FveDRD1 gene for regulating sugar accumulation in strawberry fruit and application thereof

CN122648482APending Publication Date: 2026-08-28ANHUI AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202611160894.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-08-03
Publication Date
2026-08-28

AI Technical Summary

Technical Problem

草莓中RdDM途径核心组分对草莓果实糖分积累的调控作用及具体功能尚不明确

Benefits of technology

1)通过甲基磺酸乙酯(EMS)诱变筛选获得的一株果实糖含量显著下降的突变体为材料,确定致突变基因为RdDM途径的关键元件FveDRD1,探究DNA甲基化通路调控草莓果实糖含量的分子机制,为草莓果实的糖代谢调控和品质改良研究提供了重要的理论参考。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122648482A_ABST
    Figure CN122648482A_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of plant molecular genetic engineering, and particularly relates to a FveDRD1 gene for regulating sugar accumulation in strawberry fruits and application thereof. The sequence of the FveDRD1 gene is shown as SEQ ID NO:1, and the amino acid sequence encoded by the FveDRD1 gene is shown as SEQ ID NO:2. The FveDRD1 gene can positively regulate sugar accumulation, such as sucrose, glucose and fructose, in strawberry fruits. By inhibiting or eliminating the expression of the FveDRD1 gene in the strawberry fruits, the sugar accumulation in the fruits can be reduced, and the sweetness can be reduced. The application provides a new genetic resource for improving the quality of strawberries.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant molecular genetic engineering technology, and in particular to an FveDRD1 gene that regulates sugar accumulation in strawberry fruit and its application. Background Technology

[0002] Strawberries are rich in nutrients, have a unique flavor, and possess high economic value. The flavor compounds (sugars, acids, and aroma compounds) of strawberries have a significant impact on the fruit's intrinsic quality. Soluble sugar content is a key indicator determining the flavor quality and market competitiveness of strawberries, significantly affecting sweetness, texture, and storage performance, and is a core sensory factor for consumers evaluating fruit quality. Understanding the regulatory mechanisms of sugar accumulation in strawberries is of great guiding significance for improving strawberry quality and cultivating superior new varieties.

[0003] The regulation of sugar metabolism in fruits depends on a variety of transcription factors and epigenetic mechanisms. DNA methylation is an important epigenetic modification in plants, and recent studies have shown that it plays a crucial role in the regulation of fruit development and quality traits. The RNA-directed DNA methylation (RdDM) pathway is a key pathway for de novo methylation in plants, in which DRD1 (Defective in RNA-directed DNA methylation 1), as a core element of the RdDM pathway, participates in genome-wide CHH-type DNA methylation modification and plays an important role in gene expression regulation.

[0004] Cheng et al. (2018) reported in Genome Biology that the RdDM pathway regulates strawberry ripening as a whole, but did not identify any components. The regulatory role and specific functions of the core components of the RdDM pathway in strawberry fruit sugar accumulation remain unclear. Summary of the Invention

[0005] To address the problems in the prior art, one of the objectives of this invention is to provide the application of the FveDRD1 gene in regulating sugar accumulation in strawberry fruit. The sequence of the FveDRD1 gene is shown in SEQ ID NO:1, and the amino acid sequence it encodes is shown in SEQ ID NO:2.

[0006] Furthermore, the sugar includes any one or more of sucrose, glucose, and fructose.

[0007] Furthermore, by inhibiting the expression of the FveDRD1 gene, the sugar accumulation in strawberry fruit is reduced; and by increasing the expression of the FveDRD1 gene, the sugar accumulation in strawberry fruit is promoted.

[0008] A second objective of this invention is to provide an expression cassette comprising the FveDRD1 gene and a promoter, terminator, and / or regulatory element operatively linked to the FveDRD1 gene, the sequence of which is shown in SEQ ID NO:1.

[0009] A third objective of this invention is to provide a construct for increasing the expression level of the FveDRD1 gene in strawberries, comprising the expression cassette as described above, wherein the promoter is used to drive the overexpression of the FveDRD1 gene in strawberry cells or tissues.

[0010] The fourth objective of this invention is to provide a construct for reducing or eliminating FveDRD1 gene expression in strawberries, which is selected from any one of the FveDRD1-RNAi interference vector and the CRISPR / Cas9 knockout vector targeting the FveDRD1 gene.

