Aeromonas hydrophila nucleic acid aptamer, screening method and application thereof

By screening Aeromonas hydrophila nucleic acid aptamers using SELEX technology and combining them with qPCR, the problems of long detection time and low sensitivity of existing detection methods are solved, enabling rapid and accurate quantitative detection of Aeromonas hydrophila, especially in seawater and tissue samples.

CN122146708APending Publication Date: 2026-06-05CHANGLE JUQUAN FOOD +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
CHANGLE JUQUAN FOOD
Filing Date
2026-04-24
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing methods for detecting Aeromonas hydrophila suffer from problems such as long detection time, low sensitivity, and high false positive or false negative rates, making it difficult to achieve rapid and accurate detection.

Method used

High-affinity and specific nucleic acid aptamers for Aeromonas hydrophila were screened using SELEX technology. Combined with qPCR technology, an aptamer-qPCR detection method for Aeromonas hydrophila was established to achieve quantitative detection of Aeromonas hydrophila.

Benefits of technology

It achieves good linearity in the range of 10–108 CFU/mL, with a sensitivity of 10 CFU/mL, making it suitable for the detection of seawater and tissue samples. It reduces detection costs and time, and improves detection accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146708A_ABST
    Figure CN122146708A_ABST
Patent Text Reader

Abstract

The application discloses a nucleic acid aptamer of Aeromonas hydrophila and a screening method and application thereof. The nucleic acid aptamer is obtained by SELEX technology, and the affinity of the nucleic acid aptamer to the target bacteria Aeromonas hydrophila is significantly higher than that to non-target bacteria (Vibrio anguillarum, Edwardsiella tarda, Pseudomonas mutabilis and Vibrio harveyi) (P<0.05). On this basis, a nucleic acid aptamer-qPCR quantitative detection method for the bacteria is established, and the method has a good linear relationship in the range of 10-10 8 CFU / mL, a linear fitting coefficient R2=0.9904, and a minimum detection limit of 10 CFU / mL, and the nucleic acid aptamer has good detection effect in seawater and tissue samples.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention specifically relates to a nucleic acid aptamer of Aeromonas hydrophila, its screening method and application, belonging to the field of molecular biology technology. Background Technology

[0002] Aeromonas hydrophila (Ah) is a Gram-negative bacterium widely found in water and soil. It is highly resilient and adaptable, capable of surviving and reproducing under diverse environmental conditions. This bacterium infects various aquatic organisms, including fish, amphibians, and crustaceans, causing serious diseases such as hemorrhagic septicemia, ulcer disease, and enteritis, resulting in significant economic losses to the aquaculture industry. Furthermore, this bacterium can also infect humans, acting as a zoonotic pathogen and posing a potential threat to public health. Therefore, accurate and sensitive detection of this bacterium is of great importance for disease control and for ensuring public health safety.

[0003] Currently, the main methods for detecting Aeromonas hydrophila include microbial culture methods, antibody-based immunological methods, and molecular biological methods targeting specific genes. While these methods play an important role in pathogen detection, they still have some limitations in practical applications. For example, microbial culture methods, although classic, are time-consuming and have low sensitivity; immunological methods, while rapid, simple, and usable on-site, have low sensitivity, and the detection limits for Aeromonas hydrophila are typically around 10. 3 Approximately CFU / mL; although molecular biology methods are highly specific and sensitive (detection limits are typically 1-10 CFU / mL); 3 However, this method requires the extraction of Aeromonas hydrophila DNA, has high testing requirements, and is prone to false positives or false negatives. Therefore, to meet practical needs, it is necessary to develop new detection technologies to find more ideal detection methods.

[0004] Nucleic acid aptamers are single-stranded oligonucleotides obtained by screening random oligonucleotide libraries using SELEX technology. Through their specific spatial structures, they can bind with high affinity and specificity to various targets such as small molecules, proteins, cells, and pathogenic microorganisms, thus becoming a novel type of recognition molecule with enormous application potential in the field of detection.

