Pichia manshurica capable of degrading ethyl carbamate and application thereof

By isolating Pichia mansoni ZYXW-J9 from fermented foods, the problem of poor degradation effect of existing strains in high acid and high alcohol environments has been solved, achieving effective degradation of ethyl carbamate in food and improving the quality and safety of fermented foods.

CN122104453APending Publication Date: 2026-05-29DALIAN POLYTECHNIC UNIVERSITY
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
DALIAN POLYTECHNIC UNIVERSITY
Filing Date
2026-03-13
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

The existing resource library of ethyl carbamate degrading strains is insufficient, and most strains have poor degradation effects in high acid and high alcohol environments, which cannot meet the biodegradation requirements of ethyl carbamate in food. There is a lack of strains that are acid-resistant, alcohol-resistant, and produce flavor substances for use in high acid and high alcohol fermented foods.

Method used

We provide a strain of Pichia mansoni ZYXW-J9 isolated from fermented foods, which has acid and alcohol resistance properties. It can effectively degrade ethyl carbamate in high-concentration ethanol and low pH environments and produce flavor substances. It can be prepared into microbial preparations or fermentation agents for the degradation of ethyl carbamate in food.

Benefits of technology

This strain maintains high degradation activity in high acid and high alcohol environments, significantly reduces the content of ethyl carbamate in food, improves the nutritional value and flavor quality of fermented foods, and also has good safety and probiotic properties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104453A_ABST
    Figure CN122104453A_ABST
Patent Text Reader

Abstract

The application discloses a Pichia manshurica capable of degrading ethyl carbamate and an application thereof, and belongs to the field of food biotechnology. The application provides the Pichia manshurica ZYXW-J9 capable of efficiently degrading ethyl carbamate, and the preservation number is GDMCC No: 64936. The obtained strain ZYXW-J9 is freeze-dried or low-temperature room spray-dried to prepare a bacterial agent, or is embedded to prepare a degradation agent, and both can effectively remove EC in fermented food. The degradation agent of the strain ZYXW-J9 is used to remove EC in different food systems, and has the advantages of obvious EC removal effect, low production cost, convenient use and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a Pichia mansoni yeast that degrades ethyl carbamate and its application, belonging to the field of food biotechnology. Background Technology

[0002] Ethyl carbamate (EC) is a metabolite with genotoxic and strong carcinogenic properties, widely found in alcoholic beverages and fermented foods (such as baijiu, huangjiu, soy sauce, cheese, and vinegar). Various countries have implemented strict controls on EC content in food. The United States stipulates that ethyl carbamate in table wine (alcohol content ≤14%) should not exceed 15 μg / L, and in sweet wine (alcohol content ≥14%), it should not exceed 60 μg / L. Canada's imported distilled spirits are limited to 150 μg / L, and Japan limits it to 200 μg / L for sake and imported huangjiu.

[0003] Ethyl carbamate (EC) is mainly produced by the reaction of urea, citrulline, carbamoyl phosphate, etc., with ethanol. Methods for controlling EC mainly fall into two categories: limiting precursors and reducing EC content. Limiting precursors often involves using urease to digest urea; however, urease activity is affected by high concentrations of ethanol and pH, limiting its practicality. Reducing EC content has a wider range of applications. This method generally utilizes ethyl carbamate hydrolases and enzyme-producing microorganisms to hydrolyze ethyl carbamate into ethanol, ammonia, and carbon dioxide (Foods 2022, 11, 937). CN115287203B provides a highly efficient Rhodotorula glutinis strain for degrading ethyl carbamate, while CN113174342B and CN113337417B each provide a highly efficient Agrobacterium strain for degrading ethyl carbamate. Lysinibacillus sphaericus MT3 has also been reported to have the ability to degrade urethane (J Agric FoodChem, 2018, 66(6): 1583-1590).

[0004] However, the existing resource library of ethyl carbamate-degrading strains cannot meet the actual needs of ethyl carbamate biodegradation in food. There are relatively few ethyl carbamate-degrading strains that have been isolated and publicly reported, and the resource library of ethyl carbamate-degrading strains from fermented foods urgently needs to be expanded.

[0005] Furthermore, current technologies lack functional verification of strains that simultaneously possess acid and alcohol resistance, produce flavor compounds, and reduce ethyl carbamate, as well as reports on their specific applications in high-acid and high-alcohol fermented foods, thus limiting industry development. Therefore, screening strains that possess high alcohol tolerance, flavor compound production, ethyl carbamate-reducing ability, and good safety profile has practical significance and application value for the industrial upgrading of fermented foods involving alcoholic fermentation stages.

[0006] Pichia mansoni ( P. manshurica It has wide applications in food fermentation. The flammable material isolated from the mash of Shanxi aged vinegar... P. manshurica Y14, when applied to the fermentation of jujube fruit wine, can increase the ester aroma of jujube fruit wine (China Brewing. 2021, 40 (03): 64-72). P. manshurica When applied to the fermentation of Wogan orange wine, it can increase the types and content of higher alcohols, thereby increasing the aroma complexity of the Wogan orange wine (Food Industry Technology. 2023, 44 (06): 183-192). In patent CN116987622A, Pichia mansoni (… P. manshurica Pichia mansoni () is used to prepare synthetic microbial inoculants to increase the volatile flavor compounds such as alcohols, esters, and phenols in soy sauce. This demonstrates that Pichia mansoni () P. manshurica It has a good tradition of application in food processing and food safety. Summary of the Invention

[0007] In view of the fact that existing degrading strains are few in number and most are not from food sources, have poor degradation effect on ethyl carbamate, and are not compatible with the high acid and high alcohol environment of baijiu, huangjiu and other fermented foods, the purpose of this invention is to provide an acid and alcohol resistant strain ZYXW-J9 isolated from fermented foods, and a degrading agent prepared using this strain.

[0008] This invention is achieved through the following technical solution: This invention provides a strain of Pichia mansoni isolated from fermented food. Pichia manshurica ZYXW-J9 was deposited on August 1, 2024, at the Guangdong Provincial Center for Microbial Culture Collection. The deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, China, and the accession number is GDMCC No: 64936.

[0009] In one embodiment, the Pichia mansoni ZYXW-J9 was isolated from aged vinegar fermentation mash, and its 26S rRNA nucleotide sequence is shown in SEQ ID No. 1.

[0010] The present invention also provides a microbial preparation containing the aforementioned Pichia mansoni ZYXW-J9 or its fermentation product.

[0011] The present invention also provides a fermentation agent containing the aforementioned Pichia mansoni ZYXW-J9.

[0012] In one embodiment, the Pichia mansoni ZYXW-J9 yeast in the microbial preparation or the fermentation agent is present in live form.

[0013] In one embodiment, the microbial preparation or the fermentation agent may also contain a freeze-drying protectant or a spray-drying protectant.

[0014] In one embodiment, the formulation is in the form of a liquid bacterial agent or a solid bacterial agent.

[0015] In one embodiment, the microbial preparation is an immobilized cell of Pichia mansoni ZYXW-J9.

[0016] In one embodiment, the microbial preparation is a cell lysate of Pichia mansoni ZYXW-J9.

[0017] In one embodiment, the preparation method of the microbial inoculant is as follows: (1) The Pichia mansoni ZYXW-J9 was activated in YPD liquid medium and cultured at 25~32 ℃ and 150~250 rpm for 24~48 h to obtain seed culture; (2) Inoculate the seed culture into the fermentation medium at an inoculum of 10%-20%, and maintain the medium at 25-32 °C and an aeration rate of 0.6-1.0 m³ / h. 3 Fermentation was carried out at a stirring speed of 150-250 rpm until the cell count reached 3 × 10⁶ cells / min. 8 ~1.8×10 9 CFU / mL, to obtain the fermentation product of Pichia mansoni ZYXW-J9; (3) The fermentation product of Pichia mansoni ZYXW-J9 prepared in step (2) is encapsulated to prepare a microbial agent.

