A highly efficient serine protease for degrading β-keratin, its degradation method and application
The expression of the recombinant serine protease LteKerS derived from *Ixodes latifolia* in *Pichia pastoris* overcomes the shortcomings of existing keratinases in feather degradation, achieving efficient and mild feather degradation. The product can be used for high-value-added applications and is suitable for industrial processing.
Patent Information
- Application Number
- CN202610373736.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-25
- Publication Date
- 2026-06-02
AI Technical Summary
Existing keratinases have limitations in degrading feather shafts, insufficient stability under strong alkaline conditions, and the need for high temperatures or complex pretreatment when degrading poultry feathers, making it difficult to meet industrial requirements.
The highly efficient serine protease LteKerS, derived from Lecanicillium testudineum GZAC1Y2-12, was used to construct a recombinant serine protease rLteKerS with the N-terminal signal peptide removed and a purification tag at the C-terminus. This recombinant protease was expressed in Pichia pastoris and degraded using glycine-sodium hydroxide buffer (pH 9.0), reducing agent DTT, and a suitable temperature.
It achieves efficient degradation of intact feathers under alkaline conditions, with a feather degradation rate of 88.67%. The products are soluble proteins and peptides, which are suitable for high-value-added utilization. The reaction conditions are mild and do not require high temperature, high pressure or complex pretreatment.
Smart Images

Figure CN122128282A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of industrial biotechnology and agricultural waste resource utilization technology, specifically relating to a highly efficient serine protease for degrading β-keratin, its degradation method and application. Background Technology
[0002] With the rapid development of the global poultry farming and processing industry, chicken and duck feathers are generated in large quantities as a byproduct. Feathers are rich in β-keratin, have a highly ordered structure, and are rich in hydrogen bonds, forming a dense β-sheet structure that makes them difficult to degrade under natural conditions. Traditional feather treatment methods (such as incineration, landfill, or strong alkaline hydrolysis) suffer from high energy consumption, serious environmental pollution, and amino acid destruction, limiting the high-value utilization of feather resources.
[0003] In recent years, the degradation of feathers using microorganisms or enzymes has been considered an environmentally friendly and industrially promising solution. However, most of the keratinases reported so far have the following shortcomings: (1) limited ability to degrade highly crystalline areas such as feather shafts; (2) insufficient stability under strongly alkaline conditions; (3) often requiring high temperature or complex pretreatment steps; and (4) degradation efficiency that is difficult to meet industrial needs. Therefore, it is of great significance to develop a highly active and efficient keratinase that can directly degrade whole feathers. Summary of the Invention
[0004] The purpose of this invention is to provide a highly efficient serine protease derived from *Lecanicillium testudineum* GZAC1Y2-12 that degrades β-keratin (intact feathers, including the rachis), along with its degradation method and application. This invention aims to address the challenges of efficient degradation and high-value utilization of feathers, a byproduct of poultry farming, by providing a highly efficient enzymatic keratinase for degradation, thereby achieving efficient and bio-friendly resource utilization of poultry feather waste.
[0005] To achieve the above objectives, the present invention adopts the following technical solution:
[0006] A highly efficient serine protease LteKerS that degrades β-keratin, the full-length amino acid sequence of which is shown in SEQ ID No. 2, and the amino acid sequence of the recombinant serine protease rLteKerS constructed by removing the soluble expression portion after removing the N-terminal signal peptide and having a purification tag at the C-terminus are shown in SEQ ID No. 4.
[0007] A gene encoding the above-mentioned highly efficient serine protease LteKerS that degrades β-keratin has its full-length nucleotide sequence shown in SEQ ID No. 1.
[0008] A gene encoding the recombinant serine protease rLteKerS, the nucleotide sequence of which is shown in SEQ ID No. 3.
[0009] A mutant protease, which is any one of the following:
[0010] (a) A protein obtained by substituting, deleting or adding one or more amino acid residues of the amino acid sequence of the serine protease LteKerS, having at least 90% sequence identity with the sequence shown in SEQ ID No. 2, and having the activity of the serine protease LteKerS.
[0011] (b) A protein obtained by substituting, deleting or adding one or more amino acid residues of the amino acid sequence of the recombinant serine protease rLteKerS, having at least 90% sequence identity with the sequence shown in SEQ ID No. 4, and having serine protease rLteKerS activity.
