Compositions, kits, uses and methods of removing nucleic acid residues in enzyme products

By combining engineered Cas9 peptides with pluripotent nucleases, and utilizing the specificity of the CRISPR-Cas9 system and His-tag affinity chromatography technology, the problem of host cell nucleic acid contamination in polymerase production was solved, thereby improving purity and experimental reliability.

CN122104638APending Publication Date: 2026-05-29BEIJING BOE TECH DEV CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411751637.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-11-29
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing technologies are insufficient to efficiently remove host cell nucleic acid contamination during polymerase production, leading to inaccurate experimental results and cross-contamination. Traditional methods are cumbersome and may introduce new contamination.

Method used

An engineered Cas9 peptide is used to form an RNP complex with RNA targeting DNA. This complex is then combined with an engineered totipotent nuclease. Host cell nucleic acids are removed through specific cleavage and His-tag affinity chromatography, ensuring polymerase purity.

Benefits of technology

It achieves efficient removal of host cell nucleic acid contamination from polymerase, simplifies operation, improves purity and experimental accuracy, and is suitable for large-scale production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104638A_ABST
    Figure CN122104638A_ABST
Patent Text Reader

Abstract

The application discloses a composition, a kit, a use and a method for removing nucleic acid residues in enzyme products. The application has the advantages that, compared with the prior art, the application can effectively remove host cell nucleic acid contamination in a polymerase, and particularly, through a specific sgRNA design of a target sequence, it is ensured that even if a residual part of the sequence does not affect subsequent microbial detection. In addition, the method is simple to operate, has high purification efficiency, and is suitable for large-scale polymerase production and application.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates generally to the field of biotechnology, and more particularly to a composition, kit, use thereof, and method for removing nucleic acid residues from enzyme products. Background Technology

[0002] Polymerases are indispensable tools in molecular biology research and applications, widely used in PCR amplification, DNA sequencing, gene editing, cloning, and expression. They catalyze the synthesis of DNA or RNA chains, enabling the replication and amplification of biomolecules. However, during polymerase production, especially when using microorganisms such as *E. coli* as host cells for expression, nucleic acid contamination from the host cells is often present. These contaminants may include plasmid DNA, genomic DNA, mRNA, and other non-target nucleic acid molecules. The presence of microbial nucleic acid contamination not only increases experimental costs but may also introduce non-specific amplification, leading to false positives or false negatives and affecting the accuracy and reliability of the data. Furthermore, nucleic acid contamination can cause cross-contamination in subsequent molecular biology operations, increasing the complexity and risk of experiments.

[0003] To address this issue, researchers have developed various methods for removing nucleic acid contamination. Traditional methods include phenol / chloroform extraction, ethanol precipitation, and column chromatography purification, but these methods suffer from drawbacks such as being cumbersome, time-consuming, producing low purity, or potentially introducing new contaminants. With the continuous advancement of molecular biology techniques, researchers are seeking more efficient, specific, and gentler methods for removing nucleic acid contamination. Summary of the Invention

[0004] Based on this, this application provides a composition comprising:

[0005] a) an engineered Cas9 polypeptide, or a polynucleotide encoding the engineered Cas9 polypeptide, wherein the engineered Cas9 polypeptide comprises a Cas9 domain and an affinity tag domain;

[0006] b) RNA targeting DNA, or one or more DNA polynucleotides encoding said target DNA RNA, wherein said target DNA RNA comprises:

[0007] DNA targeting regions, which contain nucleotide sequences complementary to the target sequence in the host cell's target DNA used to produce the enzyme, and

[0008] A protein-binding region that interacts with the Cas9 domain to form an engineered complex; and

[0009] c) an engineered totipotent nuclease, or a polynucleotide encoding the engineered totipotent nuclease, wherein the engineered totipotent nuclease comprises a totipotent nuclease domain and an affinity tag domain.

[0010] In another aspect, this application also provides a kit comprising the compositions described herein.

[0011] On the other hand, this application also provides the use of the compositions or kits described herein for removing nucleic acid residues from enzyme products.

[0012] On the other hand, this application also provides a method for removing nucleic acid residues from enzyme products, comprising:

[0013] 1) The engineered Cas9 peptide in the composition described herein is mixed with the RNA of the target DNA in solution to form an RNP complex and the ion concentration and pH of the mixed solution are adjusted. The enzyme product is added to the mixed solution so that the RNP complex can target and cleave the nucleic acid remaining in the enzyme product.

[0014] 2) Add the engineered totipotent nuclease to the mixed solution in step 1) and adjust the ion concentration and pH of the mixed solution so that the engineered totipotent nuclease can further cleave the residual nucleic acid in the enzyme product;

[0015] 3) Remove the engineered Cas9 polypeptide and the engineered totipotent nuclease from the mixed solution to obtain the purified enzyme product.

[0016] The advantage of this application is that, compared with existing technologies, it can effectively remove host cell (e.g., E. coli) nucleic acid contamination from polymerases, especially through the targeted sequence designed with specific sgRNAs, ensuring that even residual sequences do not affect subsequent microbial detection. Furthermore, this method is simple to operate, has high purification efficiency, and is suitable for large-scale polymerase production and application.

[0017] Other features and advantages of this application will be set forth in the following description, and will be apparent in part from the description, or may be learned by practicing the application. Other advantages of this application can be realized and obtained by means of the embodiments described in the description and the accompanying drawings. Attached Figure Description

[0018] The accompanying drawings are used to provide an understanding of the technical solutions of this application and constitute a part of the specification. They are used together with the embodiments of this application to explain the technical solutions of this application and do not constitute a limitation on the technical solutions of this application.

[0019] Figure 1 This is a schematic diagram of a method for removing nucleic acid residues from enzyme products according to one embodiment of this application.

[0020] Figure 2 The figures shown are the verification and quality control results of Example 1 of this application. The upper and lower figures represent the amplification and verification results using different models of PCR instruments. The upper figure shows the results from the Roche Light Cycler 480 instrument, and the lower figure shows the results from a domestic instrument (Heal Force Real-Time PCR Instrument) processed with the corresponding software.

[0021] Figure 3 This image shows the results of a qPCR amplification experiment using polymerase purified by the Seq1 Cas9 plus sgRNA method in Example 1 of this application.

[0022] Figure 4 This image shows the results of a qPCR amplification experiment using polymerase purified by the SpRY Cas9 plus sgRNA method in Example 1 of this application.

[0023] Figure 5 The images show the results of qPCR amplification experiments performed using the Cas9-sgRNA digestion and totipotent nuclease methods described in Example 2 of this application, after purification of the polymerase with magnetic beads. The top image shows the polymerase purified using the Seq1Cas9-sgRNA method, and the bottom image shows the polymerase purified using the SpRYCas9-sgRNA method.

[0024] Figure 6 The figures below show the results of qPCR amplification experiments performed on the Cas9 plus sgRNA RNP complex captured by magnetic beads in Example 3 of this application. The complex was digested with enzymes and totipotent nucleases, purified with magnetic beads, and then amplified using polymerase. The top figure shows the polymerase purified using the Seq1 Cas9 plus sgRNA method, and the bottom figure shows the polymerase purified using the SpRY Cas9 plus sgRNA method.