[0018] This invention provides the application of a strain of Pichia mansoni ZYXW-J9 or its fermentation broth in the degradation of ethyl carbamate.

[0019] In one embodiment, the application involves contacting the Pichia mansoni ZYXW-J9 with ethyl carbamate in the reaction system and reacting at 28 °C for at least 24 h.

[0020] In one embodiment, the chemicals include, but are not limited to, ethyl carbamate degrading agents, ethyl carbamate adsorbents, ethyl carbamate inhibitors, ethyl carbamate decomposing agents, ethyl carbamate degrading bacterial strains, and ethyl carbamate degrading microbial agents.

[0021] The present invention also provides a method for degrading ethyl carbamate in food. In the food preparation process, Pichia mansoni ZYXW-J9 or the microbial preparation is added to degrade ethyl carbamate. After degradation, the food is sterilized and prepared.

[0022] In one embodiment, the food includes, but is not limited to, fermented foods and alcoholic beverages.

[0023] In one embodiment, the food is vinegar, vinegar made from fermented grains, baijiu (Chinese white liquor), huangjiu (yellow wine), red wine, or soy sauce.

[0024] The present invention also provides an ethyl carbamate degrading agent, wherein the degrading agent is prepared by encapsulating the fermentation product of Pichia mansoni ZYXW-J9 obtained by cultivation.

[0025] In one embodiment, the fermentation product of Pichia mansoni ZYXW-J9 in step (2) includes: Pichia mansoni ZYXW-J9 bacterial fermentation broth, Pichia mansoni ZYXW-J9 fermentation broth supernatant, Pichia mansoni ZYXW-J9 cell suspension, and Pichia mansoni ZYXW-J9 cell lysate.

[0026] In one embodiment, the drying method includes freeze-vacuum drying.

[0027] Beneficial effects This invention provides a strain of Pichia mansoni ( Pichia manshurica ZYXW-J9, this strain was isolated from the fermented mash of "Shanxi Aged Vinegar" in Qingxu County, Shanxi Province, and has the following characteristics: (1) The strain ZYXW-J9 grows well at pH 3.0 and 20% ethanol concentration, and is resistant to acid and ethanol.

[0028] (2) The strain ZYXW-J9 and its cell lysate have good ethyl carbamate degradation function. They can significantly reduce EC content in different substrates (baijiu, red wine, yogurt, vinegar, soy sauce, etc.) and maintain high degradation activity in high concentration ethanol environment, low pH fermentation environment or high salt complex fermentation environment.

[0029] (3) The strain ZYXW-J9 is sensitive to common fungal antibiotics, does not hemolyze, and has good safety.

[0030] (4) The strain ZYXW-J9 can produce flavor substances such as phenylethanol, ethyl acetate, ethyl isovalerate, butyl acetate, ethyl palmitate, and ethyl linoleate during fermentation.

[0031] (5) The strain ZYXW-J9 can tolerate the gastrointestinal environment, has antioxidant properties, and has excellent probiotic properties.

[0032] Based on the aforementioned excellent characteristics of strain ZYXW-J9, this strain, as a starter culture, can ensure the safety and flavor quality of fermented foods, shorten the fermentation cycle, and significantly improve the nutritional value of fermented foods.

[0033] Preservation of biological materials Pichia mansoni ( Pichia manshurica ZYXW-J9, categorized and named Pichia manshurica It was deposited on August 1, 2024 at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No: 64936, and the deposit address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing. Attached Figure Description

[0034] Figure 1 This is a streak image of the Pichia mansoni ZYXW-J9 strain of the present invention.

[0035] Figure 2 This is a microscopic image of Pichia mansoni ZYXW-J9, the product of this invention.

[0036] Figure 3 This is a graph showing the acid-tolerant growth curves of Pichia mansoni ZYXW-J9 under different pH conditions. Figure 4 This is a growth curve of the ethanol tolerance of Pichia mansoni ZYXW-J9 according to the present invention. Detailed Implementation

[0037] The following embodiments are merely preferred embodiments of the present invention, but the scope of protection of the present invention is not limited thereto. The present invention mainly describes the strains and the application ideas based on the strains. Simple parameter substitutions in the embodiments cannot be described one by one in the embodiments. Any other changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention should be considered as equivalent substitutions. Any person skilled in the art should be covered within the scope of protection of the present invention within the technical scope disclosed in the present invention. The present invention will be further described below with reference to the accompanying drawings and specific embodiments. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field; unless otherwise specified, the reagents and materials used in the following embodiments are all commercially available.

[0038] All culture media used in this invention were prepared using conventional methods. Unless otherwise specified, the molecular biology operations involved in the examples refer to Sambrook J et al., eds., Science Press, 2002, Molecular Cloning: A Laboratory Manual (3rd Edition); or to the product instruction manual.

[0039] The culture medium used in the following examples was prepared as follows: YPD liquid culture medium: 20.0g peptone, 10.0g yeast extract, 20.0g glucose, distilled water to 1L, adjust pH to 7.0, autoclave for 20min.

[0040] YPD solid medium: 20.0g peptone, 10.0g yeast extract, 20.0g glucose, 15g agar, distilled water to 1L, adjust pH to 7.0, autoclave for 20min, then pour into plates.

[0041] YNB liquid culture medium: Ammonium sulfate 5000 mg, inositol 2 mg, nicotinic acid (vitamin B3) 0.4 mg, thiamine hydrochloride (vitamin B1) 0.4 mg, copper sulfate 0.04 mg, potassium dihydrogen phosphate 1000 mg, boric acid 0.5 mg, pyridoxine hydrochloride (vitamin B6) 0.4 mg, calcium pantothenate (vitamin B5) 0.4 mg, para-aminobenzoic acid 0.2 mg, magnesium sulfate 500 mg, manganese sulfate 0.4 mg, zinc sulfate 0.4 mg, ferric chloride 0.2 mg, riboflavin (vitamin B2) 0.2 mg, calcium chloride 100 mg, potassium iodide 0.1 mg, sodium molybdate 0.2 mg, biotin (vitamin B7, H) 0.002 mg, folic acid (vitamin B9) 0.002 mg, sodium chloride 100 mg, distilled water to 1 L, filter head sterilized.

[0042] YNB solid culture medium: Ammonium sulfate 5000 mg, inositol 2 mg, nicotinic acid (vitamin B3) 0.4 mg, thiamine hydrochloride (vitamin B1) 0.4 mg, copper sulfate 0.04 mg, potassium dihydrogen phosphate 1000 mg, boric acid 0.5 mg, pyridoxine hydrochloride (vitamin B6) 0.4 mg, calcium pantothenate (vitamin B5) 0.4 mg, para-aminobenzoic acid 0.2 mg, magnesium sulfate 500 mg, manganese sulfate 0.4 mg, zinc sulfate 0.4 mg, ferric chloride 0.2 mg, riboflavin (vitamin B2) 0.2 mg, calcium chloride 100 mg, potassium iodide 0.1 mg, sodium molybdate 0.2 mg, biotin (vitamin B7, H) 0.002 mg, folic acid (vitamin B9) 0.002 mg, sodium chloride 100 mg, 15 g agar, distilled water to 1 L, filter head sterilized.

[0043] The EC content determination methods involved in the following examples are as follows: The residual amount of EC in the culture supernatant was determined according to the national standard method GB5009.223-2014, with uninoculated YPD medium as a control. Each treatment was repeated in triplicate. The concentration of ethyl carbamate was calculated based on the peak area and the standard curve.

[0044] Degradation rate calculation formula: Degradation rate (%) = (EC content in control group - EC content in experimental group) / EC content in control group × 100% In the following comparative examples, Rhodotorula glutinis CGMCC No. 23534 (disclosed in patent CN 115287203B), Agrobacterium tumefaciens CGMCC No. 21309 (disclosed in patent CN 113174342B), and Agrobacterium tumefaciens CGMCC No. 21308 (disclosed in patent CN 113337417B) were all strains previously screened by the inventors' team; Pichia mansoni CICC 1352 and CICC31428 were purchased from the China Industrial Microbial Culture Collection Center.

