentobarbital, and an incision was made in the ventral dorsal region to expose both kidneys. Renal ischemia was induced by bilateral arterial clamping. After 30 minutes of ischemia, the arterial clamps were released, the wound was sutured, and the kidneys were reperfused for 24 hours.

[0249] Mice were given the drug once by gavage immediately after surgery.

[0250] Sample preparation

[0251] Preparation of kidney tissue sections and cryopreserved kidney samples

[0252] The mouse kidneys were removed using sterile scissors and forceps, with the left kidney split open along its midline. One half of the kidney was fixed in 4% paraformaldehyde for 24 hours, then embedded and sectioned. The other half of the kidney was placed in cryovials, frozen in liquid nitrogen for 15 minutes, and then transferred to a freezer at –80 °C as a cryopreserved kidney sample.

[0253] Plasma sample preparation

[0254] After euthanizing the mice, blood was collected from the eyeballs using sterile forceps. After blood collection, the blood was allowed to stand at room temperature for 30 minutes, then centrifuged at 3000 rpm for 15 minutes. The supernatant was collected and stored at –80°C for later use.

[0255] The obtained mouse kidney tissue sections were used in Experiment 3.1, and the plasma samples were used in Experiments 3.2 and 3.3.

[0256] 3.1 Hematoxylin-eosin staining (HE)

[0257] Stain kidney tissue sections with hematoxylin for 14 seconds, then with another hematoxylin solution for 1 minute, and wash with water for 5 minutes. Differentiate with differentiation solution for 3 to 5 seconds, and wash with water for 1 minute. Treat with blue solution for 7 seconds, and wash with water for 20 seconds. Immerse the sections in 95% ethanol for 1 minute, and then stain with eosin solution for 14 seconds.

[0258] The results of hematoxylin-eosin staining of kidney tissue sections from each group of mice are as follows: Figure 5 As shown. Compared with the IRI group, the renal tubular damage and vacuolar degeneration in the kidney tissue of mice in the IRI+L group and the IRI+H group were significantly improved, with the improvement in the IRI+H group being significantly better than that in the IRI+L group.

[0259] 3.2 Creatinine (Scr) Measurement

[0260] The creatinine assay kit was purchased from Nanjing Jiancheng Bioengineering Research Institute Co., Ltd., catalog number: C011-2-1.

[0261] Add 180 µL of enzyme solution A to each of the sample wells (T), standard wells (S), and blank wells (B). Add 6 µL of the sample to be tested to the sample well, 6 µL of the standard to the standard well, and 6 µL of double-distilled water to the blank well. Incubate at 37°C for 5 minutes. Measure the absorbance (OD value) A1 of each group at 546 nm using a microplate reader.

[0262] Then, 60 µL of enzyme solution B was added to each of the sample wells, standard wells, and blank wells, and incubated at 37°C for 5 minutes. The absorbance (OD value) of each group at a wavelength of 546 nm was measured using a microplate reader.

[0263] Calculate ΔA for each group = A2 – K×A1, where K is the dilution factor with a value of 186 / 246.

[0264] Based on the calculated ΔA of the sample well, standard well, and blank well (represented as ΔA respectively) T ΔA S ΔA B ), calculate creatinine concentration (unit: µmol / L): C×(ΔA) T – ΔA B ) / (ΔA S – ΔA B ), where C is the concentration of the standard, i.e., 442 µmol / L.

[0265] The creatinine measurement results of each group of mice are as follows: Figure 6 As shown in (a), serum creatinine levels in the IRI+L and IRI+H groups decreased significantly in a concentration-dependent manner compared to the IRI group. This indicates that the administration of compound (I) significantly improved renal function in mice. Compound (I) is effective in treating or preventing inflammation caused by acute kidney injury.

[0266] 3.3 Blood Urea Nitrogen (BUN) Determination

[0267] The urea nitrogen assay kit was purchased from Nanjing Jiancheng Bioengineering Research Institute Co., Ltd., item number: C013-1-1.

[0268] Add 1 mL of 1 g / L oxime solution and 1 mL of acid working solution to each of the sample wells (T), standard wells (S), and blank wells (B). Add 0.02 mL of the test sample to the sample well, 0.02 mL of 10 mmol / L BUN standard to the standard well, and 0.02 mL of double-distilled water to the blank well. Mix well, incubate in a 100°C water bath for 15 minutes, and immediately cool with tap water. Pipette 200 µL of the reaction solution into a 96-well plate. Measure the absorbance (OD value) A of each group at a wavelength of 520 nm using a microplate reader.

