Functionalized silver nanocluster probe, preparation method and application thereof
Patent Information
- Application Number
- CN202610533982.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-22
- Publication Date
- 2026-07-07
- Estimated Expiration
- 2046-04-22
AI Technical Summary
Existing integrated diagnostic and therapeutic materials suffer from structural instability, functional crosstalk, and the inability to coordinate detection and treatment in real time due to the separation of signal recognition, signal reporting, and antibacterial function.
A functionalized silver nanocluster probe is designed, which connects the silver nanocluster to the nucleic acid aptamer via Ag-S bonds. After binding to the target, the fluorescent reporter molecule is recovered, thus achieving the unity of signal output and antibacterial function.
It enables rapid and highly specific identification of pathogens in a single material, possesses antibacterial activity, simplifies operation, reduces costs, and is suitable for the integrated rapid detection and treatment of pathogens, with broad clinical application prospects.
Smart Images

Figure CN122056919B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedical technology, and particularly to a functionalized silver nanocluster probe, a preparation method thereof, and an application thereof. Background Art
[0002] Bacterial infection is an important issue threatening global public health. Especially with the widespread use of antibiotics, drug-resistant strains have emerged continuously, making traditional antibacterial treatments face severe challenges. Timely and accurately detecting pathogens is crucial for the early diagnosis and effective treatment of infectious diseases.
[0003] Currently, the commonly used clinical bacterial detection methods mainly include bacterial culture, polymerase chain reaction, and immunological detection, etc. Although the result of the bacterial culture method is reliable, the operation is cumbersome and time-consuming, usually taking several days to obtain the result, which is difficult to meet the need for rapid diagnosis. The polymerase chain reaction has high sensitivity and specificity, but requires complex nucleic acid extraction steps and precise temperature control equipment, with high costs, and is easily interfered by inhibitors in the sample. Immunological detection methods rely on antibodies, but the antibody preparation cycle is long, there are large differences between batches, and the affinity for some antigens is limited.
[0004] In terms of antibacterial treatment, antibiotics are still the mainstream choice. However, the abuse of antibiotics has accelerated the generation of bacterial drug resistance, and the spread of multi-drug resistant bacteria has continuously reduced the efficacy of traditional antibiotics. There is an urgent need to develop non-antibiotic antibacterial strategies clinically. In recent years, nanomaterials have shown great potential in the antibacterial field due to their unique physical and chemical properties. For example, silver nanomaterials can play a broad-spectrum antibacterial role by releasing silver ions to destroy bacterial cell membranes and interfere with nucleic acid replication, etc., and are not easily induced to produce drug resistance.
[0005] In addition, the integrated strategy of integrating diagnostic and therapeutic functions on the same nanoplatform has become a research hotspot. Existing technologies have tried to assemble recognition elements, signal reporting molecules, and antibacterial units onto nanocarriers through physical adsorption or chemical coupling to achieve the linkage of detection and treatment. However, such "assembled" composite structures have poor stability in complex biological environments, and each functional module may dissociate in advance, and there is often interference between the detection signal and antibacterial activity, resulting in a decline in overall performance. Therefore, developing a single material system with a simple structure, functional synergy, and spatio-temporal unity of detection and treatment is still a technical problem亟待解决 in this field. Summary of the Invention
[0006] The purpose of the present invention is to provide a functionalized silver nanocluster probe, a preparation method thereof, and an application thereof, which solve the technical problems of unstable structure, functional crosstalk, and inability to achieve real-time coordination of detection and treatment caused by the separation of signal recognition, signal reporting, and antibacterial functions in existing diagnosis and treatment integrated materials.
[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0008] This invention provides a functionalized silver nanocluster probe, comprising a silver nanocluster and a nucleic acid aptamer. A fluorescent reporter molecule is attached to the first end of the nucleic acid aptamer, and a thiol group is modified to the second end of the nucleic acid aptamer. The nucleic acid aptamer is connected to the surface of the silver nanocluster by forming an Ag-S bond with silver atoms on the surface of the silver nanocluster through the thiol group. The fluorescence of the fluorescent reporter molecule can be quenched by the silver nanocluster, and the fluorescence of the fluorescent reporter molecule is restored when the nucleic acid aptamer specifically binds to the target.
[0009] Preferably, the nucleic acid aptamer is a single-stranded oligonucleotide sequence capable of specifically recognizing a target, wherein the target is selected from at least one of pathogens, pathogen-secreted protein markers, nucleic acid targets, small molecules, or inorganic ions.
[0010] Preferably, the fluorescent reporter molecule is attached to the end of the nucleic acid aptamer, and the nucleic acid aptamer forms the Ag-S bond with the silver atoms on the surface of the silver nanocluster through the thiol group modified at its end.
[0011] Preferably, the silver nanoclusters are silver nanoclusters synthesized with 1,3-benzenedithiol as a ligand, the nucleic acid aptamer is a BM2 sequence capable of specifically binding to Mycobacterium tuberculosis or its surface lipoarabinomannan, the fluorescent reporter molecule is a FAM fluorescent reporter molecule, the FAM fluorescent reporter molecule is linked to the 3' end of the BM2 sequence, the 5' end of the BM2 sequence is modified with a thiol group for forming the Ag-S bond, and the fluorescence of the FAM fluorescent reporter molecule is restored after the BM2 sequence specifically binds to Mycobacterium tuberculosis or lipoarabinomannan.
[0012] Preferably, the BM2 sequence is as shown in SEQ ID NO.1.
[0013] This invention also provides a method for preparing the above-mentioned functionalized silver nanocluster probe, comprising the following steps: S1: dissolving silver salt in an organic solvent, adding a thiol ligand to form an Ag-S complex, and then adding a reducing agent to carry out a reduction reaction to obtain silver nanoclusters; S2: mixing a nucleic acid aptamer linked to a fluorescent reporter molecule with a reducing agent to carry out a reduction reaction to open its disulfide bonds, thereby obtaining a reduced nucleic acid aptamer; S3: mixing the silver nanoclusters obtained in S1 with the reduced nucleic acid aptamer obtained in S2 in a solvent and performing a rotational reaction in the dark to allow the nucleic acid aptamer to modify the surface of the silver nanoclusters through Ag-S bonds, thereby obtaining the functionalized silver nanocluster probe.
[0014] Preferably, in S1, the reduction reaction time is 6–72 hours; in S3, the light-protected rotation reaction time is 24–72 hours, and the reaction temperature is 15–35°C; in S1, after adding the thiol ligand to form the Ag-S complex, triphenylphosphine is added, followed by the reducing agent; S1 further includes the steps of centrifuging the reaction mixture after reduction, collecting the precipitate, washing with ethanol, and vacuum drying, wherein the centrifugation speed is 5000–15000 rpm, and the centrifugation time is 1–5 minutes; in S2, the reducing agent is tricarboxyethylphosphine, and the reduction reaction is carried out at room temperature under light-protected conditions; in S3, the silver nanoclusters are ultrasonically dispersed and then mixed with the reduced nucleic acid aptamers, vortexed, and then subjected to the light-protected rotation reaction in physiological saline, wherein the speed of the light-protected rotation reaction is 10–50 rpm; in S1, the organic solvent is a mixture of methanol and dichloromethane.
[0015] The present invention also provides the application of the above-described functionalized silver nanocluster probes or functionalized silver nanocluster probes prepared by the above method in the preparation of drugs or kits for pathogen detection or pathogen killing.
[0016] The present invention also provides the application of the above-described functionalized silver nanocluster probes or functionalized silver nanocluster probes prepared by the above method in the preparation of reagents for visual tracing of intracellular pathogens.
[0017] The present invention also provides the application of the above-described functionalized silver nanocluster probes or functionalized silver nanocluster probes prepared by the above method in the preparation of drugs for inducing M1 polarization of macrophages.