[0005] This invention discloses a method for detecting Aeromonas hydrophila using SELEX technology to screen for high-affinity and specific nucleic acid aptamers of Aeromonas hydrophila, and based on this, establishes an aptamer-qPCR detection technique for Aeromonas hydrophila. This method has a sensitivity of 10 to 10^6 qPCR. 8It exhibits good linearity within the CFU / mL range, with a linear fitting coefficient R² = 0.9904 and a detection limit of 10 CFU / mL. It demonstrates excellent detection performance in seawater and tissue samples, aiming to lay the foundation for the prevention and control of Aeromonas hydrophila diseases and the application development of nucleic acid aptamers. Summary of the Invention

[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows: One objective of this invention is to provide a nucleic acid aptamer for Aeromonas hydrophila, which is an aptamer represented by any one of the nucleotide sequences shown in SEQ ID NO:1 or SEQ ID NO:2: SEQ ID NO:1: TCAGTCGCTTCGCCGTCTCCTTCAGGAGACGGCTCTAAGTAACGTCGCACATATCGCGGCACAAGAGTGAGCACAAGAGGGAGACCCCAGAGGG, SEQ ID NO:2: TCAGTCGCTTCGCCGTCTCCTTCGGCCAGCCGAAGGAGACGTGGTGATTTCACTAAGACGCACAAGAGGGAGACCCCAGAGGG.

[0007] The second objective of this invention is to provide a SELEX screening method for nucleic acid aptamers of Aeromonas hydrophila, comprising the following steps: (1) Design and synthesize an ssDNA library with fixed sequences at both ends and 25 random base sequences in the middle; (2) Prepare a buffer solution containing Aeromonas hydrophila and incubate it with a buffer solution containing an ssDNA library under certain conditions. (3) Isolate the ssDNA that binds to Aeromonas hydrophila, perform asymmetric PCR amplification to obtain an ssDNA library that can be used for the next round of screening, and perform agarose electrophoresis detection and affinity determination. (4) Complete n rounds of screening of the ssDNA library obtained in the previous round according to steps (2) and (3) to obtain the final ssDNA library; (5) Perform high-throughput sequencing on the PCR products of the nth round of screening. The high-frequency sequences obtained are classified and statistically analyzed according to the number of occurrences and the number of rounds of occurrence. Calculate the relative importance index (IRI). Then arrange all high-frequency sequences in descending order of IRI value. (6) Synthesize the top 10 IRI sequences and verify their affinity and specificity. The sequences with high affinity and specificity are selected Aeromonas hydrophila aptamers.

[0008] Further, the ssDNA library described in step (1) is: 5′-TCAGTCGCTTCGCCGTCTCCTTC-intermediate sequence-GCACAAGAGGGAGACCCCAGAGGG-3′, where the intermediate sequence is a 25-base sequence.

[0009] Furthermore, the primer P1 for preparing the ssDNA library is 5′-TCAGTCGCTTCGCCGTCTCCTTC-3′, and the primer P2 is 5′-CCCTCTGGGGTCTCCCTCTTGTGC-3′.

[0010] Furthermore, n≥3 in step (4).

[0011] Furthermore, n=3 as stated in step (4).

[0012] A third objective of this invention is to provide an application of the Aeromonas hydrophila nucleic acid aptamer as described in claim 1 in the quantitative detection of Aeromonas hydrophila.

[0013] Furthermore, a quantitative detection method for Aeromonas hydrophila is characterized by using the Aeromonas hydrophila nucleic acid aptamer as described in claim 1 to add the sample and standard solution as experimental and control groups respectively, washing, resuspending, heating and centrifuging to obtain supernatant, using the supernatant as a template for qPCR, obtaining the Ct value at the corresponding bacterial concentration for calculation, thereby quantitatively detecting the concentration of Aeromonas hydrophila.

[0014] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. The Aeromonas hydrophila nucleic acid aptamer provided by this invention has strong specificity and affinity for Aeromonas hydrophila. Whether measured by ssDNA method or qPCR method, its specificity and affinity for Aeromonas hydrophila are significantly higher than those for Vibrio harveyi (Vh), Vibrio anguillarum (Vam), Edwardsiella tarda (Et), and Pseudomonas plecoglossicida (Pp).

[0015] 2. The Aeromonas hydrophila nucleic acid aptamers provided by this invention have small molecular weights and are easy to synthesize and label; both AH4 and AH9 have significant affinity and specificity for the target bacterium Aeromonas hydrophila (P<0.05), with AH4 having higher affinity and better specificity.