[0011] Furthermore, the FveDRD1-RNAi interference vector contains a specific interference fragment targeting a non-conserved region of the FveDRD1 gene, and the specific interference fragment is inserted in the vector in both forward and reverse forms to form an inverted repeat hairpin structure. The sequence of the specific interference fragment is shown in SEQ ID NO:3.

[0012] Furthermore, the CRISPR / Cas9 knockout vector contains a nucleic acid sequence expressing an sgRNA targeting the FveDRD1 gene, wherein the target site of the sgRNA is located in the second exon region of the FveDRD1 gene, and the target sequence is shown in SEQ ID NO:4 and SEQ ID NO:5, respectively.

[0013] Preferably, the backbone of the FveDRD1-RNAi interference vector is the pK7WIWG2D vector, and the backbone of the CRISPR / Cas9 knockout vector is the PKSE401 vector carrying a GFP green fluorescent protein tag.

[0014] The fifth objective of this invention is to provide a host cell characterized by comprising any of the constructs described above.

[0015] The sixth objective of this invention is to provide the application of the constructs described above or the host cells described above in regulating sugar accumulation in strawberry fruits.

[0016] The present invention also provides a method for increasing the sugar content of strawberry fruit by introducing the construct described above for increasing the expression level of the FveDRD1 gene in strawberry into strawberry fruit or callus, thereby increasing the expression level of the FveDRD1 gene.

[0017] The present invention also provides a method for reducing the sugar content of strawberry fruit by introducing the FveDRD1-RNAi interference vector or CRISPR / Cas9 knockout vector as described above into the strawberry fruit to reduce or eliminate the expression level of the FveDRD1 gene.

[0018] The beneficial effects of this invention are as follows: 1) Using a mutant with significantly reduced fruit sugar content obtained through ethyl methanesulfonate (EMS) mutagenesis screening as material, the mutagenic gene was identified as FveDRD1, a key element of the RdDM pathway. The molecular mechanism of DNA methylation pathway regulating sugar content in strawberry fruit was explored, providing an important theoretical reference for the study of sugar metabolism regulation and quality improvement of strawberry fruit.

[0019] 2) Through mutant screening, transcriptome analysis, methylation sequencing and gene editing verification, it was confirmed for the first time that FveDRD1 positively regulates sugar accumulation in strawberry fruit by regulating the CHH methylation level of key genes in sugar metabolism, filling the technical gap in the regulation of strawberry sugar metabolism through the RdDM pathway and providing a new key gene target for strawberry quality improvement. Attached Figure Description

[0020] Figure 1 for rss Determination of mutant phenotype and soluble sugar content. In the figure, A represents the wild-type (WT) plant phenotype, and B represents... rss The mutant plant phenotype, C represents wild type (WT) and rss Comparison of fruit phenotypes at maturity of mutants, D represents wild type (WT) and... rss Determination of soluble sugar (sucrose, glucose, fructose) content in the mature fruit of mutants.

[0021] Figure 2 GO functional enrichment analysis of differentially expressed genes (DEGs) between wild-type and fvedrd1 mutants. The horizontal axis represents the number of enriched genes, and the vertical axis represents the name of the enriched pathway. The right side of the figure is marked with a color bar -log. 10 Indicates the significance level of enrichment ( P value), P The smaller the value, the more reddish the color. P The higher the value, the more bluish the color.

[0022] Figure 3 This is a heatmap showing the expression patterns of key differentially expressed genes in the glucose metabolism pathway. The numbers in the graph represent the transcriptional level of the corresponding gene in the current sample; the larger the number, the higher the gene transcriptional abundance. The colors reflect the relative expression level of the same gene in different columns of samples, with red indicating relatively high expression and blue indicating relatively low expression.

[0023] Figure 4The figures show the expression levels of DDR members and key genes in the drd1 mutant. Figure A compares the expression levels of core genes (FveDRD1, FveDMS3, FveRDM1) of the DDR complex in the wild type and the fvedrd1 mutant. Figure B compares the expression levels of key genes in glucose metabolism (FveNAC073, FveTST1, FveSUS1, FveCWINV1) after RNAi inhibition of FveDRD1.

[0024] Figure 5 This study analyzed the changes in CHH methylation levels of key genes in the sugar metabolism pathway. In the figure, A represents the methylation peak analysis of FveNAC073; B represents the methylation peak analysis of FveNTST13; C represents the methylation peak analysis of FveSUS1; and D represents the methylation peak analysis of FveCWINV1. The red boxes indicate regions with significantly reduced methylation levels, and WT-rep1 represents the DNA methylation level in wild-type fruits.