[0045] Example 1: Pichia mansoni ( Pichia manshurica Separation and preparation of ZYXW-J9 1. Isolation and purification of bacterial strains: (1) Sample: Fermented vinegar mash collected from Qingxu County, Shanxi Province.

[0046] (2) The separation and screening method involves first enriching the antioxidants and then verifying the EC degradation function: Take 1 g of vinegar mash and add it to 10 mL of YNB liquid medium containing 5 g / L EC. Transfer the sample to a homogenizing bag and agitate for 30 min. Under aseptic conditions, transfer a portion of the liquid from the homogenizing bag to a 50 mL centrifuge tube and incubate at 30 ℃ and 200 rpm for 16 h. After the medium becomes turbid, dilute and spread it onto YNB solid plates containing 10 g / L EC as the sole carbon source. Incubate upside down at 28 ℃ for 72 h until colonies form. Streak single colonies onto YNB solid plates containing 10 g / L EC as the sole carbon source. Purify for three generations. Examine single colonies under a microscope to confirm they are uncontaminated. Cryopreserve the strain, naming it ZYXW-J9. It was also found that strain ZYXW-J9 can grow well with EC as the sole carbon source, indicating that strain ZYXW-J9 has EC degradation function.

[0047] 2. Identification of strain ZYXW-J9: (1) The genome of strain ZYXW-J9 was extracted and identified by 26S rRNA PCR. The genome extraction method was carried out according to the glass bead method in the "Concise Guide to Molecular Biology Experiments".

[0048] PCR conditions suddenly changed: The amplification system consisted of: 25 µL of 2×Taq Master Mix, 2 µL of primer D1, 2 µL of primer D2, 19 µL of sterile water, and 2 µL of template. The PCR reaction conditions were: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 15 s; 50 °C annealing for 15 s; 72 °C extension for 1 min; 72 °C for 15 min; 30 cycles; and isothermal at 4 °C.

[0049] After PCR, agarose gel electrophoresis (1.0%) was performed to detect the PCR products of the yeast samples. Bright bands indicated successful PCR amplification of the genome, which could then be sent for sequencing. Primer sequences: D1: GCATATCAATAAGCGGAGGAAAAG, D2: GGTCCGTGTTTCAAGACGG.

[0050] The 26S rRNA sequence of the strain ZYXW-J9 is as follows: (SEQ ID NO.1).

[0051] Blastn analysis of the sequencing results revealed that this bacterium is related to... Pichia manshurica The highest homology was 95.92%. Morphological and 26S rRNA identification confirmed that strain ZYXW-J9 is... Pichia manshurica It was named Pichia mansoni ( Pichia manshurica ZYXW-J9.

[0052] (2) Strain ZYXW-J9 grew well on YPD solid plates, and after culturing at 28℃ for 24-48 h, as... Figure 1 , Figure 2 As shown, it forms moist, round, raised, smooth, light pink colonies; microscopic examination reveals that the bacteria are oval and rod-shaped, turning orange-red after standing at 4 ℃ for 2 days. The optimal growth temperature is 28 ℃, and the optimal pH is 5-6.

[0053] Based on morphological and 26S rRNA identification, this EC-degrading strain ZYXW-J9 was classified as Pichia manshurica .

[0054] Example 2: Pichia mansoni ( Pichia manshurica Preparation of ZYXW-J9 bacterial agent 1. Preparation of Pichia mansoni ZYXW-J9 liquid inoculum Dispensing of YPD medium: Sterile YPD medium is aseptically dispensed into 50 mL centrifuge tubes (10 mL), 250 mL Erlenmeyer flasks (50 mL), and 5 L baffled Erlenmeyer flasks (1000 mL).

[0055] Remove the glycerol tube containing *Pichia mansoni* ZYXW-J9 from the -80 ℃ freezer. Transfer one loopful of the bacterial ice residue to 10 mL of YPD liquid medium and incubate at 200-250 rpm and 28 ℃ with shaking for 24 h. Then, transfer the culture at a 1% (v / v) inoculation rate to a 250 mL Erlenmeyer flask containing 50 mL of YPD medium and continue incubating at 200-250 rpm and 28 ℃ with shaking for 24 h. Finally, transfer the culture at a 1% (v / v) inoculation rate to a 3 L Erlenmeyer flask containing 750 mL of YPD medium and incubate at 200-250 rpm and 28 ℃ with shaking for 24 h. Centrifuge the bacterial culture C at 8000 rpm for 10 min to collect the cells. Dilute the *Pichia mansoni* ZYXW-J9 cells with a 0.9% sodium chloride aqueous solution to prepare 1×10⁻⁶ cells. 9 -1×10 10 Prepare a bacterial suspension of CFU / mL for later use.

[0056] 2. Preparation of Pichia mansoni ZYXW-J9 solid inoculum Pichia mansoni ZYXW-J9 was inoculated into YPD medium, cultured at 28 ℃ for 48 h, and then centrifuged to prepare 1×10⁻⁶ cells. 8A bacterial suspension of CFU / mL was mixed with an equal mass of lyophilization protectant (a mixed solution of 100 g / L skim milk, 30 g / L inulin, 20 g / L maltodextrin, and 20 g / L resistant dextrin). After pre-freezing at -40 °C, the mixture was placed in a vacuum freeze dryer and vacuum dried (cold trap temperature -45 °C, vacuum degree 10-20 Pa) for 36-48 h. Drying was stopped when the moisture content of the bacterial powder dropped to 2.5%-3%, thus obtaining the bacterial agent in dry powder form. The viable count of Pichia mansoni ZYXW-J9 in the bacterial agent reached 1×10⁻⁶. 11 -1×10 12 CFU / g.

[0057] Another method involves inoculating Pichia mansoni ZYXW-J9 into YPD medium, culturing at 28 ℃ for 48 h, and then centrifuging to prepare the cells into 10⁻⁶ cells. 8 A bacterial suspension of CFU / mL was mixed with an equal mass of spray drying protectant (final concentration of 100 g / L skim milk, 20 g / L glycerol, and 30 g / L sucrose), and spray-dried at 35 °C to obtain a dry powder form of bacterial agent. The viable cell count of Pichia mansoni ZYXW-J9 in the bacterial agent was 1 × 10⁻⁶. 11 CFU / g.

[0058] Example 3: Pichia mansoni ( Pichia manshurica Preparation of EC degradation agent of ZYXW-J9 strain The specific steps are as follows: (1) Pichia mansoni strain ZYXW-J9 was inoculated into YPD liquid medium for activation and cultured at 25-30 ℃ and 150-250 rpm for 24 h to obtain seed liquid.

[0059] (2) Inoculate the seed culture at a rate of 10% into a production fermenter containing YPD fermentation medium (70% full), with an aeration rate of 0.6~1.0 m. 3 The stirring speed was 300 rpm, the culture temperature was controlled at 28 ℃, and the culture time was 48~96 h. After fermentation, the number of cells obtained was 3×10⁶. 8 ~1.8×10 9 ZYXW-J9 culture medium with CFU / mL.

[0060] After fermentation, the fermentation broth is collected under aseptic conditions and directly packaged into liquid dosage forms in packaging bottles.