[0018] The beneficial effects of this invention are:
[0019] This invention provides a functionalized silver nanocluster probe integrating visual sensing and antibacterial properties. The probe is simple to prepare, structurally stable, and enables rapid, highly specific identification and signal output of pathogens in a single material, while possessing direct antibacterial activity without the need for additional antibiotic loading. The probe exhibits good water solubility and high biocompatibility, enabling in-situ tracing and clearance of pathogens both inside and outside cells, shortening the window period from diagnosis to intervention. It provides a new technological tool for the rapid detection and integrated treatment of pathogen infections, possessing significant potential for clinical application translation. Specifically, its advantages include: First, the preparation and modification process of the probe is simple, enabling simultaneous signal recognition, signal reporting, and antibacterial functions in a single material. Second, the probe is an enzyme-free system with strong anti-interference capabilities, is easy to store, and significantly reduces operational complexity. Third, this invention combines the characteristics and advantages of nanomaterials, nucleic acid aptamers, and fluorescent signal reporters, enabling rapid, highly sensitive, and highly specific analysis of multiple targets such as pathogens, proteins, nucleic acids, small molecules, and ions. Furthermore, except for cell culture processes, the detection system can be completed at room temperature, without relying on precision temperature control equipment. Furthermore, this invention effectively incorporates a fluorescent reporter molecule, whose fluorescence signal follows a "from zero to presence" pattern in the presence of the target, exhibiting high signal-to-noise ratio and accuracy. It also provides multiple analysis modes, including fluorescence signal acquisition and in-situ visualization imaging, making it widely applicable and meeting diverse detection needs. Finally, the functionalized silver nanocluster probe of this invention does not require additional antibiotic loading, possessing direct antibacterial properties and producing significant antibacterial effects. Moreover, the fluorescence quenching system exhibits rapid fluorescence response, ensuring that the accuracy of fluorescence tracing is not affected by the antibacterial effect, thus demonstrating broad application prospects. Attached Figure Description
[0020] Figure 1 The following figures show the results of material characterization and fluorescence quenching system construction: (a) TEM characterization diagram, scale bar: 20 nm; (b) particle size diagram; (c) Zeta potential diagram; (d) fluorescence spectrum diagram; (e) LAM-recovered FAM fluorescence diagram; (f) fluorescence quenching and recovery phenomenon diagram; (g) stability evaluation diagram of recovered FAM fluorescence; (h) gradient concentration LAM fluorescence detection results diagram; and (i) gradient concentration LAM fluorescence detection standard curve diagram.
[0021] Figure 2 The results of BM2 modification improving the water solubility of AgNCs are shown in the figure, where: (a) is a figure showing the dispersion of BM2-AgNCs and AgNCs in water, and (b) is a figure comparing the PDI coefficients of BM2-AgNCs and AgNCs.
[0022] Figure 3 The figures show the results of extracellular targeting and bactericidal effects of BM2-AgNCs, where: (a) is M.tb(a) is a fluorescence co-localization imaging image of BM2-AgNCs, scale bar: 10 μm; (b) is a linear analysis of fluorescence intensity based on the results of (a); (c) is a confocal imaging image of FAM fluorescence recovery, scale bar: 10 μm; (d) is a quantitative analysis image of recovered FAM fluorescence intensity; (e) is a staining result of live / dead bacteria, scale bar: 10 μm; (f) is a pie chart of the quantitative live / dead staining results in (e); and (g) is a CFU counting result of plate dilution plating.
[0023] Figure 4 The following figures represent the biosafety and cell internalization assessment results of BM2-AgNCs: (a) MTT assay results for A549 cells, (b) CCK8 assay results for THP-1 cells, (c) clonogenic assay results, (d) confocal imaging of macrophages with internalized NPs after 24 h (scale bar: 10 μm), (e) linear analysis of internalization fluorescence, (f) fluorescence results of macrophages with internalized BM2-AgNCs detected by flow cytometry, (g) confocal imaging of BM2-AgNCs and lysosomes, (h) linear analysis of confocal imaging results of BM2-AgNCs and lysosomes after 12 h, and (i) linear analysis of confocal imaging results of BM2-AgNCs and lysosomes after 24 h.
[0024] Figure 5 Figure 1 shows the results of the intracellular targeting and antibacterial performance evaluation of BM2-AgNCs, where: (a) shows the interaction between BM2-AgNCs and intracellular... M.tb Confocal imaging, scale bar: 10 μm, (b) shows BM2-AgNCs and intracellular... M.tb The confocal fluorescence linear analysis diagram, (c) shows the concentration of BM2-AgNCs and intracellular molecules at 12 h. M.tb (d) is a confocal fluorescence linear analysis diagram of intracellular FAM fluorescence recovery confocal imaging, scale bar: 10 μm; (e) is a confocal fluorescence linear analysis diagram of intracellular FAM fluorescence recovery; (f) is a diagram of intracellular antibacterial performance verification; (g) is a diagram of macrophage pre-activated antibacterial performance verification; (h) is a schematic diagram of intracellular antibacterial activity and imaging.
[0025] Figure 6The results of BM2-AgNCs activating macrophages to exert a synergistic antibacterial effect are shown in the following figures: (a) Flow cytometry results of CD80, CD206, TNF-α and IL-10 expression in macrophages after intracellular antibacterial treatment; (b) Flow cytometry results of macrophage polarization characterization; (c) Confocal imaging of intracellular bacteria and lysosomes, scale bar: 10 μm; (d) Linear analysis of fluorescence intensity of NC group in (c); (e) Linear analysis of fluorescence intensity of BM2-AgNCs group in (c); (f) Linear analysis of fluorescence intensity of antibiotic group in (c).
[0026] Figure 7 BM2-AgNCs were used to detect gradient concentrations of LAM in different matrices, and standard curves were constructed. The matrices used in (ad) were PBS, sputum, serum and urine, respectively.
[0027] Figure 8 The results of sequence-specific analysis are shown in the figure, where (a) is the result of confocal imaging and (b) is the result of fluorescence sensor detection. Scale bar: 10 μm.
[0028] Figure 9 This is a graph showing the results of strain-specific analysis. Scale bar: 10 μm. Detailed Implementation
[0029] This invention provides a functionalized silver nanocluster probe, comprising a silver nanocluster and a nucleic acid aptamer. A fluorescent reporter molecule is attached to the first end of the nucleic acid aptamer, and a thiol group is modified to the second end of the nucleic acid aptamer. The nucleic acid aptamer is connected to the surface of the silver nanocluster by forming an Ag-S bond with silver atoms on the surface of the silver nanocluster through the thiol group. The fluorescence of the fluorescent reporter molecule can be quenched by the silver nanocluster, and the fluorescence of the fluorescent reporter molecule is restored when the nucleic acid aptamer specifically binds to the target.
[0030] In this invention, silver nanoclusters refer to nanoscale aggregates composed of several to dozens of silver atoms, typically with a size between 1 and 10 nm, such as 1–3 nm, 2–5 nm, or 3–8 nm. Silver nanoclusters possess unique size-dependent fluorescence emission properties, and their fluorescence wavelength can be tuned by varying the number of silver atoms. Nucleic acid aptamers are single-stranded DNA or RNA sequences screened from random single-stranded oligonucleotide libraries using in vitro exponential enrichment ligand system evolution techniques. Their length is generally 25–80 bases, such as 25–40, 40–60, or 60–80 bases. Aptamers can bind to various target molecules with high affinity and high specificity through their folded three-dimensional conformations. Fluorescent reporter molecules are chemical groups that can absorb specific wavelengths of excitation light and emit longer wavelength fluorescence. Common examples include fluoresceins (such as FAM and FITC), rhodamine derivatives (such as TAMRA and ROX), anthocyanins (such as Cy3 and Cy5), and the Alexa Fluor series. The thiol group (-SH) is a sulfur-containing functional group that can be introduced into the ends of nucleic acids through solid-phase synthesis. A coordination covalent bond (Ag-S bond) can be formed between the silver atom and the thiol group, which exhibits good stability under physiological conditions (e.g., pH 6.5–7.5, temperature 15–37℃). Fluorescence quenching refers to the phenomenon where, when a fluorescent reporter molecule and a quencher (in this case, silver nanoclusters) are sufficiently close in space, the fluorescence intensity decreases significantly or even disappears completely through mechanisms such as fluorescence resonance energy transfer or electron transfer. When the nucleic acid aptamer specifically binds to the target, the aptamer undergoes a conformational change or spatial displacement, causing the fluorescent reporter molecule to move away from the surface of the silver nanoclusters, thus relieving the quenching effect and restoring fluorescence. This "on-off" fluorescence response mode has an extremely low background signal, which is beneficial for improving the detection signal-to-noise ratio.
