Nanoparticle formulations for creation of in situ car t cells
Patent Information
- Application Number
- EP2024857365
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-08-23
- Filing Date
- 2024-08-23
- Publication Date
- 2026-07-01
AI Technical Summary
Current methods for producing CAR T cells are complex, expensive, and limited by the need for ex vivo processing, which restricts large-scale production and patient access.
The use of lipid nanoparticle formulations to deliver mRNA encoding for CAR T cells directly to spleen cells in vivo, allowing for selective targeting and in situ generation of CAR T cells.
This approach enables efficient and cost-effective production of CAR T cells in situ, potentially increasing patient access and reducing the complexity and expense of current methods.
Smart Images

Figure US2024043633_27022025_PF_FP_ABST
Abstract
Description
DESCRIPTIONNANOPARTICLE FORMULATIONS FOR CREATION OF IN SITU CAR T CELLS
[0001] This application claims the benefit of priority to United States Provisional Application No. 63 / 534,327, filed on August 23, 2023, the contents of which are hereby incorporated by reference.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] This invention was made with government support under Grant Nos. R01 CA269787- 01 and R01 5R01EB025192-06 awarded by the National Institutes of Health (NIH). The government has certain rights in the invention.REFERENCE TO A SEQUENCE LISTING
[0003] This application contains a Sequence Listing XML, which has been submitted electronically and is hereby incorporated by reference in its entirety. Said Sequence Listing XML, created on August 23, 2024, is named UTFDP4274WO.xml and is 12,216 bytes in size.BACKGROUNDI. FieldThe present invention relates generally to the fields of medicine, biochemistry, and nucleic acid delivery. For example, in certain aspects, the present invention relates to the generation of CAR T cells in situ. In certain aspects, the present invention relates to compositions formulated for selective delivery of nucleic acid cargo to spleen cells such as lymphocytes.IL Description of Related ArtChimeric Antigen Receptor (CAR) T cell therapy has advanced the field of cancer immunotherapy, from initial reports (Milone et al., 2009; Carpenito et al., 2009; Huang et al. , 2008) to six approved CAR T cell therapies in the clinic as of April 2023 (FDA Kymriah, 2017; FDA Yescarta, 2017; FDA Tecartus, 2020; FDA ABECMA 2021; FDA Breyanzi, 2021 ; FDA CARVYKTI, 2022). About 90% of patients with B cell malignancies respond toCAR T cell treatment. However, longitudinal studies indicate that 40-60% of the patients will relapse (Gu et al., 2022). In addition, the current methods for CAR T cell production are complicated (Amini et al., 2022) and highly expensive with costs rising to half a million dollars (Hernandez et al., 2018; Choi et al., 2022). Ex vivo CAR T cell production requires the collection of patient blood and isolation of T cell population in a process called leukapheresis. Then, T cells undergo ex vivo engineering via viral transduction to insert the CAR gene, followed by a process of activation and expansion of the T cells (FIG. 1A). Before the patient can receive the treatment, they must undergo lymphodepletion via chemotherapy treatment a few days before CAR T cell infusion (Liang et al., 2020; Owen et al. , 2023). Because this process uses the patient’s own T cells, CAR T cells cannot be manufactured at large scales and be ready-to-use when any patient may need it. In addition, the facilities that manufacture this kind of cell therapy are limited and the entire process can take 4-6 weeks. All this added together results in scarce patient access to CAR T cell therapy. Thus, methods for safe, non-viral generation of CAR T cells directly inside a patient’s body (Xin et al. , 2022; Parayath et al. , 2021) are needed (FIG. IB).SUMMARYIn some aspects, the present disclosure provides lipid compositions, specifically lipid nanoparticles, that may be used in methods of preparing chimeric antigen receptor (CAR) T cells. In particular, the compositions may be used to target a spleen cells such as a T cell.In another aspect, the present disclosure provides methods of preparing