[0025] Figure 6 The phenotypes of strawberry fruits after treatment with DNA methylation inhibitors for different number of days.

[0026] Figure 7 This study compares the soluble sugar content of the control group, the DNA methylation inhibitor treatment group, and mature fruits.

[0027] Figure 8 The figure shows the expression levels of DDR members and key genes in fruits after Aza treatment. Figure A compares the expression levels of core genes (FveDRD1, FveDMS3, FveRDM1) of the DDR complex, and Figure B compares the expression levels of key genes (FveNAC073, FveTST1, FveSUS1, FveCWINV1) of sugar metabolism.

[0028] Figure 9 for FveDRD1 CR The creation of the material, A in the figure is the FveDRD1 gene structure diagram, showing two sgRNA sites and base sequences, with red text representing the PAM sites of the two sgRNAs, B is... FveDRD1 CR The mutation sites of L11 and L13 calluses are indicated by the numbers following the sequence, which represent the mutation rate of each allele across all clones.

[0029] Figure 10 The results show the determination of soluble sugar content in wild and positive callus tissues (L11, L13, L21).

[0030] Figure 11The figure shows the phenotype and soluble sugar accumulation of diploid strawberry 'Ruegen' after transient transformation with the FveDRD1 interference vector. Figure A shows the phenotype of strawberry fruit after different number of days of transformation, and Figure B shows the comparison of soluble sugar content of mature fruit in the control group and the treatment group.

[0031] Figure 12 To show the expression levels of DDR members and key genes after transient injection of 'Ruegen' fruit, Figure A compares the expression levels of core genes (FveDRD1, FveDMS3, FveRDM1) of the DDR complex, and Figure B compares the expression levels of key genes for sugar metabolism (FveNAC073, FveTST1, FveSUS1, FveCWINV1).

[0032] Figure 13 The figure shows the phenotype and soluble sugar accumulation of octoploid strawberry 'Hongyan' after transient transformation with the FveDRD1 interference vector. Figure A shows the phenotype of strawberry fruit after different number of days of transformation, and Figure B shows the comparison of soluble sugar content of mature fruit in the control group and the treatment group.

[0033] Figure 14 To show the expression levels of DDR members and key genes after instantaneous injection of 'Hongyan' fruit, Figure A compares the expression levels of the core genes (FveDRD1, FveDMS3, FveRDM1) of the DDR complex, and Figure B compares the expression levels of key genes for sugar metabolism (FveNAC073, FveTST1, FveSUS1, FveCWINV1).

[0034] All data are expressed as ± standard deviation. This means P is less than 0.5. This means P < 0.01. This means P < 0.001. This means P < 0.0001. Detailed Implementation

[0035] To facilitate understanding, the technical solution of the present invention will be explained in more detail below with reference to experiments.

[0036] Experiment 1 1. The mutant drd1 has reduced sugar accumulation in its fruit. Using diploid strawberry 'Ruegen' as material, wild-type seeds were treated with EMS chemical mutagenesis to construct a mutant library. M1 generation plants were obtained by direct sowing of EMS-treated seeds. After plant maturity, self-pollination was performed, and seeds were harvested and used to cultivate the M2 generation population. Large-scale phenotypic screening was conducted on the M2 population. Soluble sugar content in fruits from nearly 500 lines was measured at fruit maturity, and a mutant with significantly reduced sugar content was selected and named [Mule Name Missing]. rss (reduced soluble sugars) .

[0037] See Figure 1 Compared to the wild type, rss The fruits of the mutant plants were significantly smaller. Mature fruits of both wild-type and mutant plants, artificially pollinated and grown under the same conditions, were analyzed using high-performance liquid chromatography (HPLC) to quantify the soluble sugar content (Solarbio kit, sucrose: BC2465; glucose: BC2500; fructose: BC2495). The results showed that compared to the wild type, the glucose content in the mutant fruits decreased from 21 mg / g to 13.2 mg / g, and the fructose content decreased from 22.5 mg / g to 15.5 mg / g, with both accumulation levels significantly inhibited. More significantly, sucrose, a key carbon source for long-distance transport of photosynthetic assimilates and crucial for sink establishment, was drastically reduced in the mutants; the sucrose content in wild-type fruits was 1.8 mg / g, while in the mutants it was only 0.45 mg / g.

