Construction and application of 2-deoxyribose-5-phosphate aldolase mutant of rhodococcus ruber sd3

CN122588065APending Publication Date: 2026-08-18JIANGXI NORMAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610105428.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-26
Publication Date
2026-08-18

AI Technical Summary

Technical Problem

[0006]针对野生型RrDeoC在催化非天然底物氯乙醛时催化效率受限的问题,本发明通过虚拟筛选结合点突变活性验证,成功获得了一种RrDeoC突变体

Benefits of technology

[0013]The mutant S43A provided by this invention exhibits significantly improved catalytic activity and substrate conversion rate compared to the wild-type enzyme, and is a preferred embodiment of this invention. In addition, this invention also includes other mutants S131A and S131T obtained by the same virtual screening method, which do not show significant improvement in catalytic activity, but are also within the protection scope of this invention.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122588065A_ABST
    Figure CN122588065A_ABST
Patent Text Reader

Abstract

A novel 2-deoxyribose-5-phosphoaldolase was identified and isolated from Rhodococcus SD3. Rr DeoC), functional studies have shown that this enzyme can catalyze the aldol condensation reaction between acetaldehyde and chloroacetaldehyde, and is used in the synthesis of key intermediates for statin drugs (DeoC). 3R , 5S )-6-chloro-2,4,6-trideoxypyranose. However, wild-type Rr DeoC still suffers from limited catalytic efficiency in the conversion of the non-natural substrate chloroacetaldehyde. To address this issue, this invention combines rational design and virtual screening strategies to improve catalytic efficiency. Rr The DeoC enzyme molecule underwent rational modification. The results showed that... Rr The DeoC mutant S43A achieved a chloroacetaldehyde conversion rate of 69.4% after 1 h of aldol condensation, which was 24.7% higher than that of the wild type. After optimization, the conversion rate of chloroacetaldehyde was further improved to 79.8% after 12 h of aldol condensation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention pertains to the application of biocatalysis technology in the synthesis of pharmaceutical intermediates, specifically involving a compound derived from Rhodococcus SD3 (… Rhodococcus ruber SD3) 2-deoxyribose-5-phosphate aldolase mutant, and the use of this mutant in the synthesis of statin drug intermediates ( 3R , 5S Application in 6-chloro-2,4,6-trideoxypyranoside. Background Technology

[0002] Statins are a class of highly effective HMG-CoA reductase inhibitors, widely used to regulate blood lipids and prevent and treat cardiovascular diseases such as atherosclerosis, and their market demand is enormous. 3R , 5S 6-chloro-2,4,6-trideoxypyranose is a key chiral intermediate in the synthesis of statin drugs, and its synthesis efficiency directly affects the production cost and industrialization process of statin drugs.

[0003] Biocatalysis has gradually become an important technology for the preparation of chiral drug intermediates due to its advantages such as mild reaction conditions, high stereoselectivity, and environmental friendliness. 2-Deoxyribose-5-phosphate aldolase (DeoC), as a key aldolase, can catalyze the aldol condensation reaction of acetaldehyde with substituted acetaldehyde, providing an efficient pathway for the synthesis of statin drug intermediates.

[0004] In the prior art, a novel 2-deoxyribose-5-phosphate aldolase (named) was identified and isolated from Rhodococcus SD3. Rr DeoC can catalyze the aldol condensation reaction of acetaldehyde and chloroacetaldehyde to produce ( 3R , 5S 6-chloro-2,4,6-trideoxypyranose. However, wild-type Rr DeoC has limited catalytic efficiency for non-natural substrates such as chloroacetaldehyde, resulting in low substrate conversion rates, which restricts its application in the large-scale synthesis of statin drug intermediates.

[0005] To address the limited catalytic efficiency of wild-type enzymes, enzyme molecule modification has become an important technical means to improve their catalytic performance. Rational modification methods based on virtual mutation screening can precisely locate key sites in enzyme molecules and perform mutation modifications, thereby directionally improving enzyme catalytic activity, substrate tolerance, and other properties. Currently, for... Rr No rational modifications to DeoC have been reported; therefore, there is an urgent need for a method that significantly improves catalytic performance. Rr The DeoC mutant and its construction method are proposed to overcome the shortcomings of existing technologies. Summary of the Invention

[0006] For wild type Rr To address the limitation of DeoC's catalytic efficiency when catalyzing the non-natural substrate chloroacetaldehyde, this invention successfully obtained a new type of DeoC through virtual screening combined with point mutation activity verification. Rr DeoC mutant. Compared to wild type. Rr Compared to DeoC, this mutant exhibits significantly enhanced catalytic activity and substrate conversion, enabling efficient catalysis of the aldol condensation reaction of acetaldehyde and chloroacetaldehyde, thereby achieving the key intermediate for statin drugs (…). 3R , 5S Efficient synthesis of 6-chloro-2,4,6-trideoxypyranose.

