Arginase mutant and genetically engineered bacteria thereof

By performing site-directed mutagenesis on arginase and constructing genetically engineered bacteria, the problem of low arginase activity was solved, enabling efficient production and environmentally friendly manufacturing of L-ornithine.

CN122146675APending Publication Date: 2026-06-05TIANJIN TIANYAO PHARM CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
TIANJIN TIANYAO PHARM CO LTD
Filing Date
2024-12-03
Publication Date
2026-06-05

Smart Images

  • Figure HDA0005166004220000011
    Figure HDA0005166004220000011
  • Figure HDA0005166004220000012
    Figure HDA0005166004220000012
Patent Text Reader

Abstract

The application belongs to the technical field of biology, and discloses an arginase mutant and application of a genetically engineered bacterium of the arginase mutant. The arginase mutant is obtained by mutating the 133th and 170th amino acids in the amino acid sequence of human arginase I. Compared with human arginase I, the arginase mutant has significantly improved enzyme activity and good stability, and can efficiently catalyze L-arginine to generate L-ornithine. The genetically engineered bacterium of the arginase mutant has low cost and high conversion rate, and lays a foundation for industrial production of L-ornithine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of an arginase mutant and its genetically engineered bacteria. Background Technology

[0002] L-Ornithine, also known as L-2,5-diaminovalerate, is a basic amino acid containing two amino groups and one carboxyl group. Its chemical name is α,δ-diaminovalerate, and its molecular formula is C5H2O. 12 N₂O₂. L-Ornithine is readily soluble in water and ethanol, and slightly soluble in ether. Pure L-ornithine is a white solid, but it is difficult to crystallize; therefore, its main product form is L-ornithine hydrochloride. L-ornithine monosalt is readily soluble in water, but insoluble in methanol, ethanol, and ether.

[0003] L-Ornithine is a non-protein amino acid that participates in the catabolism of proteins, carbohydrates, and fats. As an intermediate metabolite in the urea cycle, it is also a precursor in the synthesis of important metabolites such as arginine, citrulline, and amines. Studies have shown that L-Ornithine has significant therapeutic effects in protecting the liver and promoting patient recovery. Furthermore, as a functional amino acid, L-Ornithine can improve nutrition and has health benefits.

[0004] According to literature reports, the main methods for preparing L-ornithine include chemical methods, fermentation methods, and enzymatic conversion methods.

[0005] Chemical methods for producing L-ornithine are gradually being phased out due to their numerous reaction steps, abundant byproducts, the presence of racemic D-ornithine in the reaction products, and severe environmental pollution. Fermentation is a common industrial method for directly producing L-ornithine, but the wastewater generated during fermentation also pollutes the environment, and it suffers from drawbacks such as a long fermentation cycle, complex product composition, and low yield. Enzymatic conversion, where arginine is converted to L-ornithine by arginase, offers advantages such as high catalytic efficiency, fewer byproducts, high specificity, mild reaction conditions, short reaction cycle, and easy product separation. Therefore, enzymatic conversion for L-ornithine production has attracted widespread attention.

[0006] In enzymatic reactions, arginase has low activity, so a more active arginase is needed to improve substrate conversion, thereby reducing the production cost of L-ornithine and improving economic efficiency.

[0007] To address the shortcomings of existing technologies, this invention aims to provide an arginase mutant to enhance the catalytic activity of arginase and apply it to the efficient production of L-ornithine.

[0008] In view of this, the present invention is hereby proposed. Summary of the Invention

[0009] The main objective of this invention is to provide an arginase mutant and to use its genetically engineered strain for the industrial production of L-ornithine, in order to at least partially solve one of the aforementioned technical problems.

[0010] In a first aspect, the present invention provides an arginase mutant, which is obtained by mutating positions 133 and 170 of the amino acid sequence shown in SEQ ID NO. 1.

[0011] Furthermore, the arginase mutant is obtained by replacing leucine at position 133 with glutamine and serine at position 170 with threonine in the amino acid sequence shown in SEQ ID NO.1, and its amino acid sequence is shown in SEQ ID NO.2.

[0012] Secondly, the present invention provides a coding gene that encodes the above-mentioned arginase mutant, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0013] Thirdly, the present invention provides a recombinant vector containing the above-mentioned coding gene.

[0014] Furthermore, the vector can be any vector suitable for expressing the above-mentioned coding gene, with pET29a being the preferred vector.