[0038] 2. Transcriptome sequencing analysis of the fvedrd1 mutant To elucidate the molecular mechanism of decreased sugar content in mutant fruits and identify key genes, transcriptome sequencing analysis was performed on wild-type and mutant fruit samples at maturity.

[0039] Using a fold change ≥2 and P < 0.05 as the screening threshold for differentially expressed genes (DEGs), a total of 4561 DEGs were identified. Among them, 2423 genes were significantly upregulated in mutants, and 2138 genes were significantly downregulated. Gene Ontology (GO) functional enrichment analysis was performed on the above 4561 DEGs; see [link to relevant documentation]. Figure 2 The results showed that differentially expressed genes were significantly enriched in key biological processes such as carbohydrate synthesis, sugar metabolism, and signal response.

[0040] More specifically, differentially expressed genes are mainly enriched in sugar metabolism signaling pathways such as sucrose, glucose and fructose. For example, genes that promote sugar accumulation, such as FveNAC073, FveMATE51 and FveTST1, have significantly decreased expression levels in mutants, while genes that inhibit sugar accumulation, such as FveSPS1, FveSUS1 and FveCWINV1, have significantly increased expression levels in mutants.

[0041] Based on the enrichment analysis results above, we further focused on the core genomes involved in transmembrane transport and metabolic regulation of sugars in fruits, and performed a heatmap analysis of transcriptomic data of key factors in sugar metabolism pathways. (See attached image.) Figure 3 The results showed that, fvedrd1 In the mature fruit of the mutant, sugar transport and metabolism genes showed a polarization. Upper cluster genes, which are highly expressed in the wild type, such as sucrose transporter FveSUT1, polyol / monosaccharide transporters FvePMT1 / FvePMT6 / FveSFP8, vacuole sugar transporter FveTST1, and transcription factor FveNAC073, were significantly downregulated in the mutant; while lower cluster genes, which are lowly expressed in the wild type, such as cell wall invertases... FveCWINV1 Sucrose synthase FveSUS1 / 7 and sucrose metabolism enzymes FveSPS1 / FveSPP1 / FveSPP2 The FveDRD1 deletion was significantly upregulated in the mutant. It is speculated that the deletion of FveDRD1 inhibited vacuolar sugar input while enhancing sucrose breakdown, ultimately leading to a significant decrease in fruit sugar content.

[0042] 3. Genomic pool resequencing to locate candidate mutagenic genes Mutant genes were cloned using pooled genome resequencing (BSA-seq). Twenty wild-type and 20 mutant strains were selected from the BC1F2 population to construct DNA pools for sequencing. Based on bioinformatics analysis of the sequencing data, following EMS mutagenesis principles, 17 candidate SNPs were initially screened. Among these, 11 had read mutation rates not exceeding 100%, including 3 synonymous mutations and 2 missense mutations. A mutation was found to be present only on the second exon of FvH4_2g09760, changing the base from C to T and altering the amino acid composition from glutamine to a stop codon, leading to premature translation termination. Alignment with the *Strombocys edulis* gene annotation file confirmed this gene as FveDRD1.

[0043] 4. The expression levels of key genes in the sugar metabolism pathway changed in mutant fruits. To clarify the impact of FveDRD1 mutations on the transcriptional levels of other members of the complex and glucose metabolism genes, in wild-type and... fvedrd1 In mature fruits of mutant strains, the core subunits of the DDR complex were detected by RT-qPCR. FveDRD1 , FveDMS3 and FveRDM1 The level of expression. See also Figure 4 In the A mutant, compared to the wild type, the expression levels of all three genes were significantly downregulated, among which... FveDRD1 and FveRDM1 The largest decrease was observed. FveDMS3 Secondly, it confirmed the existence of a synergistic regulatory mechanism among DDR complex members at the transcriptional level.

[0044] Furthermore, genes were selected from the differentially expressed genes. FveNAC073 , FveTST1 , FveSUS1 and FveCWINV1 These four genes, which showed significant differences in expression levels, were used for validation. See also... Figure 4 The results of qRT-PCR for B-cell protein PCR show that... FveNAC073 and FveTST1 Transcription level at drd1 The mutant fruit showed a significant downregulation. However, FveSUS1 and FveCWINV1 The transcriptional level of these genes was significantly upregulated in the mutant fruit, suggesting that the changes in these genes may directly or indirectly lead to... drd1 The soluble sugar content of the mutant fruit is reduced.

