Raapfago primer combination for identifying gender of yushan gecko and application thereof

Abstract

The present application relates to a RAA- Pf Ago primer combination and its application, relate to the technical field of molecular biology and animal sex identification. Based on the RAA- Pf The sex identification method of the Yau Shan crocodile based on the Ago primer combination can extract DNA through non-invasive sampling (oral swab), rapidly, sensitively and specifically identify the sex of the Yau Shan crocodile under constant temperature conditions, and is not dependent on the experience of breeders, and is suitable for laboratory and field detection.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and animal sex determination technology, and specifically to the RAA- method for determining the sex of the Yaoshan Crocodile Lizard. Pf Ago primer combinations and their applications. Background Technology

[0002] Yaoshan Crocodile Lizard ( Shinisaurus crocodilurus The Yaoshan crocodile lizard is a unique species belonging to its own family, genus, and clan. It is listed as a Class I National Key Protected Wild Animal in China and is included in the IUCN Red List of Threatened Species. Currently, the wild population of the Yaoshan crocodile lizard is scarce. Conservation efforts involve both artificial breeding and reintroduction into the wild, with sex identification being a crucial step in population management and breeding pairing.

[0003] However, juvenile Yaoshan crocodile lizards lack obvious secondary sexual characteristics, and traditional sex determination methods rely on adult morphological differences (e.g., adult males have a bright red or light blue ventral surface on their head and thorax, while females have a light yellow or pale red surface; adult males have significantly larger heads than adult females), making accurate identification of juveniles impossible. Existing technologies have reported the use of PCR methods for sex determination in crocodile lizards, for example, using female-specific primers to amplify the lizard and observe a specific band at 557 bp to identify females. However, PCR methods rely on sophisticated thermal cycling equipment, are complex and time-consuming, require specialized laboratory conditions, are unsuitable for rapid field testing, and lack internal controls.

[0004] In recent years, recombinase-mediated isothermal amplification (RAA) has emerged as an isothermal amplification technique that can complete amplification in 20 to 30 minutes at 37–42°C without the need for complex thermal cycling equipment. Pf Ago proteins are a class of programmable endonucleases found in prokaryotes. They can directionally cleave target sequences guided by 5'-phosphorylated DNA, recognizing single-stranded or double-stranded DNA without requiring a PAM sequence. The application of RAA technology with... Pf Ago protein binding (RAA-) Pf RAA (Rapid Aspect Ratio) has been initially applied to sex determination in birds such as flamingos. However, it has not yet been seen to be used for sex determination in birds such as flamingos. Pf Reports indicate that Ago technology has been applied to sex determination in reptiles, particularly the Yaoshan Crocodile Lizard. Summary of the Invention

[0005] To address the above problems, this invention provides a RAA- for identifying the sex of the Yaoshan Crocodile Lizard. Pf Ago primer combination, with this RAA- PfThe Ago primer combination-based sex determination method for Yaoshan crocodile lizards can rapidly, sensitively, and specifically identify the sex of Yaoshan crocodile lizards by extracting DNA through non-invasive sampling (oral swabs) under isothermal conditions, without relying on the experience of breeders, and is suitable for laboratory and field testing.

[0006] This invention provides a RAA- for identifying the sex of the Yaoshan Crocodile Lizard. Pf Ago primer sets, including amplification primer pairs and gDNA; The amplification primer pair includes: Upstream primer RAA-F2: CCCAAAGCGAAACTATCCTGAGGGAATGAA (SEQ ID NO:1), downstream primer RAA-R2: TGCCTGGAGGCAGATCCGGAAGAAGGCACG (SEQ ID NO:2); The gDNA corresponding to Pf The Ago cleavage target sequence is located in the amplification product of samples from female individuals. The gDNA corresponding to Pf The Ago cleavage target sequence is: CTTCGAGGGAGAATGATGCCAATGGCCT (SEQ ID NO: 13).

[0007] In one embodiment, the gDNA is TCCCTCGAAGTGAATG (SEQ ID NO:6).

