A caliper structure ratio type dual aptamer probe and application thereof
By using a ratiometric dual aptamer probe with a caliper structure to identify the oligomeric state of EV membrane proteins, this technology solves the problem of achieving dynamic high-throughput, in-situ detection, which is difficult in existing technologies. It enables non-invasive, rapid, and sensitive TCR-CD3 dimer detection, which is suitable for monitoring rejection reactions after organ transplantation.
Patent Information
- Application Number
- CN202610116621.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2026-01-20
- Filing Date
- 2026-01-28
- Publication Date
- 2026-05-29
AI Technical Summary
Existing technologies lack detection strategies that are easy to operate, can achieve dynamic high-throughput or in-situ detection, and can specifically identify the structure and functional state of EV membrane proteins (such as the oligomerization state of proteins), making it difficult to achieve non-invasive and dynamic monitoring, especially in acute rejection reactions in organ transplantation.
A ratiometric dual aptamer probe with a caliper structure is designed to target and bind CD3 protein with first and second nucleic acid aptamer probes respectively, exciting different fluorescence signals. Ratio analysis is used to identify TCR-CD3 monomers and dimers, achieving label-free differentiation of oligomeric states of EV membrane proteins.
It achieves non-invasive, rapid, sensitive, and specific identification of acute cellular rejection reactions, and can detect TCR-CD3 dimer with high sensitivity in plasma samples. It is suitable for monitoring rejection reactions after organ transplantation and has high specificity and clinical application potential.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to a ratiometric dual aptamer fluorescence with a caliper structure and its applications. Background Technology
[0002] Post-organ transplant rejection detection primarily relies on methods such as tissue biopsy, serum biochemical markers, immune cell subset and cytokine detection, and donor-derived cell-free DNA (cfDNA) analysis. While tissue biopsy, as the gold standard, allows direct observation of pathological changes, it is invasive, carries high operational risks, and cannot achieve dynamic monitoring. Serum biochemical markers (such as creatinine and ALT) have poor specificity and delayed responses. While immune marker detection can reflect immune status, results are easily interfered with by other inflammations or infections, and the testing process is complex. cfDNA technology is highly sensitive and non-invasive, but expensive and carries the risk of false positives. Overall, these detection methods still have significant limitations in terms of specificity, timeliness, non-invasiveness, and functional assessment, necessitating more precise, dynamic, and non-invasive alternatives.
[0003] In related technologies, to address the aforementioned issues, studies have utilized extracellular vesicles (EVs) as biomarkers for acute rejection in organ transplantation. As nanoparticles rich in information about cell origin, EVs have been widely applied in disease diagnosis, immune monitoring, and efficacy evaluation. Detection of EV surface proteins is a key technical pathway for identifying their cellular origin and functional status. Studies have found that rejection-related molecules such as CD3, CD8, Granzyme B, and miR-155 can be detected in EVs derived from T cells or immune-activated cells. These EV biomarkers are upregulated during rejection, possessing potential early warning value. Furthermore, in biological systems, proteins do not function in isolation; protein aggregation is prevalent, often functioning as homodimers or oligomers. This aggregation is crucial for protein stability, activity regulation, and functional diversity. The applicant's previous Chinese patent CN2022101694461 isolated a novel functional EVs biomarker—TCR-CD3 dimer EVs—to reflect T cell activation and immune rejection status in vivo, and is a potential marker of rejection response. Therefore, studying the structure and functional state of EVs membrane proteins (e.g., the oligomerization state of proteins) has extremely important application prospects in assessing immune rejection in organ transplantation.
[0004] Among related technologies, detection techniques for studying the oligomerization state of proteins mainly include chemical cross-linking, fluorescence correlation spectroscopy (FCS), and FRET (Förster resonance energy transfer). While these methods can be used to study protein-protein interactions, they are typically complex to operate, highly dependent on equipment, and difficult to achieve high-throughput or in-situ detection. In recent years, nucleic acid aptamers have gained increasing attention in the field of protein detection due to their high affinity for target proteins and high modifiability. Especially in membrane protein research, by designing the tail structure of aptamer probes, fluorescence signals can be generated when different proteins interact or approach each other, thus providing indirect evidence of protein co-localization or interaction. However, when multiple aptamers target the same protein, it may cause non-physiological aggregation of the target protein, thereby masking its original spatial distribution and hindering the differentiation and quantification of the true oligomerization state. Therefore, in the application scenario of immune rejection in organ transplantation, there is an urgent need for a novel detection strategy that can non-invasively, dynamically, and specifically identify the structural and functional states of EV membrane proteins.
[0005] Therefore, solving the current problem of lacking a detection strategy that is easy to operate, can achieve dynamic high-throughput or in-situ detection, and can specifically identify the structure and functional state of EV membrane proteins (such as the oligomerization state of proteins) has extremely important application value. Summary of the Invention
[0006] This invention aims to address at least one of the technical problems existing in the prior art. To this end, this invention proposes a ratiometric dual aptamer probe with a caliper structure and its application, aiming to solve the problem of the current lack of detection strategies that are easy to operate, can achieve dynamic high-throughput or in-situ detection, and can specifically identify the structure and functional state (e.g., oligomerization state) of EV membrane proteins.
[0007] In a first aspect, the present invention provides a ratiometric dual aptamer probe with a caliper structure, the ratiometric dual aptamer probe comprising a first nucleic acid aptamer probe, a second nucleic acid aptamer probe, and a nucleic acid T-strand connecting the two; the nucleic acid T-strand comprises a T1 strand located at the 3' end and a T2 strand located at the 5' end; the first nucleic acid aptamer probe is at least partially complementary to the T1 strand, and the second nucleic acid aptamer probe is at least partially complementary to the T2 strand; the first nucleic acid aptamer probe generates a first fluorescence after targeting and binding to CD3 protein, and the second nucleic acid aptamer probe generates a second fluorescence after targeting and binding to CD3 protein, wherein the first fluorescence and the second fluorescence are different; wherein the CD3 protein binding capacity of the first nucleic acid aptamer probe is 1.7 to 3.0 times that of the second nucleic acid aptamer probe.
[0008] The ratiometric dual aptamer probe with a caliper structure according to embodiments of the present invention has at least the following beneficial effects: The present invention develops a ratiometric probe with a caliper structure for identifying the oligomeric conformation state of EV membrane proteins, targeting a novel functional EV biomarker—TCR-CD3 dimer EVs. This probe is suitable for non-invasive, rapid, sensitive, and specific identification of acute cell rejection responses, overcoming the limitation of traditional antibody detection methods being insensitive to spatial structure. The ratiometric fluorescent aptamer probe of the present invention can rapidly and effectively detect the ratio of TCR-CD3 monomers / dimers in complex biological EV samples. The beneficial effects of the aforementioned dual aptamer fluorescent probe include:
[0009] 1) Unique detection strategy: Oligomeric state differentiation is achieved through a ratio-type caliper structure. The probe adopts a dual-affinity aptamer design and forms a "caliper structure" through spatial arrangement. It can identify TCR-CD3 monomers and dimers respectively and output two fluorescent signals at the same time. The label-free differentiation of the oligomeric state of proteins on the surface of EVs is achieved by changing the ratio. The method is unique and has strong distinguishing ability.
[0010] 2) Non-invasive, micro-volume blood sample detection: The detection method using the ratiometric dual aptamer probe described above can be directly applied to plasma samples. Only a small amount of plasma sample is required, and there is no need for cell culture or tissue biopsy. The detection process is simple and easy to perform, suitable for rapid, dynamic, and non-invasive monitoring. It has high specificity and clinical application potential, providing new monitoring tools and research platforms for related fields such as organ transplantation, immune rejection, autoimmunity, and immunotherapy.