[0016] 3. The tertiary structure of the Aeromonas hydrophila nucleic acid aptamer provided by the present invention is similar to a tetrahedral spatial structure. The stem-loop structure formed by the first 40 nucleotides extends out to form the vertices of the tetrahedron, and the remaining nucleotides form the triangular base of the tetrahedron. The 5′ end is on the side of the tetrahedron and has more free strands, while the 3′ end is at the bottom of the tetrahedron and also has some free strands. Both ends are open-chain structures, which have a certain degree of flexibility and variability, which is beneficial for binding with Aeromonas hydrophila.

[0017] 4. The Aeromonas hydrophila nucleic acid aptamer provided by this invention establishes an aptamer-qPCR method for the quantitative detection of Aeromonas hydrophila. The detection method is in the range of 10-10... 8 The method exhibits good linearity (R² = 0.9904) within the CFU / mL range, indicating that it can be used for the quantitative detection of Aeromonas hydrophila without the need for bacterial DNA extraction, and its limit of detection is as low as 10 CFU / mL. Compared to current immunological methods for detecting Aeromonas hydrophila, it has higher sensitivity; compared to other molecular biological methods for detecting Aeromonas hydrophila, it does not require bacterial DNA extraction and can quantitatively detect Aeromonas hydrophila with a limit of detection as low as 10 CFU / mL, demonstrating good sensitivity and applicability.

[0018] 5. The relative standard deviations (0.71%-4.76% and 0.48%-7.63%, respectively) of the Aeromonas hydrophila nucleic acid aptamers provided by this invention in detecting Aeromonas hydrophila in seawater and tissue samples are both much less than 12%. This indicates that the method is feasible, and Aeromonas hydrophila nucleic acid aptamers #1 and #2 can be used for the detection of Aeromonas hydrophila in water bodies and aquatic products.

[0019] 6. The SELEX screening method for Aeromonas hydrophila nucleic acid aptamers provided by this invention has low synthesis cost and short cycle (minimum 3 rounds), which is superior to other methods for similar targets. Attached Figure Description

[0020] Figure 1 This is an agarose gel electrophoresis image of the asymmetric PCR results of the three rounds of screening products of the Aeromonas hydrophila nucleic acid aptamers of this invention. Figure 2 The affinity changes of the products from three rounds of screening of Aeromonas hydrophila nucleic acid aptamers of this invention after asymmetric PCR. Figure 3 a) The affinity of the Aeromonas hydrophila nucleic acid aptamers AH4 and AH9 of this invention for different bacteria (Vam is Vibrio anguillarum; Et is Edwardsiella tarda; Pp is Pseudomonas proteus; Vh is Vibrio harveyi; Ah is Aeromonas hydrophila) was determined by the ssDNA method. Figure 3b is the determination of the affinity of the Aeromonas hydrophila nucleic acid aptamers AH4 and AH9 of the present invention for different bacteria (Vam is Vibrio anguillarum; Et is Edwardsiella tarda; Pp is Pseudomonas proteus; Vh is Vibrio harveyi; Ah is Aeromonas hydrophila) by qPCR. Figure 4 To determine the affinity constant of the Aeromonas hydrophila nucleic acid aptamer of this invention using qPCR, Figure a shows the curve of Ct value of aptamer binding as a function of aptamer concentration; Figure b shows the linear curve of Ct value versus aptamer concentration; and Figure c shows the fitted curve of affinity constant. Figure 5 a and Figure 5 b represents the secondary and tertiary structures of the Aeromonas hydrophila nucleic acid aptamer AH4 of the present invention, respectively. Figure 6 This is the standard curve for the quantitative detection of Aeromonas hydrophila using the Aeromonas hydrophila nucleic acid aptamer-qPCR method of the present invention. Detailed Implementation

[0021] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0022] To better understand the present invention, the following embodiments are provided for further illustration. These embodiments are for explanation only and do not constitute any limitation on the present invention.

[0023] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged. Unless otherwise specified, the experimental methods in the following examples are conventional methods.