[0008] Many non-model organisms have poorly differentiated sex chromosomes, making it difficult to identify sex-linked DNA sequences. Gene sequence differences can be very small, increasing the difficulty of discovering stable genetic markers. The sex determination mechanism of the Yaoshan crocodile lizard is not yet fully understood, lacking universal sex-linked molecular markers like the CHD gene in birds. Furthermore, finding sex-specific sequences in reptiles is difficult; the crocodile lizard does not have sex chromosomes. The inventors discovered this male-female difference in the sex-determining region of the crocodile lizard's autosomes. Therefore, the technical challenge of this case lies in discovering and validating sequences applicable to RAA- PfThe Ago system, with its female-specific targets, overcomes the inherent difficulty of "discovering stable genetic markers" in reptile sex identification. Reptile sex chromosome differentiation is typically subtle, making the search for stable sex-specific DNA sequences extremely difficult. Furthermore, reptilian genomes often contain numerous repetitive sequences (such as transposons and microsatellites) and exhibit significant genome size variation, leading to non-specific amplification during RAA amplification (primer binding to non-target repetitive sequences), requiring more refined primer design to avoid false positives. The low degree of differentiation in reptile W / Z chromosomes (or X / Y chromosomes) and the limited and potentially short sequence difference regions between males and females further complicate the search for specific targets. This invention, through direct sequencing and alignment, identified two sequences unique to females, while males possess only one. Based on these sequence differences, the inventors designed multiple sets of RAA primers and... Pf Ago's guide DNA (gDNA) was selected and screened. The RAA primer (F2R2) stably amplified the target fragment in both males and females, providing sufficient substrate for subsequent cleavage. The gDNA (g7) specifically recognized and guided the cleavage of female-specific DNA sequences, while being ineffective in males, ensuring specificity for sex differentiation. Based on this, a RAA primer suitable for sex identification in the Yaoshan Crocodile Lizard was constructed. Pf The aforementioned exploration process using Ago primer combinations requires extensive basic research on this species. Therefore, the technical achievement of this invention in overcoming the inherent difficulty of "discovering stable genetic markers" in reptile sex determination is highly innovative and represents a significant advancement in RAA- Pf Ago technology faces challenges that it has never encountered and does not need to address in sex determination in other species, such as birds.

[0009] The present invention also provides the RAA- Pf Application of Ago primer combinations in the preparation of a kit for sex identification of the Yaoshan alligator lizard.

[0010] This invention also provides a system for sex identification of the Yaoshan crocodile lizard, including the aforementioned RAA- Pf Ago primer combinations.

[0011] In one embodiment, the sex identification system further includes an internal control system, which includes an internal control gDNA. The internal reference gDNA corresponds to Pf The Ago cleavage target sequence is located in the samples from female individuals and the amplification products from male individuals, and the internal reference gDNA corresponds to... Pf The Ago cleavage target sequence is: GTTGTTGCGTAAGAAGAACTGCAGAGCTCGTCCCATTCACTTCGAGGGAGA (SEQ ID NO:21).

[0012] In one embodiment, the internal reference gDNA is GCTCTGCAGTTCTTCT (SEQ ID NO:14).

[0013] In one embodiment, the internal control system further includes an internal control probe having the sequence 5'-TCGAAGTGAATGGGACGAGCTCTGCAGT-3' (SEQ ID NO:26).

[0014] To ensure reliable results, an internal control gDNA (ig7) was designed, targeting a conserved sequence shared by both sexes. If the internal control shows a normal cleavage signal, the experimental system is considered effective, thus effectively avoiding false negatives.

[0015] The present invention also provides a kit for sex identification of the Yaoshan alligator lizard, comprising the aforementioned system.

[0016] In one embodiment, the kit includes the aforementioned system, Pf Ago protein, RAA amplification reaction buffer Pf Ago cleavage reaction buffer.