[0025] Figure 7 This is a graph showing the results of a qPCR amplification experiment using the Cas9 plus sgRNA digestion and totipotent nuclease digestion method of this application and the partially purified polymerase purified by molecular imprinting in Example 4 of this application. Detailed Implementation

[0026] Unless otherwise stated, the technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this application pertains. When a quantity, concentration, or other value or parameter is expressed as a range, preferred range, or preferred upper and lower numerical limits, it should be understood that this is equivalent to specifically disclosing any range by combining any pair of upper or preferred values ​​with any lower or preferred value, regardless of whether the range is specifically disclosed. Unless otherwise stated, the numerical ranges listed herein are intended to include the endpoints of the range and all integers and fractions (decimals) within that range.

[0027] When used with a numerical variable, the terms "about" or "approximately" usually mean that the value of the variable and all values ​​of the variable are within the experimental error (e.g., within the 95% confidence interval of the mean) or within ±10% of the specified value, or a wider range.

[0028] The expression "comprising," or similar expressions such as "including," "containing," and "having," is open-ended and does not exclude additional unlisted elements, steps, or components. The expression "consisting of," excludes any unspecified elements, steps, or components. The expression "substantially consisting of," limits the scope to the specified elements, steps, or components, plus optional elements, steps, or components that do not materially affect the essential and novel features of the claimed subject matter. It should be understood that the expression "comprising" encompasses both the expressions "substantially consisting of" and "consisting of."

[0029] The expression "at least one" or "one or more" indicates 1, 2, 3, 4, 5, 6, 7, 8, 9 or more kinds.

[0030] The CRISPR-Cas9 system, as an emerging gene-editing tool, is widely used for various gene manipulations due to its high specificity and ease of design. The Cas9 protein is a nuclease that can specifically recognize and cleave target DNA sequences by binding to sgRNA. In this application, this property of the Cas9 protein is cleverly applied to remove host cell (e.g., *E. coli*) nucleic acid contamination from polymerase. By designing specific sgRNAs, the Cas9 protein can target and cleave host cell (e.g., *E. coli*) nucleic acid sequences that may be present in the polymerase, thereby achieving specific removal of contaminated nucleic acids. This method not only improves the purity of the polymerase but also avoids new contamination problems that may be introduced by traditional methods.

[0031] However, the use of Cas9 protein also brings new challenges. For example, how to ensure that Cas9 protein removes nucleic acid contamination without damaging the activity and structure of the polymerase itself, and how to effectively remove Cas9 protein and sgRNA from the reaction system to avoid their interference with subsequent experiments—these problems need to be solved in practical applications.

[0032] To overcome these challenges, this application proposes a strategy combining Cas9 protein and DNA / RNA nucleases. Through precise and unique design and optimization, it achieves highly efficient removal of host cell (e.g., E. coli) nucleic acid contamination from polymerases. Furthermore, this application employs His-tagged affinity chromatography technology to further improve polymerase purity and recovery rate. In summary, this application provides an innovative solution to the problem of nucleic acid contamination in polymerase production. By utilizing the high specificity of the CRISPR-Cas9 system and the efficient purification capabilities of His-tagged affinity chromatography, this application not only significantly improves polymerase purity but also ensures its accuracy and reliability in subsequent experiments. The widespread application of this method will have a profound impact on molecular biology research and related industries.

[0033] In one aspect, this application provides a composition comprising:

[0034] a) an engineered Cas9 peptide, or a polynucleotide encoding an engineered Cas9 peptide, wherein the engineered Cas9 peptide contains a Cas9 domain and an affinity tag domain.

[0035] b) RNA targeting DNA, or one or more DNA polynucleotides encoding RNA targeting DNA, wherein the RNA targeting DNA comprises:

[0036] DNA targeting regions, which contain nucleotide sequences complementary to the target sequence in the host cell's target DNA used to produce the enzyme, and

[0037] The protein-binding region interacts with the Cas9 domain to form an engineered complex; and

[0038] c) an engineered totipotent nuclease, or a polynucleotide encoding an engineered totipotent nuclease, wherein the engineered totipotent nuclease comprises a totipotent nuclease domain and an affinity tag domain.

[0039] The term "nucleic acid" or "polynucleotide" refers to a polymer that can correspond to a polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or similar. This includes polymers of nucleotides such as RNA and DNA, as well as their synthetic forms, modified (e.g., chemically or biochemically modified) forms, and mixed polymers (e.g., comprising RNA and DNA subunits). Exemplary modifications include methylation, substitution of one or more naturally occurring nucleotides with analogs, modifications between nucleotides such as uncharged bonds (e.g., methyl phosphonate, triphosphate, phosphoamidide, carbamate, etc.), side portions (e.g., polypeptides), intercalating agents (e.g., acridine, psoralen, etc.), chelating agents, alkylating agents, and modified bonds (e.g., α-anomeric nucleic acids, etc.). It also includes synthetic molecules that mimic the ability of polynucleotides to bind to a specified sequence via hydrogen bonds and other chemical interactions. Nucleic acids can be or can include, for example, chromosomes or chromosomal segments, vectors (e.g., expression vectors), expression cassettes, naked DNA or RNA polymers, products of polymerase chain reaction (PCR), oligonucleotides, probes, and primers. Nucleic acids can be, for example, single-stranded, double-stranded, or triple-stranded, and are not limited to any particular length. Unless otherwise indicated, a particular nucleic acid sequence may optionally contain or encode a complementary sequence, except for any explicitly stated sequence.

[0040] As used herein, the term "domain" refers to the structure of a biomolecule that contributes to a specific function of the biomolecule. A domain may contain a continuous region (e.g., a continuous sequence) or distinct non-continuous regions (e.g., non-continuous sequences) of a biomolecule. Examples of protein domains include, but are not limited to, endonuclease domains, DNA-binding domains, and reverse transcription domains; examples of nucleic acid domains are regulatory domains, such as transcription factor-binding domains. In some embodiments, a domain (e.g., a Cas domain) may contain two or more smaller domains (e.g., a DNA-binding domain and an endonuclease domain).

[0041] RNA molecules that bind engineered Cas9 peptides and target them to specific locations within target DNA are referred to herein as "DNA-targeting RNA" or "DNA-targeting RNA polynucleotide" (also referred to herein as "guide RNA," "gRNA," or "sgRNA"). The DNA-targeting RNA of this application comprises two segments: a "DNA-targeting segment" and a "protein-binding segment." "Segment" means a segment / part / region of a molecule, such as a continuous nucleotide sequence in RNA. A segment can also mean a region / part of a complex such that a segment may contain a region of more than one molecule. For example, in some cases, the protein-binding segment of the DNA-targeting RNA (described below) is an RNA molecule and therefore the protein-binding segment contains a region of said RNA molecule.