[0269] Based on the calculated A values ​​(denoted as A) for sample wells, standard wells, and blank wells, respectively... T A S A B ), calculate the blood urea nitrogen concentration (unit: mmol / L): C × (A T – A B ) / (A S – AB ), where C is the concentration of the standard, i.e., 10 mmol / L.

[0270] The results of blood urea nitrogen measurement in each group of mice are as follows: Figure 6 As shown in (b), serum urea nitrogen levels in the IRI+L and IRI+H groups decreased significantly in a concentration-dependent manner compared to the IRI group. This indicates that the administration of compound (I) significantly improved renal function in mice. Compound (I) is effective in treating or preventing inflammation caused by acute kidney injury.

[0271] Example 4: Further study on the therapeutic effect of the compound on inflammation caused by acute kidney injury.

[0272] To further investigate the protective effect of compound (I) on the kidneys of AKI mice, the high-dose group (IRI+H group) with better effect was selected for further study on the therapeutic effect on AKI mice.

[0273] Experimental animal grouping

[0274] Based on the grouping in Experiment 3, mice were randomly divided into four groups: sham surgery group, ischemia-reperfusion injury (IRI) group, ischemia-reperfusion injury + low-dose compound (IRI+L) group, and ischemia-reperfusion injury + high-dose compound (IRI+H) group.

[0275] - Sham group: sham surgery was performed during modeling, and solvent was administered during drug administration.

[0276] - Sham+H group: A sham operation was performed during modeling, and compound C1 was administered at a dose of 60 mg per kg of mouse body weight.

[0277] - IRI group: Ischemia-reperfusion injury model was created normally, and solvent was applied during drug administration.

[0278] - IRI+H group: The ischemia-reperfusion injury model was established normally, and compound C1 was administered at a dose of 60 mg per kg of mouse body weight.

[0279] Animal modeling and drug administration, sample preparation

[0280] Same as Example 3.

[0281] The obtained mouse kidney tissue sections were used in Experiment 4.1, and the frozen mouse kidney samples were used in Experiments 4.2 and 4.3.

[0282] 4.1 Hematoxylin-eosin staining (HE)

[0283] The experimental procedure is the same as in Experiment 3.1 above.

[0284] Photographs of the appearance of the kidney tissue of mice in each group are as follows: Figure 7 As shown in (a). Compared to the IRI group, the appearance of the kidney tissue in the IRI+H group of mice was significantly improved, and medullary congestion was significantly reduced. The results of hematoxylin-eosin staining and its magnified local images are shown below. Figure 7 As shown in (b), compared to the IRI group, the IRI+H group showed significant improvement in the appearance of kidney tissue and a marked reduction in medullary congestion; the tubular cell damage, brush border detachment, and intraluminal vacuolar structures observed in the IRI group were also significantly improved in the IRI+H group. This indicates that the compound of formula (I) can effectively treat or prevent inflammation caused by acute kidney injury.

[0285] On the other hand, such as Figure 7 As shown in (a) and (b), there was little difference in the appearance of the kidney tissues of mice in the Sham group and the Sham+H group, and there were no significant changes in the renal tubules within the lumen of the mouse kidney tissues. The compound of formula (I) does not cause damage or other negative effects on the kidneys under normal conditions (i.e., without injury or inflammation).

[0286] 4.2 q-PCR detection of mRNA levels

[0287] The mRNA transcription levels of kidney injury-related markers such as KIM-1 and NGAL, as well as inflammatory factors IL-β, TNF-α, and IL-6, in the serum of mice in each group were detected by qPCR.

[0288] Total RNA extraction

[0289] The Steady Pure Rapid RNA Extraction Kit (Aikerui Biotechnology) was used.

[0290] Cryopreserved mouse kidney samples were transferred to a liquid nitrogen-pre-cooled mortar and ground into powder. 10 mg of the powder was transferred to a 1.5 mL RNase-free centrifuge tube, and 300 μL of Buffer QLS lysis buffer was added. The mixture was vortexed at high speed to ensure complete lysis. The lysed sample was centrifuged at 12000 rpm and 4°C for 5 minutes, and the supernatant was transferred to a new RNase-free centrifuge tube.