[0012] An expression vector containing a nucleotide sequence as shown in SEQ ID No. 1 or SEQ ID No. 3. Preferably, the expression vector is a pPIC series expression vector.
[0013] A recombinant engineered bacterial strain, wherein the recombinant engineered bacterial strain is *Pichia pastoris* containing the expression vector. Preferably, the genetically engineered recombinant bacterial strain is *Pichia pastoris* GS115.
[0014] A method for constructing a recombinant Pichia pastoris engineered strain involves linking a gene with the sequence shown in SEQ ID No. 1 or SEQ ID No. 3 to an expression vector, linearizing it with SacI, and then electroporating it into Pichia pastoris cells.
[0015] An enzyme preparation comprising the aforementioned serine protease LteKerS or the aforementioned recombinant serine protease rLteKerS, wherein the enzyme preparation is enzyme powder or enzyme solution.
[0016] A method for producing serine protease, wherein the recombinant Pichia pastoris engineered strain is inoculated into a culture medium for culture, and the serine protease is collected after methanol-induced secretion expression.
[0017] A method for producing serine protease, wherein the method involves collecting the supernatant from cell culture medium induced to express serine protease in BMMY medium to obtain a crude enzyme solution of serine protease, which is then concentrated and purified by nickel column chromatography to obtain a purified recombinant serine protease rLteKerS enzyme solution.
[0018] A method for preparing a recombinant protein of a serine protease that efficiently degrades β-keratin includes the following steps:
[0019] (1) Based on the mass spectrometry identification results of the secretory keratinase of Lecanicillium testudineum GZAC1Y2-12 induced by β-keratin, combined with genome sequencing analysis, the amino acid sequence and coding gene sequence of the keratinase were confirmed. It belongs to the serine protease family and is named LteKerS. The amino acid sequence is shown in SEQ ID No. 2 and the coding gene sequence is shown in SEQ ID No. 1.
[0020] (2) A Pichia pastoris eukaryotic expression vector containing a recombinant serine protease with the N-terminal signal peptide removed and a purification tag at the C-terminus was constructed to express the recombinant serine protease rLteKerS. The recombinant serine protease rLteKerS protein, which can efficiently degrade β-keratin, was isolated and purified. The amino acid sequence of the recombinant serine protease rLteKerS is shown in SEQ ID No. 4, and the coding gene sequence of the recombinant serine protease rLteKerS is shown in SEQ ID No. 3.
[0021] This invention also provides the application of the aforementioned serine protease LteKerS or recombinant serine protease rLteKerS or the aforementioned enzyme preparation in the degradation of β-keratin. The application includes the degradation of β-keratin in feathers. The aforementioned serine protease LteKerS or recombinant serine protease rLteKerS efficiently degrades β-keratin under the following conditions: glycine-sodium hydroxide buffer (pH 9.0), a reducing agent DTT concentration of 35 mM, a temperature of 45°C, and a rotation speed of 200 rpm.
[0022] The beneficial effects of this invention are as follows: The serine protease provided by this invention can efficiently degrade β-keratin under alkaline conditions, directly acting on intact feathers, including the recalcitrant rachis structure, achieving a feather degradation rate of 88.67% within 15 hours. The reaction conditions are mild, requiring no high temperature, high pressure, or complex pretreatment. The products are soluble proteins and peptides, which can be used as high-value-added amino acid raw materials, functional peptide raw materials, biodegradable materials, precursors for bio-based materials, biological feed proteins, fertilizers, etc., possessing high resource utilization value and suitable for large-scale processing of by-products such as poultry feathers, showing promising industrial application prospects. Attached Figure Description
[0023] Figure 1 It is a positive clone selected by colony PCR screening of Pichia pastoris strain expressing recombinant serine protease rLteKerS.
[0024] Figure 2This is the enzymatic activity of the screened positive clone Pichia pastoris strain expressing recombinant serine protease rLteKerS in degrading β-keratin.
[0025] Figure 3 This describes the activity of crude enzyme solution expressed by the Pichia pastoris engineered strain with high expression of recombinant serine protease rLteKerS in degrading β-keratin in the presence or absence of DTT.
[0026] Figure 4 The images show scanning electron microscopy analysis of the morphology of feathers (chicken feathers) after degradation by recombinant serine protease rLteKerS; A: Feathers without degradation treatment; B: Feathers after degradation by recombinant serine protease rLteKerS.