[0042] In some implementations, the Cas9 domain is selected from the Seq1 Cas9 domain, SpRY Cas9 domain, SpCas9 domain, BlatCas9 domain, Nme2Cas9 domain, PnpCas9 domain, SauCas9 domain, SauCas9-KKH domain, SauriCas9 domain, SauriCas9-KKH domain, ScaCas9-Sc++ domain, SpyCas9 domain, SpyCas9-NG domain, SpyCas9-SpRY domain, and St1Cas9 domain; optionally, the Cas9 domain is the Seq1Cas9 domain or the SpRY Cas9 domain.

[0043] In some embodiments, the affinity tag domain is selected from polyhistidine tags, polyarginine tags, peptide substrates of antibodies, chitin-binding domains, RNase S-peptide, protein A, β-galactosidase, FLAG tags, Strep II tags, streptavidin-binding peptide (SBP) tags, calmodulin-binding peptide (CBP) tags, glutathione S-transferase (GST), maltose-binding protein (MBP), S-tags, HA tags, c-Myc tags, SUMO tags, Escherichia coli thioredoxin, NusA, chitin-binding domain CBD, chloramphenicol acetyltransferase CAT, LysRS, ubiquitin, calmodulin, and λgpV; optionally, the affinity tag domain is a His tag containing one or more His groups; optionally, the affinity tag domain is a hexamethylenetetramine tag.

[0044] In some implementations, the length of the DNA target region can be from about 12 nucleotides to about 100 nucleotides. For example, the length of the DNA target region can be from about 12 nucleotides (nt) to about 80 nt, from about 12 nt to about 50 nt, from about 12 nt to about 40 nt, from about 12 nt to about 30 nt, from about 12 nt to about 25 nt, from about 12 nt to about 20 nt, or from about 12 nt to about 19 nt. For example, the length of the DNA targeting segment can be approximately 19nt to approximately 20nt, approximately 19nt to approximately 25nt, approximately 19nt to approximately 30nt, approximately 19nt to approximately 35nt, approximately 19nt to approximately 40nt, approximately 19nt to approximately 45nt, approximately 19nt to approximately 50nt, approximately 19nt to approximately 60nt, approximately 19nt to approximately 70nt, approximately 19nt to approximately 80nt, approximately 19nt to approximately 90nt, approximately 19nt to approximately 100nt, approximately 20nt to approximately 25nt, approximately 20nt to approximately 30nt, approximately 20nt to approximately 35nt, approximately 20nt to approximately 40nt, approximately 20nt to approximately 45nt, approximately 20nt to approximately 50nt, approximately 20nt to approximately 60nt, approximately 20nt to approximately 70nt, approximately 20nt to approximately 80nt, approximately 20nt to approximately 90nt, or approximately 20nt to approximately 100nt. The length of the nucleotide sequence (DNA target sequence) of the DNA target region complementary to the nucleotide sequence (target sequence) of the target DNA can be at least about 12 nt. For example, the length of the DNA target sequence of the DNA target region complementary to the target sequence of the target DNA can be at least about 12 nt, at least about 15 nt, at least about 18 nt, at least about 19 nt, at least about 20 nt, at least about 25 nt, at least about 30 nt, at least about 35 nt, or at least about 40 nt. For example, the length of the DNA targeting sequence of the DNA target region complementary to the target sequence of the target DNA can be from about 12 nucleotides (nt) to about 80 nt, from about 12 nt to about 50 nt, from about 12 nt to about 45 nt, from about 12 nt to about 40 nt, from about 12 nt to about 35 nt, from about 12 nt to about 30 nt, from about 12 nt to about 25 nt, from about 12 nt to about 20 nt, from about 12 nt to about 19 nt, from about 19 nt to about 20 nt, from about 19 nt to about 25 nt, from about 19 nt to about 30 nt, from about 19 nt to about 35 nt, from about 19 nt to about 40 nt, from about 19 nt to about 45 nt, from about 19 nt to about 50 nt, or from about 20 nt to about 60 nt. The length of the nucleotide sequence (DNA target sequence) of the DNA target region complementary to the nucleotide sequence of the target DNA (target sequence) can be at least about 12 nt.

[0045] In some embodiments, the percentage of complementarity between the DNA targeting sequence of the DNA targeting region and the target sequence of the target DNA may be at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%). In some cases, the percentage of complementarity between the DNA targeting sequence of the DNA targeting region and the target sequence of the target DNA is 100% over the seven consecutive 5' nucleotides of the target sequence on the complementary strand of the target DNA. In some cases, the percentage of complementarity between the DNA targeting sequence of the DNA targeting region and the target sequence of the target DNA is at least 60% over about 20 consecutive nucleotides. In some cases, the percentage of complementarity between the DNA targeting sequence of the DNA targeting region and the target sequence of the target DNA is 100% over the fourteen consecutive 5' nucleotides of the target sequence on the complementary strand of the target DNA and as low as 0% over the remaining nucleotides. In such cases, the DNA targeting sequence may be considered to be 14 nucleotides in length. In some cases, the percentage of complementarity between the DNA targeting sequence of the DNA targeting region and the target sequence of the target DNA is 100% at the seven consecutive 5' end nucleotides of the target sequence on the complementary strand of the target DNA and as low as 0% on the remaining nucleotides. In such cases, the DNA targeting sequence can be considered to be 7 nucleotides in length.

[0046] In some embodiments, the RNA targeting DNA is derived from 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the sequences shown in SEQ ID NO:1-12; optionally, the RNA targeting DNA is selected from one or more of the sequences shown in SEQ ID NO:1-12.

[0047] In some embodiments, the Cas9 domain is a Seq1 Cas9 domain, and the RNA targeting the DNA is derived from 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the sequences shown in SEQ ID NO:1-6; or

[0048] The Cas9 domain is the SpRY Cas9 domain, and the RNA targeting DNA is derived from 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the sequence shown in SEQ ID NO:7-12.

[0049] In some implementations, the Cas9 domain is a Seq1 Cas9 domain, and the RNA targeting the DNA is selected from one or more sequences shown in SEQ ID NO:1-6; or

[0050] The Cas9 domain is the SpRY Cas9 domain, and the RNA targeting the DNA is selected from one or more sequences shown in SEQ ID NO:7-12.

[0051] As used in this article, UltraNuclease, also known as a non-restrictive endonuclease or broad-spectrum nuclease, is a non-specific endonuclease derived from Serratia marcescens. It can cleave between any nucleotides within the strand, completely digesting nucleic acids into 5'-monophosphate oligonucleotides of 2-5 bases in length. It can degrade various forms (double-stranded, single-stranded, linear, circular, native, or denatured) DNA and RNA under a wide range of conditions (6M Urea, 0.1M Guanidine HCl, 0.4% Triton X-100, 0.1% SDS, 1mM EDTA, 1mM PMSF), and is widely used for removing nucleic acids from biological products.

[0052] As used herein, the terms “host genome” or “host cell” refer to a cell and / or its genome in which proteins and / or genetic material have been introduced, including single-celled prokaryotic and eukaryotic organisms (e.g., bacteria, yeast, and actinomycetes) and single cells and / or their genomes derived from higher plants or animals grown in cell cultures. It should be understood that such terms are intended not only to refer to a specific subject cell and / or genome, but also to the genomes of the offspring of such cells and / or the offspring of such cells. Because certain modifications may occur in offspring due to mutations or environmental influences, such offspring may actually differ from the parent cell, but are still included within the scope of the term “host cell” as used herein. A host genome or host cell can be an isolated cell or cell line grown in a culture, or genomic material isolated from such a cell or cell line, or a host cell or host genome constituting a living tissue or organism.