[0061] (3) After fermentation, the ZYXW-J9 culture medium collected in step (2) is freeze-dried and then the volume is adjusted back to 1 / 20 of the original volume using deionized water to obtain ZYXW-J9 fermentation broth. (4) After fermentation, the ZYXW-J9 culture medium collected in step (2) is centrifuged at 4000 g for 10 min to collect the ZYXW-J9 cell precipitate; (5) After diluting the bacterial precipitate obtained in step (4) with PBS buffer, a bacterial suspension of strain ZYXW-J9 was obtained, with a bacterial concentration of OD 600 = 20. (6) The bacterial suspension of strain ZYXW-J9 obtained in step (5) was subjected to cell wall disruption to obtain ZYXW-J9 cell lysate; (7) The ZYXW-J9 bacterial fermentation broth prepared in step (3), the ZYXW-J9 bacterial suspension prepared in step (5), and the ZYXW-J9 cell lysate prepared in step (6) were respectively encapsulated with sodium alginate to prepare corresponding immobilized microspheres. The specific steps are as follows: Sodium alginate (concentration of 40 g / L) was mixed with the ZYXW-J9 bacterial fermentation broth prepared in step (3), the ZYXW-J9 bacterial suspension prepared in step (5), and the ZYXW-J9 cell lysis broth prepared in step (6) at a volume ratio of 1:1. The mixture was then drawn up with a 10 mL syringe and slowly dripped into the solidification solution (0.6% CaCl2 saturated boric acid solution) at a rate of 2-10 drops / second. The solidification time was 5 h. Immobilized cells were thus obtained. The immobilized cells were rinsed 3-4 times with physiological saline, then coated with a chitosan (2%) solution for 40 min. They were then rinsed again with 0.8% physiological saline 3-4 times, drained, and stored at 4 °C for later use, thus preparing the EC degradation agent.

[0062] The embedding preparations made from the ZYXW-J9 bacterial fermentation broth prepared in step (3), the ZYXW-J9 bacterial suspension prepared in step (5), and the ZYXW-J9 cell lysate prepared in step (6) are EC degrading agent 1, EC degrading agent 2, and EC degrading agent 3, respectively.

[0063] (8) The bacterial concentrations of ZYXW-J9 in EC degradation agent 1 and EC degradation agent 2 were measured respectively, and were: OD 600 =10、OD 600 =20, the absorbance of the EC degradation agent 3 solution at 600 nm is 0.3.

[0064] Example 4: Pichia mansoni ( Pichia manshurica Application of ZYXW-J9 in Baijiu 20 mL each of EC degradation agent 1, EC degradation agent 2, and EC degradation agent 3 prepared in Example 3 were used to treat baijiu samples containing EC, as detailed below: EC degradation agents 1, 2, and 3 (20 mL each) were added to 60 mL of 45% ABV baijiu (Chinese liquor), and each was fermented in a 250 mL flask at 28 °C and 100 rpm for 5 days. The control group was fermented in a 250 mL flask with 20 mL of YPD medium added to 60 mL of 45% ABV baijiu for 24 h at 28 °C and 30 rpm. After the reaction, 2 mL of the supernatant was collected and filtered through a 0.2 µm filter membrane. The residual EC concentration in the supernatant was measured, with three replicates for each treatment. The results are shown in Table 1. EC degradation agents 1, 2, and 3 all reduced the EC concentration in baijiu, decreasing it from 230.37 μg / L to 74.27 μg / L, 85.76 μg / L, and 42.07 μg / L, respectively, with degradation rates of 67.76%, 62.76%, and 81.74%.

[0065] Table 1. EC degradation rate of different EC degrading agents

[0066] Example 5: Pichia mansoni ( Pichia manshurica Application of ZYXW-J9 in Fermented Foods The following examples use EC degrading agent 3 from Example 4 as an example to demonstrate that the strain of this application can degrade EC in various fermented foods and alcoholic beverages. The samples used below are all commercially available products.

[0067] The treatment method for EC degrading agent 3 involved in the following examples is as follows: Pichia mansoni ZYXW-J9 strain was inoculated into YPD liquid medium for activation, and cultured at 25-30 ℃ and 150-250 rpm for 24 h with constant temperature shaking to obtain seed culture. The seed culture was inoculated at a 10% inoculation rate into a production fermenter containing YPD fermentation medium (70% liquid volume), with an aeration rate of 0.6-1.0 m³ / h. 3 The stirring speed was 300 rpm, the culture temperature was controlled at 28 ℃, and the culture time was 48~96 h. After fermentation, the number of cells obtained was 3×10⁶. 8 ~1.8×10 9 ZYXW-J9 culture medium was collected at CFU / mL. After fermentation, the ZYXW-J9 culture medium was collected and centrifuged at 4000 g for 10 min to collect the ZYXW-J9 cell precipitate. After dilution with PBS buffer, a ZYXW-J9 cell suspension was obtained, with a cell concentration of: OD 600=20; The cell walls of the bacteria were broken to obtain ZYXW-J9 cell lysate, which was then mixed with 4% sodium alginate at a volume ratio of 1:1. The mixture was drawn up with a 10 mL syringe and slowly dripped into the curing solution (0.6% CaCl2 saturated boric acid solution) at a rate of 2-10 drops / second for about 5 h to prepare immobilized cells; The immobilized cells were rinsed 3-4 times with physiological saline and coated with chitosan (2%) solution for 40 min. They were then rinsed again with 0.8% physiological saline 3-4 times, drained, and stored at 4 ℃ for later use.

[0068] (1) Preparation of red wine EC reaction solution: 60 mL of red wine (12 degrees); EC: 3.0 ppm; EC degradation agent 3: 20 mL.

[0069] (2) Preparation of yogurt EC reaction solution: 60 mL yogurt; EC: 3.0 ppm; EC degradation agent 3: 20 mL.

[0070] (3) Preparation of vinegar EC reaction solution: vinegar 60 mL; EC: 3.0 ppm; EC degradation agent 3: 20 mL.

[0071] (4) Preparation of soy sauce EC reaction solution: 60 mL soy sauce; EC: 3.0 ppm; EC degradation agent 3: 20 mL.

[0072] (5) Preparation of sauce EC reaction solution: 30 g of sauce, add 30 mL of deionized water, EC: 3.0 ppm; EC degradation agent 3: 20 mL.

[0073] The above reaction solution was incubated in a 250 mL Erlenmeyer flask at 28 °C and 100 rpm for 5 days.

[0074] Example 6: Pichia mansoni ( Pichia manshurica Application of ZYXW-J9 in alcoholic beverages The following examples use EC degrading agent 3 from Example 4 as an example to demonstrate that the strain of this application can degrade EC in actual alcoholic beverages. The samples used below are all commercially available products.

[0075] (1) Preparation of EC reaction solution for sesame-flavored baijiu: 60 mL of sesame-flavored baijiu (53 degrees); 20 mL of EC degradation agent 3. The initial EC content was 214.1 μg / L.

[0076] (2) Preparation of EC reaction solution for strong-aroma baijiu: 60 mL of strong-aroma baijiu (45 degrees); 20 mL of EC degradation agent 3. The initial EC content was 191.9 μg / L.

[0077] (3) Preparation of the EC reaction solution for Maotai-flavor liquor: 60 mL of Maotai-flavor liquor (42 degrees); 20 mL of EC degradation agent 3. The initial EC content was 72.8 μg / L.

[0078] (4) Preparation of EC reaction solution for light-aroma baijiu: 60 mL of light-aroma baijiu (38 degrees); 20 mL of EC degradation agent 3. The initial EC content is 46.2 μg / L.

[0079] (5) Preparation of EC reaction solution for rice wine: 60 mL of rice wine (15 degrees); 20 mL of EC degradation agent 3. The initial EC content is 307.2 μg / L.

[0080] The above reaction solution was incubated in a 250 mL Erlenmeyer flask at 28 °C and 100 rpm for 2 days.

[0081] Example 7: Pichia mansoni ( Pichia manshurica Application of ZYXW-J9 in reducing EC content during the fermentation of rice dregs vinegar Hainan fermented rice vinegar was prepared according to the traditional fermentation process of Hainan lees vinegar, including raw mash fermentation, cooked mash fermentation, distillation, and stir-frying. The volume of raw mash fermentation was 200 L in each batch. Rice and water were mixed in a ratio of 1:3. A traditional starter culture was used as the control group. The experimental group, based on the traditional starter culture dosage of the control group, was supplemented with 10... 8 Inoculate with Pichia mansoni at a CFU / L ratio ( Pichia manshurica ZYXW-J9 solid microbial agent was fermented at room temperature (24-30 ℃) for 30 days. The mixture was stirred using a food-grade electric mixer, three times a day for the first 7 days of fermentation, and once a day from the 8th to the 15th day. After that, it was sealed and statically fermented for 15 days to obtain raw vinegar mash. The alcohol was then separated by distillation to obtain the remaining mash.