[0027] Figure 5 The reaction conditions for the degradation of β-keratin by the recombinant serine protease rLteKerS were optimized; A: pH of the degradation reaction system; B: DTT concentration; C: degradation temperature; D: oscillation speed; E: degradation time. Detailed Implementation
[0028] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. The following embodiments are implemented based on the technical solution of the present invention, and provide detailed implementation methods and specific operation processes. However, the scope of protection of the present invention is not limited to the following embodiments, and the embodiments do not limit the present invention in any way.
[0029] The reagents, methods, and equipment used in the following embodiments are conventional reagents, methods, and equipment in this technical field.
[0030] SEQ ID No. 1: Full-length nucleotide sequence of LteKerS, a serine protease derived from Lecanicillium testudineum GZAC1Y2-12.
[0031] SEQ ID No. 2: Full-length amino acid sequence of LteKerS, a serine protease derived from Lecanicillium testudineum GZAC1Y2-12.
[0032] SEQ ID No. 3: Nucleotide sequence of rLteKerS, a recombinant serine protease protein derived from Lecanicillium testudineum GZAC1Y2-12 with the N-terminal signal peptide removed and a purified tag attached to the C-terminus.
[0033] SEQ ID No. 4: Amino acid sequence of rLteKerS, a recombinant serine protease protein derived from Lecanicillium testudineum GZAC1Y2-12 with the N-terminal signal peptide removed and a purified tag attached to the C-terminus.
[0034] The strain GZAC1Y2-12, classified as *Lecanicillium testudineum*, is deposited at the China General Microbiological Culture Collection Center (CGMCC) on January 13, 2020, with accession number CGMCC No. 19366. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.
[0035] Example 1: Confirmation and Acquisition of the β-keratinase Gene
[0036] PDA solid medium: Boil 200 g of potatoes (peeled and diced) in water for 20-30 minutes, filter the liquid through gauze, add 20 g of glucose and 15-20 g of agar, heat until completely dissolved, add water to 1 L, and sterilize at 121°C for 20 minutes.
[0037] β-keratin degradation basal medium: NaCl 0.12 g, KH2PO3 0.05 g, ZnSO4 0.005 g and CaCl2 0.02 g, add double-distilled water to make up to 100 mL, adjust pH to 7.0, sterilize, and then add 1 g of β-keratin (chicken feathers).
[0038] Lecanicillium testudineum GZAC1Y2-12 (China General Microbiological Culture Collection Center, accession number: CGMCC No. 19366) was inoculated onto PDA solid medium and activated by static culture at 25°C for 7 days. Then, mycelia were picked and inoculated into β-keratin degradation basal medium for liquid culture to induce β-keratinase expression. The culture was carried out at 25°C and 120 rpm with shaking for 7 days. The fermentation broth was centrifuged at 4°C and 12000 rpm for 30 min, filtered through a 0.22 μm microporous membrane, and dialyzed. Then, it was concentrated by centrifugation at 4°C and 4000 rpm using an ultrafiltration tube with a molecular weight cutoff of 3 kDa (Millipore, catalog number: UFC9003) to obtain a concentrated cell-free crude enzyme supernatant. Cell-free supernatant crude enzyme solution was separated on an SDS-PAGE gel. After staining and destaining, the highly expressed protein band on the SDS-PAGE gel was cleaved. Its molecular weight was approximately 40 kDa, and it was sent to Sangon Biotech (Shanghai) Co., Ltd. for mass spectrometry identification. Based on the peptide fragment identified by mass spectrometry, combined with the genome sequencing data of *Lecanicillium testudineum* GZAC1Y2-12 and comparative analysis with the theoretical molecular weight of the protein, it was confirmed that the highly expressed protein is the expression product of the *Peptidases_S8_PCSK9_ProteinaseK_like* gene located in contig5l of the genome, belonging to the serine protease family. Its full-length amino acid sequence is SEQ ID No. 2, and the coding gene sequence is SEQ ID No. 1, named LteKerS.