[0031] Preferably, the nucleic acid aptamer is a single-stranded oligonucleotide sequence capable of specifically recognizing a target, wherein the target is selected from at least one of pathogens, pathogen-secreted protein markers, nucleic acid targets, small molecules, or inorganic ions.
[0032] In this invention, pathogens include, but are not limited to, bacteria (such as Mycobacterium tuberculosis, Escherichia coli, Staphylococcus aureus), fungi (such as Candida albicans, Aspergillus), viruses (such as influenza virus, HIV, SARS-CoV-2), mycoplasma, chlamydia, etc. Protein markers secreted by pathogens refer to proteins released into the surrounding environment during the pathogen's growth and metabolism, such as bacterial exotoxins, enzymes (such as urease, coagulase), outer membrane proteins, secretory antigens, etc. Nucleic acid targets refer to specific deoxyribonucleic acid or ribonucleic acid sequences, such as conserved fragments of the pathogen's genome, drug resistance genes, microRNAs, messenger RNA, etc. Small molecule targets include antibiotic residues, mycotoxins, pesticide residues, metabolites, hormones, etc., whose molecular weight is typically less than 1000 Daltons. Inorganic ion targets include heavy metal ions (such as Hg²⁺, Pb²⁺, Cd²⁺, Ag⁺), anions (such as F⁻, CN⁻, NO₂⁻), etc. The aptamers exhibit high selectivity in recognizing the aforementioned targets, with dissociation constants reaching nanomolar or even picomolar levels, and are not easily affected by other coexisting substances in the sample.
[0033] Preferably, the fluorescent reporter molecule is attached to the end of the nucleic acid aptamer, and the nucleic acid aptamer forms the Ag-S bond with the silver atoms on the surface of the silver nanocluster through the thiol group modified at its end.
[0034] In this invention, the fluorescent reporter molecule is preferably attached to the 5' or 3' end of the nucleic acid aptamer, while the thiol group is modified at the other end. This design, with modifications at both ends, makes the aptamer function as a bifunctional molecule, with one end responsible for signal output and the other for anchoring to the surface of the silver nanoclusters. This end-labeling method minimizes interference with the recognition conformation in the middle region of the aptamer. End modification can be achieved by adding phosphoramidite monomers with fluorescent or thiol groups during solid-phase synthesis, or by introducing them after synthesis through chemical cross-linking. Commonly used reagents for thiol modification include thiol modifiers C6 SS and C3 SS. The formation of the Ag-S bond can occur spontaneously at room temperature (20–25°C) or under mild heating conditions (25–37°C), with reaction times typically ranging from several hours to tens of hours, requiring no additional catalyst.
[0035] Preferably, the silver nanoclusters are silver nanoclusters synthesized with 1,3-benzenedithiol as a ligand, the nucleic acid aptamer is a BM2 sequence capable of specifically binding to Mycobacterium tuberculosis or its surface lipoarabinomannan, the fluorescent reporter molecule is a FAM fluorescent reporter molecule, the FAM fluorescent reporter molecule is linked to the 3' end of the BM2 sequence, the 5' end of the BM2 sequence is modified with a thiol group for forming the Ag-S bond, and the fluorescence of the FAM fluorescent reporter molecule is restored after the BM2 sequence specifically binds to Mycobacterium tuberculosis or lipoarabinomannan.
[0036] In this invention, 1,3-phenyldithiol is an aromatic organic compound containing two thiol groups. These two thiol groups can coordinate with multiple silver atoms to form a stable Ag-S network structure, which helps to obtain silver nanoclusters with uniform size and excellent fluorescence properties. Besides 1,3-phenyldithiol, other dithiols such as 1,2-phenyldithiol, 1,4-phenyldithiol, and 4,4'-biphenyldithiol can also serve as ligands, but 1,3-phenyldithiol is more effective due to its moderate steric hindrance. Mycobacterium tuberculosis is the main pathogen causing tuberculosis. Its cell wall is rich in lipoarabinomannan, and the mannose cap structure of this polysaccharide is a unique virulence factor of Mycobacterium tuberculosis, which can serve as a specific detection target. The BM2 sequence is a single-stranded DNA aptamer that can highly specifically recognize mannose cap-modified lipoarabinomannan. FAM (6-carboxyfluorescein) is a derivative of the fluorescein family. Its maximum excitation wavelength is approximately 494 nm, and its maximum emission wavelength is approximately 520 nm. It exhibits green fluorescence and good photostability, making it one of the most commonly used fluorescent labels in bioanalysis. Labeling BM2 with FAM at the 3' end and modifying the 5' end with a thiol group allows the aptamer to attach to the surface of silver nanoclusters in a "5' end anchored, 3' end free" manner. This facilitates the spatial displacement of the fluorescent reporter molecule and fluorescence recovery during target binding.
[0037] Preferably, the BM2 sequence is as shown in SEQ ID NO.1, specifically: SH-5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCCCCCCATGAACTAGGCTCCACAATGAGTTTGGGGGTCAATGCGTCATAGGATCCCGC-3'-FAM. Those skilled in the art can directly synthesize the BM2 aptamer using conventional chemical synthesis methods (such as the solid-phase phosphoramidite method) based on the sequence information in SEQ ID NO.1; alternatively, it can be obtained through commercial purchase.
[0038] This invention also provides a method for preparing the above-mentioned functionalized silver nanocluster probe, comprising the following steps: S1: dissolving silver salt in an organic solvent, adding a thiol ligand to form an Ag-S complex, and then adding a reducing agent to carry out a reduction reaction to obtain silver nanoclusters; S2: mixing a nucleic acid aptamer linked to a fluorescent reporter molecule with a reducing agent to carry out a reduction reaction to open its disulfide bonds, thereby obtaining a reduced nucleic acid aptamer; S3: mixing the silver nanoclusters obtained in S1 with the reduced nucleic acid aptamer obtained in S2 in a solvent and performing a rotational reaction in the dark to allow the nucleic acid aptamer to modify the surface of the silver nanoclusters through Ag-S bonds, thereby obtaining the functionalized silver nanocluster probe.
[0039] In this invention, the silver salt can be silver nitrate, silver acetate, silver perchlorate, or silver trifluoromethanesulfonate, with silver nitrate being preferred. Organic solvents include methanol, ethanol, acetonitrile, dichloromethane, chloroform, or mixtures thereof, with a mixture of methanol and dichloromethane being preferred. In addition to 1,3-benzenedithiol, thiol ligands such as 1,2-benzenedithiol, 1,4-benzenedithiol, dodecyl mercaptopropionic acid, etc., can also be used. Common reducing agents include sodium borohydride, potassium borohydride, hydrazine hydrate, or sodium citrate, among which sodium borohydride offers rapid reduction and controllable reaction. The reduction reaction can be carried out in an ice-water bath or at room temperature. In step S2, the nucleic acid aptamer linked to the fluorescent reporter molecule may form intramolecular or intermolecular disulfide bonds during synthesis, which need to be broken by a reducing agent (such as tricarboxyethylphosphine, dithiothreitol, or β-mercaptoethanol) to ensure effective exposure of free thiol groups. The light-shielded rotation reaction in step S3 ensures thorough and uniform mixing of the reactants while preventing photobleaching of fluorescent molecules due to light exposure. The rotation speed should not be too fast to avoid generating bubbles; the reaction vessel is typically a centrifuge tube or a glass bottle. The entire preparation process is carried out at room temperature and pressure, is simple to operate, and is easy to scale up for production.