[0017] This invention also provides a method for sex determination of the Yaoshan crocodile lizard, comprising the following steps: collecting a sample, extracting genomic DNA, and using the genomic DNA as a template, employing the RAA- Pf The amplification primer pairs in the Ago primer set are subjected to RAA isothermal amplification to obtain amplification products. The amplification products are then... Pf Ago protein, the RAA- Pf The gDNA in the Ago primer combination is mixed and subjected to a cleavage reaction to obtain the cleavage reaction product. The sex is then determined based on the cleavage reaction product.

[0018] In one embodiment, the RAA isothermal amplification is performed at a temperature of 37-45°C for 5-30 minutes.

[0019] In one embodiment, the sex identification method further includes an internal control step, which includes: using internal control gDNA in the system to perform a cleavage reaction on the amplification product.

[0020] Understandably, if the aforementioned intrinsic parameter cut signal is normal, it indicates that RAA- Pf Ago primer combinations and sex determination methods are effective.

[0021] Compared with the prior art, the present invention has the following beneficial effects: The RAA- of the present invention for sex identification of Yaoshan Crocodile Lizard PfAgo primer combinations and their applications, using the RAA- Pf The Ago primer combination-based sex determination method for Yaoshan crocodile lizards can rapidly, sensitively, and specifically identify the sex of Yaoshan crocodile lizards by extracting DNA through non-invasive sampling (oral swabs) under isothermal conditions, without relying on the experience of breeders, and is suitable for laboratory and field testing.

[0022] The beneficial effects of this invention are as follows: 1. Isothermal amplification, simple equipment: This invention uses RAA isothermal amplification technology, which can complete amplification under isothermal conditions of 37-42℃, without the need for precision thermal cycling equipment such as PCR instruments, and is suitable for grassroots units with scarce resources and field testing.

[0023] 2. Rapid and efficient detection: The entire detection process (excluding DNA extraction) can be completed within 30 to 60 minutes, which is much faster than the traditional PCR method.

[0024] 3. High sensitivity: Sensitivity tests have verified that the detection method of this invention can reach 0.1 ng of genomic DNA, which can meet the detection needs of trace samples.

[0025] 4. High specificity: The gDNA obtained by screening in this invention can specifically recognize female amplification products. Female samples show obvious cleavage signals, while male samples do not show cleavage signals, and the two are significantly different.

[0026] 5. Non-invasive sampling, animal-friendly: Samples are collected using oral swabs, which does not damage the Yaoshan crocodile lizard and is especially suitable for sex identification of rare and endangered animals.

[0027] 6. Internal control quality control, reliable results: This invention designs an internal control system that can effectively monitor the effectiveness of the experimental system and avoid false negative results.

[0028] 7. Intuitive result interpretation: The sex can be intuitively determined by fluorescence signals or electrophoresis bands, without relying on experience. Attached Figure Description

[0029] Figure 1 Electrophoresis results of RAA amplification primer pair for male and female Yaoshan crocodile lizard DNA amplification, showing that both males and females can amplify bands; Figure 2 Electrophoresis diagram of the amplification results of DNA from two male Yaoshan crocodile lizards using PCR primers; Figure 3 The experimental results for optimizing the RAA amplification reaction temperature (A) and time (B) are shown in the figure, indicating that 43℃ and 15 min are the optimal conditions; Figure 4The image shows the cutting effect of g1-g7 on the amplification products of male and female Yaoshan crocodile lizards, indicating that females can be cut but males cannot. Figure 5 The image shows the verification results of the specificity of the cutting of male and female Yaoshan crocodile lizards in G7. The female has significant brightness, while the male has no brightness. Figure 6 The graph shows the sensitivity test results of the sex determination method, with a sensitivity of 0.1 ng. Figure 7 The image shows the cutting effect of internal control gDNA (ig1-ig7) on male and female Yaoshan crocodile lizards; Figure 8 The graph shows the results of the specificity verification of the internal reference system. Figure 9 The graph shows the sensitivity test results of the internal reference system; Figure 10 The results of sex determination using the sex determination method on 10 Yaoshan Crocodile Lizards of unknown sex showed a 100% consistency rate with the results of cloacal examination. Detailed Implementation

[0030] To facilitate understanding of the present invention, a more complete description will be given below with reference to the accompanying drawings. Preferred embodiments of the invention are shown in the drawings. However, the invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the invention.