[0011] 3) High sensitivity and specificity: By optimizing the aptamer affinity and structural response mechanism, high sensitivity detection of trace amounts of TCR-CD3 dimer EVs is achieved. In the mouse xenograft model, it can accurately distinguish between rejection and non-rejection states, and the signal intensity is well correlated with the degree of rejection, with good accuracy.
[0012] 4) The platform has strong compatibility and is easy to promote: The detection method can be completed in a standard microplate fluorescence reading system without the need for complex instruments or sorting systems, which facilitates standardization and mass promotion. At the same time, it has high modular compatibility with other aptamers and markers, making it suitable for building a multi-index joint analysis platform.
[0013] 5) High application prospects: This invention constructs a complete detection system for a novel immune rejection biomarker, which has the basic conditions for productization and reagent kit development, and is expected to be applied to various scenarios such as rejection detection after organ transplantation and efficacy evaluation of immunotherapy.
[0014] CD3 is an important biomarker on the T cell membrane, comprising four protein chains (CD3δ, CD3ε, CD3γ, and CD3ζ). Two heterodimer pairs (CD3δ / CD3ε and CD3γ / CD3ε) can form the TCR-CD3 complex with the T cell receptor, participating in the regulation of T cell antigen recognition, signal transduction, and T cell development. The applicant's earlier Chinese patent CN2022101694461 disclosed a novel functional EV biomarker—TCR-CD3 complex dimer EVs—used to reflect T cell activation and immune rejection status in vivo, representing a potential marker of rejection reactions. The ratiometric dual-aptamer fluorescent probe detection system provided by this invention, based on the detection of TCR-CD3 complex dimer EVs, can non-invasively and rapidly identify acute cellular rejection reactions. It can be applied to post-organ transplant rejection monitoring, possessing high specificity and clinical application potential. In this invention, the aforementioned ratiometric dual aptamer probe targets EVs with a TCR-CD3 complex dimer structure. Compared to traditional CD3-positive EVs, this EV subset reflects the molecular aggregation characteristics of the T cell receptor (TCR) in the activated state, and can more sensitively indicate the T cell-mediated rejection response process. To achieve specific recognition and quantitative analysis of this biomarker, this invention proposes for the first time a dual aptamer fluorescent probe system with a "ratiometric caliper structure". This probe contains two switch-type aptamer units with different affinities for CD3 protein. By rationally controlling the spatial spacing and directional arrangement of the two units, it recognizes the monomers and dimers of the TCR-CD3 complex, and generates characteristic fluorescent signals after binding to the target. The first aptamer probe unit exhibits a higher affinity for CD3 protein (resulting in stronger CD3 protein binding). Monomers of the TCR-CD3 complex preferentially bind to this probe and excite the first fluorescence. However, in the presence of a TCR-CD3 complex dimer, the first aptamer probe unit binds to one CD3 protein before the second aptamer probe unit binds to the other, exciting the second fluorescence. In other words, the TCR-CD3 complex dimer excites both the first and second fluorescence simultaneously, while the TCR-CD3 complex monomer only excites the first fluorescence. By analyzing the intensity of these two fluorescence signals, in-situ detection and label-free differentiation of the oligomerization state of the TCR-CD3 complex on the surface of EVs can be achieved, thereby indirectly reflecting the activation and rejection levels of T cells. This invention demonstrates that in a mouse skin allogeneic transplantation model, the ratio of the second fluorescence intensity detected by this probe to the first fluorescence intensity is significantly increased and positively correlated with the degree of rejection; while in the autologous transplantation model and the normal control group, this ratio shows no significant change.These results demonstrate that the ratiometric fluorescent aptamer probe of this invention can rapidly and effectively detect the ratio of TCR-CD3 monomers / dimer EVs in complex biological samples, providing a new detection method for evaluating the progression of acute rejection after organ transplantation.
[0015] In some embodiments of the present invention, the CD3 protein binding capacity of the first nucleic acid aptamer probe is 1.7 to 3.0 times that of the second nucleic acid aptamer probe. For example, it can be 1.7 times, 1.8 times, 1.9 times, 2.0 times, 2.1 times, 2.2 times, 2.3 times, 2.4 times, 2.5 times, 2.6 times, 2.7 times, 2.8 times, 2.9 times, 3.0 times, or within any range of two of the above values. The present invention defines the CD3 protein binding capacity of the two probes as the ratio of the free-moving spatial area of the nucleic acid aptamer probe to the dissociation equilibrium constant of the corresponding probe (…). K d The ratio of Area / K d ).
[0016] In some embodiments of the present invention, according to 5' In the 3' direction, the first nucleic acid aptamer probe sequentially includes a nucleic acid aptamer capable of targeting and binding to the CD3 protein, a first complementary strand at least partially complementary to the nucleic acid aptamer, and a first anchoring domain that binds to the T1 strand, and a first fluorescent group is attached to the 5' end.
[0017] In some embodiments of the present invention, according to 5' In the 3' direction, the second nucleic acid aptamer probe sequentially includes a nucleic acid aptamer capable of targeting and binding to the CD3 protein, a second complementary strand at least partially complementary to the nucleic acid aptamer, and a second anchoring domain that binds to the T2 strand, and a second fluorescent group is attached to the 5' end.
[0018] In this article, unless otherwise stated, “complementary” means that bases are combined according to the principle of complementary base pairing.
[0019] In some embodiments of the present invention, the at least partial complementarity includes at least 70% complementarity, at least 80% complementarity, or at least 90% complementarity.
[0020] In some preferred embodiments of the present invention, the at least partially complementary includes at least 91% complementarity, at least 92% complementarity, at least 93% complementarity, at least 94% complementarity, at least 95% complementarity, at least 96% complementarity, at least 97% complementarity, at least 98% complementarity, or at least 99% complementarity, and more preferably 100% complementarity.
[0021] In some specific embodiments of the present invention, the sequence of the nucleic acid aptamer is shown in SEQ ID No. 1: SEQ ID No. 1: 5'-GCCGCGGGGTGGGTCTAGTGTGGATGTTTAGGGGGCGGC-3' In some embodiments of the present invention, the length of the first complementary chain is 0 to 10 nt longer than the length of the second complementary chain, preferably 10 nt. For example, it can be 0 nt, 1 nt, 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, or within any range of two of the above values.
[0022] In some embodiments of the present invention, the length of the first complementary chain is 10 to 20 nt, preferably 20 nt. For example, it can be 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, or within any two of the above values.
[0023] In some embodiments of the present invention, the length of the second complementary chain is 10 to 20 nt, preferably 10 nt. For example, it can be 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, or within any two of the above values.
[0024] In some specific embodiments of the present invention, the length of the first complementary chain is 20nt, and the length of the second complementary chain can be 10nt, 14nt, 18nt, or 20nt.
[0025] In some specific embodiments of the present invention, the length of the first complementary chain is 18nt, and the length of the second complementary chain can be 10nt, 14nt, or 18nt.
[0026] In some specific embodiments of the present invention, the length of the first complementary chain is 14nt, and the length of the second complementary chain can be 10nt or 14nt.
[0027] In some specific embodiments of the present invention, the length of the first complementary chain is 10 nt, and the length of the second complementary chain is 10 nt.