[0040] Preferably, in S1, the reduction reaction time is 6–72 hours; in S3, the light-protected rotation reaction time is 24–72 hours, and the reaction temperature is 15–35°C; in S1, after adding the thiol ligand to form the Ag-S complex, triphenylphosphine is added, followed by the reducing agent; S1 further includes the steps of centrifuging the reaction mixture after reduction, collecting the precipitate, washing with ethanol, and vacuum drying, wherein the centrifugation speed is 5000–15000 rpm, and the centrifugation time is 1–5 minutes; in S2, the reducing agent is tricarboxyethylphosphine, and the reduction reaction is carried out at room temperature under light-protected conditions; in S3, the silver nanoclusters are ultrasonically dispersed and then mixed with the reduced nucleic acid aptamers, vortexed, and then subjected to the light-protected rotation reaction in physiological saline, wherein the speed of the light-protected rotation reaction is 10–50 rpm; in S1, the organic solvent is a mixture of methanol and dichloromethane.
[0041] In this invention, the reduction reaction time is preferably 12–48 hours, more preferably 24–36 hours, and most preferably 10–12 hours (as in the examples). The light-protected rotation reaction time is preferably 36–60 hours, more preferably 48 hours. The light-protected rotation reaction temperature is preferably 20–30°C, more preferably 25°C. Triphenylphosphine is a commonly used ligand exchanger and stabilizer. Adding triphenylphosphine to the synthesis of silver nanoclusters helps to control the size and dispersion of the nanoclusters and improve the uniformity of the product. The centrifugation speed is preferably 8000–12000 rpm, more preferably 8000–10000 rpm; the centrifugation time is preferably 2–4 minutes, more preferably 2 minutes. Tricarboxyethylphosphine is a colorless, odorless, water-soluble reducing agent with highly selective reducing ability for thiol groups and does not react with other functional groups. It is milder and odorless than dithiothreitol. Room temperature usually refers to 15–30°C, and light protection can be achieved by wrapping the container in aluminum foil or placing it in a dark box. Ultrasonic dispersion refers to the redispersing of potentially agglomerated nanoparticles into a uniform suspension using the cavitation effect of ultrasound. The ultrasonic power is typically 100–500 W, and the time is 1–10 minutes. Vortex mixing refers to using a vortex mixer to violently rotate the liquid, creating a vortex and achieving rapid mixing. The time is typically 30 seconds to 2 minutes. Physiological saline refers to a 0.9% sodium chloride aqueous solution, which is isotonic with human body fluids and does not damage biological samples. The rotational reaction speed in the dark is preferably 20–40 rpm, more preferably 30 rpm. The mixing volume ratio of methanol and dichloromethane can be adjusted as needed, for example, methanol:dichloromethane = 1:1 to 1:5, more preferably 1:2.
[0042] The present invention also provides the application of the above-described functionalized silver nanocluster probes or functionalized silver nanocluster probes prepared by the above method in the preparation of drugs or kits for pathogen detection or pathogen killing.
[0043] In this invention, "pathogen detection" refers to the qualitative or semi-quantitative analysis of pathogens in test samples using the fluorescence response characteristics of the probe. This can be applied to clinical samples (such as sputum, blood, and urine), environmental samples (such as water and soil), or food samples. The detection kit typically includes the probe of this invention, buffer solution, washing solution, standards, positive control, negative control, and instructions for use. The kit can be in the form of a liquid kit, a lyophilized powder kit, or test strips. Packaging can be in individually sealed aluminum foil bags, plastic boxes, or glass bottles. "Pathogen-killing drugs" refers to pharmaceutical compositions using the probe of this invention as the active ingredient, which can be formulated into dosage forms such as injections, sprays, topical gels, dressings, and lotions. Drugs can be used alone or in combination with pharmaceutically acceptable carriers (such as buffer salts, protectants, and excipients). Pharmaceutically acceptable carriers include, but are not limited to, phosphate buffer, physiological saline, mannitol, trehalose, and polyethylene glycol. "Or" indicates that kits for detection can be prepared separately, or drugs for treatment can be prepared, or combined products with both detection and treatment functions can be prepared.
[0044] The present invention also provides the application of the above-described functionalized silver nanocluster probes or functionalized silver nanocluster probes prepared by the above method in the preparation of reagents for visual tracing of intracellular pathogens.
[0045] In this invention, "intracellular pathogen visualization and tracing" refers to the real-time observation of the presence, distribution, migration, and dynamic changes of pathogens within living cells using the fluorescence "on-off" characteristic of a probe. This application is typically combined with fluorescence microscopy for imaging, including confocal laser scanning microscopy, wide-field fluorescence microscopy, and total internal reflection fluorescence microscopy. The tracer reagent may contain the probe of this invention, cell culture medium, nuclear dyes (such as DAPI, Hoechst 33342), lysosomal dyes (such as LysoTracker), cell membrane dyes (such as Dil), and other auxiliary components. The reagent can be in the form of ready-to-use liquid, concentrated solution, or lyophilized powder. By co-incubating the reagent with the test cells for a certain period of time and observing under a fluorescence microscope, intracellular pathogens can be directly located without lysing the cells. This tracer reagent can be used to study the interaction between pathogens and the host, the screening of antipathogenic drugs, and basic research on infection mechanisms. Products that can be manufactured include intracellular pathogen detection kits, drug screening kits, and research-grade fluorescent tracer probes.
[0046] The present invention also provides the application of the above-described functionalized silver nanocluster probes or functionalized silver nanocluster probes prepared by the above method in the preparation of drugs for inducing M1 polarization of macrophages.
[0047] In this invention, macrophages are important members of the body's innate immune system, possessing extremely strong phagocytic and antigen-presenting capabilities. Depending on the microenvironmental stimuli, macrophages can polarize into either the classically activated M1 type (pro-inflammatory, anti-infective) or the alternatively activated M2 type (anti-inflammatory, tissue repair). M1 polarization is typically accompanied by upregulation of cell surface markers CD80, CD86, and MHC-II, as well as increased secretion of pro-inflammatory cytokines such as tumor necrosis factor-α, interleukin-6, and interleukin-12. Inducing macrophage polarization towards the M1 type can enhance the body's ability to clear intracellular parasites (such as Mycobacterium tuberculosis, Salmonella, and Listeria). The probe of this invention can induce macrophage polarization towards the M1 type, manifested as an increased CD80 / CD206 ratio, elevated tumor necrosis factor-α expression, and decreased interleukin-10 expression. Drugs prepared using the probe of this invention can achieve superior anti-infective effects by enhancing the antibacterial activity of macrophages. The drug may be available in the form of an injection (intravenous, intramuscular, or subcutaneous), an inhaler (for lung infections), a spray, or a topical formulation. The drug may contain pharmaceutically acceptable excipients, stabilizers, and preservatives.