[0024] Example 1 A method for screening nucleic acid aptamers of Aeromonas hydrophila includes the following steps: (1) The primers for the random ssDNA library are as follows: Primer P1: 5′-TCAGTCGCTTCGCCGTCTCCTTC-3′; Primer P2: 5′-CCCTCTGGGGTCTCCCTCTTGTGC-3′; The designed and synthesized random ssDNA library sequence was 5′-TCAGTCGCTTCGCCGTCTCCTTC-intermediate sequence-GCACAAGAGGGAGACCCCAGAGGG-3′, with the intermediate sequence consisting of 25 random bases. A 10 μmol / L stock solution was prepared using ultrapure water and diluted with 2× binding buffer before use. (The 20× binding buffer consisted of 0.9 mol / L NaCl, 0.5 mol / L KCl, 0.4 mol / L Tris-HCl, and 0.1 mol / L MgCl2, pH=7.4. It was sterilized at 121℃ for 25 min before use, and then diluted with sterile ultrapure water to prepare 2× and 1× binding buffers.) (2) Aeromonas hydrophila was prepared into a 10% concentration using 2× binding buffer. 8 CFU / mL bacterial culture. (1) The synthesized random ssDNA library was diluted to 2 μmol / L with 2× binding buffer, heated in a metal bath at 95℃ for 5 min, and then in an ice bath for 10 min. 100 μL of the solution was then mixed with 100 μL of 10 μL of other solutions. 8 Mix the bacterial suspension with CFU / mL and incubate at 28℃ and 200r / min for 1h.

[0025] (3) After incubation, centrifuge at 6000 r / min for 5 min, discard the supernatant, wash the bacterial pellet twice with 200 μL of 1× binding buffer, centrifuge at 6000 r / min for 5 min, discard the supernatant, and resuspend the bacterial pellet with 100 μL of 1× binding buffer. The resuspended pellet contains the target bacterium Aeromonas hydrophila and its bound ssDNA. Heat the bacterial suspension in a 95℃ metal bath for 5 min, cool to room temperature, centrifuge at 12000 r / min for 10 min, and store the supernatant at 4℃ for later use. Use the supernatant as a template for asymmetric PCR amplification. The 50 μL PCR system consists of 25 μL of 2× Super Pfx Master Mix (PCR buffer premix), 4 μL of primer P1 (10 µmol / L), 4 μL of primer P2 (0.2 µmol / L), 4 μL of template (selection product), and 13 μL of ddH2O. The asymmetric PCR parameters were as follows: 98 °C pre-denaturation for 3 min; followed by 98 °C denaturation for 10 s, 60 °C annealing for 30 s, and 72 °C extension for 15 s, for a total of 30 cycles; finally, a 72 °C extension for 300 s and incubation at 4 °C. The obtained PCR products were analyzed by agarose gel electrophoresis and affinity determination. This completed the first round of SELEX screening, yielding the first round of PCR products.

[0026] (4) Take 100 μL of the PCR product obtained in step (3) as the ssDNA library for the second round of screening. Follow the steps of the first round to complete the second round of screening. Then take 100 μL of the PCR product obtained in the second round as the ssDNA library for the third round of screening. Perform the same screening to complete the third round of screening.

[0027] (5) Perform high-throughput sequencing on the PCR products from the three rounds of screening. Classify and count the high-frequency sequences obtained from the three rounds of high-throughput sequencing according to the number of occurrences and the number of rounds in which they occur, and calculate the relative importance index (IRI). Then, sort all the high-frequency sequences in descending order of IRI value, and focus on studying the top 10 sequences in terms of IRI.

[0028] After asymmetric PCR amplification, the products from the three rounds of screening all showed relatively clear bands in their electrophoresis images (e.g., Figure 1 This indicates that the screening was effective from the very first round. Figure 2 This indicates that as the screening progressed, the affinity of the aptamer-enriched library for Aeromonas hydrophila gradually increased, and was significantly higher than that of the random library (33.23±1.02 μg / mL, P < 0.05). By the third round, the affinity had increased to 44.02±1.20 μg / mL, indicating that the screening was effective and that the nucleic acid aptamer sequences with affinity were well enriched. Table 1 further shows that the proportion of high-frequency sequences gradually increased as the screening progressed, indicating that high-frequency sequences with high affinity were gradually enriched. Two high-frequency sequences, SEQ ID NO:1 (named AH4) and SEQ ID NO:2 (named AH9), were selected from the high-frequency sequences (see Table 2) for further research.