[0045] 5. Key genes in glucose metabolism are modified by CHH-type methylation. Based on the above experimental results, it can be seen that FveDRD1 deletion directly disrupts the expression patterns of genes in the sugar metabolism pathway of strawberry fruit. To explore its upstream epigenetic regulatory mechanisms and further analyze whether differentially expressed genes are directly regulated by DNA methylation, this study conducted a correlation analysis of CHH-type DNA methylation levels targeting the core DEGs of the sugar metabolism pathway.

[0046] See results Figure 5 . FveDRD1 The loss of [specific gene name] leads to a significant downregulation of CHH methylation levels in several key genes in the glucose metabolism pathway, with hypomethylation sites mainly concentrated in the promoter region and gene body edges (5' / 3'UTR). This is particularly relevant for rate-limiting glucose transporters. FveTST1 and transcription factors FveNAC073 Decreased methylation levels lead to suppressed expression levels; while for sugar metabolism enzyme genes... FveSUS1 and FveCWINV1 Low expression of methylation leads to transcriptional activation. These results indicate that... FveDRD1 By differentially regulating the methylation status of transport and metabolism genes, the sugar accumulation in forest strawberry fruits can be precisely controlled.

[0047] Experiment 2 DNA methylation inhibitor treatment reduces sucrose content in diploid strawberries To further clarify the effect of DNA methylation on the soluble sugar content of fruit, diploid 'Ruegen' strawberries in the green fruit stage were injected with 1 mM of the DNA methylation inhibitor 5-Azacytidine (5-Aza), and the strawberry fruits were sampled and analyzed 5-7 days after injection.

[0048] Figure 6Phenotypic results showed that 5-Aza treatment accelerated the coloring process of 'Ruegen' strawberries. On day 2 post-treatment, the 5-Aza group showed significant red pigment accumulation on the fruit surface, while the control group was still in the white-ripe to early color-changing stage. By day 4 post-treatment, the 5-Aza group had achieved near-complete coloring, entering the ripening stage approximately 1-2 days earlier than the control group. These results preliminarily indicate that DNA demethylation positively regulates the ripening and development process of strawberries.

[0049] Seven days after injection, the soluble sugar content of mature fruits in the control and treatment groups was quantitatively determined, and the results are shown in the figure. Figure 7 Analysis revealed that the 5-Aza treatment had a significant effect on all three sugars. The decrease in sucrose content was the most pronounced, while glucose content showed an increasing trend.

[0050] To further clarify the effects of 5-Aza treatment on the expression levels of key components of the RdDM pathway and genes related to glucose metabolism, qRT-PCR was performed on members of the DDR complex and genes related to glucose metabolism. The results are shown in [Figure number missing]. Figure 8 As can be seen, 1 mM 5-Aza treatment significantly inhibited the transcriptional levels of DDR complex members. Compared with the control group, FveDRD1 , FveDMS3 and FveRDM1 The relative expression levels of all of them decreased significantly. (Vacanthopeptide) FveTST1 and transcription factors FveNAC073 Significantly downregulated, while sucrose synthase FveSUS1 and cell wall invertase FveCWINV1 Then an upward adjustment occurs. This expression pattern is similar to... fvedrd1 The high degree of consistency among the genetic mutants indicates that DNA methylation is an epigenetic marker essential for maintaining normal sugar metabolism in strawberry fruit.

[0051] Experiment 3 The sugar content of forest strawberry FveDRD1-CRISPR / Cas9 callus tissue decreased. Using CRISPR / Cas9 gene editing technology, the FveDRD1 gene was targeted and edited using wild-type diploid strawberry 'Ruegen' as the recipient material, resulting in different types of edits. drd1Knockout lines were established. PKSE401 was used as the gene editing vector, carrying a GFP (green fluorescent protein) tag. Two specific sgRNA target sites were designed for the second exon region of the FveDRD1 gene: sgRNA1 sequence: TTAGATGACGGTGGTAAATATGG; sgRNA2 sequence: GCCTTCCTACTCTTTCCAGGAGG. Stable transformation was performed using callus tissue from diploid strawberry 'Ruegen' leaves. Positive materials were initially screened by green fluorescence. After subculture, plants with green fluorescent roots were obtained.

[0052] The genetic transformation of strawberry leaves is influenced by many factors, such as transformation conditions, the growth status of the material, genotype, and antibiotic type. Since the time required for strawberry leaf transformation from callus to seedling differentiation can be as long as a year, we first identified strawberry calluses with GFP fluorescence obtained in the early stages, and then analyzed the sugar content of successfully edited calluses.