[0031] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0032] Unless otherwise specified, all reagents, materials, and equipment used in this embodiment are commercially available; unless otherwise specified, all test methods are conventional test methods in this field.

[0033] Example 1: Discovery and Primer Design of Female-Specific Sequences in Yaoshan Crocodile Lizard 1.1 Genomic DNA Extraction Oral swab samples were collected from the Yaoshan crocodile lizard, and DNA was extracted using a genomic DNA extraction kit. The DNA concentration and purity were then measured using a spectrophotometer before use.

[0034] 1.2 Discovery of female-specific sequences Primers designed based on the complete genome sequence of the Yaoshan crocodile lizard: ex309F: CAACCCCAAAGCGAAACTAT (SEQ ID NO:31); ex309R: AGATGTACCACCGGGAGGAT (SEQ ID NO:32) DNA was amplified from female Yaoshan crocodile lizards (the amplification system used was a commercially available product from Hangzhou Zhongce Biotechnology Co., Ltd., catalog number S001ZC). Sequencing revealed two sequences: Female Sequence 1: CAGAGCTCGTCCCATTCACTTCGAGGGAGAATTATGCCCGTCGATTTGGAAGCCCCATTGATGCCAATGGCCTGCGCTTCCAAGCAGAGCGTGCCTTCTTCCGGATCTGCCTCCAGGCAGCCGCTTCTGCTCCGCCGCAAAGGAAAGGGGGAGAAAGGCTAGAGAAACAAATGCCCTGCCCAGATGACATCCTCCCGGTGGTACATCTCTC (SEQ ID NO: 22) Female sequence 2: CAGAGCTCGTCCCATTCACTTCGAGGGAGAATGATGCCAATGGCCTGCGCTTCCAAGCAGAGCGTGCCTTCTTCCGGATCTGCCTCCAGGCAGCCGCTTCTGCTCCGCCGCAAAGGAAAGGGGGAGAAAGGCTAGAGAAACAAATGCCCTGCCCAGATGACATCCTCCCGGTGGTACATCTCTC (SEQ ID NO: 23) However, when the DNA of the male Yaoshan crocodile lizard was amplified using the same primers, only one sequence was obtained: CAGAGCTCGTCCCATTCACTTCGAGGGAGAATTATGCCCGTCGATTTGGAAGCCCCATTGATGCCAATGGCCTGCGCTTCCAAGCAGAGCGTGCCTTCTTCCGGATCTGCCTCCAGGCAGCCGCTTCTGCTCCGCCGCAAAGGAAAGGGGGAGAAAGGCTAGAGAAACAAATGCCCTGCCCAGATGACATCCTCCCGGTGGTACATCTCTC (SEQ ID NO: 24) Further forward and backward amplification confirmed that the female Yaoshan crocodile lizard's DNA contained two sequences, while the male contained only one sequence.

[0035] 1.3 Design and screening of amplification primers 1.3.1 Based on the above differences in male and female sequences, four pairs of RAA primers were designed: - RAA-F1 / RAA-R1 (F1R1): RAA-F1:ACCCCAAAGCGAAACTATCCTGAGGGAATG (SEQ ID NO:3) RAA-R1: GGGAGGATGTCATCTGGGCAGGGCATTTGT (SEQ ID NO: 4) - RAA-F2 / RAA-R2 (F2R2): RAA-F2:CCCAAAGCGAAACTATCCTGAGGGAATGAA (SEQ ID NO:1) RAA-R2: TGCCTGGAGGCAGATCCGGAAGAAGGCACG (SEQ ID NO: 2) - RAA-F3 / RAA-R1 (F3R3) RAA-F3: CACCCCAAAGCGAAACTATCCTGAGGGAA (SEQ ID NO: 5) RAA-R1: GGGAGGATGTCATCTGGGCAGGGCATTTGT (SEQ ID NO: 4) - RAA-F4 / RAA-R1 (F4R4) RAA-F4: CACCCCAAAGCGAAACTATCCTGAGGGAA (SEQ ID NO: 27) RAA-R1: GGGAGGATGTCATCTGGGCAGGGCATTTGT (SEQ ID NO: 4) RAA amplification reaction buffer: A standard RAA amplification reaction buffer can be used. In this example, a commercially available product was used, purchased from Hangzhou Zhongce Biotechnology Co., Ltd.