[0053] In some embodiments, the host cell is selected from prokaryotic microorganisms, eukaryotic microorganisms, mammalian cells, and plant cells; optionally, the host cell is selected from Escherichia coli, Bacillus subtilis, Salmonella typhimurium, Serratia marcesans, Saccharomyces cerevisiae, human cells, bovine cells, horse cells, pig cells, goat cells, corn cells, soybean cells, wheat cells, and rice cells; optionally, the host cell is Escherichia coli.

[0054] Suitable prokaryotes for use as "host cells" include eubacteria, such as Gram-negative or Gram-positive organisms, such as Enterobacteriaceae, such as Escherichia (e.g., E. coli), Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella (e.g., Salmonella typhimurium), and Serratia (e.g., Serratia myxoides). The host organisms include prokaryotes, Shigella, and Bacilli, such as Bacillus subtilis and Bacillus licheniformis; Pseudomonas, such as Pseudomonas aeruginosa; and Streptomyces. Besides prokaryotes, "host cells" also include eukaryotic microorganisms such as filamentous fungi or yeasts. Among lower eukaryotic host microorganisms, Saccharomyces cerevisiae or common baking yeast are most commonly used.However, several other genera, species, and strains are generally available and useful in this paper, such as *Schizosaccharomyces pombe*; hosts of *Kluyveromyces* such as, for example, *Kluyveromyces lactis*, *Kluyveromyces fragilis*, *Kluyveromyces bulgaricus*, *Kluyveromyces wickeramii*, *Kluyveromyces waltii*, *Kluyveromyces drosophilarum*, *Kluyveromyces thermogenlerans*, and *Kluyveromyces marxianus*; *Pichiapastoris*; *Candida*; *Trichoderma reesia*; and *Neurospora*. crassa); Schwanniomyces such as Schwanniomyces occidentalis; and filamentous fungi such as Neurospora, Penicillium, Tolypocladium and Aspergillus hosts such as Aspergillus nidulans and Aspergillus niger.

[0055] Prokaryotes are typically used as host cells. Suitable prokaryotic host cells include *Escherichia coli* K12 strain 94 (ATCC No. 31, 446), *Escherichia coli* strain W3110 (ATCC No. 27, 325), *Escherichia coli* K12 strain DG116 (ATCC No. 53, 606), *Escherichia coli* X1776 (ATCC No. 31, 537), and *Escherichia coli* B; however, many other strains of *Escherichia coli* such as HB101, JM101, NM522, NM538, and NM539, as well as many other prokaryotic species and genera including bacilli such as *Bacillus subtilis*, other Enterobacteriaceae such as *Salmonella typhimurium* or *Serratia marcesans*, and various *Pseudomonas* species, can all be used as hosts. In some cases, the host cell can be an animal cell or a plant cell, as described herein. In other cases, the host cell can be a mammalian cell, a human cell, a avian cell, a reptile cell, a bovine cell, a horse cell, a pig cell, a goat cell, a sheep cell, a chicken cell, or a turkey cell. In still other cases, the host cell can be a corn cell, a soybean cell, a wheat cell, or a rice cell.

[0056] In some implementations, the targeted region of the host genome is the DNA region of the host cell's 16S rRNA. In some implementations, the target region (primarily the DNA region of the host cell's 16S rRNA) is preferentially cleaved to ensure that the cleavage of the target region by the Cas9 nuclease does not affect subsequent detection reactions.

[0057] In some embodiments, the composition includes:

[0058] a) Engineered Cas9 peptide, wherein the engineered Cas9 peptide contains a Seq1 Cas9 domain and six amino tag domains;

[0059] b) RNA targeting DNA, wherein the RNA targeting DNA is selected from one or more sequences shown in SEQ ID NO:1-6; and

[0060] c) Engineered totipotent nuclease, wherein the engineered totipotent nuclease contains a totipotent nuclease domain and a six-group amino tag domain.

[0061] In some embodiments, the composition includes:

[0062] a) Engineered Cas9 peptide, wherein the engineered Cas9 peptide comprises a SpRY Cas9 domain and a six-amino tag domain;

[0063] b) RNA targeting DNA, wherein the RNA targeting DNA is selected from one or more sequences shown in SEQ ID NO:7-12; and

[0064] c) Engineered totipotent nuclease, wherein the engineered totipotent nuclease contains a totipotent nuclease domain and a six-group amino tag domain.

[0065] In another aspect, this application also provides a kit comprising the composition described herein.

[0066] In some embodiments, the kit comprises a composition including:

[0067] a) an engineered Cas9 peptide, or a polynucleotide encoding an engineered Cas9 peptide, wherein the engineered Cas9 peptide contains a Cas9 domain and an affinity tag domain.

[0068] b) RNA targeting DNA, or one or more DNA polynucleotides encoding RNA targeting DNA, wherein the RNA targeting DNA comprises:

[0069] DNA targeting regions, which contain nucleotide sequences complementary to the target sequence in the host cell's target DNA used to produce the enzyme, and

[0070] The protein-binding region interacts with the Cas9 domain to form an engineered complex; and

[0071] c) an engineered totipotent nuclease, or a polynucleotide encoding an engineered totipotent nuclease, wherein the engineered totipotent nuclease comprises a totipotent nuclease domain and an affinity tag domain.

[0072] In some implementations, the kit may also contain one or more of the following: nuclease inhibitors, buffers, detergents, polyamines, adjuvants, wetting agents, stabilizers, and antioxidants.

[0073] In some implementations, the kit also contains a buffer.

[0074] On the other hand, this application also provides the use of the compositions or kits described herein for removing nucleic acid residues from enzyme products.

[0075] In some implementations, the enzyme product is a polymerase product.

[0076] In some implementation schemes, the nucleic acid residue is E. coli DNA nucleic acid residue.

[0077] On the other hand, this application also provides a method for removing nucleic acid residues from enzyme products, comprising:

[0078] 1) The engineered Cas9 peptide in the composition described herein is mixed with RNA targeting DNA in solution to form an RNP complex. The ion concentration and pH of the mixed solution are adjusted, and an enzyme product is added to the mixed solution so that the RNP complex can target and cleave the nucleic acid remaining in the enzyme product.

[0079] 2) Add engineered tomolyzed nuclease to the mixed solution in step 1) and adjust the ion concentration and pH of the mixed solution so that the engineered tomolyzed nuclease can further cleave the residual nucleic acid in the enzyme product;

[0080] 3) Remove the engineered Cas9 peptide and engineered totipotent nuclease from the mixed solution to obtain the purified enzyme product.

[0081] In some embodiments, the pH of the mixed solution in step 1) is 7.9-8.5, and it contains: 1000 mmol / L NaCl, 500 mmol / L Tris-HCl, 100 mmol / L MgCl2, and the ratio of RNP complex to enzyme product is 1:20-1:3000 (this ratio is the volume ratio of the RNP complex solution to the enzyme product solution added to the reaction mixture).