[0028] More specifically, the sequence of the first complementary strand is shown in SEQ ID No. 2: SEQ ID No. 2: 5'-CACTAGACCCACCCCGCGGC-3' More specifically, the sequence of the second complementary strand is shown in SEQ ID No. 3: SEQ ID No. 3: 5'-ACCCCGCGGC-3' In some specific embodiments of the present invention, the sequence of the first anchoring structural domain is as shown in SEQ ID No. 4: SEQ ID No. 4: 5'-TATCTAACTAGTACTCGAACACGT-3' In some specific embodiments of the present invention, the sequence of the second anchoring structural domain is as shown in SEQ ID No. 5: SEQ ID No. 5: 5'-CTATGGTGCATGGCTTGAGTTACT-3' In some embodiments of the present invention, the first fluorescence and the second fluorescence are each independently selected from one of yellow fluorescence, green fluorescence, red fluorescence, blue fluorescence, orange fluorescence, and purple fluorescence. In the present invention, there are no further limitations on the first fluorescence and the second fluorescence, as long as they are different and distinguishable.
[0029] In some embodiments of the present invention, the first fluorescence is selected from one of yellow fluorescence, green fluorescence, red fluorescence, blue fluorescence, orange fluorescence, and purple fluorescence. Red fluorescence is preferred.
[0030] In some embodiments of the present invention, a first fluorescent group is attached to the 5' end of the first nucleic acid aptamer probe, and the first fluorescent group emits a first fluorescence. The present invention does not impose further limitations on the first fluorescent group; any fluorescent group commonly used in the art can be reasonably applied. Specifically, the first fluorescent group is ROX, a red fluorescent label with an excitation peak at 568 nm and an emission peak at 595 nm.
[0031] In some embodiments of the present invention, the second fluorescence is selected from one of yellow fluorescence, green fluorescence, red fluorescence, blue fluorescence, orange fluorescence, and purple fluorescence. Green fluorescence is preferred.
[0032] In some embodiments of the present invention, a second fluorescent group is attached to the 5' end of the second nucleic acid aptamer probe, and the second fluorescent group emits a second fluorescence. The present invention does not impose further limitations on the second fluorescent group; any fluorescent group commonly used in the art can be reasonably applied. Specifically, the second fluorescent group is FAM (5-carboxyfluorescein), a fluorescent dye with bright green fluorescence, an excitation peak at 492 nm, and an emission peak at 518-520 nm.
[0033] In some specific embodiments of the present invention, the sequence of the T1 chain is as shown in SEQ ID No. 6: SEQ ID No. 6: 5'-ACGTGTTCGAGTACTAGTTAGATA-3' In some specific embodiments of the present invention, the sequence of the T2 chain is as shown in SEQ ID No. 7: SEQ ID No. 7: 5'-AGTAACTCAAGCCATGCACCATAG-3' In some embodiments of the present invention, the nucleic acid T chain further includes a dT chain connecting the T1 chain and the T2 chain.
[0034] In some embodiments of the present invention, the length of the dT chain is 1 to 20 nt. For example, it can be 1 nt, 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, or within the range of any two of the above values.
[0035] This invention discovers that the probe spacing affects the recognition of TCR-CD3 dimers. In order to maintain a certain spacing, this invention adds a number of dT bases (i.e., dT chains) between the T1 chain and the T2 chain. The number of dT bases is 1~20nt.
[0036] In some embodiments of the present invention, a first fluorescence quenching group is attached to the 3' end of the T1 chain. Specifically, the first fluorescence quenching group can be BHQ (black hole quencher), such as BHQ-1, BHQ-2, and BHQ-3.
[0037] In some embodiments of the present invention, a second fluorescence quenching group is attached to the dT chain near the 5' end. Specifically, the second fluorescence quenching group can be BHQ (black hole quencher), such as BHQ-1, BHQ-2, and BHQ-3.
[0038] In a specific embodiment of the present invention, the provided caliper-structured ratiometric dual aptamer probe includes a first nucleic acid aptamer probe, a second nucleic acid aptamer probe, and a nucleic acid T-strand connecting the two; the nucleic acid T-strand includes a T1 strand located at the 3' end and a T2 strand located at the 5' end, the 3' end of the T1 strand being connected to a first fluorescence quenching group, and the 3' end of the T2 strand being connected to a second fluorescence quenching group; according to the 5'... In the 3' direction, the first nucleic acid aptamer probe sequentially includes a nucleic acid aptamer capable of targeting and binding to the CD3 protein, a first complementary strand at least partially complementary to the nucleic acid aptamer, and a first anchoring domain that binds to the T1 strand, and a first fluorescent group is attached to the 5' end; the length of the first complementary strand is 20 nt. The second nucleic acid aptamer probe sequentially includes a nucleic acid aptamer capable of targeting and binding to the CD3 protein, a second complementary strand at least partially complementary to the nucleic acid aptamer, and a second anchoring domain that binds to the T2 strand; the 5' end is attached to a second fluorescent group; the length of the second complementary strand is 10 nt.
[0039] Figure 1(a) is a schematic diagram of one type of ratiometric dual aptamer probe with caliper structure provided by the present invention (named TA20-TA10). As shown in the figure, the T1 strand at the 3' end of the nucleic acid T strand binds to the first nucleic acid aptamer probe (TA20), and the T2 strand at the 5' end of the nucleic acid T strand binds to the second nucleic acid aptamer probe (TA10).
[0040] In another specific embodiment of the present invention, the provided caliper-structured ratiometric dual aptamer probe includes a first nucleic acid aptamer probe, a second nucleic acid aptamer probe, and a nucleic acid T-strand connecting the two; the nucleic acid T-strand includes a T1 strand located at the 3' end and a T2 strand located at the 5' end, the 3' end of the T1 strand being connected to a first fluorescence quenching group, and the 3' end of the T2 strand being connected to a second fluorescence quenching group; according to the 5'... In the 3' direction, the first nucleic acid aptamer probe sequentially includes a nucleic acid aptamer capable of targeting and binding to the CD3 protein, a first complementary strand at least partially complementary to the nucleic acid aptamer, and a first anchoring domain that binds to the T1 strand, and a first fluorescent group is attached to the 5' end; the length of the first complementary strand is 10 nt. The second nucleic acid aptamer probe sequentially includes a nucleic acid aptamer capable of targeting and binding to the CD3 protein, a second complementary strand at least partially complementary to the nucleic acid aptamer, and a second anchoring domain that binds to the T2 strand; the 5' end is attached to a second fluorescent group; the length of the second complementary strand is 10 nt.
[0041] Figure 1(b) is another schematic diagram of the ratio-type dual aptamer probe with caliper structure provided by the present invention (named TA10-TA10). As shown in the figure, the T1 chain at the 3' end of the nucleic acid T chain binds to the first nucleic acid aptamer probe (TA10), and the T2 chain at the 5' end of the nucleic acid T chain binds to the second nucleic acid aptamer probe (TA10).
[0042] The structure of TA20 is shown in Figure 1(c): according to 5' In the 3' direction, the structure sequentially includes a nucleic acid aptamer capable of targeting and binding to the CD3 protein (region A), a first complementary strand (20 bases) at least partially complementary to the nucleic acid aptamer, and a first anchoring domain (region T) that binds to the T1 strand. The 5' end of TA20 is connected to a first fluorescent group, and the 3' end of the T1 strand is connected to a first fluorescence quencher. When the nucleic acid aptamer does not bind to the target CD3 protein, it forms a stable secondary structure with the first complementary strand, bringing the first fluorescent group and the quencher group into spatial proximity, thus achieving fluorescence quenching. When the nucleic acid aptamer recognizes and binds to the CD3 protein, a conformational change occurs, disrupting the original complementary strand hybridization structure, causing the first fluorescent group to move away from the quencher group, thus restoring the fluorescence signal.