[0291] Add an equal volume of anhydrous ethanol to the supernatant, mix thoroughly, and transfer to a Quick-RNA microcolumn. Centrifuge at 12,000 rpm for 2 minutes at room temperature and discard the filtrate. Add 700 μL of Buffer QWB to the microcolumn, centrifuge at 12,000 rpm for 1 minute at room temperature, and discard the filtrate. Attach the microcolumn to a new collection tube and centrifuge at 12,000 rpm for 2 minutes at room temperature. Attach the microcolumn to a new 1.5 mL RNase-free centrifuge tube, add 50 μL of RNase-free water to the center of the adsorption column, incubate at room temperature for 3 minutes, and centrifuge at 12,000 rpm for 2 minutes to obtain the eluted RNA. Measure the total RNA concentration using NanoDrop.

[0292] Reverse transcription

[0293] The Evo M-MLV reverse transcription premixed kit (Aikerui Biotechnology) was used.

[0294] Add 2 µL of gDNA Clean Reaction Mix Ver. 2 and 4 µL of 5X Evo M-MLV RTReaction Mix Ver. 2, and add RNase-free water to a final volume of 20 µL to prepare the reaction solution. Perform reverse transcription using a PCR instrument: 37°C for 15 minutes; 85°C for 5 seconds; maintain at 4°C. After reverse transcription, determine the cDNA concentration using NanoDrop.

[0295] qPCR

[0296] The SYBR Green Pro Taq HS premixed qPCR kit (Aikerui Biotechnology) was used.

[0297] Add 10 µL of 2× SYBR Green Pro Taq HS Premix (final concentration 1×), ≤ 100 ng of DNA template, 0.4 µL of 10 µM forward primer (final concentration 0.2 µM), 0.4 µL of 10 µM reverse primer (final concentration 0.2 µM), and 0.4 µL of 4 µM ROX reference dye (final concentration 0.08 µM), and add RNase-free water to a final volume of 20 µL to prepare the PCR reaction solution. The sequences (5′–3′) of each primer are as follows: IL-1β forward primer: TGCCACCTTTTGACAGTGATG (SEQ ID NO: 1) IL-1β reverse primer: TGATGTGCTGCTGCGAGATT (SEQ ID NO: 2) IL-6 forward primer: GACAAAGCCAGAGTCCTTCAGA (SEQ ID NO: 3) IL-6 reverse primer: TGTGACTCCAGCTTATCTCTTGG (SEQ ID NO: 4) TNF-α forward primer: CCCTCACACTCACAAACCAC (SEQ ID NO: 5) TNF-α reverse primer: ACAAGGTACAACCCATCGGC (SEQ ID NO: 6) KIM1 forward primer: ACATATCGTGGAATCACAACGAC (SEQ ID NO: 7) KIM1 reverse primer: ACTGCTCTTCTGATAGGTGACA (SEQ ID NO: 8) NGAL forward primer: GCAGGTGGTACGTTGTGGG (SEQ ID NO: 9) NGAL reverse primer: CTCTTGTAGCTCATAGATGGTGC (SEQ ID NO: 10)

[0298] Amplification reactions were performed using a qRT-PCR instrument: 95 °C, 30 s, 1 cycle; 95 °C, 5 s, 60 °C, 30 s, 40 cycles; 95 °C, 10 s, 65 °C, 60 s, 97 °C, 1 s, 1 cycle; 37 °C, 30 s, 1 cycle. Data analysis was performed after the reactions were completed.

[0299] result

[0300] In acute kidney injury (AKI), the expression levels of kidney injury markers such as kidney injury molecule-1 (KIM-1), neutrophil gelatinase lipotransferase (NGAL), inflammatory factors, and apoptosis-related proteins are significantly elevated in kidney tissue. The expression levels of these proteins are highly correlated with the prognosis of AKI.