[0048] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0049] Example
[0050] This embodiment provides a method for preparing functionalized silver nanocluster probes (BM2-AgNCs):
[0051] Synthesis of AgNCs
[0052] 20 mg of silver nitrate was dissolved in 5 mL of methanol, and 10 mL of dichloromethane was added. Then, 13.5 μL of 1,3-benzenedithiol (BDT) was added. The solution immediately turned turbid yellow with insoluble yellow flocculent matter, indicating the formation of an Ag-S complex. Next, 200 mg of triphenylphosphine (TPP) was dissolved in 1 mL of dichloromethane and quickly added to the reaction flask. The yellow flocculent matter immediately disappeared, and the solution became clear and colorless. After stirring for 10 minutes, a freshly prepared solution of 10.5 mg of sodium borohydride dissolved in 500 μL of deionized water was added. The solution immediately turned dark brown. Stirring continued for 10 to 12 hours, and the color gradually turned orange-red, indicating the formation of AgNCs. The reaction solution was centrifuged at 8000 rpm for 2 minutes, the supernatant was discarded, and the dark orange precipitate at the bottom was collected. The precipitate was washed several times with ethanol to remove unreacted matter, and then dried overnight under vacuum to obtain purified AgNCs powder. The dried powder was dispersed in 400 μL of... The solution is vortexed in N,N-dimethylformamide (DMF) for at least 1 minute, filtered through a needle filter with a pore size of 220 nm, and then dropped onto a microscope slide. The slide is placed in a dark box in a fume hood and slowly evaporated at room temperature. After about 2 days, deep orange rhomboid single crystals are obtained.
[0053] Modification of AgNCs surfaces with BM2
[0054] TCEP solution (5 mM) was added to BM2 solution (2.5 μM), mixed thoroughly, and reacted at room temperature in the dark for 1 h to carry out the reduction reaction. The ultrasonically dispersed AgNCs suspension was mixed with the reduced BM2 solution, vortexed for 2 min, and then mixed by rotating (30 rpm) at room temperature in the dark for 48 h to obtain BM2-AgNCs solution (1 mg / mL). All reactions were carried out in 0.9% physiological saline.
[0055] Taking the detection and inactivation of Mycobacterium tuberculosis using BM2-AgNCs as an example, the specific principle of this invention in practical application is as follows:
[0056] ①Preparation of BM2-AgNCs: A nucleic acid aptamer BM2, which specifically binds to Mycobacterium tuberculosis and its surface mannose cap-modified lipoarabinomannan (ManLAM), was synthesized and labeled with 3' end FAM fluorescent label (FAM-BM2); the 5' end -SH of FAM-BM2 was used to bind with silver atoms on the surface of AgNCs to form Ag-S bonds, thereby modifying the surface of AgNCs with FAM-BM2 to form a functionalized BM2-AgNCs fluorescent probe;
[0057] ②In vitro detection of BM2-AgNCs: After the formation of BM2-AgNCs, the FAM fluorescence modified on BM2 can be effectively quenched. Once Mycobacterium tuberculosis or ManLAM appears in the system, the FAM fluorescence will be restored immediately due to its specific recognition and binding to BM2. The signal is measured by a fluorescence spectrometer for quantitative analysis of the target analytes.
[0058] ③ Intracellular tracing and intracellular and extracellular antibacterial activity: The BM2-AgNCs fluorescence quenching system is co-incubated with cells. Once Mycobacterium tuberculosis is infected intracellularly, it will appear as an in situ "light" under a confocal laser scanning microscope to achieve rapid detection of intracellular infection. At the same time, BM2-AgNCs have effective intracellular and extracellular bactericidal effects. BM2-AgNCs can promote macrophage polarization to M1 type and induce phagolysosome maturation, thus exerting synergistic anti-Mycobacterium tuberculosis activity.
[0059] Based on the BM2-AgNCs provided in this embodiment, the following tests are performed:
[0060] Material characterization and construction of fluorescence quenching system
[0061] Material characterization
[0062] AgNCs and BM2-AgNCs were characterized using transmission electron microscopy (TEM), dynamic light scattering (DLS), and fluorescence spectrophotometry. TEM results showed that both AgNCs and BM2-AgNCs were spherical nanoparticles with particle sizes of 5 nm and 20 nm, respectively. Figure 1 a). BM2 modification increased the particle size of AgNCs, which is consistent with the trend of hydrated particle size changes in DLS analysis (AgNCs, 16 nm; BM2-AgNCs, 50 nm). Figure 1 b). Zeta potential results showed that BM2 modification increased the negative charge on the AgNCs surface (Zeta potential decreased from -4.064 mV to -26.92 mV). Figure 1 c). Changes in particle size and zeta potential confirm successful BM2 modification of the AgNCs surface. Combined with previous studies, BM2 mainly binds to the AgNCs surface via Ag-S bonds. Fluorescence spectroscopy results demonstrate that BM2 modification did not alter the fluorescence of AgNCs. Figure 1 d). 0.1 mg / mL AgNCs and BM2-AgNCs were prepared using physiological saline, dispersed by sonication, and allowed to stand for 4 h. AgNCs showed significant precipitation, while BM2-AgNCs dispersed better. DLS analysis compared the polydispersity index (PDI) of the two; BM2-AgNCs had a PDI less than 0.5, indicating good water dispersibility, while AgNCs had a PDI greater than 1.0, indicating poor water solubility. Figure 2In summary, BM2 modification effectively enhances the water solubility of AgNCs while retaining their fluorescence properties.
[0063] Construction of fluorescence quenching system
[0064] After the BM2-AgNCs were prepared, the FAM fluorescence modified at the BM2 terminus was measured. It was found that the fluorescence was effectively quenched by the AgNCs. Further research was conducted to determine whether BM2-AgNCs could be used for reporting Mycobacterium tuberculosis / ManLAM. In this invention, after adding LAM standards to the system, it was observed that the FAM fluorescence recovered and stabilized within a short time (1 min). Figure 1 (e) This confirms that LAM can act as a switch to trigger the quenching and recovery of FAM fluorescence in this system. When LAM is present, FAM fluorescence recovers, while when LAM is absent, FAM remains quenched. This finding lays the foundation for the subsequent construction of a biosensor strategy for the detection of Mycobacterium tuberculosis. After optimization of the reaction components, the optimal FAM-BM2 concentration for this system was determined to be 0.1 µM. At this concentration, AgNCs are effectively dissolved while exhibiting good fluorescence intensity. Furthermore, under the condition of 0.1 mg / mL AgNCs, the quenching process of FAM fluorescence by AgNCs is highly efficient, and the recovery of FAM fluorescence is maximized when the target is present.
[0065] The fluorescence quenching system constructed under the above optimized conditions can quench FAM fluorescence to 7.5% of its initial value. Once the target is added, the FAM fluorescence can rapidly recover to 66.0% of its original fluorescence intensity in just 1 minute. Figure 1 f), and the recovered fluorescence remains stable ( Figure 1 g). Gradient concentrations of LAM confirmed that the BM2-AgNCs fluorescence quenching system can respond to targets at the ag / mL level, with a detection limit as low as 10 ag / mL (g). Figure 1 h, i). Based on the BM2-AgNCs fluorescence quenching system, only simple synthesis steps and detection procedures are required to achieve highly sensitive detection of targets, assisting in the diagnosis of tuberculosis.
[0066] BM2-AgNCs target and eliminate Mycobacterium tuberculosis extracellularly.