[0007] This invention addresses the problems in the prior art. Rr DeoC addresses the technical challenge of limited catalytic efficiency for non-natural substrates by providing a set of methods for achieving this through rational design and virtual screening. Rr DeoC mutant.

[0008] This invention constructs recombinant expression vectors containing S43A, S131A, and S131T mutant genes, respectively, and uses them for subsequent protein expression and functional verification.

[0009] This invention provides a method for preparing S43A, S131A, and S131T mutant enzymes, the method comprising: (a) Under conditions suitable for protein expression, expression vectors containing S43A, S131A and S131T mutant genes are cultured and induced to express the mutant enzymes. (b) The expression product is purified by affinity chromatography to obtain the S43A, S131A and S131T mutant recombinant proteins.

[0010] The buffer solution used in the catalytic process of this invention is a conventional buffer solution in the art, with a suitable pH of 4-9; more suitable buffer solutions are sodium citrate buffer (pH 4-6), phosphate buffer (pH 6-8), and Tris-HCl buffer (pH 8-9); the optimal buffer solution for catalytic activity is sodium citrate buffer at pH 5.0.

[0011] The temperature conditions used in the catalytic process of this invention are 20℃-50℃, and the optimal temperature for catalytic activity is 30℃.

[0012] The chloroacetaldehyde concentration used in the catalytic process of this invention is 5 mM-100 mM, the acetaldehyde concentration is twice that of chloroacetaldehyde, and the optimal substrate concentration for catalytic activity is 50 mM.

[0013] The mutant S43A provided by this invention exhibits significantly improved catalytic activity and substrate conversion rate compared to the wild-type enzyme, and is a preferred embodiment of this invention. In addition, this invention also includes other mutants S131A and S131T obtained by the same virtual screening method, which do not show significant improvement in catalytic activity, but are also within the protection scope of this invention. Attached Figure Description

[0014] Figure 1 Construction of S43A, S131A, and S131T mutant strains. Note: Lane M: DL2000 marker, DL10000 marker; Figure A shows the site-directed mutagenesis PCR amplification products, lanes 1-2 are S43A, 3-4 are S131A, and 5-6 are S131T; Figure B shows the gel recovery of the site-directed mutagenesis PCR amplification products, lanes 1-3 correspond to S43A, S131A, and S131T respectively; Figure C shows the PCR amplification verification of the positive clones of the recombinant plasmid of the mutant strains, lanes 1-3 are S43A, 4-6 are S131A, and 7-9 are S131T.

[0015] Figure 2 Soluble expression analysis of S43A, S131A, and S131T. Note: Lane M represents protein markers 14.4-94.0 kDa; lanes 1-4 represent S43A uninduced whole protein, induced whole protein, induced supernatant, and induced precipitation, respectively; lanes 5-8 represent S131A uninduced whole protein, induced whole protein, induced supernatant, and induced precipitation, respectively; lanes 9-12 represent S131T uninduced whole protein, induced whole protein, induced supernatant, and induced precipitation, respectively.

[0016] Figure 3 Purification of S43A, S131A, and S131T mutant proteins. Note: Figures A and C are electrophoresis images of the purification results of S43A, S131A, and S131T proteins, respectively. The lanes correspond as follows: Lane M is the protein marker (14.4-94.0 kDa), Lane 1 is the uninduced whole protein, Lane 2 is the induced whole protein, Lane 3 is the induction supernatant, Lane 4 is the flow-through buffer, Lane 5 is the washing buffer, and Lanes 6-13 are the elution buffer.

[0017] Figure 4 Differences in the catalytic activity of S43A enzyme under different pH conditions.

[0018] Figure 5 Differences in S43A tolerance under different pH conditions.

[0019] Figure 6 Differences in S43A tolerance at different temperatures.