[0039] The amino acid sequence of the serine protease LteKerS was predicted using SignalP 5.0 (https: / / services.healthtech.dtu.dk / services / SignalP-5.0 / ), and the first 21 amino acids were identified as the signal peptide. A recombinant protein rLteKerS (amino acid sequence SEQ ID No. 4) with the signal peptide truncated and a his6 tag purification label at the C-terminus was constructed. First, total RNA was extracted from *Lecanicillium testudineum* GZAC1Y2-12 using a fungal total RNA extraction kit (Sangon Biotech (Shanghai) Co., Ltd., catalog number: B518629). Then, reverse transcription was performed using a reverse transcription kit (QIAGEN, catalog number: 205113) with Oligo-dT Primer and Random Primer as primers, respectively. The two cDNA products were mixed and used as a template. PCR amplification was then performed using primers rLteKerS_F and rLteKerS_R to obtain the rLteKerS gene sequence (corresponding nucleotide sequence is SEQ ID No. 3), which was then ligated into *Pichia pastoris* GS115. The recombinant plasmid pPIC9K-rLteKerS was obtained by intersecting the EcoRI and NotI restriction sites of the secretory expression vector pPIC9K (Invitrogen, V17520) using GS115 (Invitrogen, catalog number: C18100). After verification by colony PCR and sequencing, it was used for secretory expression. The recombinant plasmid pPIC9K-rLteKerS was linearized using SacI restriction endonuclease (New England Biolabs, catalog number: R0156S). The linearized product was purified by 1% agarose gel electrophoresis and then recovered using a gel extraction kit (Nanjing Novozymes Biotechnology Co., Ltd., catalog number: DC301).
[0040] Primer name Primer sequence (5'-3') rLteKerS_F <![CDATA[A GAATTC GCCGTTGAGGTTATCGAGGAGG]]> rLteKerS_R <![CDATA[ATTAATTC GCGGCCGC TTAGTGGTGGTGGTGGTGGTGACCCTGGTAGTTGTTGTAG]]>
[0041] Note: Underlined areas are enzyme cleavage sites.
[0042] Example 2 Heterologous expression of β-keratinase
[0043] YPD medium: yeast extract 10.0 g / L, peptone 20.0 g / L, glucose 20.0 g / L, adjust pH to 6.0-6.5, sterilize at 115℃ for 15 min.
[0044] MD medium: Sterilize 15.0 g / L agar at 121℃ for 15 min, cool to medium temperature, add filtered sterilized YNB 6.7 g / L and glucose 20.0 g / L solution adjusted to pH 5.6, mix well and pour into plates.
[0045] BMGY medium: 20.0 g / L peptone, 10.0 g / L yeast extract, 3.9 g / L K2HPO4, 11.8 g / L KH2PO4, 10 mL glycerol, adjust pH to 6.0 and bring volume to 898 mL. Sterilize at 121℃ for 15 min and cool. Add 100 mL of filtered and sterilized 13.4% YNB solution and 2 mL of 500× biotin solution.
[0046] BMMY medium: 20.0 g / L peptone, 10.0 g / L yeast extract, sterilized at 121℃ for 15 min, cooled and then added 13.4 g / L filtered sterile YNB, 0.4 mg / L biotin, 100 mL / L 1 M potassium phosphate buffer (pH 6.0), and 5 mL / L filtered sterile methanol solution.
[0047] Preparation of Pichia pastoris GS115 electrocompetent cells: Single colonies of Pichia pastoris GS115 were picked and inoculated into 3 mL of YPD medium and cultured at 30℃ with shaking at 250 rpm until OD. 600 The concentration was 2.0, and the culture was transferred to 100 mL of YPD medium at a ratio of 1:100 and continued to culture until OD200. 600 When the pH reaches 1.2~1.5, the cells are collected by centrifugation at 4℃ and 6000 rpm for 5 min. The cells are resuspended and washed three times with 50 mL of pre-cooled sterile water, then washed once with 20 mL of pre-cooled sterile 1 M sorbitol solution, and finally resuspended with 1 mL of pre-cooled sterile 1 M sorbitol solution. The cells are then aliquoted into 80 μL / tube of Pichia pastoris GS115 electrotransfer competent cells.