[0067] Silver-based nanomaterials are widely used in antibacterial strategies, exhibiting complex and efficient mechanisms of action, including cell membrane disruption, inhibition of key biomolecule synthesis (such as enzymes and DNA), and ROS generation. Unlike the antibacterial mechanisms of conventional antibiotics, antibacterial silver materials can eliminate drug-resistant bacteria and possess broad-spectrum antibacterial properties. To evaluate the in vitro targeting ability of BM2-AgNCs, Mycobacterium tuberculosis was labeled using DMAO, a membrane-permeable DNA fluorescent dye suitable for stable staining of bacteria. After co-incubation at 37°C in the dark for 1 h, BM2-AgNCs (red) and Mycobacterium tuberculosis (green) showed significant co-localization. Figure 3 (a, b). Furthermore, this invention evaluated whether *Mycobacterium tuberculosis* could recover the FAM fluorescence modified on BM2-AgNCs. To avoid fluorescence signal crosstalk, *Mycobacterium tuberculosis* was labeled using a Dil fluorescent probe. BM2-AgNCs were co-incubated with *Mycobacterium tuberculosis* for 1 h under the same conditions. Confocal imaging results showed that in the presence of *Mycobacterium tuberculosis*, FAM fluorescence (green) was significantly recovered and exhibited obvious co-localization with *Mycobacterium tuberculosis* (yellow). Figure 3 (c, d). Conversely, in the absence of bacterial cells, the FAM fluorescence is quenched. These results indicate that BM2-AgNCs possess the ability to precisely target Mycobacterium tuberculosis, and can locate the presence of Mycobacterium tuberculosis through dual fluorescence of AgNCs (red) and FAM (green). Compared to single fluorescent labeling, the dual fluorescent labeling strategy has the potential to improve detection sensitivity and specificity, and provides a more precise visual signal for the localization of Mycobacterium tuberculosis.
[0068] Furthermore, this invention evaluated the in vitro bactericidal performance of BM2-AgNCs against Mycobacterium tuberculosis. BM2-AgNCs and Mycobacterium tuberculosis were co-incubated at 37°C for 24 h. Live / dead bacterial staining results showed that BM2-AgNCs resulted in the death of 88.80% of Mycobacterium tuberculosis, while the antibiotic group only resulted in the death of 67.06% of Mycobacterium tuberculosis. Figure 3 e, f). Further evaluation of the antibacterial effect of different concentrations of BM2-AgNCs was conducted using a plate dilution plating experiment to count the colony-forming units (CFU) of Mycobacterium tuberculosis after different treatments. 0.1 mg / mL BM2-AgNCs showed superior antibacterial effect compared to the antibiotic group ( Figure 3 g).
[0069] Biosafety and cell internalization assessment
[0070] MTT assay results showed that different concentrations of BM2-AgNCs had no significant effect on the proliferation ability of A549 cells. Figure 4 a). Meanwhile, CCK8 assay results demonstrated that BM2-AgNCs did not affect the proliferation of THP-1 cells (a). Figure 4 b). Furthermore, BM2-AgNCs did not inhibit colony formation in A549 cells ( Figure 4 c). The safety of BM2-AgNCs was further verified in mice by administration via tail vein for one week. In vivo administration of BM2-AgNCs had no significant effect on the body weight of mice. H&E staining of all organs showed normal morphology and no pathological changes, indicating that mice tolerated BM2-AgNCs well under the current administration regimen. Serum biochemical indicators also showed that BM2-AgNCs had no side effects on liver, kidney, or cardiac function. These results collectively demonstrate that BM2-AgNCs have good biocompatibility in cell and animal models, and further validation of their intracellular and in vivo antibacterial properties can be conducted.
[0071] Mycobacterium tuberculosis mainly evades the immune system by parasitizing macrophages, leading to persistent infection. Therefore, BM2-AgNCs must enter macrophages to exert intracellular bactericidal effects and clear the pathogen. This invention compared whether there were differences in macrophage uptake of AgNCs before and after BM2 modification. The uptake dynamics of BM2-AgNCs and AgNCs over 72 hours were monitored using confocal fluorescence microscopy. Compared to AgNCs, the macrophage uptake capacity of BM2-AgNCs was significantly improved (…). Figure 4 d). Bright intracellular fluorescence signals were observed as early as 3 h, and the fluorescence intensity increased over time, reaching a maximum at 24 h and remaining at a high level. Figure 4 e). BM2 enhances the water solubility of AgNCs and also imparts better biocompatibility, enabling them to exert further biological activity in cells. Flow cytometry results also confirmed the effective internalization of BM2-AgNCs. Compared to uninfected macrophages, macrophages infected with Mycobacterium tuberculosis showed significantly higher BM2-AgNCs uptake efficiency. This enhanced phagocytic capacity helps to further promote the internalization of BM2-AgNCs, resulting in a more effective bacterial clearance function. Figure 4 f). Previous studies have shown that AgNPs, after being internalized by cells, are deposited in lysosomes in a time-dependent manner. Lysosomes further degrade AgNPs, releasing active components such as silver ions to exert their biological functions. Simultaneously, through sulfidation and acidification, lysosomes ultimately clear AgNPs and reduce their toxicity. Based on this, this invention further investigated the intracellular behavior of BM2-AgNCs. Macrophages were incubated with BM2-AgNCs for 12 h and 24 h, and lysosomes were stained using LysoTracker. Confocal imaging showed significant colocalization of BM2-AgNCs (red) and lysosomes (green), indicating that the nanoparticles enter the endolysosome pathway and ultimately enter the lysosome (…). Figure 4This pathway is consistent with the behavior of Mycobacterium tuberculosis inside macrophages, which facilitates BM2-AgNCs spatially approaching the bacterial cells and exerting a targeted therapeutic effect.
[0072] Targeting and efficacy evaluation of intracellular Mycobacterium tuberculosis
[0073] This invention co-incubates 1 MOI of Mycobacterium tuberculosis with macrophages for 24 h, washes away extracellular bacterial cells, and constructs a macrophage infection model to further verify the intracellular targeting and antibacterial ability of BM2-AgNCs. After co-incubating BM2-AgNCs with infected macrophages for 4 h, significant co-localization of BM2-AgNCs (red) and Mycobacterium tuberculosis (green) can be observed intracellularly, indicating that BM2-AgNCs have rapid and precise intracellular targeting ability. At 12 h, BM2-AgNCs still maintain tight binding with the bacterial cells, indicating that this targeting is robust and has the potential to exert a sustained therapeutic effect. Figure 5 Meanwhile, in infected macrophages, FAM fluorescence recovered rapidly (4 h) and effectively, showing significant co-localization with Mycobacterium tuberculosis. In contrast, in uninfected macrophages, FAM fluorescence remained quenched. Figure 5 (d, e). The above results collectively demonstrate that the BM2-AgNCs dual-fluorescent labeling tracking strategy is equally effective in cells.
[0074] After co-incubating BM2-AgNCs with infected macrophages for 72 h, the cells were lysed and bacterial cells were released. The lysed bacterial suspension was plate-spread and CFU counted to evaluate the intracellular bactericidal effect of BM2-AgNCs. Consistent with the extracellular antibacterial effect, BM2-AgNCs effectively inhibited intracellular Mycobacterium tuberculosis, with the inhibitory effect increasing with increasing concentration. 0.1 mg / mL BM2-AgNCs showed superior antibacterial efficacy compared to the antibiotic group (…). Figure 5f). Existing studies have demonstrated that BM2 can bind to the surface of Mycobacterium tuberculosis and block the binding of ManLAM to the mannose receptor (MR) on the surface of macrophages, thereby inhibiting its conventional invasion of macrophages. This process also promotes the binding of ManLAM to CD44, activating the antibacterial activity of macrophages. Simultaneously, studies have shown that silver nanoparticles can recruit and activate macrophages and induce downstream innate immune responses, playing a role in infection prevention. Therefore, this invention also evaluated whether BM2-AgNCs can directly activate macrophages to prevent or prematurely eliminate Mycobacterium tuberculosis infection. Uninfected macrophages were pretreated with 0.1 mg / mL BM2-AgNCs for 72 h, and then infected with 1 MOI of Mycobacterium tuberculosis. CFU counts were performed on the bacterial culture after macrophage lysis, demonstrating that BM2-AgNCs pretreatment effectively reduced the number of surviving bacteria inside macrophages. There was no significant difference in the number of surviving bacteria inside macrophages treated with antibiotics compared to untreated macrophages. Figure 5 g). BM2-AgNCs possess a unique antibacterial mechanism, capable of synergistically inhibiting bacteria in conjunction with macrophages. Figure 5 h). At the same time, by inhibiting the infection of macrophages by Mycobacterium tuberculosis, its spread can be effectively blocked and its habitat in the body can be breached.