[0053] Will FveDRD1-CRISPR The vector was stably transformed into strawberry via Agrobacterium-mediated transformation, yielding positive calluses L11, L13, and L21. Genomic DNA was extracted from the positive calluses, and specific PCR amplification was performed on the sgRNA-targeted editing region. The amplification products were ligated into the T vector and sequenced for identification. Based on the sequencing results, the presence of base insertions, deletions, or substitutions was statistically analyzed. Figure 9 As shown: In L11, sgRNA1 undergoes two different editing scenarios: allele1 has a 1-base deletion, and allele2 has a 4-base deletion. Both of these editing scenarios result in protein frameshifting and loss of function. sgRNA2 also exhibits two different editing scenarios: allele1 is not edited, allele2 has a 1-base deletion, and allele3 contains a base substitution. In L13, sgRNA1 undergoes two different editing scenarios: allele1 has a 1-base deletion, and allele2 has a 4-base deletion. gRNA2 also exhibits two different editing scenarios: allele1 has a 1-base deletion, and allele2 contains a base substitution. In L21, sgRNA1 is not edited, while sgRNA2 exhibits two different editing scenarios: allele1 is not edited, allele2 has a 1-base deletion, and allele3 contains a base substitution.

[0054] The sugar content of successfully edited callus was determined. See also Figure 10 ,exist FveDRD1-CRISPR In successfully edited callus, the content of soluble sugars such as fructose, glucose, and sucrose was significantly lower than that in unedited callus. This data is consistent with... fvedrd1 The phenotype of reduced sugar content in the mutant fruit is highly consistent. The observation of a consistent low-sugar phenotype at the callus level strongly supports this finding. FveDRD1 The RdDM-mediated pathway is a fundamental regulator for maintaining sugar homeostasis in forest strawberry cells.

[0055] Experiment 4 Transient conversion of the FveDRD1 interferometer reduces sugar content in strawberry fruit Build FveDRD1 Interference vector (FveDRD1-RNAi): A non-conserved sequence of approximately 300 bp from the FveDRD1 gene was selected as the interference fragment. The target fragment was amplified and recovered using specific primers. The cloned target gene fragment was ligated into the intermediate PENTR1A vector. After transformation into competent cells, single colonies were selected for sequencing, and positive plasmids with correct sequences were screened. Using Gateway LR recombination, the target fragment was directionally recombinated into the plant binary RNAi vector pK7WIWG2D. The recombination product was transformed, plated, and screened for single colonies. Positive clones were identified by both PCR and sequencing. The criterion for successful vector construction was that the complete target interference fragment could be detected at both insertion sites during sequencing.

[0056] 1. Transient conversion reduces sugar content in diploid strawberry fruit Will FveDRD1 Interference vectors were used to transiently transform 'Ruegen' fruit during the green fruit stage. After 5-7 days, the difference in soluble sugar content in mature fruit of the experimental group (injected with FveDRD1-RNAi bacterial solution) and the control group (injected with blank buffer) was measured.

[0057] like Figure 11 As shown in the figure, A is the phenotype of injection 0-7 days after injection, and B shows the inhibition. FveDRD1 The expression significantly reduced the content of sucrose, fructose, and glucose in the fruit, with all three levels decreasing significantly compared to the control group.

[0058] Figure 12 The RT-qPCR test results shown in Figure A indicate that... FveDRD1 Transcriptional levels were significantly reduced in the interference lines, and the other two core subunits of the DDR complex were also significantly reduced. FveDMS3 and FveRDM1 It also showed synchronous downregulation. This result indicates that there is a tight synergistic regulatory mechanism among the members of the DDR complex at the transcriptional level, thereby ensuring the execution of the overall function of the complex.

[0059] For an analysis of the expression levels of key genes in the glucose metabolism pathway, see [link to relevant documentation]. Figure 12 B, discovered FveTST1 and FveNAC073 Expression levels were significantly downregulated in the interference lines. In contrast, FveSUS1 and FveCWINV1 Significant upregulation was observed in the interference lines. In conclusion, the FveDRD1-mediated regulatory pathway can regulate sugar accumulation in strawberry fruits.