[0015] Fourthly, the present invention provides a genetically engineered bacterium, wherein the genetically engineered bacterium comprises the above-mentioned recombinant vector.

[0016] Furthermore, the host bacteria of the genetically engineered bacteria can be one of Escherichia coli, yeast, or Bacillus subtilis, preferably Escherichia coli BL21(DE3).

[0017] Fifthly, the present invention provides the application of the genetically engineered bacteria. After the genetically engineered bacteria are induced to express arginase, the bacterial cells are collected by centrifugation. The enzyme solution obtained by freezing and thawing or homogenizing the bacterial cells can efficiently catalyze the production of L-ornithine from L-arginine.

[0018] Compared with the prior art, the present invention has the following beneficial effects: the arginase mutant provided in the present invention has high enzyme activity, good stability and high conversion rate. The application of this genetically engineered bacterium is conducive to realizing the green biomanufacturing of L-ornithine, reducing production costs and improving economic benefits. Attached Figure Description

[0019] Figure 1 The effect of pH on enzyme activity stability

[0020] Figure 2 The effect of temperature on enzyme activity stability Detailed Implementation

[0021] The embodiments of the present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Experimental methods not specifically described in the examples are generally performed according to conventional experimental methods in the field of molecular biology, including but not limited to the experimental methods described in *Molecular Cloning: A Laboratory Manual* by M.R. Green and *Molecular Biology* by Robert F. Weaver, or according to the experimental methods recommended by reagent kit and instrument manufacturers. Unless otherwise specified, the reagents and biological materials used in the examples are commercially available.

[0022] 1. The culture media and their formulations involved in the examples are as follows:

[0023] LB liquid medium: 10 g / L tryptone, 10 g / L sodium chloride, 5 g / L yeast extract, purified water, pH 7.0.

[0024] LB solid medium: 10 g / L tryptone, 10 g / L sodium chloride, 5 g yeast extract, 20 g / L agar powder, purified water, pH 7.0.

[0025] Fermentation medium: potassium dihydrogen phosphate 7 g / L, disodium hydrogen phosphate 6.8 g / L, glycerol 20 g / L, peptone 15 g / L, magnesium sulfate 1.5 g / L.

[0026] 2. The information on the strains and plasmids involved in the examples is as follows:

[0027] The expression vector pET29a was purchased from Sangon Biotech Co., Ltd.

[0028] BL21(DE3) competent cells were purchased from Thermo Scientific.

[0029] 3. Enzyme activity detection methods

[0030] L-arginine substrate: Dissolve 20g of arginine in 100ml of purified water, adjust the pH to 8.0 with concentrated HCl, and then add manganese chloride to a final concentration of 2mM.

[0031] Crude enzyme solution: Take 1g of bacterial cells that have been frozen at -20℃ for more than 24 hours, add purified water to make up to 100ml, and stir well.

[0032] Enzymatic reaction: Take 0.2 ml of arginine solution, add 0.1 ml of crude enzyme solution and 0.7 ml of purified water, react at 35℃ for 10 min, and after the reaction is completed, add 1 ml of 3.5% hydrochloric acid to terminate the reaction. Dilute the reaction solution 20 times and pass it through a membrane for HPLC detection of enzyme activity.

[0033] The definition of an arginase activity unit (U): The amount of enzyme required to hydrolyze 1 micromole of L-arginine per minute is defined as one activity unit (U).

[0034] 4. HPLC detection conditions for L-arginine content

[0035] HPLC conditions: C18 chromatography (4.6*250mm, 5μm), detection wavelength 205nm, flow rate 1mL / min, injection 10μL, column temperature 25℃, mobile phase was buffer:acetonitrile = 94:6.

[0036] Buffer solution: Weigh 14.5g potassium dihydrogen phosphate and 1.10g sodium heptanesulfonate into a 1000ml volumetric flask, add purified water to a final volume of 1L, dissolve, and shake well.

[0037] Example 1: Construction of Human Arginase I Genetically Engineered Bacteria

[0038] We obtained the amino acid sequence of human arginase I from the NCBI protein database as shown in SEQ ID NO.1. We optimized the codons of this sequence using Escherichia coli as the host bacterium and sent it to Genewiz Biotechnology Co., Ltd. for the total synthesis of the target gene.