[0082] Steam glutinous rice with water until cooked, add sweet wine yeast at 4 g / kg, and simultaneously add 10 7 Inoculate with Pichia manshurica ZYXW-J9 liquid inoculum at a ratio of CFU / kg, stir well, and let stand for 3 days to obtain cooked mash.

[0083] Raw mash and fermented mash were mixed in equal proportions, with three times the amount of water added. Additional ingredients such as scallions, ginger, garlic, chili peppers, garlic oil, and chili sauce were added, and the mixture was cooked at high temperature to produce fermented mash vinegar. The content of ethyl carbamate and flavor compounds in the raw mash, fermented mash, and fermented mash vinegar samples from both the control and experimental groups after fermentation were determined.

[0084] Example 8: Pichia mansoni ( Pichia manshurica Application of ZYXW-J9 in the vinegar fermentation process According to SB / T 10305-1999, the brewing process for aged vinegar, sorghum is crushed into 6-8 pieces → water is added at a material-to-liquid ratio of 1:0.6 to moisten the material → steaming for 2 hours → simmering for 15 minutes → adding warm water (twice the weight of the raw material) and soaking → adding Daqu (based on the weight of the raw material) at a ratio of 1:0.5, along with water equal to half the weight of the raw material, and simultaneously adding 10... 9 CFU / L inoculation with Pichia mansoni ZYXW-J9 liquid inoculum → pre-fermentation for 3 days, stirring twice daily → post-fermentation for 15 days → alcohol content above 5% → mix with vinegar mash, prepared according to a raw material: bran: rice bran ratio of 1:0.5:0.8, and simultaneously add 10 6 Inoculate with Pichia mansoni at a CFU / L ratio ( Pichia manshurica ZYXW-J9 solid microbial agent → acetic acid fermentation for 9 days, turning the mash daily → smoking the mash at 70℃ for 4 days → vinegar extraction → aging. The samples after vinegar extraction were directly tested for ethyl carbamate and flavor compound content. Example 9: Pichia mansoni ( Pichia manshurica Properties of strain ZYXW-J9 1. Safety evaluation of Pichia mansoni strain ZYXW-J9 (1) Antibiotic susceptibility test of Pichia mansoni ZYXW-J9 The antibiotic susceptibility spectrum of Pichia mansoni ZYXW-J9 was characterized using the paper disc diffusion method. Activated cells were prepared into 1×10⁻⁶ cells. 8 A CFU / mL bacterial suspension was prepared, and 200 μL of the suspension was spread onto YPD plates. Six common antifungal antibiotic susceptibility test discs (fluconazole (25 μg), ketoconazole (50 μg), miconazole (10 μg), fluriconazole (10 μg), itraconazole (10 μg), and nystatin (100 μg) were carefully placed on the discs, with a spacing of at least 24 mm between each disc. After incubation at 28 ℃ for 48 h, the diameter of the inhibition zone was measured and counted to analyze resistance (≤14 mm), mid-term inhibition (14-20 mm), or susceptibility (≥20 mm). Triple replicates were performed. The results showed that *Pichia mansoni* ZYXW-J9 was sensitive to all six fungal antibiotics and did not exhibit resistance to these antibiotics, indicating good strain safety.

[0085] (2) Hemolysis experiment of Pichia mansoni ZYXW-J9 Culture medium preparation: Columbia agar + 5% defibrinated sheep blood will be prepared. Isolate the bacterial culture (approximately 1 × 10⁻⁶). 8 (CFU / mL) Pichia pastoris ZYXW-J9 was streaked onto a Columbia agar plate containing 5% defibrinated sheep blood and incubated at 28 °C for 48 h. The presence of a clear zone was then observed. Staphylococcus aureus ATCC 25923 was used as a positive control.

[0086] The results showed that the Staphylococcus aureus ATCC 25923 positive control strain exhibited a wide (6-8 mm), well-defined, and completely transparent hemolytic zone around its colonies, typical of β-hemolysis. In contrast, the Pichia mansoni ZYXW-J9 colonies provided in this invention showed no hemolysis around their colonies, indicating good strain safety.

[0087] 2. Evaluation of the prebiotic properties of Pichia mansoni strain ZYXW-J9 (1) Artificial simulation of gastric juice experiment Preparation of simulated gastric juice: Add 16.4 mL of dilute hydrochloric acid to approximately 900 mL of water and 10 g of pepsin, mix thoroughly, and then add water to bring the volume to 1000 mL. Adjust the pH to 2.5, filter through a 0.22 μm filter membrane for sterilization, and store at 4 °C.

[0088] Simulated gastric juice tolerance experiment: A single colony of ZYXW-J9 was picked from a YPD agar solid plate and transferred to YPD liquid medium for culture, yielding a bacterial suspension (approximately 1 × 10⁻⁶). 8 (CFU / mL) Collect 5 mL of bacterial culture by centrifugation at 10000 rpm, 4 °C for 5 min. Wash twice with sterile phosphate buffer (pH 7.4), and repeat the above steps. Resuspend the bacterial cells in 5 mL of simulated gastric fluid (pH 2.5). Count the number of viable bacteria after incubation in simulated gastric fluid (pH 2.5) for 0 h and 3 h using the plate spread method, with three replicates for each group. *Escherichia coli* Nissle 1917 was used as a positive control.

[0089] Survival rate (%) = logCFU(N1) / logCFU(N0) × 100%.

[0090] Wherein, N0 represents the number of viable bacteria after incubation in artificial simulated gastric fluid for 0 h, and N1 represents the number of viable bacteria after incubation in artificial simulated gastric fluid for 3 h.

[0091] The results showed that after 3 h of culture in simulated gastric juice conditions (containing 0.3% pepsin, pH 2.5), the survival rate of ZYXW-J9 was 86.73%, while the survival rate of the positive control group, *E. coli* Nissle 1917, was 86.14%. These results indicate that ZYXW-J9 exhibits a better survival rate in simulated gastric juice compared to *E. coli* Nissle 1917.

[0092] (2) Artificial simulation of intestinal fluid experiment Prepare simulated intestinal fluid: Prepare a 1 mg / mL solution of trypsin using sterile phosphate buffer (pH 7.4), add 0.3% bovine bile salt, and adjust the pH to 7.4 with 1 mol / L sodium hydroxide. Then filter the solution through a 0.22 μm microporous membrane for sterilization before use.

[0093] Simulated intestinal fluid tolerance test: A single colony of ZYXW-J9 was picked from a YPD agar solid plate and transferred to YPD liquid medium for culture, yielding a bacterial suspension (approximately 1 × 10⁻⁶). 8 (CFU / mL); collect 5 mL of bacterial culture by centrifugation at 10000 rpm, 4 °C for 5 min, wash twice with sterile phosphate buffer (pH 7.4), and repeat the above steps. Resuspend the bacterial cells in 5 mL of simulated intestinal fluid (pH 7.4). Count the number of viable bacteria at 0 h and 4 h in the simulated intestinal fluid (pH 7.4) using the plate spread method, with three replicates for each group. *Escherichia coli* Nissle 1917 was used as a positive control.

[0094] Survival rate (%) = logCFU(N1) / logCFU(N0)*100%; where N0 represents the number of viable bacteria after incubation in artificial simulated intestinal fluid for 0 hours, and N1 represents the number of viable bacteria after incubation in artificial simulated intestinal fluid for 3 hours.

[0095] The results showed that after 4 h of culture in simulated intestinal fluid (containing 0.3% trypsin and 0.3% bovine bile salts), the survival rate of ZYXW-J9 was 85.92%, while the survival rate of the positive control group, Escherichia coli Nissle 1917, was 84.64%. These results indicate that ZYXW-J9 has a better survival rate in simulated intestinal fluid compared to Escherichia coli Nissle 1917.