[0082] In some embodiments, the mixed solution in step 2) has a pH of 8-9 and contains: 0.25 U / mL-25 U / mL engineered totipotent nuclease, 10-30 mM Tris-HCl, and 1-5 mM magnesium ions.

[0083] In some implementations, in step 3), engineered Cas9 peptides and engineered pluripotent nucleases are removed by using a chromatography column or magnetic beads capable of binding affinity tags.

[0084] In some implementations, in step 3), instead of removing the engineered Cas9 peptide and engineered totipotent nuclease from the mixed solution, the enzyme products in the mixed solution are purified and separated using molecular imprinting.

[0085] In some implementation schemes, illustrative methods for removing nucleic acid residues from enzyme products include... Figure 1 As shown, including

[0086] 1) His-tagged Cas9 nuclease treatment: This involves treating the polymerase with a His-tagged Cas9 nuclease and sgRNA to form an RNP complex that targets and cleaves specific *E. coli* nucleic acid sequences. The selected sequence segment, based on subsequent microbial testing, needs to be compared with the *E. coli* subtype sequence used in polymerase production. sgRNA design and Cas9 nuclease selection are then based on the *E. coli* sequence.

[0087] 2) Totipotent nuclease degradation: The polymerase is further treated with a His-tagged totipotent nuclease to degrade the cleaved target sequence and other non-target linear and circular sequences.

[0088] 3) Adjustment of ion concentration and pH value: Add buffer to adjust the ion concentration and pH value of the reaction system to conditions suitable for nuclease activity.

[0089] 4) Incubation: Incubate the reaction system at a suitable temperature for 30 minutes to ensure that the nuclease fully degrades nucleic acid contaminants.

[0090] 5) His-tag affinity purification: Method 1: Add the reaction system to a chromatography column packed with Ni-NTA beads, and use the affinity between His tag and Ni-NTA to purify the polymerase. After elution, obtain the polymerase free of contaminants.

[0091] Method 2: Using His-tagged affinity magnetic beads, His-tagged Cas enzymes and broad-spectrum nucleases are separated and removed by a magnetic rack or magnet to obtain pure polymerase.

[0092] In some implementations, instead of removing the Cas enzyme and broad-spectrum nuclease from the mixed solution in step 5), the polymerase in the mixed solution is purified and separated using molecular imprinting.

[0093] This application describes several embodiments, but these descriptions are exemplary and not limiting, and it will be apparent to those skilled in the art that many more embodiments and implementations are possible within the scope of the embodiments described herein. Although many possible combinations of features are shown in the drawings and discussed in the detailed description, many other combinations of the disclosed features are also possible. Unless specifically limited, any feature or element of any embodiment may be used in combination with, or may replace, any feature or element of any other embodiment.

[0094] This application includes and contemplates combinations of features and elements known to those skilled in the art. The embodiments, features, and elements disclosed in this application can also be combined with any conventional features or elements to form unique inventive solutions. Any feature or element of any embodiment can also be combined with features or elements from other inventive solutions to form another unique inventive solution. Therefore, it should be understood that any feature shown and / or discussed in this application can be implemented individually or in any suitable combination. Therefore, the embodiments are not limited except by the limitations imposed by the appended claims and their equivalents. Furthermore, various modifications and changes can be made within the scope of the appended claims.

[0095] Furthermore, in describing representative embodiments, the specification may have presented methods and / or processes as a specific sequence of steps. However, the method or process should not be limited to the specific order of steps described herein, to the extent that it does not depend on such a specific order. As will be understood by those skilled in the art, other sequences of steps are also possible. Therefore, the specific order of steps set forth in the specification should not be construed as a limitation of the claims. Moreover, the claims concerning the method and / or process should not be limited to the steps performed in the written order, and those skilled in the art will readily understand that these orders can be varied and still remain within the spirit and scope of the embodiments of this application.

[0096] Experimental methods in the following embodiments without specific conditions are generally determined according to national standards. Experimental materials in the following embodiments without specified sources are all commercially available raw materials. The equipment used in each step of the following embodiments is conventional equipment. If there is no corresponding national standard, then generally accepted international standards, conventional conditions, or conditions recommended by the manufacturer are followed. Unless otherwise defined or stated, all technical and scientific terms used in this application have the same meaning as those skilled in the art. Furthermore, any methods and materials similar or equivalent to those described herein may be applied to the methods of this application.

[0097] Example

[0098] Example 1.

[0099] Step 1: His-tagged Cas9 nuclease treatment

[0100] First, suitable His-tagged Cas9 nucleases (Seq1 Cas9 and SpRY Cas9, both purchased from New England Biolabs) were selected, ensuring high affinity and specificity. sgRNAs targeting specific genomic DNA of specific host cells were designed and synthesized, ensuring specific binding and guidance of the Cas9 nuclease to the target sequence. In this embodiment, Seq1 Cas9 and SpRY Cas9 were used to cleave the target DNA, and corresponding sgRNA sequences were designed. The target DNA used was *E. coli* DNA, and the designed sgRNA sequences are as follows:

[0101] sgRNA corresponding to Seq1 Cas9 nuclease:

[0102] Seq1 Cas9 sgRNA1:

[0103] CGACGAUGCGUAGCCGACCUGUUUUAGAGCUGUGUUGGAAACAACACAGCGAGUUA

[0104] AAAUAAGGCUUQUACQUEQUAQUQUU UUUU(SEQ IDNO:1)

[0105] Seq1 Cas9 sgRNA2:

[0106] UGAUCGGCCACUGGGACUGUUUAAGCUGUGUUGGAAACACACAGCGAGUUA

[0107] AAAUAAGGCUUQUEQUEQUEQUE UUUU(SEQ IDNO:2)

[0108] Seq1 Cas9 sgRNA3:

[0109] ACUGGGACUGAGACACGGCGUUUACACACACUGAGAGAAACACACAGCAGGUUA

[0110] AAAUAAGGCUUQUACQUAQUACQUAUUUUU(SEQ IDNO:3)

[0111] Seq1 Cas9 sgRNA4:

[0112] GCGUGGGGAGCGAACAGGAUGUUUAAGCUGUGUUGGAAACACACAGCGAGUUA

[0113] AAAUAAGGCUUQUEQUEQUEQUE UUUU(SEQ IDNO:4)

[0114] Seq1 Cas9 sgRNA5:

[0115] GUUUAAUUCGAAGCAACCGGUUUUAGCUGUGUUGGAAACACACAGCGAGUUA

[0116] AAAUAAGGGCUUQUEQUEQUEQUE UUUU(SEQ IDNO:5)

[0117] Seq1 Cas9 sgRNA6:

[0118] UUGUCGUCAGCUCGUGUCGUGUUUUAGAGCUGUGUUGGAAACAACACAGCGAG UUAAAAUAAGGCUUUGUCCGUACACAACUUGUAAAAGUGGCACCCGAUUCGGGUGC AUUUUUU(SEQ ID NO:6)