[0029] Table 1. Number and percentage of high-frequency sequences

[0030] Table 2 Candidate Nucleic Acid Aptamer Sequences

[0031] (6) Determination of the affinity of aptamers or PCR products for bacteria using the ssDNA method: Dilute the bacteria to 10× binding buffer. 8 CFU / mL bacterial suspension was prepared, and nucleic acid aptamers were diluted to 200 nmol / L with 2× binding buffer. PCR products were diluted 50-fold with 2× binding buffer. The diluted nucleic acid aptamers or PCR products were heated in a 95°C metal bath for 5 min, then incubated on ice for 10 min. Then, 100 μL of the diluted solution was mixed with 100 μL of ... 8 Mix 100 μL of bacterial suspension at CFU / mL as the experimental group; separately, take 100 μL of 2× binding buffer to replace the aptamer and mix with 100 μL of 10× binding buffer. 8A bacterial suspension of CFU / mL was mixed to serve as the control group. Both the experimental and control groups were incubated on a shaker at 200 rpm for 1 h, then centrifuged at 10000 rpm for 10 min, the supernatant was discarded, the bacterial pellet was washed once with 1× binding buffer, centrifuged at 6000 rpm and the supernatant was discarded, and the bacterial pellet was resuspended in 100 μL of 1× binding buffer to obtain the bacterial suspension. Both the experimental and control groups were heated at 95℃ for 5 min, cooled to room temperature, and centrifuged at 12000 rpm for 10 min, and the supernatant was collected.

[0032] Affinity determination using the ssDNA method: The concentration of ssDNA in the supernatant was measured using an ultra-micro spectrophotometer. Therefore, the affinity of the nucleic acid aptamer or PCR product for the bacteria = ssDNA concentration in the experimental group - ssDNA concentration in the control group.

[0033] (7) Determination of aptamer affinity by qPCR: Obtain the supernatant of the experimental group and the control group according to the method in step (6). Then, qPCR was performed using the supernatant of the experimental group and the control group as templates. The 20 µL qPCR system consisted of 1 µL template, 10 µL 2×PCR premix (containing SYBR Green I dye), 1 µL P1 (10 µmol / L), 1 µL P2 (10 µmol / L) and 7 µL ddH2O. The amplification parameters were: 98 °C pre-denaturation for 3 min; then denaturation at 98 °C for 10 s, annealing at 60 °C for 30 s, and finally extension at 72 °C for 15 s, for a total of 30 cycles. For the target bacterium Aeromonas hydrophila, the supernatant of its experimental group contained more nucleic acid aptamers, and the Ct value was lower. For non-target bacteria, non-specific binding may occur, resulting in a small amount of nucleic acid aptamers in the supernatant of the experimental group, leading to a larger Ct value. In contrast, the control group, lacking nucleic acid aptamers, normally cannot amplify and therefore has no Ct value.

[0034] The Ct value reflects the concentration of the aptamer binding to the bacteria, and the two are inversely proportional. The greater the affinity of the aptamer for the bacteria, the higher the concentration of the aptamer binding, and the lower the Ct value. Since affinity is inversely correlated with Ct value and positively correlated with aptamer concentration, using Ct value to represent affinity is not intuitive. Therefore, we convert Ct value to aptamer concentration and use the concentration of the aptamer binding to the bacteria to represent its affinity.

[0035] The linear equation for converting Ct values ​​to aptamer concentrations was constructed as follows: Nucleic acid aptamers at concentrations of 1, 10, 20, 30, 40, 50, and 60 nmol / L were heated in a 95°C metal bath for 5 min, followed by an ice bath for 10 min. These were then used as templates for qPCR, with the qPCR system and parameters as described above. A linear fit was then performed with aptamer concentration on the x-axis and Ct values ​​on the y-axis, yielding the corresponding linear equation and standard curve. This equation allows the conversion of Ct values ​​to the corresponding aptamer concentrations, which represent the corresponding affinity.