[0043] The structure of TA10 is shown in Figure 1(d): Following the 5'→3' direction, it sequentially includes a nucleic acid aptamer capable of targeting and binding to the CD3 protein (region A), a first complementary strand (10 bases) at least partially complementary to the nucleic acid aptamer, and a first anchoring domain (region T) that binds to the T2 strand. A second fluorescent group is attached to the 5' end of TA10, and a second fluorescence quencher group is attached to the 3' end of the T2 strand. When the nucleic acid aptamer does not bind to the target CD3 protein, it forms a stable secondary structure complementary to the first complementary strand, making the second fluorescent group and the second quencher group spatially close, thus achieving fluorescence quenching. When the nucleic acid aptamer recognizes and binds to the CD3 protein, a conformational change occurs, disrupting the original complementary strand hybridization structure, causing the second fluorescent group to move away from the quencher group, thus restoring the fluorescence signal.
[0044] In a specific embodiment of the present invention, the provided caliper-structured ratiometric dual aptamer probes (TA20-TA10) have the sequence of the first nucleic acid aptamer probe as shown in SEQ ID No. 8: SEQ ID No. 8: 5'-GCCGCGGGGTGGGTCTAGTGTGGATGTTTAGGGGGCGGCCACTAGACCCACCCCGCGGCTATCTAACTAGTACTCGAACACGT-3', the 5' end is connected to ROX; The sequence of the second nucleic acid aptamer probe is shown in SEQ ID No. 9: SEQ ID No. 9: 5'-GCCGCGGGGTGGGTCTAGTGTGGATGTTTAGGGGGCGGCACCCCGCGGCCTATGGTGCATGGCTTGAGTTACT-3', the 5' end is connected to FAM; The sequence of the T strand of the nucleic acid is shown below: 5'-AGTAACTCAAGCCATGCACCATAG(SEQ ID No. 7)-(BHQ2)-dT-ACGTGTTCGAGTACTAGTTAGATA(SEQ ID No. 6)-(BHQ1)-3'.
[0045] In a specific embodiment of the present invention, the provided caliper-structured ratiometric dual aptamer probe (TA10-TA10) has the sequence of the first nucleic acid aptamer probe as shown in SEQ ID No. 10: SEQ ID No. 10: 5'-GCCGCGGGGTGGGTCTAGTGTGGATGTTTAGGGGGCGGCACCCCGCGGCTATCTAACTAGTACTCGAACACGT-3', the 5' end is connected to ROX; The sequence of the second nucleic acid aptamer probe is shown in SEQ ID No. 9: SEQ ID No. 9: 5'-GCCGCGGGGTGGGTCTAGTGTGGATGTTTAGGGGGCGGCACCCCGCGGCCTATGGTGCATGGCTTGAGTTACT-3', the 5' end is connected to FAM; The sequence of the T strand of the nucleic acid is shown below: 5'-AGTAACTCAAGCCATGCACCATAG(SEQ ID No. 7)-(BHQ2)-dT-ACGTGTTCGAGTACTAGTTAGATA(SEQ ID No. 6)-(BHQ1)-3'.
[0046] In a specific embodiment of the present invention, a ratio-type dual-adaptor probe (TA10-TA20) with a caliper structure is provided. The sequence of the first nucleic acid aptamer probe is shown in SEQ ID No. 10: SEQ ID No. 10: 5'-GCCGCGGGGTGGGTCTAGTGTGGATGTTTAGGGGGCGGCACCCCGCGGCTATCTAACTAGTACTCGAACACGT-3', the 5' end is connected to ROX; The sequence of the second nucleic acid aptamer probe is shown in SEQ ID No. 11: SEQ ID No. 11: 5'-GCCGCGGGGTGGGTCTAGTGTGGATGTTTAGGGGGCGGCCACTAGACCCACCCCGCGGCCTATGGTGCATGGCTTGAGTTACT-3', the 5' end is connected to FAM; The sequence of the T strand of the nucleic acid is shown below: 5'-AGTAACTCAAGCCATGCACCATAG(SEQ ID No. 7)-(BHQ2)-dT-ACGTGTTCGAGTACTAGTTAGATA(SEQ ID No. 6)-(BHQ1)-3'.
[0047] In some embodiments of the present invention, when the nucleic acid aptamer recognizes and binds to the CD3 protein, the fluorescent group moves away from the quenching group, and the fluorescence signal is restored.
[0048] In a second aspect, the present invention provides the application of the above-described ratiometric aptamer fluorescent probe in detecting the content of TCR-CD3 dimer in extracellular vesicles.
[0049] A third aspect of the present invention provides a method for detecting the content of TCR-CD3 dimer in extracellular vesicles, comprising the steps of: S100, providing the above-mentioned ratiometric dual aptamer fluorescent probe; S200. The ratiometric dual aptamer fluorescent probe is reacted with the extracellular vesicle to be tested. The TCR-CD3 monomer in the extracellular vesicle binds to the first nucleic acid aptamer probe of the ratiometric dual aptamer fluorescent probe and excites the first fluorescence. The TCR-CD3 dimer in the extracellular vesicle simultaneously binds to both the first and second nucleic acid aptamer probes of the ratiometric dual aptamer fluorescent probe and excites the first and second fluorescence. S300. Calculate the content of TCR-CD3 dimer in the extracellular vesicles by analyzing the signal intensity of the first fluorescence and the second fluorescence by ratio analysis.
[0050] The present invention provides a method for detecting the content of TCR-CD3 dimer in extracellular vesicles. Targeting a novel functional EV biomarker—TCR-CD3 dimer EVs—it employs a caliper-structured ratiometric probe to identify the oligomerization conformation of EV membrane proteins. This method is suitable for non-invasive, rapid, sensitive, and specific identification of acute cellular rejection responses, overcoming the limitation of traditional antibody detection methods' insensitivity to spatial structure. Beneficial effects include: 1) Unique detection strategy: Oligomeric state differentiation is achieved through a ratio-type caliper structure. The probe adopts a dual-affinity aptamer design and forms a "caliper structure" through spatial arrangement. It can identify TCR-CD3 monomers and dimers respectively and output two fluorescent signals at the same time. The label-free differentiation of the oligomeric state of proteins on the surface of EVs is achieved by changing the ratio. The method is unique and has strong distinguishing ability.
[0051] 2) Non-invasive + micro-volume blood sample detection: The above detection methods can be directly applied to plasma samples, requiring only a small amount of plasma sample, without the need for cell culture or tissue biopsy. The detection process is simple and easy to perform, suitable for rapid, dynamic, and non-invasive monitoring, and has high specificity and clinical application potential. It provides new monitoring tools and research platforms for related fields such as organ transplantation, immune rejection, autoimmunity, and immunotherapy.
[0052] 3) High sensitivity and specificity: By optimizing the aptamer affinity and structural response mechanism, high sensitivity detection of trace amounts of TCR-CD3 dimer EVs is achieved. In the mouse xenograft model, it can accurately distinguish between rejection and non-rejection states, and the signal intensity is well correlated with the degree of rejection, with good accuracy.
[0053] 4) The platform has strong compatibility and is easy to promote: The detection method can be completed in a standard microplate fluorescence reading system without the need for complex instruments or sorting systems, which facilitates standardization and mass promotion. At the same time, it has high modular compatibility with other aptamers and markers, making it suitable for building a multi-index joint analysis platform.
[0054] 5) High application prospects: This invention constructs a complete detection system for a novel immune rejection biomarker, which has the basic conditions for productization and reagent kit development, and is expected to be applied to various scenarios such as rejection detection after organ transplantation and efficacy evaluation of immunotherapy.
[0055] In a third aspect, the present invention provides a kit comprising the ratiometric dual aptamer fluorescent probe described above.