[0048] Two μg of the linearized plasmid pPIC9K-rLteKerS, purified by gel extraction, was electroporated into Pichia pastoris GS115 competent cells. The electroporation parameters were: voltage 1.5 kV, capacitance 25 μF, resistance 200 Ω, and electroporation time 5 ms. Immediately after electroporation, 1 mL of pre-chilled sterile 1 M sorbitol solution was added, and the cells were incubated for 1 h. 200 μL of the incubated plasmid was then plated on MD agar plates for screening. Colony PCR was performed to identify the transformed single clones using universal primers α-factor (5'-TACTATTGCCAGCATTGCTGC-3') and 3'AOX1 (5'-GCAAATGGCATTCTGACATCC-3'). Figure 1 After sequencing verification, the correctly sequenced positive clones (clones 1, 3, 5, 9, 10, 15, 18, 20, 21, 22, 23, and 24) were subjected to small-scale shake-flask expression and inoculated into 100 mL of BMGY medium and cultured until OD500. 600 When the enzyme activity reaches approximately 2.0, the cells are collected by centrifugation at 6000 rpm for 15 min at 4°C. The cells are then resuspended in BMMY medium and induced for 5 days with methanol at a final concentration of 0.5% (v / v) (replenished every 24 h). After induction, the supernatant is collected by centrifugation, and its crude enzyme activity is measured. The high-yielding strain with the highest enzyme activity is then screened. Figure 2 ).
[0049] Example 3: Enzyme activity assay of crude β-keratin-degrading enzyme solution
[0050] Take 100 μL of 2% casein and add 100 μL of crude keratinase enzyme solution. React in a constant temperature water bath at 30℃ for 10 min, then immediately add 200 μL of 0.4 mol / L trichloroacetic acid solution to terminate the reaction. The control experimental system is the same as the experimental group, but the trichloroacetic acid solution is added before the reaction. Centrifuge the reaction system at 12000 rpm for 2 min, take 20 μL of the supernatant and add it to 100 μL of 0.5 mol / L Na2CO3. Finally, add 20 μL of Folin-Ciocalteu reagent (Shanghai Beyotime Biotechnology Co., Ltd., catalog number: ST2070), mix thoroughly, and react at 50℃ for 10 min. Measure the absorbance at a wavelength of 660 nm. Each experiment was repeated in triplicate.
[0051] One unit of enzyme activity (1 U) is defined as: under the experimental reaction conditions, hydrolyzing casein for 10 min, resulting in A... 660 The amount of enzyme required to increase by 0.001.
[0052] The crude enzyme solution of Pichia pastoris strain 22, which expressed recombinant serine protease rLteKerS, showed the highest enzyme activity. Figure 2 Furthermore, with the assistance of the reducing agent DTT, it can efficiently and rapidly degrade the natural substrate of β-keratin—feathers; and it also exhibits certain degradation activity on feathers in the absence of DTT. Figure 3 ).
[0053] Example 4 Purification of β-keratinase
[0054] The Pichia pastoris strain with high recombinant protein expression yield obtained in Example 2 was cultured on a large scale and induced to express with methanol. The fermentation supernatant was initially concentrated using a hollow fiber membrane, and then enriched with protein by ammonium sulfate fractionation (70% saturation). The precipitated protein was resuspended in Tris-HCl, pH 8.0 buffer and dialyzed. Then, affinity chromatography was performed using a nickel column (Ni-NTA resin, GE, catalog number: 17-5318-02), with gradient elution using Tris-HCl, pH 8.0 buffer containing 5 mM, 150 mM, and 500 mM imidazole. The eluent containing the target protein was the purified recombinant serine protease rLteKerS.
[0055] Example 5: Assay of the activity of recombinantly expressed β-keratin-degrading enzyme
[0056] To confirm the biological activity of the recombinant expressed serine protease, its degradation function was verified using chicken feathers, a natural substrate of β-keratin. Since keratin is rich in disulfide bonds and structurally stable, the reducing agent may be crucial for degradation efficiency. Two parallel reactions were set up for the β-keratin degradation experiment: a reducing environment containing 25 mM dithiothreitol (DTT, Sangon Biotech (Shanghai) Co., Ltd., catalog number: A620058) and a control system without DTT. The degradation reaction system (1 mL) of the purified recombinant serine protease rLteKerS obtained in Example 4 included: 5 mg chicken feathers, an appropriate amount of 0.05 M PBS pH 8.0 buffer, 25 μL 1 M DTT, and 100 μg of purified recombinant serine protease rLteKerS. The reaction system was placed in a shaker at 30℃ and 150 rpm for 15 h. After the reaction, the reaction was terminated by centrifugation at 12000 rpm for 5 min, and insoluble matter was removed. The soluble protein content in the supernatant was determined using the Bradford Protein Quantitative Kit (Shanghai Beyotime Biotechnology Co., Ltd., catalog number: PP103-03).