[0075] Macrophage M1 polarization and phagolysosomal maturation
[0076] Macrophages are the first line of defense of the host's innate immune system against Mycobacterium tuberculosis, but they can also be affected by the immune evasion mechanisms of Mycobacterium tuberculosis, transforming them into a sanctuary and a carrier of its spread within the body. This role shift is closely related to the polarization direction of macrophages, including M1 and M2 types. M1 macrophages mainly participate in inflammatory responses and anti-infection, enhancing their ability to phagocytose and clear pathogens; while M2 macrophages play a key role in tissue repair and immune regulation, but relatively weaken their ability to clear pathogens, manifesting as a decrease in antibacterial capacity. Utilizing this mechanism, Mycobacterium tuberculosis has a strong ability to polarize infected macrophages from the M1 phenotype to the M2 phenotype, thereby evading macrophage killing and surviving or proliferating within them. Therefore, inducing M1 polarization of macrophages to exert the antibacterial capacity of the innate immune system is an important direction in constructing tuberculosis treatment strategies, and can exert synergistic effects with antibacterial drugs. This invention uses flow cytometry to verify whether BM2-AgNCs can induce macrophage polarization towards the M1 type. This invention detected the expression of CD80 (an M1 marker) and CD206 (also known as the mannose receptor, an M2 marker) in infected macrophages, and used CD80 / CD206 to assess the direction of macrophage polarization. Figure 6a) Treatment with BM2-AgNCs significantly increased the CD80 / CD206 ratio, while untreated or antibiotic-treated macrophages showed the opposite trend. This indicates that BM2-AgNCs successfully induced M1-type macrophage polarization and promoted the clearance of intracellular pathogens and enhanced anti-infection capabilities. BM2 treatment alone could induce similar M1-type polarization, thanks to BM2's activation of the macrophage CD44-related signaling pathway. AgNCs alone could also induce M1-type polarization, but not significantly. Subsequently, the M1 and M2 phenotypes were validated based on cytokine production, including tumor necrosis factor-α (TNF-α, M1) and interleukin-10 (IL-10, M2). Consistent with previous trends, BM2-AgNCs increased TNF-α release from infected macrophages and inhibited IL-10 expression. Although BM2 alone effectively promoted M1-type polarization, BM2-AgNCs showed a clear advantage in enhancing cytokine expression and activating macrophage function. Previously, this invention demonstrated that BM2-AgNCs can prematurely activate macrophages to resist Mycobacterium tuberculosis infection. This is related to BM2 blocking Mycobacterium tuberculosis from entering macrophages via the MR pathway, and may also be due to BM2-AgNCs prematurely stimulating M1 polarization in macrophages. This invention used the same flow cytometry protocol to analyze uninfected macrophages treated with BM2-AgNCs. The results were consistent with expectations; BM2-AgNCs can indeed directly induce M1 polarization in macrophages, including an increase in CD80 / CD206, increased TNF-α expression, and a decrease in IL-10 expression. Figure 6 b).
[0077] Mycobacterium tuberculosis (MBTB) avoids further degradation by inhibiting the maturation of phagocytosolic lysosomes in macrophages, which is another important mechanism for its immune evasion. Previous studies have shown that this mechanism is closely related to ManLAM. BM2-AgNCs exert local bactericidal ability by targeting ManLAM on the surface of intracellular MBTB, potentially inhibiting ManLAM function and thus reversing this immune evasion mechanism, promoting the clearance of pathogens by phagocytosolic lysosomes. In this invention, MBTB-infected macrophages were treated with BM2-AgNCs for 24 h, and lysosomes were stained using LysoTracker. Confocal imaging results showed that MBTB (green) and lysosomes (yellow) exhibited significant co-localization in BM2-AgNCs-treated macrophages, while MBTB was significantly more prominent outside the lysosomes in untreated and antibiotic-only macrophages. Figure 6(cf) indicates that after BM2-AgNCs enter macrophages, they target ManLAM, inhibit the immune evasion of Mycobacterium tuberculosis, and promote the fusion of bacteria in phagosomes into lysosomes to more effectively clear Mycobacterium tuberculosis from cells.
[0078] The above results demonstrate that BM2-AgNCs exert their synergistic antibacterial function against Mycobacterium tuberculosis through multiple mechanisms. BM2-AgNCs utilize the inherent antibacterial mechanism of silver nanomaterials to clear extracellular bacteria, while BM2 binds to ManLAM, inhibiting its entry into macrophages via MR. Through effective macrophage internalization, BM2-AgNCs can target and clear intracellular bacteria. Simultaneously, by targeting intracellular ManLAM, it inhibits immune evasion, promotes phagolysosome maturation, and facilitates the entry of pathogens into phagolysosomes for degradation. Furthermore, through the synergistic effect of its components, BM2-AgNCs effectively induce M1 polarization in both infected and uninfected macrophages, enhancing the activation of innate anti-infection immunity and cytokine expression, jointly combating Mycobacterium tuberculosis both inside and outside the cell. Simultaneously, M1 polarization reduces the expression of CD206 (MR) in macrophages, further inhibiting Mycobacterium tuberculosis invasion of macrophages.
[0079] Anti-interference verification
[0080] This invention collected sputum, serum, and urine from healthy patients as potential interfering matrices to verify the ability of BM2-AgNCs to combat matrix interference. Using urine, serum, and sputum from healthy volunteers as matrices, different concentrations of LAM standards (1, 10, 50, and 100 ng / mL) were added, and detection was performed using the fluorescence sensor established in this invention. Each concentration was tested in triplicate, with PBS buffer as a control. The detection performance of the sensor in different matrices was evaluated by calculating the differences in recovery rate, coefficient of variation (CV), and standard curve slope. Figure 7 As shown in Tables 1 and 2:
[0081] Table 1. Standard curves and slope variations of BM2-AgNCs for detecting LAM in different matrices.
[0082] matrix Standard curve slope* <![CDATA[R 2 <!-- 11 -->]]> PBS y = 2332.7x + 5823.0 — 0.99 sputum y = 1942.8x + 5568.0 -16.7% 0.99 serum y = 2225.8x + 5102.8 -4.6% 0.95 urine y = 2127.2x + 5522.7 -8.8% 0.90
[0083] *Slope change (%) = (Matrix slope - PBS slope) / PBS slope × 100%
[0084] Table 2 Recovery and CV values of LAM in different matrices detected by BM2-AgNCs
[0085]
[0086] *CV: Coefficient of Variation
[0087] The results showed that the slope of the standard curve constructed by BM2-AgNCs for LAM detection in urine and serum was not significantly different from that in PBS, both being less than 15%, indicating minimal interference. However, in sputum samples, the slope difference slightly exceeded 15%, suggesting that sputum samples may cause some interference with the detection. This may be because sputum samples contain more impurities, which are easily incompletely digested, thus interfering with the detection. Considering that this interference has a negligible impact on the final detection results, the results are acceptable. Furthermore, according to the World Health Organization's recommendations, urine samples accumulate LAM more easily, making them the optimal sample type for LAM detection. Therefore, this invention suggests that future clinical applications should primarily focus on the detection of LAM in urine, as urine samples have less impact on the detection results, and the risk of interference is easier to reduce.
[0088] The recoveries of LAM in all matrices ranged from 80% to 120%, indicating good accuracy of the method. The coefficients of variation at each concentration point were less than 10%, meeting the precision requirements for biological sample analysis. These results demonstrate that the established fluorescence sensor exhibits good anti-interference ability and detection reliability in complex biological matrices such as urine, serum, and sputum, laying the foundation for its application in clinical samples.