[0036]

[0037] The RAA amplification reaction procedure was as follows: using the genomic DNA of the Yaoshan crocodile lizard as a template, the RAA reaction was carried out at 43℃ for 15 min.

[0038] The results are as follows Figure 1 As shown in the figure, RAA amplification experiments verified that RAA-F2 / RAA-R2 (F2R2) showed the best results, the highest amplification efficiency, and the fewest nonspecific bands. Both females and males could amplify bands, making it suitable for subsequent amplification. Pf Ago cuts the substrate.

[0039] 1.3.2 Design amplification primers based on PCR technology.

[0040] The target sequence for PCR amplification is: ATTCACTTCGAGGGAGAATGATGCCAATGGCCTGCGCTTCCAAGCAGAGCGTGCCTTCTTCCGGATCTGCCTCCAGGCAGCCGCTTCTGCTCCGCCGCAAAGGAAAGGGGGAGAAAGGCTAGAGAAACAAATGCCCTGCCCAGATGACATCCTCCCGGTGGTACATCTCTCTTGTCTGGCATCCTTGCGTGATAACTATGGGACAGATTACTATGAGATAGAATCAA ACGGCGGATCTGTTCCTGAGCATTACATCGATGCTGTGAACCGTAATGTCCTTTTATATTTAAATTCCCTCCATCTGCTTTATTGATTCCTCTCTGCTGCAGCGGAGCCAGAATCGGGGAAATACAAGGAAGGCCCGTCTGTATTATTCATTCTGGGGCATTATTATTAAAACCCGGCGGGCGCAAGGGAGGAGTGTTGGGGGGGGGGGTCTTAATATTACTCCAAA ATGTTCCAACGAAGCTTCAGCTGGTCCCAATCAGGTCCCGATAGATCCTCTAAATCCGGCATGATTGTTCCTTTTGAAATATGTCAATGCGATTACCGATGC (SEQ ID NO: 28) The PCR amplification primer pair is as follows: exW-F1: 5'-ATTCACTTCGAGGGAGAATGA-3' (SEQ ID NO: 29) exW-R1: 5'-GCATCGGTAATCGCATTGACA-3' (SEQ ID NO: 30) PCR amplification reaction system: 12.5 μL of 2×Taq PCR Mix, 1.0 μL of DNA template. The amount of template used can be adjusted according to the concentration of DNA. 0.5 μL each of the forward and reverse primers with a concentration of 10 μmol / L, and bring the total volume to 25 μL with sterile deionized water. PCR amplification reaction program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 57-63℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ final extension for 8 min.

[0041] The sex of the Yaoshan crocodile lizard was determined using the above-mentioned PCR amplification primer pairs, reaction system, and reaction procedure. The operation steps are as follows: Genomic DNA was extracted from the Yaoshan crocodile lizard to be tested, and then amplified using the above-mentioned PCR amplification primer pairs. After detection by agarose gel electrophoresis, if a specific band is found at 557 bp, it indicates that the sample corresponds to a female Yaoshan crocodile lizard; if no band is found, it is a male Yaoshan crocodile lizard.

[0042] The results are as follows Figure 2 As shown, both samples from male Yaoshan crocodile lizards exhibited banding.

[0043] Example 2: Optimization of RAA amplification temperature and time To further improve amplification efficiency, this embodiment systematically optimized the RAA reaction conditions for the optimal primer pairs (SEQ ID NO: 1 and 2).