a chimeric antigen receptor (CAR) T cell in a patient comprising administering to the patient an mRNA encapsulated in a lipid nanoparticle, wherein the lipid nanoparticle selectively binds to a spleen cell, wherein the administration results in the formation of the CAR T cell in vivo.In still yet another aspect, the present disclosure provides methods of preparing a chimeric antigen receptor (CAR) T cell in a patient comprising administering to the patient an mRNA encapsulated in a lipid nanoparticle, wherein the lipid nanoparticle selectively internalizes into a spleen cell, wherein the administration results in the formation of the CAR T cell in vivo.In some embodiments, the spleen cell is a lymphocyte. In some embodiments, the lymphocyte is a T cell. In some embodiments, the T cell is a CD4+ T cell. In other embodiments, the T cell is a CD8+ T cell.In some embodiments, the lipid nanoparticle has a pKa of less than 6. In some embodiments, the pKais from about 1 to about 6. In some embodiments, the pKais from about 3 to about 6.In some embodiments, the lipid nanoparticle comprises an ionizable cationic lipid. In some embodiments, the ionizable cationic lipid is a dendrimer or dendron. In some embodiments, the dendrimer or dendron is further defined by the formula:Core-Repeating Unit-Terminating Group (I) wherein the core is linked to the repeating unit by removing one or more hydrogen atoms from the core and replacing the atom with the repeating unit and wherein: the core has the formula:wherein:Xi is amino or alkylamino(csi2), dialkylamino(c<i2), heterocycloalkyl(c<i2), heteroaryl(c<i2), or a substituted version thereof;Ri is amino, hydroxy, or mercapto, or alkylamino(c<i2), dialkylamino(c<i2), or asubstituted version of either of these groups; and a is 1, 2, 3, 4, 5, or 6; or the core has the formula: (III) wherein:X2 is N(R5)y; R5 is hydrogen, alkyl(C≤18), or substituted alkyl(C≤18); and y is 0, 1, or 2, provided that the sum of y and z is 3; R2 is amino, hydroxy, or mercapto, or alkylamino(C≤12), dialkylamino(C≤12), or a substituted version of either of these groups; b is 1, 2, 3, 4, 5, or 6; and z is 1, 2, 3; provided that the sum of z and y is 3; or the core has the formula: IV) wherein:X3 is −NR6−, wherein R6 is hydrogen, alkyl(C≤8), or substituted alkyl(C≤8), −O−, or alkylaminodiyl(C≤8), alkoxydiyl(C≤8), arenediyl(C≤8), heteroarenediyl(C≤8), heterocycloalkanediyl(C≤8), or a substituted version of any of these groups; R3 and R4 are each independently amino, hydroxy, or mercapto, or alkylamino(C≤12), dialkylamino(C≤12), or a substituted version of either of these groups; or a group of the formula: −N(Rf)f(CH2CH2N(Rc))eRd; wherein: e and f are each independently 1, 2, or 3; provided that the sum of e and f is 3; Rc, Rd, and Rf are each independently hydrogen, alkyl(C≤6), or substituted alkyl(C≤6); c and d are each independently 1, 2, 3, 4, 5, or 6; orthe core is alkylamine(C≤18), dialkylamine(C≤36), heterocycloalkane(C≤12), or a substituted version of any of these groups; wherein the repeating unit comprises a degradable diacyl and a linker; the degradable diacyl group has the formula: II) wherein:A1and A2are each independently −O− or −NRa−, wherein: Ra is hydrogen, alkyl(C≤6), or substituted alkyl(C≤6); Y3 is alkanediyl(C≤12), alkenediyl(C≤12), arenediyl(C≤12), or a substituted version of any of these groups; or a group of the formula:X3 and X4 are alkanediyl(C≤12), alkenediyl(C≤12), arenediyl(C≤12), or a substituted version of any of these groups; Y5 is a covalent bond, alkanediyl(C≤12), alkenediyl(C≤12), arenediyl(C≤12), or a substituted version of any of these groups; and R9 is alkyl(C≤8) or substituted alkyl(C≤8); the linker group has the formula: I) wherein:Y1is alkanediyl(C≤12), alkenediyl(C≤12), arenediyl(C≤12), or a substituted version of any of these groups; and wherein when the repeating unit comprises a linker group, then the linker group comprises an independent degradable diacyl group attached to both the nitrogen and the sulfur atoms of the linker group if n is greater than 1, wherein the first group in the repeating unit is a degradablediacyl group, wherein for each linker group, the next repeating unit comprises two degradable diacyl groups