[0036] For the two nucleic acid aptamers AH4 and AH9, the affinity of these two sequences for different bacteria was determined using ssDNA and qPCR methods, respectively. The affinity specificity of these two high-frequency sequences and the methods for determining these two affinity methods were compared and studied. Figure 3 (ab). As can be seen from the figure, both methods show that AH4 and AH9 have significantly higher affinity for the target bacterium Aeromonas hydrophila than the other four non-target bacteria (P < 0.05), demonstrating better affinity specificity.

[0037] Example 2 The nucleic acid aptamer AH4 was obtained through the screening method in Example 1. The affinity constant of nucleic acid aptamer AH4 for Aeromonas hydrophila was determined by qPCR, and the steps are as follows: Experimental group: Nucleic acid aptamers were diluted with 2× binding buffer to concentrations of 1, 10, 20, 30, 40, 50, 60, 80, 100, 150, 200, 250, 300, and 350 nmol / L, respectively. After heating in a 95°C metal bath for 5 min and then in an ice bath for 10 min, the solutions were mixed with 100 μL of 10× binding buffer. 8 Mix CFU / mL Aeromonas hydrophila and incubate at 200 rpm for 1 h on a shaker. Then centrifuge at 10000 rpm for 10 min, discard the supernatant, wash the bacterial pellet once with 1× binding buffer, and resuspend the pellet in 100 μL of 1× binding buffer to prepare a bacterial suspension. Then heat at 95°C for 5 min, cool to room temperature, centrifuge at 12000 rpm for 10 min, and collect the supernatant.

[0038] Control group: 100 μL of 2× binding buffer was used instead of the nucleic acid aptamer, and mixed with 100 μL of 10... 8 The bacterial suspension of CFU / mL was mixed and the procedure was followed as in the experimental group to obtain the supernatant of the control group.

[0039] Then, following the method in step (7) of Example 1, qPCR and subsequent steps were performed using the supernatants of the experimental and control groups as templates to obtain the affinity of the nucleic acid aptamers. Plotting aptamer concentration on the x-axis and binding aptamer concentration (i.e., affinity) on the y-axis, a nonlinear fitting was performed using Origin software, with the fitting function being Y=A. m ·X / (K d +X), and the affinity constant K of the aptamer can be obtained by fitting the equation. d Saturation affinity A m .

[0040] In this embodiment, the Ct values ​​of AH4 at different concentrations were determined using qPCR. Figure 4 a) This Ct value reflects the concentration of the aptamer bound to the bacteria. Then, based on the linear equation between the Ct value and the aptamer concentration ( Figure 4 b), converting the Ct value to the concentration of aptamer bound to the bacteria, allows us to obtain the fitting curve of the affinity constant of AH4 ( Figure 4 c). From Figure 4 As can be seen from b, the fitting coefficient R0 2 The value of 0.992 indicates a good linear relationship between aptamer concentration and its Ct value. Therefore, the more intuitive aptamer concentration can be used instead of the Ct value for fitting the affinity constant. Figure 4 The affinity constant K of aptamer AH4 can be obtained from c. d =171.60±33.15 nmol / L, saturation affinity A m =73.69±6.54 nmol / L, fitting coefficient R 2 =0.9808, indicating that the fitting curve has a good fit, and also showing that it is feasible to determine the affinity constant of aptamers by qPCR.

[0041] Example 3 Nucleic acid aptamer AH4 was obtained using the screening method in Example 1, and quantitative detection of Aeromonas hydrophila was performed using the nucleic acid aptamer-qPCR method. The steps are as follows: The Aeromonas hydrophila culture was diluted to 10 and 10 ppm using 2× binding buffer, respectively. 2 10 3 10 4 10 5 10 6 10 7 10 8 CFU / mL, then 100 μL was taken and combined with 100 μL and 250 nmol / L nucleic acid aptamer AH4, respectively, as the experimental group; another 100 μL of 2× binding buffer was taken to replace the nucleic acid aptamer and combined with 100 μL and 100 nmol / L nucleic acid aptamer AH4, respectively. 8CFU / mL of Aeromonas hydrophila was bound as a control group. Then, following the method in step (7) of Example 1, qPCR was performed using the supernatants of the experimental and control groups as templates to obtain the Ct values ​​at the corresponding bacterial concentrations. A linear fit was performed with the logarithm of bacterial concentration as the abscissa and the Ct value as the ordinate to obtain the standard curve of Ct value-logarithm of bacterial concentration and its linear equation.