[0096] (3) Antioxidant experiment DPPH free radical scavenging rate test: 0.0078 g DPPH was dissolved in anhydrous ethanol and diluted to 100 ml to prepare 0.2 mmol / L DPPH. It was stored in the dark and used immediately.

[0097] Following the steps (1) above, a bacterial concentration of 10 was obtained. 8 ZYXW-J9 bacterial culture at CFU / mL; The above 10 8 ZYXW-J9 bacterial culture with CFU / mL was mixed with 100% ethanol DPPH solution (0.2 mM) at a volume ratio of 1:1 and incubated in the dark at 25 °C for 30 min.

[0098] ZYXW-J9 bacterial culture and 100% ethanol were used as blanks, while DPPH ethanol solution was used as a control. The supernatant was collected after centrifugation at 2330×g (4120 rpm) for 10 minutes. The absorbance was measured in triplicate at 517 nm.

[0099] ABTS free radical scavenging test: ABTS (14 mM) and potassium persulfate (5 mM) were dissolved in 0.1 M potassium phosphate buffer (pH 7.4), mixed in a 1:1 ratio, and reacted at 25 °C for 12-16 h.

[0100] 100 μL of strain DL-BJ01 (10 8 Add CFU / mL to 900 μL of ABTS solution and incubate in the dark at 25 °C for 15 min. After centrifugation (14000 g, 1 min), measure the absorbance of the supernatant at 734 nm.

[0101] The results showed that ZYXW-J9 had a DPPH scavenging activity of 91.38% and an ABTS scavenging activity of 89.13%, indicating that strain ZYXW-J9 has good antioxidant activity.

[0102] 3. Analysis of acid and alcohol tolerance of Pichia mansoni strain ZYXW-J9 (1) Acid tolerance test of Pichia mansoni strain ZYXW-J9: The number of live bacteria was 3×10 8 CFU / mL of Pichia mansoni ZYXW-J9 bacterial suspension was inoculated at a ratio of 3% (v / v) into YPD liquid medium at pH 2.0, 3.0, 4.0, 5.0, and 6.0, and incubated at 28 °C. OD values ​​of the samples were measured every 2 h using an automated growth curve analyzer. 600nm Value determination. Results are as follows: Figure 3 As shown, the strain still exhibits a significant growth trend at pH 3.0. This indicates that Pichia mansoni ZYXW-J9 has good tolerance to acidic environments and is suitable for the low pH nutrient environment of fermented foods, which is beneficial for its role in degrading EC in fermented foods.

[0103] (2) Ethanol tolerance test of Pichia mansoni strain ZYXW-J9: The number of live bacteria was 3×10 8 CFU / mL Pichia mansoni ZYXW-J9 bacterial suspension was inoculated at 3% (v / v) in YPD liquid medium with ethanol contents of 0%, 5%, 10%, and 15%, respectively, and incubated at 28 °C. OD values ​​of the samples were measured every 2 h using an automated growth curve analyzer. 600nm Value determination. Results are as follows: Figure 4As shown, the strain still exhibits a significant growth trend even at an ethanol content of 15%. This indicates that Pichia mansoni ZYXW-J9 has good tolerance to an ethanol content of 15%, making it suitable for the high-alcohol nutritional environment of fermented products such as alcoholic beverages, and it is also beneficial for effectively degrading EC in high-alcohol systems.

[0104] Comparative Example 1: Application of Rhodotorula glutinis CGMCC No. 23534 strain in Baijiu (Chinese liquor) The Pichia mansoni strain ZYXW-J9 in Example 4 was replaced with Rhodotorula buergerianum strain CGMCC No. 23534, and other conditions were the same as in Example 4. This sample was named Comparative Example 1.

[0105] Comparative Example 2: Application of Agrobacterium tumefaciens CGMCC No. 21309 strain in Baijiu (Chinese liquor) The Pichia mansoni strain ZYXW-J9 in Example 4 was replaced with Agrobacterium CGMCC No. 21309, and other conditions were the same as in Example 4. This sample was named Comparative Example 2.

[0106] Comparative Example 3: Application of Agrobacterium CGMCC No. 21308 in Baijiu (Chinese liquor) The Pichia mansoni ZYXW-J9 strain in Example 4 was replaced with Agrobacterium CGMCC No. 21308, and other conditions were the same as in Example 4. This sample was named Comparative Example 3. Comparative Example 4: Application of Pichia mansoni CICC 1352 strain in Baijiu (Chinese liquor) The Pichia mansoni strain ZYXW-J9 in Example 4 was replaced with Pichia mansoni strain CICC1352, and other conditions were the same as in Example 4. This sample was named Comparative Example 4. Comparative Example 5: Application of Pichia mansoni strain CICC31428 in Baijiu (Chinese liquor) The Pichia mansoni strain ZYXW-J9 in Example 4 was replaced with Pichia mansoni strain CICC31428, and other conditions were the same as in Example 4. This sample was named Comparative Example 5. Comparative Example 6: Application of Rhodotorula glutinis CGMCC No. 23534 strain in fermented foods The Pichia mansoni strain ZYXW-J9 used in the preparation of the degradation agent in Example 5 was replaced with Rhodotorula buergerianum strain CGMCC No. 23534, while other conditions remained the same as in Example 5. This sample was named Comparative Example 6. Comparative Example 7: Application of Agrobacterium rhizogenes CGMCC No. 21309 strain in fermented foods The Pichia mansoni strain ZYXW-J9 used in the preparation of the degradation agent in Example 5 was replaced with Agrobacterium CGMCC No. 21309, while other conditions remained the same as in Example 5. This sample was named Comparative Example 7. Comparative Example 8: Application of Agrobacterium CGMCC No. 21308 in Fermented Foods The Pichia mansoni ZYXW-J9 strain used in the preparation of the degradation agent in Example 5 was replaced with Agrobacterium CGMCC No. 21308, while other conditions remained the same as in Example 5. This sample was named Comparative Example 8. Comparative Example 9: Application of Pichia mansoni CICC 1352 strain in fermented foods The Pichia mansoni strain ZYXW-J9 used in the preparation of the degradation agent in Example 5 was replaced with Pichia mansoni strain CICC1352, while other conditions remained the same as in Example 5. This sample was named Comparative Example 9. Comparative Example 10: Application of Pichia mansoni strain CICC31428 in Baijiu (Chinese liquor) The Pichia mansoni strain ZYXW-J9 used in the preparation of the degradation agent in Example 5 was replaced with Pichia mansoni strain CICC31428, while other conditions remained the same as in Example 5. This sample was named Comparative Example 10. Comparative Example 11: Application of Rhodotorula glutinis CGMCC No. 23534 strain in alcoholic beverages The degrading agent prepared by Pichia mansoni strain ZYXW-J9 used in Example 6 was replaced with the degrading agent prepared by Rhodotorula buergerianum strain CGMCC No. 23534, and other conditions were the same as in Example 6. This sample was named Comparative Example 11. Comparative Example 12: Application of Agrobacterium tumefaciens CGMCC No. 21309 strain in alcoholic beverages The degradation agent prepared by Pichia mansoni strain ZYXW-J9 used in Example 6 was replaced with the degradation agent prepared by Agrobacterium CGMCC No. 21309, and other conditions were the same as in Example 6. This sample was named Comparative Example 12. Comparative Example 13: Application of Agrobacterium CGMCC No. 21308 in Alcoholic Beverages The degradation agent prepared by Pichia mansoni strain ZYXW-J9 used in Example 6 was replaced with the degradation agent prepared by Agrobacterium CGMCC No. 21308, and other conditions were the same as in Example 6. This sample was named Comparative Example 13. Comparative Example 14: Application of Pichia mansoni CICC 1352 strain in alcoholic beverages The degradation agent prepared by Pichia mansoni strain ZYXW-J9 used in Example 6 was replaced with the degradation agent prepared by Pichia mansoni strain CICC1352, while other conditions remained the same as in Example 6. This sample was named Comparative Example 14. Comparative Example 15: Application of Pichia mansoni strain CICC31428 in alcoholic beverages The degradation agent prepared by Pichia mansoni strain ZYXW-J9 used in Example 6 was replaced with the degradation agent prepared by Pichia mansoni strain CICC31428, while other conditions remained the same as in Example 6. This sample was named Comparative Example 15. Comparative Example 16: Application of Rhodotorula glutinis CGMCC No. 23534 strain in reducing EC content during fermentation of rice wine lees. The press 10 used in Example 7 8 Inoculate with Pichia mansoni at a CFU / L ratio ( Pichia manshurica ZYXW-J9 solid microbial agent, ferment at room temperature (24-30 ℃) for 30 days, then replace with 10 8 Inoculate with *Rhodotorula buergerianum* CGMCC No. 23534 solid inoculum at a CFU / L ratio and ferment at room temperature (24-30 °C) for 30 days, with other conditions consistent with Example 7. This sample is named Comparative Example 16.