[0301] The mRNA transcription levels of KIM-1, NGAL, IL-β, TNF-α, and IL-6 in the samples from each group of mice are as follows: Figure 8 As shown. In Figure 8In the comparison between the IRI group and the Sham group, acute kidney injury significantly upregulated the mRNA transcription levels of KIM-1, NGAL, IL-β, TNF-α, and IL-6; the comparison between the IRI group and IRI+H showed that administration of compound (I) significantly downregulated the mRNA transcription levels of KIM-1, NGAL, IL-β, TNF-α, and IL-6. Compound (I) can effectively treat, inhibit, or alleviate kidney damage and inflammation caused by acute kidney injury.

[0302] 4.3 Detection of Apoptosis-Related Protein Expression Levels

[0303] The levels of apoptosis-related proteins such as C-CASP3 and C-CASP9 in the serum of mice in each group were detected by immunoblotting.

[0304] Mouse kidney tissue was collected, cut into small pieces on ice, and added to a grinding bead. The kidney tissue was thoroughly lysed in a high-throughput tissue homogenizer using lysis buffer containing RIPA lysis buffer and protease inhibitors until no obvious tissue clumps were observed. The supernatant was collected after centrifugation at 12000g for 10 minutes at 4°C. Protein concentration was determined by the dicaprylic acid (BCA) method, and then a certain amount of 5× loading buffer was added. The mixture was diluted to 1× loading buffer and heated at 95°C for 10 minutes. Proteins were separated by 10% SDS-PAGE gel electrophoresis and transferred to a polyvinylidene fluoride (PVDF) membrane. The membrane was blocked at room temperature with 5% skim milk powder in TBST buffer (0.5% Tween 20, 20mM Tris-HCl, 150mM NaCl, pH 7.6) for 1 hour. After washing three times with TBST buffer, antibodies were diluted with primary antibody buffer (C-CASP3, C-CASP9, and β-Actin, diluted 1:1000) and incubated overnight with the membrane. Wash three times with TBST buffer, then incubate with secondary antibody (5% skim milk powder in TBST, 1:10000) at room temperature for 1 hour. Wash three times with TBST buffer. Develop with the ultrasensitive ECL chemiluminescence reagent (BeyoECL Plus) and record the chemiluminescence signal within the membrane.

[0305] The protein levels of C-CASP3 and C-CASP9 in samples from each group of mice are as follows: Figure 9 As shown in the figure. A comparison between the IRI group and the Sham group showed that acute kidney injury significantly upregulated the protein levels of C-CASP3 and C-CASP9; a comparison between the IRI group and the IRI+H group showed that administration of compound (I) significantly downregulated the protein levels of C-CASP3 and C-CASP9. Compound (I) can effectively treat, inhibit, or slow down apoptosis caused by acute kidney injury.

[0306] Experimental Example 5: Study on the therapeutic effect of compounds on osteoarthritis

[0307] Experimental animal grouping

[0308] Forty-four 12-week-old male C57 / 6J mice were randomly divided into four groups: sham surgery group, medial meniscus instability (DMM) group, medial meniscus instability solvent (DMM+V) group, and medial meniscus instability compound C1 (DMM+C) group, with 11 mice in each group.

[0309] - Sham group: A sham surgery was performed during modeling, and no medication was administered.

[0310] - DMM group: Medial meniscus instability modeling was performed normally, without drug administration.

[0311] - DMM+V group: Medial meniscus instability modeling was performed normally, and solvent was applied during drug administration.

[0312] - DMM+C group: Medial meniscus instability model was created normally, and 10 µM of compound C1 was administered at the time of drug administration.

[0313] Animal modeling and drug administration

[0314] Medial meniscus instability was induced in mice at week 0. Mice were fixed and disinfected, and the medial aspect of the patellar ligament was incised with a scalpel to expose the joint cavity. The intercondylar fat pad of the femur was bluntly dissected to expose the intercondylar region, allowing observation of the medial meniscus and tibial ligament. The medial meniscus and tibial ligament were severed with a scalpel (except in the sham-operated group), and the tissue and skin were sutured.

[0315] Starting from week 2, mice were administered the drug via weekly intra-articular injection (no drug was administered to mice in the Sham and DMM groups; the DMM+V group was given the solvent; and the DMM+C group was given 10 µM of compound C1). Mice were anesthetized with 0.1% sodium pentobarbital (10 mg / kg) via intraperitoneal injection, and the drug was injected into the patellar ligament using a microsyringe inserted at a 45-degree angle. The drug was administered weekly for 10 consecutive weeks.