[0089] Specificity analysis
[0090] Based on the BM2 core sequence capable of recognizing ManLAM, this invention designed three DNA aptamers (Table 3): BM2-M1 (with only the core region randomized, its structure similar to BM2), BM2-M2 (its stem-loop structure was disrupted), and a random sequence (to exclude the influence of non-specific DNA adsorption). Furthermore, this invention modified the 5' end of these aptamers with thiol groups and the 3' end with FAM fluorescent groups, and then modified them onto the surface of AgNCs in the same manner; the aim was to further verify whether the newly synthesized AgNCs functionalized with these three aptamers could exhibit FAM fluorescence recovery in the presence of the target analyte. This invention co-incubated these three materials with BM2-AgNCs and Mycobacterium tuberculosis for 4 hours, and then observed them using a confocal microscope. The results are as follows: Figure 8As shown in the figure. The results showed that none of the three newly designed aptamers exhibited effective FAM fluorescence recovery in the presence of Mycobacterium tuberculosis; only BM2-AgNCs was able to respond to the presence of Mycobacterium tuberculosis, thereby generating a corresponding FAM fluorescence signal. Similarly, this invention added 100 ng / mL of LAM standard to different aptamer systems and obtained the same results using a fluorescence detector (detecting FAM fluorescence). Only BM2-AgNCs showed significant fluorescence recovery, while the other three materials showed almost no FAM fluorescence recovery.
[0091] Table 3 DNA Sequences
[0092] name Sequence (5'-3') SEQ IDNO.x BM2 SH-5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCCCCCATGAACTAGGCTCCACAATGAGTTTGGGGGTCAATGCGTCATAGGATCCCGC-3'-FAM 1 BM2-M1 SH-5'-GCGGAATTCTAATACGACTCACTATAGGGAACACTACACTGTCGACTCGTACAGTAACGCCTCTCCACAATGAGTTTGGGGGTCAATGCGTCATAGGATCCCGC-3'-FAM 2 BM2-M2 SH-5'-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCCCCCATGAACTAGGCTCCACAATAAAAAAGGGGGTCAATGCGTCATAGGATCCCGC-3'-FAM 3 Random Control SH-5'-ACTGCTAGCTAGCTAGCTAGCATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGT-3'-FAM 4
[0093] This invention also evaluated the bacterial selectivity of BM2-AgNCs, selecting *Escherichia coli* (E. coli), a common clinical and research laboratory model bacterium, and *Mycobacterium smegmatis*, a species related to *Mycobacterium tuberculosis* (M. tb), as controls. Although *Mycobacterium smegmatis* and *Mycobacterium tuberculosis* are structurally and morphologically very similar, *Mycobacterium smegmatis* expresses PILAM (phosphatidylinositol cap structure) on its surface, rather than the ManLAM (mannose cap structure) targeted by BM2. Using the same method, this invention co-incubated these two DiI-labeled strains with macrophages, and then treated them with BM2-AgNCs. Next, this invention used confocal microscopy to observe the recovery of intracellular FAM fluorescence, such as... Figure 9 As shown in the figure. The results showed that BM2-AgNCs only responded to intracellular Mycobacterium tuberculosis, while other strains failed to effectively restore FAM fluorescence. This result confirms that the fluorescence quenching and recovery mechanism of BM2-AgNCs has good specificity, responding only to Mycobacterium tuberculosis.
[0094] As demonstrated by the above embodiments, this invention provides a functionalized silver nanocluster probe integrating visual sensing and antibacterial properties. This probe exhibits good detection reliability in various complex biological matrices, with recovery rates and precision in urine, serum, and sputum samples meeting the requirements for biological sample analysis. Urine samples are particularly suitable as a detection matrix due to their lower interference levels. Furthermore, the probe demonstrates high target specificity, responding to the target and recovering fluorescence only when the aptamer maintains an intact stem-loop structure; aptamers with randomized sequences or structurally damaged structures fail to recover signals. Regarding strain selectivity, the probe only produces a fluorescent response to target strains expressing specific surface sugar structures, showing no response to other closely related strains or common model strains. In summary, the functionalized silver nanocluster probe provided by this invention exhibits good anti-interference ability and excellent specificity in complex samples, enabling accurate identification and effective clearance of target pathogens, providing a reliable experimental basis for the rapid diagnosis and integrated treatment of infectious diseases.
[0095] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A functionalized silver nanocluster probe, characterized in that, The probe comprises a silver nanocluster and a nucleic acid aptamer. A fluorescent reporter molecule is attached to the first end of the nucleic acid aptamer, and a thiol group is modified to the second end of the nucleic acid aptamer. The nucleic acid aptamer is attached to the surface of the silver nanocluster by forming an Ag-S bond with the silver atoms on the surface of the silver nanocluster through the thiol group. The fluorescence of the fluorescent reporter molecule can be quenched by the silver nanocluster, and the fluorescence of the fluorescent reporter molecule is restored when the nucleic acid aptamer specifically binds to the target. The silver nanoclusters are silver nanoclusters synthesized with 1,3-benzenedithiol as a ligand. The nucleic acid aptamer is a BM2 sequence that can specifically bind to Mycobacterium tuberculosis or its surface lipoarabinomannan. The fluorescent reporter molecule is a FAM fluorescent reporter molecule, which is attached to the 3' end of the BM2 sequence. The 5' end of the BM2 sequence is modified with a thiol group for forming the Ag-S bond. When the BM2 sequence specifically binds to Mycobacterium tuberculosis or lipoarabinomannan, the fluorescence of the FAM fluorescent reporter molecule is restored. The BM2 sequence is shown in SEQ ID NO.
1.
2. A method for preparing the functionalized silver nanocluster probe according to claim 1, characterized in that, Includes the following steps: S1: Silver salt is dissolved in an organic solvent, a thiol ligand is added to form an Ag-S complex, and a reducing agent is added to carry out a reduction reaction to obtain silver nanoclusters; S2: The nucleic acid aptamer linked with the fluorescent reporter molecule is mixed with a reducing agent to carry out a reduction reaction to open its disulfide bonds and obtain the reduced nucleic acid aptamer; S3: The silver nanoclusters obtained in S1 and the reduced nucleic acid aptamers obtained in S2 are mixed in a solvent and subjected to a rotational reaction in the dark, so that the nucleic acid aptamers are modified onto the surface of the silver nanoclusters through Ag-S bonds, thereby obtaining the functionalized silver nanocluster probe.
3. The method according to claim 2, characterized in that, In S1, the reduction reaction takes 6 to 72 hours; in S3, the rotation reaction in the dark takes 24 to 72 hours, and the reaction temperature is 15 to 35°C. In step S1, after adding the thiol ligand to form the Ag-S complex, triphenylphosphine is added, followed by the reducing agent; step S1 also includes centrifuging the reaction mixture after reduction, collecting the precipitate, washing with ethanol and vacuum drying, wherein the centrifugation speed is 5000-15000 rpm and the centrifugation time is 1-5 minutes. In S2, the reducing agent is tricarboxyethylphosphine, and the reduction reaction is carried out at room temperature in the dark. S3 further includes ultrasonically dispersing the silver nanoclusters and mixing them with the reduced nucleic acid aptamers, vortexing them, and then performing the light-protected rotation reaction in physiological saline. The speed of the light-protected rotation reaction is 10-50 rpm. In S1, the organic solvent is a mixture of methanol and dichloromethane.
4. The use of the functionalized silver nanocluster probe of claim 1 or the functionalized silver nanocluster probe prepared by the method of any one of claims 2-3 in the preparation of drugs or kits for pathogen detection or pathogen killing.
5. The use of the functionalized silver nanocluster probe of claim 1 or the functionalized silver nanocluster probe prepared by the method of any one of claims 2-3 in the preparation of reagents for visual tracing of intracellular pathogens.