[0020] Figure 7Differences in S43A tolerance at different temperatures.

[0021] Figure 8 The effect of different chloroacetaldehyde concentrations on enzyme catalytic activity. Figure 9 Chloroacetaldehyde concentration and OD 528 The linear relationship of nm. Detailed Implementation

[0022] The present invention will be further described in detail below with reference to specific embodiments, but the present invention is not limited to the following embodiments.

[0023] Example 1: Rr DeoC's rational design and virtual screening.

[0024] a. Homology Modeling and Molecular Docking: First, the SDF structure of the chloroacetaldehyde small molecule was downloaded from the PubChem chemical database (https: / / pubchem.ncbi.nlm.nih.gov). Then, the SDF structure was converted to mol2 format using Openbabel-GitHub software to serve as the ligand for molecular docking. The acceptor PDB file was obtained from the AlphoFold DB database (https: / / alphafold.ebi.ac.uk / ). Rr The DeoC protein tertiary structure file was then generated. Autodock Tools 1.5.7 was used to add Gasteiger-Huckel charges and hydrogen atoms to the receptor and ligand, and the file was converted to PDBQT format. After molecular docking, the conformation with the lowest binding free energy was selected as the optimal receptor-ligand complex. The corresponding conformation was generated using PyMoL and analyzed. Amino acid residues located within the substrate binding site in the range of 6 Å-12 Å were selected as candidate mutation sites. b. Homologous sequence alignment: Based on homologous sequence alignment, the conservation of amino acids in the 6Å-12Å range of a is analyzed, and residues with conservation of less than 70% are screened as candidate mutation sites to avoid a significant impact on the overall structural stability of the enzyme. c. After performing an alanine scan using FoldX, the candidate sites in b were further screened, selecting ΔΔG (< 1 kcal mol) -1 Amino acid residues were selected as candidate sites for the next step of mutation. The results are shown in Table 1.

[0025] Table 1. List of mutation sites and ΔΔG values ​​calculated by FoldX.

[0026] mutation site ΔΔG (kcal / mol) S43A -3.24 S131A -2.01 R203A -1.18 R213A -2.26 d. Using the Saprot computational platform developed by Westlake University (https: / / colab.research.google.com / github / westlake-repl / SaprotHub / blob / main / colab / SaprotHub_v2.ipynb), saturation mutation calculations were performed on the candidate sites in c. This computational platform, based on molecular dynamics simulations and structure predictions, screens potential favorable mutation sites (mutations with a computational score greater than 0) by predicting the effects of different mutants on protein conformation and catalytic activity. The final results of the candidate favorable mutation sites are shown in Table 2.

[0027] Table 2 shows the results of saturation mutation screening based on the Sabrot platform.

[0028] mutation site Score S43A 0.9582 S131A 0.6054 S131T 2.4049

[0029] Example 2: Construction, expression and purification of S43A, S131A and S131T mutants.

[0030] Using wild-type recombinant plasmid pET-28a(+)- deoC Using the original template sequence, a PCR-based site-directed mutagenesis method was used to introduce target base mutations. The mutation primers were designed based on the target amino acid sites S43A, S131A, and S131T and their corresponding codons, as shown in Table 3.

[0031] Table 3. Site-directed mutagenesis primer sequences.

[0032] Mutated amino acid sites Upstream primer (5'→3') Downstream primer (5'→3') S43A GTCTGGGCCGTCTGCGTGTCGCCGTCGATGCT ACGCAGACGGCCCAGACCCCGAGTTCGCGGGC S131A AGGTGATCCTCGAGGCCGCGGCCCTGTCGGACGAG GGCCTCGAGGATCACCTTCAGCACGGGCTCGA S131T AGGTGATCCTCGAGACCGCGGCCCTGTCGGACGAG GGTCTCGAGGATCACCTTCAGCACGGGCTCGA

[0033] pET-28a(+)- deoC Using plasmids as templates, PCR amplification was performed by adding the corresponding upstream and downstream primers for each mutant. Since the annealing temperatures of the three mutants were consistent, the same reaction program was used for amplification. The specific PCR reaction program was as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 1 min, 64℃ annealing for 30 s, 72℃ extension for 5 min 30 s, for a total of 34 cycles, followed by a full extension at 72℃ for 5 min, and incubation at 16℃. The PCR products were correctly detected by agarose gel electrophoresis. Figure 1 A), and the PCR product was obtained by gel extraction and purification. Figure 1 B), store at -20℃ for later use.