[0316] In week 12, mice were used in the following experimental example 5.1, as well as for the preparation of knee joint samples.

[0317] Knee joint specimen preparation

[0318] Mice were euthanized rapidly by cervical dislocation. The skin of the mouse's right hind limb was cut open with surgical scissors, and the muscles on the tibia and femur were removed. The femur was separated at the hip joint, and the tibia was cut off in the middle to remove the mouse's right knee joint. The mouse's right knee joint was immersed in 10–20 times the volume of the specimen in a 50 mL centrifuge tube of 4% paraformaldehyde solution and fixed at 4 °C for 24–48 hours.

[0319] The obtained knee joint specimen was used in the following experimental example 5.2.

[0320] Preparation of paraffin sections of mouse knee joint

[0321] After fixation, mouse knee joint specimens were placed in centrifuge tubes containing 50 ml PBS and shaken three times for 10 minutes each time. Then, they were placed in 50 ml centrifuge tubes, and EDTA decalcification solution was added, followed by shaking to decalcify. The decalcification solution was changed every two days, with a total decalcification time of approximately two weeks. The decalcified tibia or femur was observed by needle puncture; complete decalcification was indicated by no resistance during puncture. The specimens were then washed three times with PBS for 10 minutes each time and soaked overnight in PBS.

[0322] The paraffin-embedded knee joint was serially sectioned at a thickness of 5 µm using a microtome. Sections showing the tibia, femur, and menisci of approximately equal size on both sides were collected. The sections were spread in a 50 °C water bath, placed on adhesive slides, and dried in a 37 °C oven.

[0323] The obtained paraffin-embedded sections of the knee joint were used in the following experimental examples 5.3 and 5.4.

[0324] 5.1 Gait Analysis

[0325] Gait analysis was performed using CatWalk software. The relevant analysis parameters of the gait analyzer were adjusted, and mice were introduced into the gait testing machine two days in advance to acclimatize to the environment. On the day of testing, mice were placed in the testing machine room six hours in advance to acclimatize. The room lights were turned off to maintain a dark and quiet environment. After the mice were placed in the gait testing machine, they walked freely, and the CatWalk software recorded their walking data. Each mouse walked through the gait slot 3–6 times. The gait data of each group of mice was analyzed using CatWalk software, and the gait data were exported for statistical analysis.

[0326] The results are as follows Figure 10 As shown. Compared with the Sham group, the DMM group and the DMM+V group showed significant decreases in swing speed and average footprint intensity, indicating that the mice in these groups exhibited obvious osteoarthritis; however, compared with the Sham group, the DMM+C group showed almost no decrease in swing speed and average footprint intensity, indicating that the mice in the DMM+C group did not exhibit osteoarthritis symptoms. Compound of formula (I) can effectively treat, inhibit, or alleviate osteoarthritis.

[0327] 5.2 Computed Tomography (CT) Scan

[0328] Computed tomographic scanning of mouse knee joint specimens was performed using a German SKYSCAN 1276 micro-C scanner. The scan thickness was 15 µm. The mouse knee joint was placed on a stage and secured with adhesive tape. 3D reconstruction of the knee joint was performed using CTvox analysis software, and bone volume in specific regions was selected for statistical analysis.

[0329] The results are as follows Figure 11 As shown in (a), the white arrows indicate osteophytes in the joints. Compared with the DMM group and the DMM+V group, the osteophyte phenomenon in the DMM+C group was significantly alleviated. Compound (I) can effectively treat, inhibit, or alleviate osteoarthritis.

[0330] 5.3 Safranin O-Fix Green Staining and Evaluation of Knee Cartilage Damage

[0331] Dewaxing and Rehydration

[0332] The paraffin sections of mouse knee joints were placed in a 65 °C oven for half an hour to fully melt the wax. The melted sections were then subjected to the following steps in sequence: soaking in xylene for 10 minutes three times, washing with anhydrous ethanol for 5 minutes twice, washing with 95% alcohol for 5 minutes once, washing with 85% alcohol for 5 minutes once, washing with 75% alcohol for 5 minutes once, washing with 50% alcohol for 5 minutes once, and finally soaking in water for 5 minutes once, to dewax and rehydrate.