[0039] PCR was performed using F1 and R1 primers (see Table 1) to amplify the fully synthesized target gene. The target gene and plasmid pET29a were then digested with NdeI and HindIII, purified, and ligated overnight at 16°C using T4 DNA ligase. The recombinant plasmid was then transformed into chemically competent cells of *E. coli* BL21(DE3) to obtain a genetically engineered bacterium containing human arginase I, named EArg-1.

[0040] Table 1 PCR primers

[0041] name Primer information F1 AAAATTCCATATGTCGGCCAAAAGCCGT R1 AAAAAAGCTTATTTCGGCGGATTCAGAT

[0042] Example 2: Construction and High-Throughput Screening of Arginase Mutant Genetically Engineered Bacteria

[0043] Following the instructions of the random mutation kit, human arginase I was randomly mutated using error-prone PCR to obtain an arginase mutant library. The mutant gene was constructed into an expression plasmid according to the method in Example 1, and then transformed into chemically competent cells of *E. coli* BL21(DE3) to obtain the genetically engineered bacterium with the arginase mutant.

[0044] The genetically engineered bacteria containing the arginase mutant were inoculated into a 96-well plate containing LB medium. After induction of expression, the supernatant was removed by centrifugation, and the mixture was shaken with Bug Buster for 1 minute to obtain the crude enzyme solution of the arginase mutant.

[0045] By using an enzyme-linked immunosorbent assay (ELISA) reader combined with color changes, a high-throughput screening method was developed to screen arginase mutants. Ultimately, two arginase mutants with significantly increased enzyme activity were screened out as M2 and M3, and their corresponding strains were named EArg-2 and EArg-3, respectively.

[0046] Example 3: Sequence Analysis and Site-Directed Mutation of Arginase Mutants

[0047] Arginase mutants M2 and M3 were sent to Genewiz Biotechnology Co., Ltd. for sequencing and sequence analysis. It was found that leucine at position 133 of M2 was replaced with glutamine, isoleucine at position 189 of M3 was replaced with leucine, and serine at position 170 was replaced with threonine.

[0048] To determine the key amino acid sites and obtain mutants with higher enzyme activity, site-directed mutagenesis was performed at positions 189 and 170 of M2 using overlap extension PCR. Then, an arginase mutant genetically engineered bacterium was constructed according to the method in Example 1, as detailed below:

[0049] (1) Replace isoleucine at position 189 with leucine to obtain M4, whose corresponding strain is EArg-4.

[0050] (2) Replace the serine at position 170 with threonine to obtain M5, whose corresponding strain is EArg-5.

[0051] (3) Replace isoleucine at position 189 with leucine and serine at position 170 with threonine to obtain M6, whose corresponding strain is EArg-6.

[0052] Example 4: Enzyme Activity Test of Arginase Mutant

[0053] Strains containing human arginase I, EArg-1, and arginase mutants EArg-2, EArg-3, EArg-4, EArg-5, and EArg-6 were inoculated into LB liquid medium containing 50 mg / L kanamycin and cultured on a shaker at 37°C and 200 rpm for 4-6 hours. When OD... 600 When the concentration reaches 1.2-1.5, add IPTG (isopropyl-β-D-thiogalactopyranoside) to a final concentration of 0.2 mM, induce at 28°C for 16 h, centrifuge at 5000 rpm for 10 minutes in a benchtop refrigerated centrifuge, collect the cells, and store at -20°C.

[0054] The enzyme activities of human arginase I and arginase mutants were detected according to the enzyme activity detection method, and the results are shown in Table 2.

[0055] Table 2. Enzyme activity detection results

[0056] Arginase name mutation site Enzyme activity (U / g) Human arginase I none 2300 mutant M2 L133Q 4580 mutant M3 I189L, S170T 5200 mutant M4 L133Q, I189L 5160 mutant M5 L133Q, S170T 9570 mutant M6 L133Q, I189L, S170T 9450

[0057] According to Table 2, positions 133 and 170 are key amino acid sites, while the change at position 189 is an invalid mutation. The arginase mutant with the highest enzyme activity is M5, and its corresponding strain is EArg-5.

[0058] Example 5: Stability evaluation of arginase mutants

[0059] Effect of pH on arginase stability: Crude enzyme solutions of human arginase I and arginase mutant M5 were placed in buffer solutions with pH ranges of 6.0-11.0 and stored overnight at 4°C. Residual enzyme activity was measured, with the initial enzyme activity taken as 100%. Results are shown in [Figure number missing]. Figure 1 .