[0107] Comparative Example 17: Application of Agrobacterium tumefaciens CGMCC No. 21309 in reducing EC content during fermentation of rice dregs vinegar The press 10 used in Example 7 8 Inoculate with Pichia mansoni at a CFU / L ratio ( Pichia manshurica ZYXW-J9 solid microbial agent, ferment at room temperature (24-30 ℃) for 30 days, then replace with 10 8 Inoculate with *Agrobacterium tumefaciens* CGMCC No. 21309 solid inoculum at a CFU / L ratio and ferment at room temperature (24-30 °C) for 30 days, with other conditions consistent with Example 7. This sample is named Comparative Example 17.

[0108] Comparative Example 18: Application of Agrobacterium CGMCC No. 21308 in reducing EC content during fermentation of rice wine lees. The press 10 used in Example 7 8 Inoculate with Pichia mansoni at a CFU / L ratio ( Pichia manshurica ZYXW-J9 solid microbial agent, ferment at room temperature (24-30 ℃) for 30 days, then replace with 10 8Inoculate with Agrobacterium CGMCC No. 21308 solid inoculum at a CFU / L ratio and ferment at room temperature (24-30 °C) for 30 days, with other conditions consistent with Example 7. This sample is named Comparative Example 18.

[0109] Comparative Example 19: Application of Pichia mansoni strain CICC 1352 in reducing EC content during fermentation of rice wine lees. The press 10 used in Example 7 8 Inoculate with Pichia mansoni at a CFU / L ratio ( Pichia manshurica ZYXW-J9 solid microbial agent, ferment at room temperature (24-30 ℃) for 30 days, then replace with 10 8 Pichia mansoni CICC 1352 solid inoculum was inoculated at a CFU / L ratio and fermented at room temperature (24-30 °C) for 30 days, with other conditions consistent with Example 7. This sample was named Comparative Example 19.

[0110] Comparative Example 20: Application of Pichia mansoni strain CICC31428 in reducing EC content during fermentation of rice wine lees. The press 10 used in Example 7 8 Inoculate with Pichia mansoni at a CFU / L ratio ( Pichia manshurica ZYXW-J9 solid microbial agent, ferment at room temperature (24-30 ℃) for 30 days, then replace with 10 8 Pichia mansoni CICC31428 solid inoculum was inoculated at a CFU / L ratio and fermented at room temperature (24-30 °C) for 30 days, with other conditions consistent with Example 7. This sample was named Comparative Example 20.

[0111] Comparative Example 21: Application of Rhodotorula glutinis CGMCC No. 23534 strain in reducing EC content during fermentation of rice wine lees vinegar The press 10 used in Example 8 9 Replace the CFU / L ratio of Pichia mansoni ZYXW-J9 liquid inoculum with a 10:10 ratio. 9 The sample was inoculated with Rhodotorula buergerianum CGMCC No. 23534 liquid inoculum at a CFU / L ratio, and other conditions were the same as in Example 8. This sample was named Comparative Example 21.

[0112] Comparative Example 22: Application of Agrobacterium rhizogenes CGMCC No. 21309 in reducing EC content during fermentation of rice dregs vinegar The press 10 used in Example 8 9 Replace the CFU / L ratio of Pichia mansoni ZYXW-J9 liquid inoculum with a 10:10 ratio. 9The sample was inoculated with Agrobacterium tumefaciens CGMCC No. 21309 liquid inoculum at a CFU / L ratio, and other conditions were the same as in Example 8. This sample was named Comparative Example 22.

[0113] Comparative Example 23: Application of Agrobacterium CGMCC No. 21308 in reducing EC content during fermentation of rice wine lees. The press 10 used in Example 8 9 Replace the CFU / L ratio of Pichia mansoni ZYXW-J9 liquid inoculum with a 10:10 ratio. 9 The inoculum was inoculated with Agrobacterium CGMCC No. 21308 liquid inoculum at a CFU / L ratio, and other conditions were the same as in Example 8. This sample was named Comparative Example 23.

[0114] Comparative Example 24: Application of Pichia mansoni strain CICC 1352 in reducing EC content during fermentation of rice wine lees vinegar The press 10 used in Example 8 9 Replace the CFU / L ratio of Pichia mansoni ZYXW-J9 liquid inoculum with a 10:10 ratio. 9 The sample was inoculated with Pichia mansoni CICC 1352 liquid inoculum at a CFU / L ratio, and other conditions were the same as in Example 8. This sample was named Comparative Example 24.

[0115] Comparative Example 25: Application of Pichia mansoni strain CICC31428 in reducing EC content during fermentation of rice wine lees. The press 10 used in Example 8 9 Replace the CFU / L ratio of Pichia mansoni ZYXW-J9 liquid inoculum with a 10:10 ratio. 9 The sample was inoculated with Pichia mansoni CICC31428 liquid inoculum at a CFU / L ratio, and other conditions were the same as in Example 8. This sample was named Comparative Example 25.

[0116] The samples from the examples and comparative examples were collected and tested, specifically including: (1) Determination of ethyl carbamate content The degradation agent with the highest degradation efficiency, 3, was named Example 4. Following the preparation method of degradation agent 3 in Example 3, corresponding degradation agents were prepared using strains from Comparative Examples 1 to 5, and these agents were used to treat baijiu samples containing EC. The degradation effect on EC in the baijiu was then measured. The results are shown in Table 2. The ZYXW-J9 degradation agent exhibits excellent degradation activity against EC in baijiu, retaining a high EC degradation capacity even under high ethanol concentration and acidic conditions, effectively removing EC from baijiu.

[0117] Table 2 EC concentrations after 24 hours of reaction in Baijiu

[0118] The reaction solutions from Examples 5 and Comparative Examples 6-10 were taken before and after treatment of fermented foods. 2 mL of the supernatant was extracted and filtered through a 0.2 µm filter membrane. The residual amount of EC in the culture supernatant was measured, thus indicating the change in EC concentration and degradation rate before and after treatment. YPD medium without inoculation was used as a control. Each treatment was repeated three times, and the results are shown in Table 3. The degradation agent prepared by Pichia mansoni ZYXW-J9 in Example 2 showed excellent degradation of EC in fermented foods. After 120 h of reaction, the degradation rate of EC in various fermented foods reached approximately 80%. This proves that the strain of this application can degrade EC in various commercially available fermented foods. The results show that the ZYXW-J9 fermented product and its EC degradation agent have excellent degradation effects on EC. The ethanol content, total acid, salt, and other components in the fermented food have little effect on the EC degradation activity of ZYXW-J9.

[0119] Table 3 EC concentrations after 5 days of reaction in a fermented food simulation system.