[0044] Temperature optimization: Using known female Yaoshan alligator lizard genomic DNA as a template, RAA reactions were performed at 37℃, 39℃, 41℃, 43℃, and 45℃ for 30 min, respectively. The amplified products were detected by 1.5% agarose gel electrophoresis. The results showed ( Figure 3 (As shown in the right figure), the brightness of the amplified band gradually increases with increasing temperature, reaching its maximum brightness at 43℃ with no nonspecific bands; the band weakens significantly at 45℃, indicating that excessively high temperatures inhibit recombinase activity. Therefore, the optimal reaction temperature is 43℃.

[0045] Time optimization: Reactions were performed at 43℃ for 0, 5, 10, 15, 20, 25, and 30 min, respectively. Electrophoresis results ( Figure 3 The left image shows that specific bands can be observed after 5 minutes, and the band brightness reaches a plateau at 15 minutes, with no significant increase after further extending the reaction time. Therefore, the optimal reaction time is 15 minutes.

[0046] Based on the above, the optimal RAA reaction conditions were determined to be a constant temperature reaction at 43℃ for 15 min, and all subsequent experiments used these conditions.

[0047] Example 3 Female specificity Pf Ago gDNA screening 2.1 gDNA Design Within the F2R2 amplification region, 7 potential lines were designed. PfAgo guide DNA (g1-g7) targets the differentially expressed region CTTCGAGGGAGAATGATGCCAATGGCCT (SEQ ID NO:13) in a female-specific sequence, as shown in SEQ ID NO:7-12 and SEQ ID NO:6.

[0048] - g1: TTGGCATCATTCTCCC (SEQ ID NO:7) - g2: GGCATCATTCTCCCTC (SEQ ID NO:8) - g3:CATCATTCTCCCTCGA (SEQ ID NO:9) - g4: TCATTCTCCCTCGAAG (SEQ ID NO:10) - g5: ATTCTCCCTCGAAGTG (SEQ ID NO:11) - g6:TCTCCCTCGAAGTGAA (SEQ ID NO:12) - g7: TCCCTCGAAGTGAATG (SEQ ID NO: 6) corresponding Pf The Ago probe is: FAM-AGGCCATTGGCATCATTCTCCCTCGAAG-BHQ1 (SEQ ID NO:25).

[0049] 2.2 Screening of gDNA RAA amplification products and Pf Ago protein and each gDNA were mixed separately and cleaved (95℃, 30min). Pf Ago cleavage reaction buffer (10x): 200 mM HEPES (pH 7.5), 2.5 M NaCl, 5 mM MnCl2; mix thoroughly, dispense into 1 mL portions, heat at -20°C, and store for later use.

[0050]

[0051] The results are as follows Figure 4 As shown, g1, g6, and g7 exhibit significant cleavage activity against female amplification products, but none of them cleave male amplification products. Among them, g7 (SEQ ID NO:6) showed the best effect and was therefore selected as the preferred gDNA.

[0052] Example 4 Specificity Verification The preferred g7 was used to conduct a sex-specificity verification experiment.

[0053] DNA samples were taken from three known female and three known male Yaoshan crocodile lizards and tested separately.

[0054] The results are as follows Figure 5 As shown, all female samples exhibited strong fluorescent cutting signals (green fluorescence visible under blue light), while all male samples showed no cutting signals. The signal intensity between the two groups was extremely significant (P<0.001), indicating that the method of the present invention has good sex specificity.

[0055] Example 5 Sensitivity Test The genomic DNA of female Yaoshan alligator lizards was serially diluted 10-fold (10 ng, 1 ng, 0.1 ng, 0.01 ng, 0.001 ng, 0.0001 ng) and used as a template. The sample was then incubated according to the method of this invention (RAA 43℃ 15 min +). Pf The test was performed at 95℃ for 30 minutes.

[0056] The results are as follows Figure 6 As shown, when the template amount is ≥0.1 ng, a significant positive fluorescent signal can be detected; when the template amount is less than 0.1 ng, the signal is no different from that of the negative control. Therefore, the detection sensitivity of the method of the present invention can reach 0.1 ng of genomic DNA.