[0056] In a fourth aspect, the present invention provides the application of the above-described ratiometric aptamer fluorescent probe, the above-described method for detecting TCR-CD3 dimer content in extracellular vesicles, or the above-described kit in at least one of (a1) to (a7): (a1) Prepare products for monitoring and / or detecting immune rejection in organ transplantation; (a2) Preparation of specific antibodies; (a3) Prepare products for immunotherapy and / or cell therapy; (a4) Non-diagnostic detection of T cell status; (a5) Research on the mechanism of T cell immunity; (a6) Biomedical field; (a7) Prepare a product, which is used in any of (a4) to (a6).
[0057] In some implementations, the product is a reagent, kit, chip, or system.
[0058] Unless otherwise stated, all nucleotide sequences in this article are presented at the 5' end. 3' end.
[0059] In this document, unless otherwise stated, “identity” has the conventional meaning in the art as “homology” between two nucleic acid or amino acid sequences, where the percentage represents the statistically significant percentage of identical nucleotide or amino acid residues between the two sequences to be compared after best alignment, with the differences between the two sequences randomly distributed across their entire length. Attached Figure Description
[0060] Figure 1 is a schematic diagram of the ratio-type dual-adaptor probe with caliper structure provided by the present invention. In Figure 1(a), it is a schematic diagram of the TA20-TA10 probe, Figure 1(b), it is a schematic diagram of the TA10-TA10 probe, Figure 1(c), it is a schematic diagram of the structure of TA20, and Figure 1(d), it is a schematic diagram of the structure of TA10.
[0061] Figure 2 The model CD3 provided for this invention + A schematic diagram of the identification results of EVs, where a: TEM image of EVs; b: particle size distribution of EVs; c: protein expression of CD3 on the surface of EVs.
[0062] Figure 3 This is a schematic diagram illustrating the specificity analysis of the CD3 aptamer probes provided by the present invention. The diagram shows a comparison of the affinity of CD3 aptamers (OSJ-T3), TA10, and TA20 with different cells.
[0063] Figure 4 The binding affinity (equilibrium dissociation constant K) of TA10, TA14, TA18 and TA20 with CD3+ EVs provided by this invention d (Diagram showing calculation and detection performance evaluation)
[0064] Figure 5 This diagram illustrates the structural design, bonding capability calculation, and verification results of the caliper probe provided by this invention.
[0065] Figure 6 A schematic diagram of the binding process between the caliper probe and TCR-CD3 monomer EVs provided by this invention, and a schematic diagram of the fluorescence signal change process.
[0066] Figure 7A schematic diagram of the binding process between the caliper probe and TCR-CD3 dimer EVs provided by this invention, and a schematic diagram of the fluorescence signal changes.
[0067] Figure 8 A schematic diagram of the direct interaction process between the caliper probe and plasma and a schematic diagram of the fluorescence signal changes provided by the present invention.
[0068] Figure 9 This is a schematic diagram of the postoperative skin condition of the mouse model used in this invention.
[0069] Figure 10 This is a schematic diagram of HE staining and immunohistochemical staining of skin sections from a mouse model with skin transplantation used in this invention.
[0070] Figure 11 A schematic diagram showing the hybridization and assembly of the caliper probe structures with different spacing configurations provided by the present invention, verified by PAGE gel electrophoresis.
[0071] Figure 12 The fluorescence kinetic curves of the caliper probe (probe-dT1 / 10 / 20) after interaction with normal mouse plasma samples provided in this invention and F FAM / F ROX ratio.
[0072] Figure 13 This is a schematic diagram illustrating the application of the caliper probe provided by the present invention in detecting acute rejection in a mouse skin transplantation model. Detailed Implementation
[0073] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.
[0074] In the description of this invention, the terms "one embodiment," "some embodiments," "illustrative embodiment," "example," "specific example," or "some examples," etc., refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of the invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.
[0075] Unless otherwise specified in the following examples, the techniques or conditions described in the literature in this field or in accordance with the product instructions shall apply. All reagents or instruments without a specified manufacturer are commercially available conventional products.
[0076] Example 1: CD3 based on aptamer probes + EV recognition, affinity modulation and fluorescence response performance verification (1) CD3 + Extraction and validation of EVs model Jurkat cells were cultured at 37°C and 5% CO2 until the cell density reached 5 × 10⁻⁶ cells / year. 5 The culture medium was replaced with a medium containing 1% serum-free EVs at a concentration of 1 / mL, and incubated at 37°C. o After culturing for another 48 h, the cell supernatant was collected and centrifuged at 300×g and 3000×g for 15 min, and then at 10000×g for 30 min to remove cell debris and large vesicles. Finally, the cells were centrifuged at 100000×g for 70 min using a refrigerated ultracentrifuge, the supernatant was discarded, and the cells were resuspended in PBS and centrifuged at 100000×g for 70 min. The supernatant was discarded, and the pellet was resuspended in 200 μL of PBS to obtain the model EVs.
[0077] One μL of model EVs was diluted 10-fold with ultrapure water and dropped onto an ultrathin carbon membrane-supported copper grid. After drying, 1% phosphotungstic acid was added, and the mixture was allowed to stand for staining for 15 seconds. Immediately afterwards, the residual phosphotungstic acid was washed away with ultrapure water. The copper grid was then placed in a vacuum and dried for 12 hours. The morphology of the EVs was then photographed using a transmission electron microscope (TEM). One μL of model EVs was diluted 1000-fold with PBS, and the particle size of the EVs was detected using a nanoflow cytometer. One μL of model EVs was added with FITC-labeled anti-CD3 antibody, stained on ice for 30 minutes, diluted 1000-fold with PBS, and the expression of CD3 protein on the surface of the EVs was detected using a nanoflow cytometer.
[0078] The results are as follows Figure 2 As shown, the morphology of the model EVs is saucer-shaped, with a diameter of approximately 100 nm. Figure 2 (a) The average particle size of EVs detected by nanoflow cytometry was approximately 76.2 ± 22.0 nm. Figure 2 (b); and the CD3 positivity rate of EVs was 19.7% ( Figure 2 (c) indicates that the morphology, particle size, and protein expression of the model EVs meet the identification requirements for EVs, and further experiments can be carried out.
[0079] (2) Design of aptamer probes and verification of target specificity As shown in Figures 1(c) and (d), the aptamer probe constructed in this embodiment consists of three parts: a nucleic acid aptamer (A) capable of targeting and binding to the CD3 protein, a DNA strand partially complementary to the nucleic acid aptamer, and an anchoring domain complementary to the T strand. One end of the nucleic acid aptamer is labeled with a fluorescent group (such as FAM or ROX), and the 3' end of the T strand is labeled with a quenching group (such as BHQ1 or BHQ2). When not binding to the target protein CD3, the aptamer forms a stable secondary structure with the complementary strand, making the fluorescent group and the quenching group spatially close, thereby achieving fluorescence quenching. When the aptamer recognizes and binds to the CD3 protein, a conformational change occurs, disrupting the original complementary strand hybridization structure, causing the fluorescent group to move away from the quenching group, thus restoring the fluorescence signal.