[0034] The purified PCR product was processed according to the following system. Dpn I. Enzyme digestion to digest the template plasmid: 10 μL of purified PCR product, 1.25 μL of 10× restriction endonuclease buffer, DpnI. 0.5 μL of enzyme was added, and the volume was increased to 12.5 μL with ddH2O. The enzyme was digested in a 37°C water bath for 2 h. The digestion product was directly converted to [a specific enzyme] using the heat shock method. E. coli BL21 competent cells were plated on LB solid medium containing kanamycin and cultured at 37°C for 12 h until single colonies appeared. A single colony was picked and transferred to 5 mL of LB liquid medium containing kanamycin and cultured at 37°C with shaking at 200 rpm until saturation. Plasmids were extracted and verified by PCR amplification to obtain positive clones. Figure 1 C) The plasmid with the amplified band size that meets the expectation is sent for sequencing to obtain the strain that matches the target mutation site.

[0035] The three constructed mutant recombinant expression strains were inoculated into LB medium containing 50 μg / mL kanamycin sulfate and cultured overnight at 37 ℃ with shaking at 200 rpm. The inoculum was then transferred at a 1:50 ratio to 200 mL Erlenmeyer flasks containing LB medium and cultured on a shaker at 37 ℃ with shaking at 200 rpm. When the OD of the culture medium... 595 When the saturation point (nm) reached 0.6, IPTG was added to a final concentration of 0.2 mmol / L as an inducer. After induction at 25°C for 15 hours, the culture medium was centrifuged, cells were collected, and washed twice with 0.85% physiological saline to obtain resting cells. The obtained resting cells were resuspended in phosphate buffer (pH 7.4) and disrupted using an ultrasonic cell disruptor. After centrifugation at 12000×g for 20 min, the supernatant obtained was the crude enzyme solution of the mutant recombinant enzyme. Figure 2 The results are from polyacrylamide gel electrophoresis.

[0036] The obtained crude enzyme solution was loaded onto a nickel column. First, impurities were eluted with solution A (pH 8.0), and then the mutated target protein was eluted with solutions B and C (pH 8.0). Rr DeoC: Collect the purified target protein, add 80% glycerol, and store at -80℃ for later use. Solution A is: phosphate buffer (pH 7.4) containing 10 mM imidazole; Solution B is: phosphate buffer (pH 7.4) containing 100 mM imidazole; Solution C is: phosphate buffer (pH 7.4) containing 500 mM imidazole. Figure 3 The images show the nickel column affinity chromatography purification of the three mutants.

[0037] Example 3: Rr Determination of substrate conversion efficiency of DeoC mutant.

[0038] This invention employs a 2,4-dinitrophenylhydrazine (2,4-DNPH) colorimetric method. Based on the colorimetric reaction characteristics of carbonyl compounds, it detects changes in the concentration of the substrate chloroacetaldehyde in the reaction solution. The amount of chloroacetaldehyde consumed reflects the catalytic activity of the enzyme, thus providing a preliminary determination of whether an aldol reaction has occurred. This colorimetric method utilizes the reaction of chloroacetaldehyde with 2,4-dinitrophenylhydrazine to generate 2,4-dinitrophenylhydrazone. The 2,4-dinitrophenylhydrazone is placed in an alkaline environment, where it reacts with KOH to generate a colored quinone compound. The absorbance of the quinone compound is detected at 528 nm using a microplate reader, thereby calculating the amount of chloroacetaldehyde consumed from the start to the end of the reaction. The reaction is carried out at 30°C in the dark. The reaction system (500 μL) consists of 25 mM chloroacetaldehyde, 50 mM acetaldehyde, phosphate buffer (pH 7.4), and 150 μL of enzyme solution, and the reaction lasts for 1 h. At the start and end of the reaction, take 4 µL of the reaction solution and dilute it 500 times with deionized water. Take 1.6 mL of the diluted solution and place it in a 5 mL centrifuge tube. Add 300 µL of 0.1% 2,4-dinitrophenylhydrazine solution, mix well, and incubate at 30°C in the dark for 20 min. Next, add 100 µL of 100 g / L KOH solution to the mixture, mix quickly, and incubate at 30°C in the dark for 10 min. After the reaction is complete, take 200 µL of the reaction solution and add it to a 96-well plate. Measure the absorbance of the reaction solution at 528 nm using a microplate reader.