[0057] Example 6: Establishment of the Internal Reference System 5.1 Design and Screening of Internal Reference gDNA Internal control gDNA (ig1-ig7) was designed within the F2R2 amplification region to target the conserved region GTTTTGCGTAAGAAGAACTGCAGAGCTCGTCCCATTCACTTCGAGGGAGA (SEQ ID NO:21) shared by both sexes.

[0058] The internal control probe is: FAM-TCGAAGTGAATGGGACGAGCTCTGCAGT-BHQ1 (SEQ ID NO:26) The seven internal reference gDNAs designed are: - ig1:TGAATGGGACGAGCTC (SEQ ID NO:15) - ig2:AATGGGACGAGCTCTG (SEQ ID NO:16) - ig3: TGGGACGAGCTCTGCA (SEQ ID NO:17) - ig4:GGACGAGCTCTGCAGT (SEQ ID NO:18) - ig5:ACGAGCTCTGCAGTTC (SEQ ID NO:19) - ig6:GAGCTCTGCAGTTCTT (SEQ ID NO:20) - ig7:GCTCTGCAGTTCTTCT (SEQ ID NO:14) Samples from female and male Yaoshan crocodile lizards of known sex were tested, and the results are as follows: Figure 7 As shown, after screening, ig6 and ig7 both showed good cleavage activity on both male and female samples, with ig7 (SEQ ID NO:14) showing the best effect.

[0059] 5.2 Validation of the internal reference system A batch of samples of known-sex female and male Yaoshan crocodile lizards (3 females and 3 males) were tested, and the specificity verification results are as follows: Figure 8 As shown, both male and female samples exhibited significant fluorescence signals in the internal control detection, showing a significant difference from the negative control.

[0060] The genomic DNA of female Yaoshan alligator lizards was serially diluted 10-fold (10 ng, 1 ng, 0.1 ng, 0.01 ng, 0.001 ng, 0.0001 ng) and used as a template. Detection was performed according to the method described above. The sensitivity test results are as follows: Figure 9 As shown, the sensitivity of the internal reference system can also reach 0.1 ng, consistent with the gender detection system.

[0061] Example 8 1. Based on the experimental results of the above embodiments, a method for sex identification of the Yaoshan Crocodile Lizard is constructed, including the following steps: (1) Sample collection: Oral epithelial cell samples were collected from the Yaoshan crocodile lizard using oral swabs; (2) DNA extraction: Genomic DNA was extracted from oral swabs; (3) RAA isothermal amplification: Using the extracted genomic DNA as a template, RAA isothermal amplification was performed using the primer pairs shown in SEQ ID NO:1 and SEQ ID NO:2; (4) Pf Ago cleavage reaction: The amplification product is then combined with... Pf Ago protein and gDNA shown in SEQ ID NO:6 were mixed and subjected to a cleavage reaction at a temperature of 95°C for 30 min. (5) Result detection: Detect the cleavage reaction product. If a cleavage signal is present, it is determined to be female; if no cleavage signal is present, it is determined to be male.

[0062] The reaction temperature for RAA amplification in step (3) is 37-42℃ and the reaction time is 20-30 minutes. In this embodiment, the reaction temperature is 43℃ ​​and the reaction time is 15 minutes.

[0063] Optionally, the sex determination method further includes an internal control step: using the internal control gDNA shown in SEQ ID NO:14. Pf If the Ago cleavage reaction shows a normal cleavage signal from the internal control, the experimental system is effective.

[0064] 2. This invention also provides a kit for identifying the sex of the Yaoshan Crocodile Lizard, comprising: (1) RAA amplification primer pair, the sequences of which are shown in SEQ ID NO:1 and SEQ ID NO:2; (2) Pf Ago protein; (3) Sex-specific gDNA, the sequence of which is shown in SEQ ID NO:6; (4) Optionally, an internal reference gDNA, the sequence of which is shown in SEQ ID NO:14; (5) RAA amplification reaction buffer (A standard RAA amplification reaction buffer can be used. In this example, a commercially available product was used, purchased from Hangzhou Zhongce Biotechnology Co., Ltd.). (6) Pf Ago cleavage reaction buffer (using standard) Pf Ago cleavage reaction buffer, or a self-prepared buffer as described in Example 3. Pf Ago cleavage reaction buffer); (7) Instruction manual.