[0080] aptamer probe: T2 sequence: 5'-AGTAACTCAAGCCATGCACCATAG (SEQ ID No. 7)-(BHQ1)-3' A10-T2 sequence: 5'-(FAM)-GCCGCGGGGTGGGTCTAGTGTGGATGTTTAGGGGGCGGCACCCCGCGGCCTATGGTGCATGGCTTGAGTTACT (SEQ ID No. 9)-3' A20-T2 sequence: 5'-(FAM)-GCCGCGGGGTGGGTCTAGTGTGGATGTTTAGGGGGCGGCCACTAGACCCACCCCGCGGCCTATGGTGCATGGCTTGAGTTACT (SEQ ID No. 11)-3' To verify the binding specificity of TA10 and TA20 to CD3, 2×10⁻⁶ samples were taken respectively. 5 Jurkat (T cells) and MDA-MB-231 cells (CD3-negative cells) were placed in sterile 1.5 mL EP tubes, and the culture medium was replaced with serum-free fresh medium. The tubes were then inoculated with 2 μM FAM fluorescently modified CD3 aptamers, TA10, and TA20 at 37°C. o Incubate at C for 2 h. During incubation, gently resuspend the cells every 30 min. After incubation, wash away unbound nucleic acid chains with PBS, resuspend the cells in 400 μL PBS, and perform fluorescence detection by flow cytometry. Results are as follows: Figure 3As shown, the CD3 aptamer showed the strongest affinity for Jurkat cells compared to MDA-MB-231 cells that do not express CD3. The fluorescence intensity of TA10 and TA20 binding to Jurkat cells was weakened, but still significantly higher than that of CD3-negative cells, indicating that the extended sequence on the probe, in addition to the aptamer, weakens its affinity for binding to CD3, but does not affect its specificity.
[0081] (3) Calculation of affinity and detection limit of TA10, TA14, TA18 and TA20 with CD3+ EVs Different concentration gradients of TA10, TA14, TA18, or TA20 (0 ~ 250 nM) were incubated with a fixed concentration of Jurkat EVs (1 × 10¹¹ particles / mL) at 37 °C for 2 hours. The total reaction volume was 50 μL, and the reaction was performed in 96-well black microplates. TA14 and TA18 refer to complementary strands with lengths of 14 nt and 18 nt, respectively. Compared to TA20, their sequences are identical except for the removal of 6 or 2 bases from their complementary strands. After incubation, fluorescence signals were detected using a microplate reader at an excitation wavelength of 485 nm and an emission wavelength of 520 nm. The obtained fluorescence intensity data were used to plot binding curves, perform nonlinear fitting analysis, and determine the dissociation equilibrium constant ( ). K d The calculation of ) yields the following fitted equation:
[0082] Where Y is the detected fluorescence intensity, X is the concentration of the aptamer switch probe, and B... max Indicates the maximum number of binding sites. K d This is the equilibrium dissociation constant between the probe under test and the EVs. For example... Figure 4 As shown in the middle ad, TA10's K d 35.2 ± 3.7 nM ( Figure 4 (a), TA14 K d 40.1 ± 2.5 nM ( Figure 4 (b) TA18 K d 49.6 ± 10.9 nM ( Figure 4 (c), TA20 is 61.7 ± 4.7 nM ( Figure 4 (d). The results show that the longer the complementary chain length, the lower the aptamer affinity. By modifying the number of bases in the complementary chain, the binding ability of the aptamer to CD3 can be effectively controlled, providing different affinity modules for the construction of dual-probe ratio probes.
[0083] To evaluate the detection sensitivity of the aptamer probe for CD3+ EVs, 200 nM of FAM-labeled TA10 or ROX-labeled TA20 was mixed with different concentrations of CD3+ EVs (1.6 × 10⁻⁶). 8 ~ 8.0 × 10 9 The particles (particles / mL) were incubated at 37°C for 2 hours, and then the fluorescence spectrum was measured using a fluorescence spectrophotometer (FAM: excitation wavelength 485 nm, emission wavelength 520 nm; ROX: excitation wavelength 580 nm, emission wavelength 605 nm). Figure 4 In the figure, e represents TA10 and f represents TA20. The fluorescence intensity shows a good linear relationship with EV concentration. Based on the standard deviation of the blank group and the slope of the linear fitting, the limit of detection (LOD) for both probes was calculated to be 2.2 × 10⁻⁶. 8 The particle / mL ratio indicates that this probe system has high sensitivity and is suitable for the quantitative detection and immune status assessment of TCR-CD3 dimer EVs in plasma samples. Furthermore, at the highest concentration (8.0 × 10⁻⁶), the sensitivity is [not specified in the original text]. 9 The fluorescence intensity of the two probes (particles / mL) was comparable to that of the original probes (A10-FAM and A20-ROX) without labeling quenching groups, indicating that the probes could completely switch conformations and release fluorescence signals in the presence of high concentrations of the target, thus verifying their good response performance and target dependence.
[0084] Example 2: Configuration design of caliper-structured aptamer probe and evaluation of its detection performance on the TCR-CD3 complex. (1) Structural design and integration capability modeling of three types of caliper probes To explore the optimal combination mode of two aptamer switching probes, in this embodiment, three caliper-structured aptamer probes were designed and assembled, namely TA10-TA20, TA10-TA10 and TA20-TA10 (probe sequence as described above). Figure 5 a: Schematic diagrams of the structural designs of three caliper probes: TA10-TA20, TA10-TA10, and TA20-TA10. The fan-shaped areas represent the spatial free swing accessibility of the 3' and 5' probes, respectively. b: Evaluation of the bonding capability of probes at different spatial positions. The bonding capability is expressed as the free swing area and the dissociation constant (K). d The ratio of ) is used for quantification; c: the hybridization between different domains of the caliper probe is verified by PAGE gel electrophoresis, lane 1: DNA molecular weight standard; lane 2: A10-T2 Lane 3: A20-T1 Lane 4: T1-T2; Lane 5: TA10-TA20; Lane 6: TA10-TA10; Lane 7: TA20-TA10. (Example) Figure 5As shown in Figure a, each probe consists of two aptamer switch probes (TA10 or TA20) connected by a bridging T-chain, one located at the 3' end of the T-chain (labeled ROX) and the other at the 5' end (labeled FAM). Due to different spatial steric hindrances, theoretically, the 3' end probe has higher conformational freedom, while the 5' end probe is constrained by the structural constraints of the T-chain. To quantify the influence of spatial factors on binding behavior, it is assumed that the binding range of the 3' end probe is a 270° sector, and that of the 5' end probe is 90°. A "CD3 binding capability" parameter is introduced, defined as the ratio of the area of space in which the probe can freely swing to the corresponding probe's... K d Ratio of values (Area / K d The calculation results are as follows: Figure 5 In the TA10-TA20 model, the binding capacity of the 3' end probe was 5.3 times that of the central probe, 3.0 times that of TA10-TA10, and 1.7 times that of TA20-TA10, indicating that the probe spatial configuration has a significant impact on target recognition ability. Furthermore, PAGE gel electrophoresis confirmed the successful hybridization of the three caliper probes. Figure 5 (c). In addition, Table 1 lists the CD3 binding capacity and ratio of the 3' and 5' probes when aptamers with different bases are used.
[0085] Table 1
[0086] (2) Fluorescence kinetic analysis of TCR-CD3 monomer EVs To investigate the differences among the three probes in recognizing TCR-CD3 monomeric EVs, a 200 nM probe was compared with Jurkat EVs (1 × 10⁻⁶). 10 The particles were mixed (particles / mL) and incubated at 37°C. The fluorescence signals of ROX (Ex / Em = 580 / 605nm) and FAM (Ex / Em = 485 / 520 nm) were monitored in real time using a microplate reader. The fluorescence value of the EV-free group at 50 minutes was used as the background fluorescence value. F blank ), calculate net signal change ( F = F F blank )and F FAM / F ROX Ratio. The test results are as follows: Figure 6 The display shows that 'a' represents three types of caliper probes and TCR. A schematic diagram of the CD3 monomer EVs binding process, b shows the interaction of three caliper probes with TCR. The diagram illustrates the fluorescence signal changes during the CD3 monomer EV binding process. Figure c shows the fluorescence signal changes at the 5' / 3' ends of the three caliper probes. It can be seen that all three probes exhibit significant ROX signal enhancement, with TA10-TA20 and TA10-TA10 showing higher ROX fluorescence intensities than TA20-TA10, consistent with their design expectation of higher 3' end binding ability. In contrast, the FAM fluorescence shows almost no change. F FAM / F ROX The ratios were all close to 0, indicating that the 5' probe was not significantly activated. These results suggest that the TCR-CD3 complex on the surface of Jurkat EVs exists mainly in monomeric form and is more easily recognized and activated by the 3' probe.