[0119] sgRNA corresponding to SpRY Cas9 nuclease:

[0120] SpRY Cas9 sgRNA1:

[0121] CAGGAUUAGAUACCCUGGUAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCU AGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU(SEQ ID NO:7)

[0122] SpRY Cas9 sgRNA2:

[0123] CGGCCGUACUCCCCAGGCGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCU AGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU(SEQ ID NO:8)

[0124] SpRY Cas9 sgRNA3:

[0125] UUGGGUUAAGUCCCGCAACGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCU AGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU(SEQ ID NO:9)

[0126] SpRY Cas9 sgRNA4:

[0127] ACGUCAUCCCCACCUUCCTCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCU AGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU(SEQ ID NO:10)

[0128] SpRY Cas9 sgRNA5:

[0129] GGCCAUGAUGACUUGACGUCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCU AGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU(SEQ ID NO:11)

[0130] SpRY Cas9 sgRNA6:

[0131] CAUGGUGUGACGGGCGGUGUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCU AGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:12) The Cas9 nuclease is mixed with the synthesized sgRNA and incubated at room temperature for 5-20 minutes to form an RNP complex.

[0132] reagents Volume / μL sgRNA 1-3 Cas enzyme 1-3 buffer solution 1 water Complete to 10

[0133] The buffer solution consisted of: 1000 mmol / L NaCl, 500 mmol / L Tris-HCl, 100 mmol / L MgCl2, and 1000 μg / mL recombinant albumin (purchased from NEB). The pH of the buffer solution was 7.9–8.2.

[0134] After the RNP complex was prepared, polymerase (Q5U hot-start ultra-fidelity DNA polymerase, purchased from NEB) was added at a ratio of 1:20 to 1:3000 for reaction. The buffer solution included: 1000 mmol / L NaCl, 500 mmol / L Tris-HCl, 100 mmol / L MgCl2, and 1000 μg / mL recombinant albumin. The pH value was 7.9-8.5, and the treatment time was 15-30 min.

[0135] Step 2: Degradation by pluripotent nuclease

[0136] After step 1, add an appropriate amount of His-tagged totipotent nuclease (purchased from Beijing Bio-Labs Technology Co., Ltd.). This enzyme can degrade linear and circular DNA and RNA. The final concentration of the totipotent nuclease is 0.25 U / mL-25 U / mL. Buffer conditions: 20 mM Tris-HCl pH 8.0, 2 mM MgCl2, 20 mM NaCl. Optimal reaction conditions: Mg ion concentration 1-5 mM, pH 8-9, reaction temperature 37℃, DTT / mercaptoethanol 0-100 mM, monovalent cation concentration 0-20 mM, phosphate ion concentration 0-10 mM.

[0137] Incubate at 37°C for 30-240 minutes to ensure that the pluripotent nuclease fully degrades the target sequence cleaved by Cas9 and other non-specifically bound nucleic acids.

[0138] Step 3: His-tag affinity purification

[0139] Prepare a Ni-NTA affinity chromatography column, which specifically binds to His-tagged proteins. Slowly pass the reaction mixture through the Ni-NTA column to capture His-tagged Cas9 nucleases and totipotent nucleases. Elute unbound proteins and nucleic acids using an appropriate elution buffer (20 mM sodium phosphate, 150 mM sodium chloride, pH 7.0) to remove potential contaminants. Adjust the pH and ionic strength of the elution buffer (no ionic strength adjustment is needed; ensure the pH is around 7.0) to optimize the elution efficiency of His-tagged proteins. Collect the eluent, which contains the decontaminating polymerase.

[0140] Step 4: Validation and Quality Control

[0141] The purity and integrity of the polymerase were verified using methods such as gel electrophoresis and mass spectrometry. Finally, the function and specificity of the polymerase were verified by quantitative real-time PCR to ensure that the level of E. coli and other microbial nucleic acid contamination in the polymerase was below the detection limit, meeting the requirements of subsequent experiments. Verification results are shown below. Figure 2 As can be seen from the results in the figure, the contamination of microbial nucleic acids such as E. coli has been successfully removed from the polymerase, and high-purity and high-activity polymerase has been obtained.

[0142] qPCR amplification experiments were performed using purified polymerase. The substrate was an E. coli nucleic acid fragment, and the primers were sequences designed for the detection of E. coli nucleic acid: qPCR-F: ACTCCTACGGGAGGCAGCA (SEQ ID NO: 13); qPCR-R: TTACCGCGGCTGCTGGCAC (SEQ ID NO: 14). The results of qPCR amplification experiments using the purified polymerase obtained through the Seq1 Cas9 plus sgRNA method are shown in the figure. Figure 3 The results of qPCR amplification experiments using polymerase purified with SpRY Cas9 and sgRNA are shown in the figure. Figure 4 It is evident that most of the polymerases purified by the method described in this application did not produce background amplification, with only one or two showing a small amount of background amplification, indicating that DNA contamination in the polymerases was effectively removed.

[0143] The method described in this application not only improves the quality of polymerase and the reliability of experiments, but also has scalability, making it suitable for large-scale production. Furthermore, rigorous quality control procedures ensure that the polymerase product meets high standards for scientific research and industrial applications.

[0144] Example 2.

[0145] Steps 1 / 2 of Example 2 are the same as in Example 1. Step 3 involves purifying the polymerase using magnetic beads.

[0146] Pretreatment of magnetic beads: Using IDT or NEB brand His-labeled magnetic beads, place the magnetic beads on a vortex mixer and mix thoroughly. Use a pipette to take 5 mL of the magnetic bead suspension into a 15 mL centrifuge tube for magnetic separation. Discard the supernatant and remove the centrifuge tube from the magnetic separator.

[0147] Add 5 mL of Binding Buffer to the centrifuge tube containing the magnetic beads, invert the tube several times to resuspend the beads; perform magnetic separation, and remove the supernatant. Repeat the washing process twice.

[0148] His-tagged Cas enzyme / totipotent nuclease was bound to magnetic beads: The mixture of resuspended magnetic beads and the treated polymerase was mixed at a volume ratio of 1:50 and mixed at room temperature for 20-30 min (or at a low temperature of 2-8℃ for 1 h to prevent degradation of the target protein). Finally, the Cas enzyme / totipotent nuclease was separated using a magnetic rack to obtain purified polymerase.

[0149] qPCR amplification was performed using the purified polymerase, and the results are as follows: Figure 5 As shown, most of the purified polymerases did not produce background amplification, with only one or two showing a small amount of background amplification.

[0150] Compared to traditional methods, magnetic bead separation technology simplifies the operation steps, making the entire purification process faster and simpler. At the same time, magnetic bead separation can shorten the separation time, improve the separation efficiency, is easy to automate, and is suitable for high-throughput applications.

[0151] Example 3.

[0152] Step 1: Pretreatment of magnetic beads

[0153] First, prepare a His-tagged Cas9 nuclease and select a suitable sgRNA to ensure specificity. Mix the Cas9 nuclease with the sgRNA to form an RNP complex. The Cas9 nuclease, sgRNA, incubation conditions, and buffer composition are the same as in Example 1.