[0039] wild type Rr DeoC(WT) is used as a control. Rr The conversion efficiency of chloroacetaldehyde in the continuous aldol condensation reaction of acetaldehyde and chloroacetaldehyde catalyzed by DeoC mutants S43A, S131A, and S131T was compared to identify mutants with beneficial catalytic activity. The reaction system (500 µL) consisted of 50 mM acetaldehyde, 25 mM chloroacetaldehyde, and 0.15 mg of purified enzyme protein, with phosphate buffer (pH 7.4) as the buffer. Following the 2,4-dinitrophenylhydrazine colorimetric method, the catalytic activity of different mutants was evaluated by detecting the amount of chloroacetaldehyde substrate consumed in the reaction systems of wild-type and mutant strains, thereby screening for mutants with significantly enhanced enzyme activity. The results are shown in Table 4. Compared with the wild-type strain, only the S43A mutant showed a 24.7% increase in chloroacetaldehyde conversion, indicating that this mutation significantly enhanced the enzyme's catalytic efficiency for this substrate in the actual reaction system. While the S131A and S131T mutants showed certain computational advantages in FoldX stability predictions and Saprot platform catalytic potential assessments, their conversion rates were lower than those of the wild-type strains in experiments. This indicates that these mutants may have failed to translate their computationally predicted potential advantages into positive catalytic effects in actual catalysis due to factors such as altered active site microenvironment and unfavorable substrate binding conformation.

[0040] Table 4. Comparison of chloroacetaldehyde conversion rates between wild-type and mutant strains.

[0041] strain type Conversion rate wild type 44.7% S43A 69.4% S131A 33.7% S131T 33.7%

[0042] Example 4: Activity determination of S43A in different pH buffer solutions.

[0043] At a reaction temperature of 30℃, an appropriate amount of purified S43A enzyme was added. Using 25 mM chloroacetaldehyde and 50 mM acetaldehyde as substrates, the relative activity of S43A in buffer solutions with different pH values ​​was investigated based on changes in absorbance at a detection wavelength of 528 nm. The buffer systems used were: sodium citrate buffer (pH 4.0-6.0); phosphate buffer (pH 6.0-8.0); and Tris-HCl buffer (pH 8.0-9.0). The results are as follows: Figure 4 As shown, the optimal pH for S43A is 5.0.

[0044] Example 5: Stability of S43A in different pH buffers.

[0045] S43A was incubated for 8 hours in different pH buffer environments, and the differences in S43A enzyme activity were then detected and compared. The experimental method was the same as in Example 4, thereby comparing the stability of S43A under different pH environments. The results are as follows: Figure 5 As shown, S43A exhibits the best stability at pH 8.0.

[0046] Example 6: Rr Activity determination of DeoC at different temperatures.

[0047] Add appropriate amounts under different temperature conditions (20℃, 30℃, 40℃, 50℃). Rr DeoC purified enzyme was used with sodium citrate (pH 5.0) as buffer, and 25 mM chloroacetaldehyde and 50 mM acetaldehyde as substrates for enzyme activity assay. The activity was investigated based on changes in absorbance at a detection wavelength of 528 nm. Rr The relative activity of DeoC at different temperatures. Results are as follows: Figure 6 As shown, Rr DeoC exhibits the highest catalytic activity at 30°C; as the temperature continues to rise, the enzyme activity begins to decline.

[0048] Example 7: Stability of S43A at different temperatures.

[0049] S43A was incubated at different temperatures (20℃, 30℃, 40℃, 50℃) for 8 h, and the differences in S43A enzyme activity were then detected and compared. The experimental method was the same as in Example 6, thereby comparing the stability of S43A at different temperatures. The results are as follows: Figure 7As shown, S43A exhibits the highest stability at 20℃.

[0050] Example 8: Activity determination of S43A at different substrate concentrations.