[0087] (3) Kinetic response of TCR-CD3 dimer EVs and plasma EVs Whole blood was obtained from 6-8 week old male C57BL / c mice via submandibular vein sampling. The blood was centrifuged at 1500×g for 15 min, and the supernatant was collected as plasma. The mouse plasma samples were centrifuged at 18000×g for 30 min at 4°C, and the supernatant was collected. The total protein concentration in the supernatant was determined using the BCA method. Subsequently, Proteinase K solution with a final concentration of 150 μg / mL was added to the plasma supernatant containing 10 mg of protein, and the mixture was incubated at 37°C for 30 min to lyse exogenous protein contaminants. Incubation was then continued at 60°C for 10 min to inactivate Proteinase K. The pretreated plasma samples were transferred to ultrafiltration centrifuge tubes with a molecular weight cutoff of 100 kDa and centrifuged at 3700×g for 15 min until the filtrate volume was reduced to approximately 50 μL. 450 μL of PBS buffer was added to the filter membrane, and this washing step was repeated three times to remove small molecule impurities. Finally, 50 μL of the liquid enriched with EVs was retained, and the ultrafiltration device was inverted and centrifuged at 2000 × g for 5 minutes to recover the residue, obtaining the complete EV fraction. To characterize the particle size distribution of the extracted plasma EVs, 5 μL of EV suspension was diluted to 1 mL with PBS and analyzed using a nanoparticle tracking analyzer (NTA). The results are as follows: Figure 7 As shown in Figure a, the average particle size of plasma EVs is 169 nm.
[0088] A 200 nM probe was used with plasma EVs (1 × 10⁻⁶). 10 The particles (particles / mL) were mixed and incubated in a 96-well plate at 37°C, with real-time monitoring of ROX and FAM fluorescence signal intensity. Figure 7As shown in Figures b and d, b is a schematic diagram of the binding process between the three caliper probes provided by this invention and TCR-CD3 dimer EVs, c is a schematic diagram of the fluorescence signal changes during the binding process between the three caliper probes provided by this invention and TCR-CD3 dimer EVs, and d is a schematic diagram of the 5' / 3' fluorescence intensity changes. The TA10-TA20 probes still exhibit a dominant ROX response, TA10-TA10 shows enhanced FAM signal, while TA20-TA10 simultaneously activates both ROX and FAM signals. F FAM / F ROX The highest ratio (0.63) corresponds to its optimal dual-site binding ability. The same trend was also confirmed in unpurified plasma. Figure 8 (a is a schematic diagram of the fluorescence signal changes during the binding process of the three caliper probes provided by the present invention with plasma, and b is a schematic diagram of the fluorescence intensity changes at 5' / 3'), indicating that the probe system has the ability to directly detect TCR-CD3 dimer EVs in complex biological samples.
[0089] Example 3: Application of distance dependence based on caliper probe in detecting acute rejection in a mouse model of skin grafting (1) Establishment of a mouse model of skin grafting Eight-week-old male C57BL / 6 mice were selected as recipients, and eight-week-old male BALB / c mice were selected as allogeneic donors. Both were housed in a specific pathogen-negative (SPF) environment (12 h / 12 h light / dark cycle, temperature 20–24°C, relative humidity 50–60%). In the allogeneic transplantation group (Allograft), a full-thickness skin flap of approximately 1 cm² was harvested from the back of the BALB / c donor mouse and stored in a sterile saline ice bath for later use. C57BL / 6 recipient mice were anesthetized with isoflurane, shaved, and disinfected with 10% povidone-iodine. A wound of the same area of skin was surgically removed from the back of the mice using aseptic techniques. The donor skin was then placed over the wound, sutured, and wrapped with commercial dressings. From postoperatively, the grafts were observed daily for signs of acute rejection, such as erythema, edema, ulceration, and crusting. The control group received autograft, i.e., skin transplanted from the C57BL / 6 mouse itself, serving as a non-rejection control. Figure 9 The appearance and morphological changes of skin grafts in the autologous transplantation group and the allogeneic transplantation group were compared. Results showed that the autologous transplantation group exhibited only mild erythema and edema in the early postoperative period, which gradually healed over time. Figure 9 (Top-middle image); The allogeneic transplant group showed obvious rejection symptoms several days post-surgery, including erythema, edema, ulceration, and crusting; by day 15, over 80% of the graft tissue had necrosis. Figure 9 (Lower middle image).
[0090] (2) Histopathological analysis Mice were sacrificed on postoperative day 15, and transplanted skin tissue was harvested, fixed in 4% paraformaldehyde, dehydrated with graded ethanol, and routinely embedded in paraffin. Sections were 5 μm thick. Hematoxylin-eosin (H&E) staining and CD3 immunohistochemical (IHC) staining were performed. IHC procedures included dewaxing, hydration, heat repair, blocking with 5% BSA for 30 minutes, incubation with anti-CD3 antibody overnight at 4°C, incubation with HRP-labeled secondary antibody at room temperature for 1 hour, washing with PBS, and development with DAB reagent. Finally, images were observed and recorded using a tissue scanner. Results are as follows: Figure 10 The images show full-thickness H&E staining images of skin from normal, autologous, and allogeneic mice. The dashed boxes indicate the graft-host skin interface. The top row shows magnified H&E staining images of this area, and the bottom row shows magnified CD3 immunohistochemical (IHC) staining images of the same area. Compared to normal mouse skin tissue, H&E staining revealed extensive inflammatory cell infiltration at the graft-host interface in the allogeneic group. IHC staining further revealed a significant increase in the number of CD3-positive T cells, suggesting that T cells play a dominant role in allogeneic rejection.
[0091] (3) Structural optimization of caliper probe spacing To investigate the effect of probe spacing on TCR-CD3 dimer recognition, three caliper probes with different spacings were designed: probe-dT0, probe-dT1, probe-dT10, and probe-dT20. The integrity of the probe structures was verified by PAGE gel electrophoresis. Figure 11 (Wheel lane 1: DNA molecular weight standard; Wheel lane 2: A10-T1) Lane 3: A20-T2 Lane 4: T1-T3; Lane 5: T1-dT1-T2; Lane 6: T1-dT10-T2; Lane 7: T1-dT20-T2; Lane 8: Probe-dT0; Lane 9: Probe-dT1; Lane 10: Probe-dT10; Lane 11: Probe-dT20. The four probes were mixed with plasma from normal C57BL / 6 mice, and changes in ROX and FAM fluorescence signals were monitored in real time. Results are as follows: Figure 12 As shown, probe-dT0 primarily activates ROX fluorescence at the 3' end, while the FAM signal at the 5' end is weak. F FAM / F ROXThe lowest ratio indicates that when the probe spacing is too short, the 3' end aptamer dominates binding, and the 5' end probe is difficult to activate. From probe-dT1 to probe-dT20, the ratio gradually decreases, indicating that the caliper probe has a clear spatial dependence on TCR-CD3 dimer recognition. If the spacing is too long (20nt), the 5' end probe may not respond sufficiently due to reduced hybridization efficiency or slow kinetics, resulting in probe-dT1 achieving the best dual-site activation effect.