[0042] Nine concentrations (10, 10⁻⁶, 10⁻⁶) of Aeromonas hydrophila were detected using the nucleic acid aptamer-qPCR method. 1 10 2 10 3 10 4 10 5 10 6 10 7 10 8 The Ct value was measured at CFU / mL to obtain the relationship curve between Ct value and bacterial concentration. Figure 6 ).from Figure 6 As can be seen, the Ct value has a good linear relationship with the logarithm of the bacterial concentration (CFU / mL), and the fitting coefficient R is [value missing]. 2 The value is 0.9904, and the corresponding fitting equation is Ct = -0.4676X + 10.634. This detection method is effective in the range of 10 to 10. 8 The method exhibits good linearity within the CFU / mL range, indicating that it can be used for the quantitative detection of Aeromonas hydrophila, with a detection limit as low as 10 CFU / mL.

[0043] Example 4 This embodiment studies the quantitative detection effect (application effect) of nucleic acid aptamer AH4 obtained by the screening method in Example 1 on Aeromonas hydrophila in seawater with different salinity and in different fish tissues.

[0044] (1) Detection of Aeromonas hydrophila in seawater with different salinities: Artificial seawater with salinities of 20, 25, 30 and 35‰ was prepared using sea salt crystals. Then, 2 mL and 2 mL of seawater with a concentration of 2×10⁻⁶ were taken respectively. 3 and 2×10 4 A suspension of Aeromonas hydrophila at CFU / mL was mixed to prepare bacterial concentrations of 10. 3 and 10 4CFU / mL spiked seawater samples were then used. 300 μL of this spiked seawater sample was mixed with 100 μL of 250 nmol / L nucleic acid aptamer AH4 to form the experimental group. The control group was prepared by mixing 150 μL of artificial seawater of the corresponding salinity with 150 μL of 2× binding buffer instead of the 300 μL spiked seawater sample, and then mixing it with 100 μL of 250 nmol / L nucleic acid aptamer AH4. Three replicates were performed for both the experimental and control groups. Then, following step (6) of Example 1, the supernatants of the experimental and control groups were prepared. qPCR was performed using the supernatants of the experimental and control groups as templates, following step (7) of Example 1, to obtain the Ct values ​​of the spiked samples at the corresponding salinity. The corresponding standard curve equation was then obtained according to the method in Example 3, and the bacterial concentration of the corresponding sample could be calculated. Simultaneously, the relative standard deviation (RSD) was calculated as standard deviation / mean value to evaluate its application effect.

[0045] (2) Detection of Aeromonas hydrophila in different tissue samples: Heart, liver, gallbladder, spleen, kidney, epidermis, and muscle tissues of eels were collected, 0.5g of each was chopped, and 5 mL of 2× binding buffer was added and soaked for 1 h. After centrifugation, the supernatant was collected to prepare a tissue suspension. Tissue suspensions with concentrations of 2×10⁻⁶ were prepared. 3 and 2×10 4 Two mL each of CFU / mL Aeromonas hydrophila suspension and two mL of tissue suspension were mixed to prepare spiked tissue fluid samples. At this point, the bacterial concentration of Aeromonas hydrophila in the spiked samples was 10... 3 and 10 4 CFU / mL. Then, 100 μL of 250 nmol / L nucleic acid aptamer AH4 was mixed with 300 μL of spiked tissue sample as the experimental group; another 150 μL of tissue suspension and 150 μL of 2× binding buffer were mixed, replacing the spiked tissue sample, and mixed with 100 μL of 250 nmol / L nucleic acid aptamer as the control group. Both the experimental and control groups were repeated in triplicate. Subsequent methods and steps were the same as in step (1) of this embodiment.

[0046] The results showed that the relative standard deviation (RSD) for seawater samples ranged from 0.71% to 4.76%, while that for tissue samples ranged from 0.48% to 7.63% (see Table 3), indicating that the deviation was larger in tissue samples. Generally, the RSD in a detection system is required to be less than 12%. Our tests on both seawater and tissue samples met these requirements. The Aeromonas hydrophila nucleic acid aptamer prepared in this invention can be used for the detection of Aeromonas hydrophila in water and aquatic products.