attached to the nitrogen atom of the linker group; and wherein n is the number of linker groups present in the repeating unit; and 5 the terminating group has the formula: (VIII) wherein:Y4 is alkanediyl(C≤18) or an alkanediyl(C≤18) wherein one or more of the hydrogen atoms on the alkanediyl(C≤18) has been replaced with −OH, −F, −Cl, −Br, −I, −SH, −OCH3, −OCH2CH3, −SCH3, or −OC(O)CH3; R10 is hydrogen, carboxy, hydroxy, or aryl(C≤12), alkylamino(C≤12), dialkylamino(C≤12), N-heterocycloalkyl(C≤12), −C(O)N(R11)−alkanediyl(C≤6)−heterocycloalkyl(C≤12), −C(O)−alkyl- amino(C≤12), −C(O)−dialkylamino(C≤12), −C(O)−N-heterocyclo- alkyl(C≤12), wherein: R11is hydrogen, alkyl(C≤6), or substituted alkyl(C≤6); wherein the final degradable diacyl in the chain is attached to a terminating group; n is 0, 1, 2, 3, 4, 5, or 6; or a pharmaceutically acceptable salt thereof. In some embodiments, the terminating group is further defined by the formula: II) wherein:Y4 is alkanediyl(C≤18); and R10is hydrogen. In some embodiments, the core is further defined by the formula: II) wherein:X2is N(R5)y; R5is hydrogen or alkyl(C≤8), or substituted alkyl(C≤18); and y is 0, 1, or 2, provided that the sum of y and z is 3; R2 is amino, hydroxy, or mercapto, or alkylamino(C≤12), dialkylamino(C≤12), or a substituted version of either of these groups; b is 1, 2, 3, 4, 5, or 6; and z is 1, 2, 3; provided that the sum of z and y is 3. In some embodiments, the core is further defined by the formula: (IV) wherein:X3is −NR6−, wherein R6is hydrogen, alkyl(C≤8), or substituted alkyl(C≤8), −O−, or alkylaminodiyl(C≤8), alkoxydiyl(C≤8), arenediyl(C≤8), heteroarenediyl(C≤8), heterocycloalkanediyl(C≤8), or a substituted version of any of these groups; R3and R4are each independently amino, hydroxy, or mercapto, or alkylamino(C≤12), dialkylamino(C≤12), or a substituted version of either of these groups; or a group of the formula: −N(Rf)f(CH2CH2N(Rc))eRd; wherein: e and f are each independently 1, 2, or 3; provided that the sum of e and f is 3; Rc, Rd, and Rfare each independently hydrogen, alkyl(C≤6), or substituted alkyl(C≤6); c and d are each independently 1, 2, 3, 4, 5, or 6. In some embodiments, the core is further defined as: , ,, , ,,, or ;In some embodiments, the lipid nanoparticle further comprises a permanently anionic lipid. In some embodiments, the permanently anionic lipid comprises a phosphate group. In some embodiments, the permanently anionic lipid is further defined as: B) wherein:R1and R2are each independently alkyl(C8-C24), alkenyl(C8-C24), or a substituted version of either group; R3 is hydrogen, alkyl(C≤6), or substituted alkyl(C≤6), or −Y1−R4, wherein: Y1 is alkanediyl(C≤6) or substituted alkanediyl(C≤6); and R4is acyloxy(C≤8-24)or substituted acyloxy(C≤8-24). In some embodiments, the permanently anionic lipid is further defined as: 15 ,., holipid. In some embodiments, the lipid nanoparticle further comprises a steroid such as cholesterol. In some embodiments, the lipid nanoparticle further comprises a polymer conjugated lipid. In some embodiments, the polymer conjugated lipid is a PEGylated lipid. In some embodiments, the polymer conjugated lipid is further defined by the formula:wherein: R12and R13are each independently alkyl(C≤24), alkenyl(C≤24), or a substituted version of either of these groups; Reis hydrogen, alkyl(C≤8), or substituted alkyl(C≤8); and x is 1-250.In other embodiments, the polymer conjugated lipid is dimyristoyl-sn-glycerol or a compound of the formula: wherein:n1 is 5-250; and n2and n3are each independently 2-25. In some embodiments, the mRNA encodes for a chimeric antigen receptor (CAR). In some embodiments, the mRNA encodes for two or more chimeric antigen receptors. In some embodiments, the mRNA further encodes for a co-stimulatory molecule. In some embodiments, the mRNA encodes for two or more co-stimulatory molecules. In some embodiments, the mRNA further encodes for a signaling domain. In some embodiments, the mRNA encodes for two or more signaling domain. In some embodiments, the mRNA further encodes for one or more cytokines. In some embodiments, the mRNA encodes for: (i) one or more chimeric antigen receptor; (ii) one or more signaling domains; and (iii) one or