[0333] dyeing

[0334] Immerse in acidic solution for 70 seconds, then in water for 1 minute; immerse in Fast Green staining solution for 20 minutes, then rinse in water; immerse in weak acid solution for 40 seconds, then rinse; immerse in safranin solution for 40 minutes, then rinse in water. Allow to air dry and mount with neutral resin. Take images under a microscope for preservation.

[0335] The obtained stained specimens are as follows Figure 11 As shown in (b).

[0336] Evaluation of knee cartilage damage

[0337] Mouse knee joint specimens stained with Safranin O and Fast Green were scored according to the scoring criteria recommended by the International Association for the Study of Osteoarthritis (OARSI). 0 points – Normal cartilage; 0.5 points – Minor loss of cartilage matrix; 1 point – Cartilage fibrosis present, no cartilage loss; 2 points – Partial cartilage loss; 3 points – Wear depth less than one-quarter of the cartilage surface; 4 points – Wear depth between one-quarter and one-half of the cartilage surface; 5 points – Wear depth between one-half and three-quarters of the cartilage surface; 6 points – Wear depth greater than three-quarters of the cartilage surface.

[0338] The maximum score, which is the highest score selected from all (5) slices of the same knee joint, and the total score, which is the sum of the four highest scores selected from all (5) slices of the same mouse knee joint, are used for statistical analysis.

[0339] The scoring results are as follows Figure 11 As shown in (a) and (b), where (a) shows the maximum score and (b) shows the total score. Compared with the Sham group, the scores of the DMM group and the DMM+V group were significantly higher, indicating that the mice in these groups had obvious osteoarthritis; however, compared with the DMM group and the DMM+V group, the score of the DMM+C group was significantly lower, indicating that the osteoarthritis symptoms of the mice in the DMM+C group were significantly suppressed or alleviated. The compound of formula (I) can effectively treat, suppress or alleviate osteoarthritis.

[0340] 5.4 Hematoxylin-eosin staining

[0341] Dewaxing and Rehydration

[0342] Same as Experiment 5.3.

[0343] dyeing

[0344] Stain with hematoxylin for 15 minutes; soak in acidic liquid for 30 seconds; stain with eosin for 30 minutes, then rinse with water to remove excess stain; soak in anhydrous ethanol, 95% ethanol, 85% ethanol, and 75% ethanol sequentially, 5 seconds each time. Air dry naturally and mount with neutral resin. Take pictures under a microscope for preservation.

[0345] The obtained stained specimens are as follows Figure 11 As shown in (c).

[0346] Synovial inflammation evaluation

[0347] Mouse knee joint hematoxylin-eosin stained specimens were scored according to the following criteria. The scoring consisted of three aspects, and the sum of the scores from the three aspects was taken as the specimen's score.

[0348] - Thickening of the synovial lining layer: 0 points - lining layer has 1 cell layer; 1 point - lining layer has 2-3 cell layers; 2 points - lining layer has 3-4 cell layers; 3 points - lining layer has 4-5 cell layers.

[0349] - Resident cell density: 0 points - normal number of stromal cells; 1 point - slightly increased number of stromal cells; 2 points - moderately increased number of stromal cells; 3 points - severely increased number of stromal cells with extensive angiogenesis.

[0350] - Synovial inflammatory cell infiltration: 0 points - no infiltrating inflammatory cells; 1 point - a few inflammatory cells infiltrated in the sublining layer; 2 points - a large number of inflammatory cells infiltrated in the sublining layer; 3 points - dense band-like inflammatory cells in the sublining layer.

[0351] The scoring results are as follows Figure 12 As shown. Compared with the Sham group, the scores of the DMM group and the DMM+V group were significantly higher, indicating that the mice in these groups had obvious osteoarthritis; however, compared with the DMM group and the DMM+V group, the score of the DMM+C group was significantly lower, indicating that the osteoarthritis symptoms of the mice in the DMM+C group were significantly suppressed or alleviated. In other words, the compound of formula (I) can effectively treat, inhibit or alleviate osteoarthritis.

[0352] The above embodiments are merely preferred embodiments of this application and should not be construed as limiting the scope of protection of this application. Any non-substantial changes and substitutions made by those skilled in the art based on this application shall fall within the scope of protection claimed by this application.