[0060] Depend on Figure 1 It can be seen that the enzyme activity loss is relatively low under pH conditions of 8.0-9.0, and the residual enzyme activity can be above 90%. Compared with human arginase I, mutant M5 is more stable under different pH conditions.

[0061] Effect of temperature on arginase stability: Crude enzyme solutions of human arginase I and arginase mutant M5 were incubated at 30-80℃ for 2 hours, and the residual enzyme activity was measured with the initial enzyme activity as 100%. The results are shown in the figure. Figure 2 .

[0062] Depend on Figure 2 It can be seen that the enzyme activity is basically not lost under the temperature conditions of 30-40℃. When the temperature is 50-60℃, mutant M5 is more stable than human arginase I.

[0063] Example 6: Fermentation preparation of arginase and arginase mutant

[0064] The genetically engineered strain EArg-1 of human arginase I and the genetically engineered strain EArg-5 of arginase mutant M5 were inoculated into LB medium containing 50 μg / mL kanamycin and cultured in a shaker at 37°C and 200 rpm for 3–4 hours to obtain seed culture.

[0065] The fresh seed culture was inoculated at a rate of 2% into 5L fermenters (3L total volume), with one bottle of seed culture per fermenter. The fermenter temperature was controlled at 37±1℃ and dissolved oxygen at ≥30%. When the cell concentration (OD)... 600When the temperature reaches 20°C, cool it to 28°C and add 0.5 mM IPTG to induce expression. During fermentation, add 25% ammonia water to control the pH at 7.0 ± 0.2. When dissolved oxygen rapidly recovers during fermentation, start adding glycerol, controlling the glycerol concentration in the fermentation broth at 5-10 g / L, and induce culture for 12-16 h.

[0066] After culturing, the bacterial cells were collected by centrifugation. The obtained bacterial cells EArg-1 and EArg-5 were stored frozen at -20°C for later use.

[0067] Example 7: Arginase-catalyzed synthesis of ornithine hydrochloride from L-arginine

[0068] Take bacterial cells EArg-1 and EArg-5 from the refrigerator at -20℃, let them thaw at room temperature, and then feed them into the cell for conversion as follows.

[0069] Weigh 200g of arginine substrate, add purified water, adjust the pH to 8.0 with hydrochloric acid, bring the volume to 1L, add 2g of bacterial cells, and then add manganese chloride to a final concentration of 2mM / L. Maintain the temperature at 35℃ and the conversion at 200r / min for 1h. Detect the L-arginine residue using HPLC and calculate the conversion rate. The results are shown in Table 3.

[0070] Table 3 Arginine Conversion Rate

[0071] Bacterial name / arginase Conversion rate % EArg-1 / Human Arginase I 24.0 EArg-5 / Mutant M5 96.5

[0072] As shown in Table 3, under the same conversion conditions, the conversion rate of arginase mutant M5 to ornithine is higher, which is 4 times higher than that of human arginase I.

[0073] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. An arginase mutant, characterized in that, It was obtained by mutating positions 133 and 170 of the amino acid sequence shown in SEQ ID NO.

1.

2. The arginase mutant according to claim 1, characterized in that, The amino acid sequence shown in SEQ ID NO.1 is modified by replacing leucine at position 133 with glutamine and serine at position 170 with threonine, resulting in the amino acid sequence shown in SEQ ID NO.

2.

3. A gene encoding a gene, characterized in that, The encoding gene encodes the arginase mutant as described in claim 1 or 2, the nucleotide sequence of which is shown in SEQ ID NO.

3.

4. A recombinant vector, characterized in that, A nucleotide sequence containing the encoding gene of claim 3.

5. The recombinant vector according to claim 4, characterized in that, Any vector suitable for expressing the gene sequence of claim 3, preferably pET29a.

6. A genetically engineered bacterium, characterized in that, It contains the recombinant vector as described in claim 4.

7. The genetically engineered bacterium according to claim 6, characterized in that, The host bacteria can be one of Escherichia coli, yeast, or Bacillus subtilis.

8. The genetically engineered bacterium according to claim 7, characterized in that, The host bacterium was selected from Escherichia coli BL21(DE3).

9. The application of the genetically engineered bacteria according to claims 6-7, characterized in that, After the genetically engineered bacteria are induced to express arginase, the bacterial cells are collected by centrifugation. The enzyme solution obtained by freeze-thawing or homogenizing the bacterial cells can efficiently catalyze the production of L-ornithine from L-arginine.