[0154] Next, an appropriate amount of carboxylated magnetic beads was washed three times with PBS buffer containing 1 mM EDTA to remove possible metal ion contamination. Then, the magnetic beads were mixed with the RNP complex (50 μL of magnetic beads (10 mg / mL) corresponds to 2 μg of RNP), and the Cas9 nuclease was captured by the affinity between the carboxylated magnetic beads and the His tag. The mixture was incubated at 4°C for 30 minutes. Simultaneously, the magnetic beads were mixed with a totipotent nuclease to produce magnetic beads bound to the totipotent nuclease.

[0155] Step 2: Introduction of Cas nuclease and totipotent nuclease

[0156] After binding Cas9 nuclease to the magnetic beads, the polymerase to be purified was added at 1.8 times the volume for the reaction, with a pH of 7.9-8.5 and a processing time of 15-30 min.

[0157] Subsequently, magnetic beads conjugated with totipotent nuclease were added, and the mixture was incubated at 37°C for 30-240 minutes to ensure that the totipotent nuclease fully degraded the target sequence cleaved by Cas9 and other non-specifically bound nucleic acids. The buffer conditions were set as follows: 20 mM Tris-HCl pH 8.0, 2 mM MgCl2, and 20 mM NaCl to ensure that the totipotent nuclease could effectively degrade the target sequence. Incubation at 37°C for 60 minutes was then performed to complete the nucleic acid degradation.

[0158] Step 3: Magnetic bead recovery and nuclease removal

[0159] After nucleic acid degradation is complete, use a magnetic bead separator / magnetic rack to separate the magnetic beads from the reaction system. Carefully transfer the supernatant. After the supernatant transfer is complete, it can be treated with magnetic beads again. Repeat the above steps, and then use the magnetic bead separator again to recover the magnetic beads to ensure that nucleic acid contamination is fully removed. The recovery time for magnetic beads is ≥30 minutes to ensure complete removal of the magnetic beads.

[0160] Step 4: Validation and Quality Control

[0161] The activity and specificity of the polymerase were verified using quantitative real-time PCR to ensure that the nuclease efficiently degraded the target sequence. qPCR amplification experiments were performed using the purified polymerase, and the results are as follows: Figure 6 As shown, most of the purified polymerase did not produce background amplification, with only one showing a small amount of background amplification.

[0162] Through the operation in Example 3, the effective removal of nucleic acid contamination from polymerase solutions was achieved by using magnetic beads combined with Cas9 nuclease and totipotent nuclease. This method not only improves processing efficiency but also reduces costs through the recovery and reuse of magnetic beads, while ensuring the high purity and activity of the polymerase, meeting the needs of subsequent experiments.

[0163] Example 4.

[0164] The polymerase was treated with Cas9 nuclease and totipotent nuclease according to the method in Example 1. The polymerase in the mixture was purified and separated using molecular imprinting. The steps of the molecular imprinting method are as follows:

[0165] 1. Preparation of Fe3O4 magnetic nanoparticles: 0.7 g FeCl3·6H2O and 1.8 g anhydrous sodium acetate were dissolved in 20 mL ethylene glycol, followed by the addition of 0.5 mL monoethylene glycol and 0.5 mL water. The mixture was magnetically stirred for 30 min until homogeneous. The mixture was then placed in a high-temperature reaction chamber and reacted at 200 °C for 12 h. The nanoparticles were washed alternately with water and ethanol until the supernatant was clear. Finally, the nanoparticles were dried in a vacuum drying oven at 80 °C for 12 h to obtain Fe3O4 magnetic nanoparticles.

[0166] 2. Preparation of Fe3O4@SiO2 magnetic nanoparticles: 100 mg of nano-Fe3O4 was dispersed in 30 mL of deionized water and sonicated for 30 min. The solution was then transferred to a 250 mL round-bottom flask, and 120 mL of anhydrous ethanol and 3.0 mL of 25% ammonia solution were added. 2.0 mL of tetraethyl orthosilicate (TEOS) was added dropwise, and the mixture was mechanically stirred overnight at 30 °C. The solution color changed from dark black to light gray, indicating successful SiO2 coating. The solution was washed alternately with water and ethanol until the supernatant became clear. The nanoparticles were then dried in a vacuum drying oven at 80 °C for 12 h to obtain Fe3O4@SiO2 magnetic nanoparticles.

[0167] 3. Amination of Fe3O4@SiO2 Magnetic Nanoparticles: After plasma electrophoresis of the Fe3O4@SiO2 magnetic nanoparticles, 200 mg of Fe3O4@SiO2 was added to 100 mL of anhydrous toluene and ultrasonically dispersed. Then, 8.0 mL of APTES was added under magnetic stirring, and the mixture was heated to reflux in an oil bath at 110 °C for 18 h. After natural cooling, the nanoparticles were ultrasonically washed three times with anhydrous ethanol and then magnetically separated. They were then dried in a vacuum drying oven at 80 °C for 12 h to obtain Fe3O4@SiO2-NH2 magnetic nanoparticles.

[0168] 4. Carboxylation of Fe3O4@SiO2-NH2 Magnetic Nanoparticles: 150 mg of aminated Fe3O4@SiO2 magnetic nanoparticles were transferred to a three-necked flask, and 150 mL of N,N-dimethylformamide (DMF) was added. 300 mg of succinic anhydride was then dissolved in DMF and slowly added dropwise to the reaction system under mechanical stirring at a rate of approximately 60 drops / min at 25 °C. After the addition was complete, the mixture was stirred continuously for 24 h. The nanoparticles were thoroughly washed multiple times with anhydrous ethanol and filtered to obtain carboxylated Fe3O4@SiO2 particles. These particles were then dried in a vacuum drying oven at 80 °C for 12 h to obtain Fe3O4@SiO2-NH2-COOH magnetic nanoparticles.

[0169] 5. Dissolve the prepared carboxyl-modified magnetic beads in a certain amount of citrate buffer solution and sonicate for 10 min to obtain solution A. The pH range of the citrate buffer solution is 6.2–7.2.

[0170] 6. Dissolve a certain amount of the functional monomer acrylamide (AAm) and a certain amount of polymerase template molecules in a certain amount of citrate buffer, and then add a certain amount of N,N-methylenebisacrylamide (MBA). After complete dissolution, obtain solution B. Prepolymerize solution B at room temperature for 0.5-2 hours. The molar ratio of acrylamide (AAm):N,N-methylenebisacrylamide (MBA) is in the range of 5:1 to 1:2, and the pH value of citrate buffer is in the range of 6.2 to 7.2.

[0171] 7. Subsequently, solutions A and B were mixed thoroughly, and a certain amount of 10% ammonium persulfate (APS) solution and tetramethylethylenediamine (TEMED) were added sequentially. The mixture was mechanically stirred at room temperature for 24 hours. The molar ratio of N,N-methylenebisacrylamide (MBA):ammonium persulfate:tetramethylethylenediamine ranged from 2:2:1 to 5:4:1, and the molar ratio of N,N-methylenebisacrylamide (MBA):magnetic beads ranged from 1:8 to 1:2.