Claims

1. Use of a compound of formula (I) or a pharmaceutically acceptable salt thereof in the preparation of a medicament for the treatment or prevention of inflammation. (I) in, R 1 Choose from the group consisting of hydrogen, halogen, alkoxy, alkanoyl, alkoxycarbonyl, and heteroaryl; R 2 It is selected from the group consisting of hydrogen, alkyl, alkenyl, alkynyl, azide alkyl, aryl alkyl, and heteroaryl alkyl; R 3 It is an unsubstituted or substituted aryl or heteroaryl group, either substituted with halogen, alkyl, aryl, or haloalkyl groups; and R 4 It is a cyano group, or an unsubstituted or halogenated, alkyl, or haloalkyl-substituted fatty acyl group, fatty oxycarbonyl group, aryl carboxyl group, aryl oxycarbonyl group, heteroaryl carboxyl group, heteroaryl oxycarbonyl group, and R 5 It is cyano; or R 4 and R 5 Together they form indene-1,3(2H)-dione-2-idel.

2. The use as described in claim 1, characterized in that, The inflammations mentioned include gastritis, appendicitis, bursitis, duodenitis, jejunitis, ileitis, colitis, cystitis, dermatitis, epididymitis, encephalitis, gingivitis, meningitis, myelitis, myocarditis, nephritis, neuritis, pancreatitis, periodontitis, pharyngitis, phlebitis, prostatitis, rhinitis, sinusitis, tendinitis, tonsillitis, urethritis, vasculitis, vaginitis, keratitis, conjunctivitis, otitis media, pneumonia, hepatitis, endometritis, cervicitis, pelvic inflammatory disease, paronychia, osteoarthritis, inflammation caused by acute kidney injury, or autoinflammatory or autoimmune diseases.

3. The use as described in claim 1 or 2, characterized in that, The medications used to treat or prevent inflammation are those that reduce the release of inflammatory factors, particularly IL-6, TNF-α, or type I interferon, especially IL-6.

4. The use as described in any one of claims 1 to 3, characterized in that, R 1 Choose from the group consisting of hydrogen, fluorine, chlorine, bromine, iodine, methoxy, ethoxy, propoxy, formyl, acetyl, propionyl, methoxycarbonyl, ethoxycarbonyl, and propoxycarbonyl, especially the group consisting of hydrogen, fluorine, chlorine, bromine, iodine, methoxy, and formyl, and even more especially the group consisting of hydrogen, fluorine, chlorine, and methoxy. Optionally, formula (I) includes R on carbon 4 of its indoline ring. 1 ; Optionally, formula (I) includes R on the 5th carbon of its indoline ring. 1 ; Optionally, formula (I) includes R on carbon 6 of its indoline ring. 1 ; Optionally, formula (I) includes R on the 7th carbon of its indoline ring. 1 .

5. The use as described in any one of claims 1 and 4, characterized in that, R 2 The group consisting of hydrogen, methyl, ethyl, propyl, isopropyl, allyl, propargyl, azidomethyl, azidoethyl, azidopropyl, phenyl, and benzyl; Optionally, R 2 The group consisting of hydrogen, methyl, ethyl, allyl, propargyl, phenyl, and benzyl is selected.

6. The use as described in any one of claims 1 to 5, characterized in that, R 3 The aryl group is either unsubstituted or substituted with halogen, alkyl, aryl, or haloalkyl. Optionally, R 3 It is an unsubstituted or substituted phenyl or naphthyl group, or a group substituted with halogen, alkyl, aryl, or haloalkyl groups. Optionally, R 3 Naphthyl groups that are unsubstituted or substituted with halogens, alkyl groups, aryl groups, or haloalkyl groups, especially R 3 It is naphthyl; Optionally, R 3 It is an unsubstituted or substituted phenyl group, especially R, which is either substituted with halogen, alkyl, aryl, or haloalkyl groups. 3 It is a phenyl group.

7. The use as described in any one of claims 1 to 6, characterized in that, R 3 The phenyl group is a phenyl group substituted with a halogen or a haloalkyl group, and more particularly a phenyl group substituted with a fluorine or a fluoroalkyl group. Optionally, R 3 A phenyl group substituted with a halogen; Optionally, R 3 The phenyl group is substituted with a haloalkyl group; Optionally, the halogen is fluorine, chlorine, bromine, or iodine, especially fluorine; Optionally, the haloalkyl group is a trihalomethyl group, particularly a trifluoromethyl group; Optionally, the substitutions specifically include or consist of meta-substitutions; Optionally, R 3 It is 3-fluorophenyl or 3-(trifluoromethyl)phenyl.