[0120] The reaction solutions of Examples 6, 11, 12, 13, 14, and 15 were taken before and after treatment with baijiu (Chinese liquor). 2 mL of the supernatant was extracted and filtered through a 0.2 µm filter membrane. The residual amount of EC in the culture supernatant was measured, thus indicating the change in EC concentration and degradation rate before and after treatment. YPD medium without inoculation was used as a control. Each treatment was repeated in triplicate. The results are shown in Table 4. The table shows that the degradation agent prepared by Pichia mansoni ZYXW-J9 in Example 6 effectively degraded EC in alcoholic beverages. The ZYXW-J9 fermentation product and its EC degradation agent showed good degradation of EC in actual fermented samples, achieving a degradation rate of approximately 70% in alcoholic beverages. Compared to Comparative Examples 11-15, Pichia mansoni ZYXW-J9 showed better EC degradation under higher ethanol concentration conditions.

[0121] Table 4. EC concentrations after 48 hours of reaction in alcoholic beverages.

[0122] Two mL of the supernatant from the fermented grains of Examples 7, 16, 17, 18, 19, and 20 were taken and filtered through a 0.2 µm filter membrane. The residual amount of EC in the culture supernatant was measured to determine the change in EC concentration and degradation rate before and after treatment. Uninoculated fermented grains were used as a blank control, with three replicates for each treatment. Table 5 shows that the EC degrading agent prepared by Pichia mansoni ZYXW-J9 in Example 7 has a good degradation effect on EC in the fermented grains, achieving a degradation rate of 78.30%, significantly higher than the comparative examples. This indicates that it can maintain a high EC degradation effect in an acidic fermentation environment.

[0123] Table 5. EC content (μg / L) in fermented vinegar made from fermented grains

[0124] Two mL of the supernatant from the vinegar samples after leaching inoculated with Examples 8, 21, 22, 23, 24, and 25 was filtered through a 0.2 µm filter membrane, and the residual amount of EC was determined. Uninoculated vinegar was used as a blank control to obtain the changes in EC concentration and degradation rate after inoculation. Each treatment was repeated in triplicate, and the results are shown in Table 6. The table shows that the EC degrading agent prepared by Pichia mansoni ZYXW-J9 in Example 8 has a significant degradation effect on EC in vinegar, with a degradation rate of 72.80%, significantly higher than that of the comparative examples. This indicates that it can retain a high EC degradation effect in an acidic fermentation environment.

[0125] Table 6. EC content in aged vinegar (leached vinegar samples) before and after inoculation and fermentation

[0126] (2) Determination of flavor compounds The flavor compound content was determined using gas chromatography-mass spectrometry (GC-MS). Sample pretreatment: 2 mL of vinegar sample was placed in a 20 mL headspace vial, and 10 μL of 2-octanol (600 mg / L) was added as an internal standard, with three replicates. Headspace solid-phase microextraction (SPE) conditions: The vial was incubated in a 60 °C water bath for 20 min. After incubation, the SPE fiber head was exposed above the headspace vial without contacting the sample, and headspace adsorption was allowed for 20 min. After extraction, the extraction head was inserted into the GC-MS system injection port for desorption. Gas chromatography conditions: Splitless injection mode; injection port temperature set to 250 °C; high-purity helium was used as the carrier gas at a flow rate of 1 mL / min. The temperature program was as follows: initial temperature 35 °C, held for 1 min; then increased to 70 °C at 10 °C / min, held for 2 min; next increased to 150 °C at 5 °C / min, held for 1 min; then increased to 200 °C at 7 °C / min, held for 1 min; finally increased to 240 °C at 3 °C / min, held for 2 min. Mass spectrometry conditions: EI mode, electron energy 70 eV; ion source temperature 230 °C; quadrupole temperature 150 °C; full scan mode; mass range m / z 30–350 u. 600 mg of 2-octanol (internal standard) was added to each sample. Semi-quantitative analysis included comparison of peak areas with the internal standard.

[0127] Table 7 shows that inoculation with Pichia manshuriensis ZYXW-J9 significantly promoted the synthesis of flavor compounds in the fermented vinegar system, and the content of esters increased significantly. Specifically, the ethyl acetate content in the fermented vinegar obtained from Example 7 was approximately 3.7 times the highest value in the control group and 11.8 times the lowest value. This fully demonstrates the ability of this strain to enhance flavor compound synthesis. Ethyl acetate contributes fruity aromas, and phenylethanol contributes floral aromas, indicating that Pichia manshuriensis ZYXW-J9 has strong aroma-enhancing potential during fermentation.

[0128] Table 8 shows that inoculation with Pichia mansoni ZYXW-J9 significantly promoted the synthesis of flavor compounds in the vinegar system, with a significant increase in the content of esters. This indicates that during vinegar fermentation, Pichia mansoni ZYXW-J9 can significantly promote the formation and accumulation of key flavor compounds such as phenylethanol, ethyl acetate, ethyl lactate, isoamyl acetate, ethyl hexanoate, ethyl octanoate, and isoamyl alcohol, confirming the universality of its flavor-enhancing function. This demonstrates that Pichia mansoni ZYXW-J9 has strong aroma-enhancing potential in fermentation.

[0129] Table 7. Analysis of flavor compounds in vinegar made from fermented grains (unit: μg / mL or μg / g)

[0130] Table 8. Analysis of flavor compounds in vinegar made from fermented grains (unit: μg / mL or μg / g)

[0131] Note: "-" indicates below the detection limit.

[0132] In conclusion, Pichia mansoni ZYXW-J9 exhibits significant advantages in treating EC in fermented products (such as baijiu, alcoholic beverages, and vinegar made from fermented grains), and also demonstrates a noticeable aroma-enhancing effect. This strain possesses excellent environmental adaptability, including tolerance to acid and ethanol, and exhibits good ethyl carbamate degradation ability, significantly improving the flavor and quality of fermented products. More importantly, this strain demonstrates good safety, laying a solid foundation for its widespread application in the industrial production of fermented foods and possessing significant application value in promoting the quality improvement and functionalization of traditional fermented foods.

[0133] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. Pichia mansoni ( Pichia manshurica ZYXW-J9 was deposited at the Guangdong Provincial Center for Microbial Culture Collection on August 1, 2024, with accession number GDMCC No: 64936.

2. A microbial preparation containing Pichia mansoni ZYXW-J9 or its fermentation product as described in claim 1.

3. The microbial preparation according to claim 2, characterized in that, The Pichia mansoni ZYXW-J9 microbial preparation exists in live form.

4. The microbial preparation according to claim 2, characterized in that, The microbial preparation is either immobilized cells of Pichia mansoni ZYXW-J9 or cell lysate of Pichia mansoni ZYXW-J9.

5. A method for degrading ethyl carbamate, characterized in that, The Pichia mansoni ZYXW-J9 as described in claim 1 or any of the microbial preparations described in claims 2 to 4 are contacted with ethyl carbamate in the reaction system and reacted at 25 to 30 °C for at least 24 hours.

6. The method according to claim 5, characterized in that, During food preparation, the aforementioned Pichia mansoni ZYXW-J9 or the aforementioned microbial preparation is added.

7. The method according to claim 6, characterized in that, The food items include, but are not limited to, fermented foods and alcoholic beverages.

8. A urethane degrading agent, characterized in that, The fermentation product of Pichia mansoni ZYXW-J9 as described in claim 1 was encapsulated to prepare an ethyl carbamate degrading agent.

9. The urethane degrading agent according to claim 8, characterized in that, The fermentation products include: Pichia mansoni ZYXW-J9 bacterial fermentation broth, Pichia mansoni ZYXW-J9 fermentation broth supernatant, Pichia mansoni ZYXW-J9 cell suspension, or Pichia mansoni ZYXW-J9 cell lysate.

10. The use of Pichia mansoni ZYXW-J9 as described in claim 1 or the microbial preparation as described in any one of claims 2 to 4 in the degradation of ethyl carbamate.

Citation Information

Patent Citations

  • CN113174342B

  • CN113337417B

  • CN115287203B

  • CN116987622A