[0065]

[0066]

[0067] Example 7: Clinical Application Validation Ten Yaoshan crocodile lizards of unknown sex were selected. Oral swabs were used to collect samples, DNA was extracted, and its quality was confirmed using a spectrophotometer. The RAA (Rapid Anti-Acid) assay was then performed according to the method of this invention. Pf Ago sex determination (with internal control also performed). Results showed 5 were male and 5 were female.

[0068] The results were then verified by cloacal examination (observation of the presence or absence of hemipenis). The results showed 5 males and 5 females, which were completely consistent with the cloacal examination results, with a consistency rate of 100% (10 / 10). The internal control signals of all samples were normal, confirming the effectiveness of the experimental system.

[0069] The results of clinical application validation are as follows Figure 10 As shown.

[0070] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0071] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A RAA-PfAgo primer combination for identifying the sex of the Yaoshan Crocodile Lizard, characterized in that, Including amplification primer pairs and gDNA; The amplification primer pair includes: Upstream primer RAA-F2: CCCAAAGCGAAACTATCCTGAGGGAATGAA (SEQ ID NO:1), downstream primer RAA-R2: TGCCTGGAGGCAGATCCGGAAGAAGGCACG (SEQ ID NO:2); The gDNA corresponding to Pf The Ago cleavage target sequence is located in the amplification product of samples from female individuals. The gDNA corresponding to Pf The Ago cleavage target sequence is: CTTCGAGGGAGAATGATGCCAATGGCCT (SEQ ID NO:13).

2. The RAA-PfAgo primer combination according to claim 1, characterized in that, The gDNA is TCCCTCGAAGTGAATG (SEQ ID NO:6).

3. The use of the RAA-PfAgo primer combination according to any one of claims 1-2 in the preparation of a kit for identifying the sex of the Yaoshan Crocodile Lizard.

4. A system for sex identification of the Yaoshan alligator lizard, characterized in that, Includes the RAA-PfAgo primer combination as described in any one of claims 1-2.

5. The system according to claim 4, characterized in that, The sex identification system also includes an internal control system, which includes an internal control gDNA. The internal reference gDNA corresponds to Pf The Ago cleavage target sequence is located in the samples from female individuals and the amplification products from male individuals, and the internal reference gDNA corresponds to... Pf The Ago cleavage target sequence is: GTTGTTGCGTAAGAAGAACTGCAGAGCTCGTCCCATTCACTTCGAGGGAGA (SEQ ID NO:21).

6. The system according to claim 5, characterized in that, The internal reference gDNA is GCTCTGCAGTTCTTCT (SEQ ID NO:14).

7. The system according to any one of claims 5-6, characterized in that, The internal control system also includes an internal control probe, the sequence of which is 5'-TCGAAGTGAATGGGACGAGCTCTGCAGT-3' (SEQ ID NO:26).

8. A reagent kit for sex identification of the Yaoshan alligator lizard, characterized in that, The system comprising any one of claims 4-7.

9. A method for sex determination of the Yaoshan alligator lizard, characterized in that, Includes the following steps: Collect samples, extract genomic DNA, and use the genomic DNA as a template to perform RAA isothermal amplification using the amplification primer pairs in any one of the RAA-PfAgo primer combinations described in claims 1-2 to obtain amplification products. Mix the amplification products, PfAgo protein, and gDNA in any one of the RAA-PfAgo primer combinations described in claims 1-2, and perform a cleavage reaction to obtain cleavage reaction products. Identify the sex based on the cleavage reaction products.

10. The sex determination method according to claim 9, characterized in that, The sex identification method further includes an internal control step, which includes: using the internal control gDNA in the system described in any one of claims 4-7 to perform a cleavage reaction on the amplified product.

Images