8. The use as described in any one of claims 1 to 7, characterized in that, R 4 It is a cyano group, or an unsubstituted or halogenated, alkyl, or haloalkyl-substituted fatty acyl group, fatty oxycarbonyl group, aryl carboxyl group, aryl oxycarbonyl group, heteroaryl carboxyl group, heteroaryl oxycarbonyl group, and R 5 It is cyano; Optionally, R 4 It is a cyano group, or an unsubstituted or substituted fatty acyl group with halogen, alkyl, or haloalkyl groups; Optionally, the fatty acyl group is selected from the group consisting of formyl, acetyl, propionyl, n-butyryl, isobutyryl, n-valeryl, isovaleryl, and neovaleryl; Optionally, R 4 It is an unsubstituted or substituted aliphatic oxycarbonyl group; Optionally, the aliphatic oxygen carbonyl group is selected from the group consisting of carboxyl, methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, isopropoxycarbonyl, n-butoxycarbonyl, isobutoxycarbonyl, and tert-butoxycarbonyl. Optionally, R 4 It is a cyano group, or an unsubstituted or halogenated, alkyl, or haloalkyl substituted arcarboxyl group, aryloxycarbonyl group, heteroarcarboxyl group, or heteroaryloxycarbonyl group; Optionally, R 4 It is a cyano group, or an unsubstituted or halogenated or halogenated aryl, aryloxycarbonyl, heteroaryl, or heteroaryloxycarbonyl group; Optionally, R 4 It is an unsubstituted or halogenated or substituted aryl or heteroaryl group; Optionally, R 4 It is an unsubstituted or halogenated or haloalkyl-substituted heteroaryl group, especially pyrrolocarboxyl, furanocarboxyl, or thiophenecarboxyl, and more particularly thiophenecarboxyl; Optionally, R 4 It is a cyano group, or an unsubstituted or substituted arcarboxyl group, or an alkyl group substituted with a halogen, alkyl group, or a haloalkyl group; Optionally, R 4 It is a cyano group, or an unsubstituted or halogenated or haloalkyl group; Optionally, R 4 It is a cyano group, or an unsubstituted or substituted benzoyl group with halogen or haloalkyl groups.

9. The use as described in any one of claims 1 to 8, characterized in that, R 4 The benzoyl group is substituted with a halogen or haloalkyl group, and more particularly with a fluorine or fluoroalkyl group. Optionally, R 4 The benzoyl group is replaced by a halogen. Optionally, R 4 Benzoyl groups are substituted with haloalkyl groups; Optionally, the halogen is fluorine, chlorine, bromine, or iodine, especially fluorine; Optionally, the haloalkyl group is a trihalomethyl group, particularly a trifluoromethyl group; Optionally, the substitutions specifically include or consist of meta-substitutions; Optionally, R 4 It is 3-fluorobenzoyl or 3-(trifluoromethyl)benzoyl.

10. The use as described in any one of claims 1 to 9, characterized in that, R 3 for , where X 1 X 2 X 3 X 4 and X 5 Each is independently hydrogen, halogen, or haloalkyl, particularly hydrogen, halogen, or trihalomethyl, wherein the halogen is fluorine, chlorine, bromine, or iodine, particularly fluorine, and especially X. 1 X 2 X 3 X 4 and X 5 In particular, X 2 X 3 and X 4 In particular, X 2 and X 4 In this context, at least one is not hydrogen; and / or R 4 for , where X 1 X 2 X 3 X 4 and X 5 Each is independently hydrogen, halogen, or haloalkyl, particularly hydrogen, halogen, or trihalomethyl, wherein the halogen is fluorine, chlorine, bromine, or iodine, particularly fluorine, and especially X. 1 X 2 X 3 X 4 and X 5 In particular, X 2 X 3 and X 4 In particular, X 2 and X 4 In this case, at least one is not hydrogen.

Citation Information

Patent Citations

  • Preparation method of compound with oxoindole spiro cyclopropane structure

    CN115028573A