[0051] Using sodium citrate (pH 5.0) as buffer, chloroacetaldehyde was added at molar concentrations of 5 mM, 10 mM, 15 mM, 25 mM, 50 mM, 75 mM, and 100 mM, with acetaldehyde at twice the molar concentration of chloroacetaldehyde. Simultaneously, an appropriate amount of purified S43A enzyme was added, and the mixture was stirred at 30°C. The relative activity of S43A at different substrate concentrations was investigated based on the change in absorbance at a detection wavelength of 528 nm. The results are as follows: Figure 8 As shown, S43A exhibits the highest catalytic activity at chloroacetaldehyde concentrations of 50 mM and acetaldehyde concentrations of 100 mM. When the chloroacetaldehyde concentration is gradually increased to 100 mM, the relative activity of the enzyme remains at around 70%, indicating that S43A has high aldehyde tolerance to chloroacetaldehyde.

[0052] Under the optimized reaction conditions described above, 0.15 mg of S43A enzyme was added to catalyze the substrate reaction, and the conversion rate of the substrate chloroacetaldehyde was detected. The conversion rate was calculated using the formula: Conversion Rate = (Amount of substrate consumed in the reaction / Total initial substrate) × 100%. The results showed that the conversion rate reached 79.8% after 12 h of reaction.

[0053] The enzyme activities in the above examples were compared using the conversion rate of chloroacetaldehyde, and the standard curve was calculated as the relationship between chloroacetaldehyde concentration and OD. 528 linear relationship of nm ( Figure 9 ).

[0054] The above embodiments are only for illustrating the technical concept and features of the present invention, and are intended to enable those skilled in the art to understand the content of the present invention and implement it accordingly. They should not be construed as limiting the scope of protection of the present invention. All equivalent changes or modifications made in accordance with the spirit and essence of the present invention should be covered within the scope of protection of the present invention.

Claims

1. A mutant of 2-deoxyribose-5-phosphate aldolase ( Rr DeoC), characterized in that, Using computer-aided rational enzyme design strategies Rr DeoC performed virtual mutations and screened for potential mutation sites S43A, S131A, and S131T.

2. The nucleotide and amino acid sequences of the S43A mutant, S131A mutant, and S131T mutant according to claim 1, characterized in that, The amino acid sequences are all based on the wild type Rr DeoC is based on only one of the sites being mutated. That is, the S43A mutant has the 43rdserine (Ser) mutated to alanine (Ala); the S131A mutant has the 131stserine (Ser) mutated to alanine (Ala); and the S131T mutant has the 131stserine (Ser) mutated to threonine (Thr).

3. A recombinant expression vector, characterized in that, The vector contains the gene encoding the S43A mutant, S131A mutant, and S131T mutant as described in claim 2.

4. The recombinant expression vector of claim 3, wherein, The vector is the prokaryotic expression vector pET-28a(+).

5. A method for preparing the S43A, S131A and S131T mutant of claim 1, characterized by, Includes the following steps: a) Using wild-type recombinant plasmid pET-28a(+)- deoC Using the original template sequence, site-directed mutagenesis primers were designed, and PCR amplification was performed to obtain recombinant plasmids containing the S43A, S131A, and S131T mutation sites, respectively. b) The mutated recombinant plasmid was transformed into Escherichia coli BL21(DE3), and the S43A, S131A and S131T mutants were heterologously expressed by induction culture; c) The S43A, S131A and S131T mutant enzymes were purified by affinity chromatography from the culture.

6. A device as described in claim 1 Rr The DeoC mutant catalyzes the synthesis of acetaldehyde and chloroacetaldehyde. 3R , 5S Application in 6-chloro-2,4,6-trideoxypyranoside.

7. Wild type Rr DeoC was used as a control to evaluate the catalytic activity of candidate sites S43A, S131A and S131T selected by virtual screening in claim 1. By detecting the amount of chloroacetaldehyde substrate consumed in the reaction system of wild-type and mutant strains, the beneficial mutant S43A with significantly improved enzyme activity was screened out.

8. The application according to claim 6, characterized in that, Using the beneficial mutant S43A obtained from screening according to claim 7 as a catalyst, the catalytic conditions of the reaction system in which it participates are optimized, and the catalytic conditions of the reaction satisfy one or more of the following: a) The reaction is carried out in a buffer system with a pH of 4.0–9.0; b) The reaction temperature is 20°C to 50°C; c) The concentration of chloroacetaldehyde is from 5 mM to 100 mM; d) The molar ratio of acetaldehyde to chloroacetaldehyde is 2:1.