[0060] 2. Transient conversion reduces sugar content in octoploid strawberry fruit. Sequence alignment analysis showed that diploid forest strawberry and octoploid cultivated strawberry... FaDRD1 The coding sequence showed a homology of up to 99%, suggesting that its function is very likely to remain conserved in a polyploid context.

[0061] To verify FveDRD1 To further investigate the conservation of function in octoploid strawberries, transient transformation experiments were conducted. Specifically, the FveDRD1-RNAi interference vector was used to transiently transform the green-fruit stage fruits of the octoploid strawberry variety 'Hongyan'.

[0062] See results Figure 13 It can be seen that, 9 days after injection, compared with the control group, FveDRD1 The contents of glucose, sucrose, and fructose in RNAi fruits all decreased significantly.

[0063] The results of the RT-qPCR analysis are shown below. Figure 14 Within the octoploid 'Red Beauty' fruit, as... FveDRD1 Downregulation of its complex members FveTST1 as well as FveNAC073 The expression level also showed a significant decrease. Conversely, FveSUS1 and FveCWINV1 It exhibits strong expression in the interfering fruit.

[0064] The above results indicate that interference in octoploids... FveDRD1 The expression of this gene also reduces the soluble sugar content in the fruit and alters the expression levels of key genes in the sugar metabolism pathway, which is consistent with the results of transient conversion in diploids.

[0065] In summary, this application experimentally demonstrates that the RdDM pathway element... FveDRD1 Loss of function leads to a significant decrease in the degree of CHH methylation across the entire genome, downregulation of DNA methylation levels in multiple genes related to sugar metabolism pathways, which in turn affects their transcription levels and ultimately inhibits sugar accumulation in strawberry fruits. FveDRD1 It is expected to be developed into a key gene for regulating the sweetness of strawberry fruits or for breeding new varieties of high-sweet strawberries.

[0066] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Application of the FveDRD1 gene in positive regulation of sugar accumulation in strawberry fruit, wherein the sequence of the FveDRD1 gene is shown in SEQ ID NO:1 and the amino acid sequence it encodes is shown in SEQ ID NO:

2.

2. The application as described in claim 1, characterized in that, The sugars include any one or more of sucrose, glucose, and fructose.

3. The application as described in claim 2, characterized in that, By inhibiting the expression of the FveDRD1 gene, sugar accumulation in strawberry fruit is reduced; by increasing the expression of the FveDRD1 gene, sugar accumulation in strawberry fruit is promoted.

4. An expression box, characterized in that, It includes the FveDRD1 gene, and a promoter, terminator and / or regulatory element operatively linked to the FveDRD1 gene, the sequence of which is shown in SEQ ID NO:

1.

5. A construct for increasing the expression level of the FveDRD1 gene in strawberry, characterized in that, It includes the expression cassette as described in claim 4, and the promoter is used to drive the overexpression of the FveDRD1 gene in strawberry cells or tissues.

6. A construct for reducing or eliminating FveDRD1 gene expression in strawberry, characterized in that, For FveDRD1-RNAi interference vectors or CRISPR / Cas9 knockout vectors targeting the FveDRD1 gene; The FveDRD1-RNAi interference vector contains a specific interference fragment targeting a non-conserved region of the FveDRD1 gene, and the specific interference fragment is inserted in the vector in both forward and reverse forms to form an inverted repeat hairpin structure. The sequence of the specific interference fragment is shown in SEQ ID NO:

3. The CRISPR / Cas9 knockout vector contains a nucleic acid sequence expressing an sgRNA targeting the FveDRD1 gene. The target site of the sgRNA is located in the second exon region of the FveDRD1 gene, and the target sequence is shown in SEQ ID NO:4 and SEQ ID NO:5, respectively.

7. The construct as claimed in claim 6, characterized in that, The backbone of the FveDRD1-RNAi interference vector is the pK7WIWG2D vector, and the backbone of the CRISPR / Cas9 knockout vector is the PKSE401 vector carrying a GFP green fluorescent protein tag.

8. A host cell, characterized in that, It includes the construct as described in claim 5 or the construct as described in claim 6.

9. The use of a construct as described in claim 5, 6, or 7, or a host cell as described in claim 8, in regulating sugar accumulation in strawberry fruit.

10. A method for reducing the sugar content of strawberry fruit, characterized in that, The expression level of the FveDRD1 gene was reduced or eliminated by introducing the FveDRD1-RNAi interference vector or CRISPR / Cas9 knockout vector as described in claim 6 or 7 into strawberry fruits.