[0172] 8. Collect the product from the solution using an external magnetic field and wash it with a mixture of methanol and acetic acid to remove the template molecules for 3-8 hours. After elution, freeze the product in a refrigerator for 20 minutes, then transfer it to a vacuum freeze dryer for 5-7 hours and store it in a refrigerator at 4 degrees Celsius for later use.

[0173] 9. When using, disperse the eluted molecularly imprinted polymer into the sample and mix thoroughly for 5-10 minutes to allow the molecularly imprinted polymer to fully bind with the template molecules (polymerase) in the sample. Then, use a magnet to separate the molecularly imprinted polymer from the sample and wash thoroughly with eluent to separate the template molecules (polymerase) from the molecularly imprinted polymer, thereby obtaining purified polymerase.

[0174] As in Example 1, purified polymerase was used for qPCR experiments to verify the purity of the polymerase. The experimental results are as follows: Figure 7 As shown.

[0175] Although embodiments of this application have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting this application. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of this application.

Claims

1. A composition, characterized in that, include: a) an engineered Cas9 polypeptide, or a polynucleotide encoding the engineered Cas9 polypeptide, wherein the engineered Cas9 polypeptide comprises a Cas9 domain and an affinity tag domain; b) RNA targeting DNA, or one or more DNA polynucleotides encoding said target DNA RNA, wherein said target DNA RNA comprises: DNA targeting regions, which contain nucleotide sequences complementary to the target sequence in the host cell's target DNA used to produce the enzyme, and A protein-binding region that interacts with the Cas9 domain to form an engineered complex; and c) an engineered totipotent nuclease, or a polynucleotide encoding the engineered totipotent nuclease, wherein the engineered totipotent nuclease comprises a totipotent nuclease domain and an affinity tag domain.

2. The composition according to claim 1, characterized in that, The Cas9 structure domain is selected from the Seq1 Cas9 structure domain, SpRY Cas9 structure domain, SpCas9 structure domain, BlatCas9 structure domain, Nme2Cas9 structure domain, PnpCas9 structure domain, SauCas9 structure domain, SauCas9-KKH structure domain, SauriCas9 structure domain, SauriCas9-KKH structure domain, ScaCas9-Sc++ structure domain, SpyCas9 structure domain, SpyCas9-NG structure domain, SpyCas9-SpRY structure domain, and St1Cas9 structure domain; optionally, the Cas9 structure domain is the Seq1 Cas9 structure domain or the SpRY Cas9 structure domain.

3. The composition according to claim 1, characterized in that, The affinity tag domain is selected from polyhistidine tags, polyarginine tags, antibody peptide substrates, chitin-binding domains, RNase S peptide, protein A, β-galactosidase, FLAG tags, Strep II tags, streptavidin-binding peptide (SBP) tags, calmodulin-binding peptide (CBP) tags, glutathione S-transferase (GST), maltose-binding protein (MBP), S-tags, HA tags, c-Myc tags, SUMO tags, Escherichia coli thioredoxin, NusA, chitin-binding domain CBD, chloramphenicol acetyltransferase CAT, LysRS, ubiquitin, calmodulin, and λgpV; optionally, the affinity tag domain is a His tag containing one or more His molecules; optionally, the affinity tag domain is a hexamethylenetetramine tag.

4. The composition according to claim 1, characterized in that, The host cell is selected from prokaryotic microorganisms, eukaryotic microorganisms, mammalian cells, and plant cells; optionally, the host cell is selected from Escherichia coli, Bacillus subtilis, Salmonella typhimurium, Serratia marcesans, Saccharomyces cerevisiae, human cells, bovine cells, horse cells, pig cells, goat cells, corn cells, soybean cells, wheat cells, and rice cells; optionally, the host cell is Escherichia coli.

5. The composition according to claim 1, characterized in that, The RNA of the target DNA is derived from 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the sequences shown in SEQ ID NO:1-12; optionally, the RNA of the target DNA is selected from one or more of the sequences shown in SEQ ID NO:1-12.

6. The composition according to any one of claims 1-5, characterized in that, The Cas9 domain is a Seq1Cas9 domain, and the RNA targeting the DNA is derived from 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the sequences shown in SEQ ID NO:1-6; or The Cas9 domain is the SpRY Cas9 domain, and the RNA of the target DNA is derived from 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the sequence shown in SEQ ID NO:7-12.

7. The composition according to claim 6, characterized in that, The Cas9 domain is a Seq1 Cas9 domain, and the RNA targeting the DNA is selected from one or more sequences shown in SEQ ID NO:1-6; or The Cas9 domain is a SpRY Cas9 domain, and the RNA targeting the DNA is selected from one or more sequences shown in SEQ ID NO:7-12.

8. A reagent kit, characterized in that, The kit comprises the composition according to any one of claims 1-7.

9. The reagent kit according to claim 8, characterized in that, The kit also contains one or more of the following: nuclease inhibitors, buffers, detergents, polyamines, adjuvants, humectants, stabilizers, and antioxidants.

10. The reagent kit according to claim 9, characterized in that, The kit also contains a buffer.

11. Use of the composition of any one of claims 1-7 or the kit of any one of claims 8-10 for removing nucleic acid residues from enzyme products.

12. The use according to claim 11, characterized in that, The enzyme product is a polymerase product.

13. The use according to claim 11, characterized in that, The nucleic acid residue is E. coli DNA nucleic acid residue.

14. A method for removing nucleic acid residues from enzyme products, characterized in that, include: 1) The engineered Cas9 polypeptide in any one of the compositions of claims 1-7 is mixed with the RNA of the target DNA in a solution to form an RNP complex and the ion concentration and pH of the mixed solution are adjusted. The enzyme product is added to the mixed solution so that the RNP complex can target and cleave the nucleic acid remaining in the enzyme product. 2) Add the engineered totipotent nuclease to the mixed solution in step 1) and adjust the ion concentration and pH of the mixed solution so that the engineered totipotent nuclease can further cleave the residual nucleic acid in the enzyme product; 3) Remove the engineered Cas9 polypeptide and the engineered totipotent nuclease from the mixed solution to obtain the purified enzyme product.

15. The method according to claim 14, characterized in that, The mixed solution in step 1) has a pH of 7.9-8.5 and contains: 1000 mmol / L NaCl, 500 mmol / L Tris-HCl, and 100 mmol / L MgCl2, and the ratio of the RNP complex to the enzyme product is 1:20-1:3000.

16. The method according to claim 14, characterized in that, The mixed solution in step 2) has a pH of 8-9 and contains: 0.25 U / mL-25 U / mL of the engineered totipotent nuclease, 10-30 mM of Tris-HCl, and 1-5 mM of magnesium ions.

17. The method according to claim 14, characterized in that, In step 3), the engineered Cas9 peptide and the engineered pluripotent nuclease are removed by a chromatography column or magnetic beads capable of binding the affinity tag.

18. The method according to claim 14, characterized in that, In step 3), instead of removing the engineered Cas9 polypeptide and the engineered totipotent nuclease from the mixed solution, the enzyme products in the mixed solution are purified and separated using molecular imprinting.