[0057] One unit of enzyme activity (1 U) is defined as the amount of enzyme required to increase the soluble protein by 1 μg by hydrolyzing β-keratin substrate (feather) for 15 h under the experimental reaction conditions.
[0058] In the formula, 100 μg and 0.1 mg are the amounts of purified recombinant serine protease rLteKerS added.
[0059] Example 6: Determination of β-keratin degradation rate
[0060] The β-keratin degradation solution was filtered through filter paper to recover undegraded β-keratin (feathers). The feathers were washed with distilled water to remove as many cells as possible. The feather residue was dried at 55°C to constant weight to calculate the degradation rate.
[0061]
[0062] Example 7 Characterization of feather degradation by recombinant β-keratinase
[0063] The β-keratin (chicken feather) residue obtained from the recombinant serine protease rLteKerS in Example 4, after being degraded for 15 h, was rinsed multiple times with distilled water and dried at 60°C for 48 h. The chicken feather residue sample was then adhered to the sample stage using conductive adhesive, sputtered with gold for approximately 30 s, and tested using a field emission scanning electron microscope (Hitachi SU8600). The accelerating voltage was 3 kV, the working distance was 7.4-9.6 mm, the magnification range was 1 μm-100 μm, and the testing mode was secondary electron mode. Scanning electron microscopy results showed that the untreated chicken feather surface structure was intact and smooth, the barbs and barbules were intact and regularly arranged, and the keratin structure was dense. Figure 4 A); however, the feather structure was completely destroyed after degradation by recombinant serine protease rLteKerS, with keratin fibers exposed and becoming loose and broken, and the barbs, barbules, and rachis all experiencing structural collapse and fragmentation. Figure 4 B). Scanning electron microscopy results show that the recombinant serine protease rLteKerS can efficiently disrupt the dense structure of β-keratin in chicken feathers, achieving complete and deep degradation of the feather shaft and vanes.
[0064] Example 8 Optimization of degradation reaction conditions for recombinant β-keratinase
[0065] Using natural β-keratin (chicken feathers) as a substrate, the activity of recombinant serine protease rLteKerS was evaluated by measuring the total content of soluble protein in the supernatant after the reaction, as in Example 5. Based on the standard reaction system (1 mL containing 5 mg chicken feathers, 100 μg purified recombinant serine protease rLteKerS, 25 μL 1 M DTT, PBS buffer, pH 8.0), the following parameters were optimized: pH (4-12, with citrate buffer for pH 4-6, PBS buffer for pH 6-8, Glycine-NaOH buffer for pH 8-10, Na2CO3-NaOH buffer for pH 10-11, and Na2HPO4-NaOH buffer for pH 11-12), DTT concentration (final concentrations of 15, 25, 35, 45, and 55 mM), degradation temperature (25-50℃), oscillation speed (0, 50, 100, 150, 200, 250, and 300 rpm), and degradation time (5, 10, 15, 20, and 25 h). Except for the parameters to be optimized, all other conditions were set according to the initial reaction settings (temperature 30℃, 0.05M PBS buffer, pH 8.0, final DTT concentration 25 mM, 150 rpm, reaction time 15 h); and the ability of recombinant serine protease to degrade chicken feathers was verified under the optimal conditions, with the initial reaction serving as a control. All experiments were performed in triplicate.