[0047] Table 3 Application Testing of Spiked Samples

[0048] Example 5 Predict the secondary and tertiary structures of nucleic acid aptamer AH4 using software (e.g., Figure 5 The secondary structure was simulated using SnapGene software. The tertiary structure of the aptamer was first obtained as a PDB file in RNA form from the RNACompose website, and then corrected to a DNA PDB file using Molecular Operating Environment (MOE) software to obtain its tertiary structure diagram.

[0049] The above description is merely an embodiment of the present invention and does not limit the patent scope of the present invention. Any equivalent structural or procedural transformations made based on the content of the present invention specification, or direct or indirect applications in other related technical fields, are similarly included within the patent protection scope of the present invention.

Claims

1. A nucleic acid aptamer for Aeromonas hydrophila, characterized in that: The aptamer is represented by either SEQ ID NO:1 or SEQ ID NO:

2. SEQ ID NO:1: TCAGTCGCTTCGCCGTCTCCTTCAGGAGACGGCTCTAAGTAACGTCGCACATATCGCGGCACAAGAGTGAGCACAAGAGGGAGACCCCAGAGGG, SEQ ID NO:2: TCAGTCGCTTCGCCGTCTCCTTCGGCCAGCCGAAGGAGACGTGGTGATTTCACTAAGACGCACAAGAGGGAGACCCCAGAGGG.

2. A method for screening Aeromonas hydrophila aptamers, characterized in that, Prepared using the following SELEX screening method: (1) Design and synthesize an ssDNA library with fixed sequences at both ends and a 25-base random sequence in the middle; (2) Prepare a buffer solution containing Aeromonas hydrophila and incubate it with a buffer solution containing an ssDNA library under certain conditions. (3) Isolate the ssDNA that binds to Aeromonas hydrophila, perform asymmetric PCR amplification to obtain an ssDNA library that can be used for the next round of screening, and perform agarose electrophoresis detection and affinity determination. (4) Complete n rounds of screening of the ssDNA library obtained in the previous round according to steps (2) and (3) to obtain the final ssDNA library; (5) Perform high-throughput sequencing on the PCR products of the nth round of screening. The high-frequency sequences obtained are classified and statistically analyzed according to the number of occurrences and the number of rounds of occurrence. Calculate the relative importance index (IRI). Then arrange all high-frequency sequences in descending order of IRI value. (6) Synthesize the top 10 IRI sequences and verify their affinity and specificity. The sequences with high affinity and specificity are selected Aeromonas hydrophila aptamers.

3. The method for screening Aeromonas hydrophila aptamers according to claim 2, characterized in that, The ssDNA library mentioned in step (1) is: 5′-TCAGTCGCTTCGCCGTCTCCTTC-intermediate sequence-GCACAAGAGGGAGACCCCAGAGGG-3′, where the intermediate sequence is a 25-base sequence.

4. The ssDNA library according to claim 3, characterized in that, The primers for preparing the ssDNA library are P1 (5′-TCAGTCGCTTCGCCGTCTCCTTC-3′) and P2 (5′-CCCTCTGGGGTCTCCCTCTTGTGC-3′).

5. The method for screening Aeromonas hydrophila aptamers according to claim 2, characterized in that, The n≥3 mentioned in step (4).

6. The method for screening Aeromonas hydrophila nucleic acid aptamers according to claim 5, characterized in that, The n=3 mentioned in step (4).

7. The application of the Aeromonas hydrophila nucleic acid aptamer as described in claim 1 in the quantitative detection of Aeromonas hydrophila.

8. A method for quantitative detection of Aeromonas hydrophila, characterized in that, The Aeromonas hydrophila nucleic acid aptamer as described in claim 1 was added to the sample and standard solution respectively as the experimental group and control group. The samples were washed, resuspended, heated and centrifuged to obtain the supernatant. The supernatant was used as a template for qPCR to obtain the Ct value at the corresponding bacterial concentration for calculation, thereby quantitatively detecting the concentration of Aeromonas hydrophila.