[0092] The difference between probe-dT0, probe-dT1, probe-dT10, probe-dT20 and probe TA20-TA10 is that the T chain is different, while the first nucleic acid aptamer probe and the second nucleic acid aptamer probe are the same.
[0093] The T-chains of each probe are as follows: Probe-dT0: T1-T3 sequence: 5'-AGTAACTCAAGCCATGCACCATAG (SEQ ID No. 7)-(BHQ2)-dT-AGTACTAGTTAGATA (SEQ ID No. 12)-3' Probe-dT1: T1-dT1-T2 sequence: 5'-AGTAACTCAAGCCATGCACCATAG (SEQ ID No. 7)-(BHQ2)-dT-ACGTGTTCGAGTACTAGTTAGATA (SEQ ID No. 6)-(BHQ1)-3' Probe-dT10: T1-dT10-T2 sequence: 5'-AGTAACTCAAGCCATGCACCATAG (SEQ ID No. 7)-(BHQ2)-dT-TTTTTTTTT-ACGTGTTCGAGTACTAGTTAGATA (SEQ ID No. 6)-(BHQ1)-3' Probe-dT20: T1-dT20-T2 sequence: 5'-AGTAACTCAAGCCATGCACCATAG(SEQ ID No. 7)-(BHQ2)-dT-TTTTTTTTTTTTTTTTTTTT-ACGTGTTCGAGTACTAGTTAGATA(SEQ ID No. 6)-(BHQ1)-3' (4) Application in transplantation models and dynamic monitoring of rejection The proportion of TCR-CD3 dimer EVs in plasma samples from normal, autologous, and allogeneic mice was detected using the four probes described above. Figure 13This study demonstrates the application of caliper probes in detecting acute rejection in a mouse skin transplantation model. (a: Fluorescence intensity ratios of different plasma proportions detected by probe-17; b: Fluorescence intensity ratios measured using probe-dT0, probe-dT1, probe-dT10, and probe-dT20 in normal, autologous, and allogeneic transplanted mouse plasmas; schematic diagram of fluorescence intensity ratios in autologous (c) and allogeneic (d) mouse plasma samples on days 0, 3, 7, 10, and 15 post-skin transplantation. Using the 5' / 3' fluorescence intensity ratio as the detection index, the results showed that probe-dT0 did not differ significantly among the three groups and could not effectively distinguish between monomers and dimers; while the fluorescence ratios of probe-dT1, probe-dT10, and probe-dT20 were significantly increased in the allogeneic transplantation group, and there was no significant difference between the autologous and normal groups.) Figure 13 (a) Further, plasma samples were collected on postoperative days 3, 7, 10, and 15 for testing. Results showed that the fluorescence ratio in the autologous transplantation group remained stable, while the fluorescence ratio in the allogeneic transplantation group significantly increased from day 7, reaching a peak on day 15, which coincided with the time of complete graft necrosis. Figure 13 (c)
[0094] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.
Claims
1. A ratiometric dual-adaptor probe with a caliper structure, characterized in that, The ratiometric dual aptamer probe includes a first nucleic acid aptamer probe, a second nucleic acid aptamer probe, and a nucleic acid T-strand connecting the two; the nucleic acid T-strand includes a T1 strand at the 3' end and a T2 strand at the 5' end; the first nucleic acid aptamer probe is at least partially complementary to the T1 strand, and the second nucleic acid aptamer probe is at least partially complementary to the T2 strand; the first nucleic acid aptamer probe generates a first fluorescence after targeting and binding to the CD3 protein, and the second nucleic acid aptamer probe generates a second fluorescence after targeting and binding to the CD3 protein, wherein the first fluorescence and the second fluorescence are different; wherein the CD3 protein binding capacity of the first nucleic acid aptamer probe is 1.7 to 3.0 times that of the second nucleic acid aptamer probe.
2. The ratiometric dual-aptamer fluorescent probe according to claim 1, characterized in that, According to 5' In the 3' direction, the first nucleic acid aptamer probe sequentially includes a nucleic acid aptamer capable of targeting and binding to the CD3 protein, a first complementary strand at least partially complementary to the nucleic acid aptamer, and a first anchoring domain that binds to the T1 strand, and a first fluorescent group is attached to the 5' end; and / or, the second nucleic acid aptamer probe sequentially includes a nucleic acid aptamer capable of targeting and binding to the CD3 protein, a second complementary strand at least partially complementary to the nucleic acid aptamer, and a second anchoring domain that binds to the T2 strand, and a second fluorescent group is attached to the 5' end.
3. The ratiometric dual-aptamer fluorescent probe according to claim 2, characterized in that, The length of the first complementary chain is 0 to 10 nt longer than the length of the second complementary chain.
4. The ratiometric dual-aptamer fluorescent probe according to claim 3, characterized in that, The length of the first complementary chain is 10~20nt; and / or, the length of the second complementary chain is 10~20nt.
5. The ratiometric dual-aptamer fluorescent probe according to claim 1, characterized in that, The 3' end of the T1 chain is connected to a first fluorescence quenching group; And / or, the nucleic acid T chain further includes a dT chain connecting the T1 chain and the T2 chain, the length of the dT chain being 1~20nt, wherein the dT near the 5' is connected to a second fluorescence quenching group.
6. The ratiometric dual-aptamer fluorescent probe according to any one of claims 1-5, characterized in that, The sequence of the first nucleic acid aptamer probe is shown in SEQ ID No. 8 or SEQ ID No. 10; And / or, the sequence of the second nucleic acid aptamer probe is shown in SEQ ID No. 9; And / or, the sequence of the T1 chain is as shown in SEQ ID No. 6; And / or, the sequence of the T2 chain is as shown in SEQ ID No.
7.
7. The use of a ratiometric aptamer fluorescent probe as described in any one of claims 1-6 in detecting the content of TCR-CD3 dimer in extracellular vesicles.
8. A method for detecting the content of TCR-CD3 dimer in extracellular vesicles, characterized in that, Including the following steps: Provide a ratiometric dual aptamer fluorescent probe as described in any one of claims 1-6; The ratiometric dual aptamer fluorescent probe is reacted with the extracellular vesicle to be tested. The TCR-CD3 monomer in the extracellular vesicle binds to the first nucleic acid aptamer probe of the ratiometric dual aptamer fluorescent probe and excites the first fluorescence. The TCR-CD3 dimer in the extracellular vesicle simultaneously binds to both the first and second nucleic acid aptamer probes of the ratiometric dual aptamer fluorescent probe and excites the first and second fluorescence. The content of TCR-CD3 dimer in the extracellular vesicles was calculated by analyzing the signal intensity of the first fluorescence and the second fluorescence.
9. A reagent kit, characterized in that, Including the ratiometric dual aptamer fluorescent probe as described in any one of claims 1-6.
10. The application of a ratiometric aptamer fluorescent probe as described in any one of claims 1-6, a method for detecting the content of TCR-CD3 dimer in extracellular vesicles as described in claim 8, or a kit as described in claim 9 in at least one of (a1) to (a7): (a1) Prepare products for monitoring and / or detecting immune rejection in organ transplantation; (a2) Preparation of specific antibodies; (a3) Prepare products for immunotherapy and / or cell therapy; (a4) Non-diagnostic detection of T cell status; (a5) Research on the mechanism of T cell immunity; (a6) Biomedical field; (a7) Prepare a product, which is used in any of (a4) to (a6).