[0066] Experimental results ( Figure 5The results showed that the optimal pH for recombinant serine protease rLteKerS to degrade β-keratin (chicken feathers) was 9.0, with an enzyme activity of 7391.46±15.82 U / mg. Furthermore, the enzyme activity of recombinant serine protease rLteKerS was relatively high within the pH range of 6.0-10.0. The optimal final concentration of the reducing agent DTT was 35 mM; below 25 mM, the enzyme activity rapidly decreased, indicating that the activity of recombinant serine protease rLteKerS depended on the synergistic effect of the reducing agent DTT. DTT played a crucial role in the efficient degradation of β-keratin by recombinant serine protease rLteKerS. The optimal degradation temperature was 45℃, and it maintained high degradation activity within the range of 30-50℃, demonstrating its ability to adapt to high-temperature environments. However, the enzyme activity decreased significantly below 30℃. The optimal shaking speed was 200 rpm, with relatively high enzyme activity at 150-250 rpm. The optimal degradation time was 15 h and 20 h. The relative enzyme activity showed almost no change at h, so 15 h, which offered better cost-effectiveness, was chosen as the final degradation time. The degradation reaction under the optimal conditions (Glycine-NaOH buffer, pH 9.0, 35 mM DTT, 45℃, 200 rpm, degradation time 15 h) was compared with that under the initial reaction conditions. The degradation rate of chicken feathers in the optimal condition group reached 88.67%, which was significantly higher than the initial control group (degradation rate 49.33%) by 39.34%.
[0067] It should be noted that although the above embodiments have been described herein, this does not limit the scope of protection of the present invention. Therefore, any changes and modifications made to the embodiments of the present invention based on the innovative concept of the present invention, or equivalent structural or procedural transformations made using the content of the present invention's specification and drawings, directly or indirectly applying the above technical solutions to other related technical fields, are all included within the scope of protection of the present invention.
Claims
1. A highly efficient serine protease LteKerS for degrading β-keratin, characterized in that, The amino acid sequence of the serine protease LteKerS is shown in SEQ ID No.
2.
2. The highly efficient serine protease LteKerS for degrading β-keratin according to claim 1, characterized in that, The serine protease LteKerS is derived from Lecanicillium testudineum GZAC1Y2-12.
3. A recombinant serine protease rLteKerS, characterized in that, The amino acid sequence of the recombinant serine protease rLteKerS is shown in SEQ ID No.
4.
4. A gene encoding the serine protease LteKerS as described in claim 1, characterized in that, Its nucleotide sequence is shown in SEQ ID No.
1.
5. A gene encoding the recombinant serine protease rLteKerS as described in claim 3, characterized in that, Its nucleotide sequence is shown in SEQ ID No.
3.
6. A mutant protease, characterized in that, The mutant protease is any one of the following: (a) A protein obtained by substituting, deleting or adding one or more amino acid residues of the amino acid sequence of the serine protease LteKerS of claim 1, having at least 90% sequence identity with the sequence shown in SEQ ID No. 2, and having the activity of the serine protease LteKerS. (b) A protein obtained by substituting, deleting or adding one or more amino acid residues of the amino acid sequence of the recombinant serine protease rLteKerS as described in claim 3, having at least 90% sequence identity with the sequence shown in SEQ ID No. 4, and having serine protease rLteKerS activity.
7. A recombinant engineered bacterium, characterized in that, The recombinant engineered bacteria is Pichia pastoris containing an expression vector, the expression vector containing a nucleotide sequence as shown in SEQ ID No. 1 or SEQ ID No.
3.
8. An enzyme preparation, characterized in that, It contains the serine protease LteKerS as described in claim 1 or the recombinant serine protease rLteKerS as described in claim 3.
9. The use of the serine protease LteKerS as described in claim 1, the recombinant serine protease rLteKerS as described in claim 3, or the enzyme preparation as described in claim 8 in the degradation of β-keratin.
10. A method for preparing a recombinant protein of serine protease that efficiently degrades β-keratin, characterized in that, Includes the following steps: (1) Based on the mass spectrometry identification results of the secretory keratinase of Lecanicillium testudineum GZAC1Y2-12 induced by keratin, combined with genome sequencing analysis, the amino acid sequence and coding gene sequence of the keratinase were confirmed. It belongs to the serine protease family and is named LteKerS. The amino acid sequence is shown in SEQ ID No. 2 and the coding gene sequence is shown in SEQ ID No.
1. (2) A Pichia pastoris eukaryotic expression vector containing a recombinant serine protease with the N-terminal signal peptide removed and a purification tag at the C-terminus was constructed to express the recombinant serine protease rLteKerS. The recombinant serine protease rLteKerS protein, which can efficiently degrade β-keratin, was isolated and purified. The amino acid sequence of the recombinant serine protease rLteKerS is shown in SEQ ID No. 4, and the coding gene sequence of the recombinant serine protease rLteKerS is shown in SEQ ID No. 3.