more co-stimulatory molecule. In some embodiments, the mRNA encodes for: (i) one or more chimeric antigen receptor; (ii) one or more signaling domains; (iii) one or more co-stimulatory molecule; and (iv) one or more cytokines. In some embodiments, the chimeric antigen receptor encoded for is an antigen of a tumor marker. In some embodiments, the tumor marker is CD19 or CD20. In some embodiments, the co-stimulatory molecule encoded for is CD28 or 41BB. In some embodiments, the signaling domain encoded for is CD3ζ.In some embodiments, the lipid nanoparticle comprises from about 1% to about 45% of an ionizable cationic lipid as a molar percentage of the lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises from about 10% to about 30% of the ionizable cationic lipid as a molar percentage of the lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises from about 1% to about 40% of a permanently anionic lipid as a molar percentage of the lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises from about 5% to about 20% of the permanently anionic lipid as a molar percentage of the lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises from about 1% to about 45% of a phospholipid as a molar percentage of the lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises from about 10% to about 30% of the phospholipid as a molar percentage of the lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises from about 10% to about 70% of a steroid as a molar percentage of the lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises from about 25% to about 60% of the polymer conjugated lipid as a molar percentage of the lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises from about 0.01% to about 15% of a polymer conjugated lipid as a molar percentage of the lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises from about 0.1% to about 10% of the polymer conjugated lipid as a molar percentage of the lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises: (i) an ionizable cationic lipid; (ii) a permanently anionic lipid; and (iii) a steroid. In some embodiments, the lipid nanoparticle comprises: (i) an ionizable cationic lipid; (ii) a permanently anionic lipid; (iii) a steroid; and (iv) a polymer conjugated lipid. In some embodiments, the lipid nanoparticle comprises: (i) an ionizable cationic lipid; (ii) a permanently anionic lipid; (iii) a steroid; and(iv) a phospholipid. In some embodiments, the lipid nanoparticle comprises: (i) an ionizable cationic lipid; (ii) a permanently anionic lipid; (iii) a steroid; (iv) a phospholipid; and (v) a polymer conjugated lipid. In some embodiments, the methods comprise systemically administering the lipid nanoparticle to the patient. In some embodiments, the systemic administration is via injection. In some embodiments, the systemic administration is intravenous administration. In another aspect, the present disclosure provides methods of treating a disease or disorder in a patient comprising administering to the patient a lipid nanoparticle comprising an mRNA, wherein the mRNA encodes for a chimeric antigen receptor, and the lipid nanoparticle selectively binds to a spleen cell. In some embodiments, the disease is cancer. In some embodiments, the cancer is a cancer of the lymph system. In some embodiments, the cancer of the lymph system is lymphoma. In other embodiments, the disease is a cardiovascular disease. In some embodiments, the cardiovascular disease is a cardiac injury or heart failure. In other embodiments, the disease or disorder is a fibrotic disease. In still another aspect, the present disclosure provides methods of modifying a lymphocyte comprising administering to a patient a lipid nanoparticle comprising a mRNA that encodes for a chimeric antigen receptor, wherein the lipid nanoparticle selectivity binds to a lymphocyte. In some embodiments, the lymphocyte is a T cell. In some embodiments, the T cell is a CD4+ T cell. In other embodiments, the T cell is a CD8+ T cell. In still yet another aspect, the present disclosure provides compositions comprising: (A) a lipid nanoparticle comprising: (i) an ionizable cationic lipid; (ii) a permanently anionic lipid; and (iii) one or more additional lipids; and (B) an mRNA encoding for a chimeric antigen receptor; wherein the mRNA is encapsulated within the lipid nanoparticle and the lipid nanoparticle has an apparent pKaof less than 6.In some embodiments, the additional lipids include a steroid such as cholesterol. In some embodiments, the additional lipids include a phospholipid. In some embodiments, the phospholipid is a neutral phospholipid. In some embodiments, the additional lipids include a polymer conjugated lipid. In some embodiments, the polymer conjugated lipid is a PEGylated lipid. In some embodiments, the lipid nanoparticle comprises from about 1% to about 45% of an ionizable cationic lipid as a molar percentage of the lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises from about 10% to about 30% of the ionizable cationic lipid as a molar percentage of the lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises from about 1% to about 40% of a permanently anionic lipid as a molar percentage of the lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises from about 5% to about 20% of the permanently anionic lipid as a molar percentage of the lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises from about 1% to about 45% of a phospholipid as a molar percentage of the lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises from about 10% to about 30% of the phospholipid as a molar percentage of the lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises from about 10% to about 70% of a steroid as a molar percentage of the lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises from about 25% to about 60% of the polymer conjugated lipid as a molar percentage of the lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises from about 0.01% to about 15% of a polymer conjugated lipid as a molar percentage of the lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises from about 0.1% to about 10% of the polymer conjugated lipid as a molar percentage of the lipid nanoparticle. Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the disclosure, are given by way of illustration only, since various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description.BRIEF DESCRIPTION OF THE DRAWINGS The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure. The invention may be better understood by reference to one of these drawings in combination with the detailed description of specific embodiments presented herein. FIGS. 1A-1B: In situ CAR T cell transfection bypasses the laborious ex vivo CAR T cell production process. (A) Conventional ex vivo method of CAR T cell preparation. (B) Presently disclosed methods of in situ CAR T cell production by Spleen SORT LNPs for in vivo transfection of T cells. FIGS. 2A-2H: Intravenously administered Spleen SORT LNPs transfect T cell in vivo. (A) Structure of the lipids used in the LNPs. (B) Formulation details for the Spleen SORT LNPs and control LNPs used in the presently disclosed methods. (C) Organ bioluminescence of C57BL / 6 mice 24h after intravenous administration of 0.3 mg / kg firefly luciferase mRNA by 0% 18:1 PA LNPs (n = 3). (D) Organ bioluminescence of C57BL / 6 mice 24h after intravenous administration of 0.3 mg / kg firefly luciferase mRNA by 10% 18:1 PA LNPs (n = 3). (E) Quantification of spleen, lung, and liver luminescence of 0% 18:1 PA LNPs and 10 % 18:1 PA LNPs. (F) Percentage of TdTomato+ T cells (CD3+) after two 0.5 mg / kg Cre mRNA IV treatments 48h apart by Spleen SORT LNPs (n = 3). (G) Percentage of TdTomato+ CD8 and CD4 T cells after two 0.5 mg / kg Cre mRNA IV treatments 48h apart by Spleen SORT LNPs (n = 3). (H) Percentage of TdTomato+ B cells, macrophages, monocytes, and neutrophils. FIGS. 3A-3B: Characterization of 5A2-SC8 LNP component. (A) Proton Nuclear magnetic resonance (1H-NMR) of 5A2-G1, intermediate of 5A2-SC8. (B) Proton Nuclear magnetic resonance (1H-NMR) of final product 5A2-SC8. FIGS. 4A-4D: Addition of 18:1 PA to the LNP formulation reduces global pKa of LNP. LNPs with 0 and 10% 18:1 PA were formulated with CAR19-41BBz mRNA . Size distribution (A), polydispersity index (PDI) (B), zeta potential (C) and global pKa (D) were measured. FIG.5: Gating strategy used to sort for CD3+, CD4+, CD8+, and TdTom+ T cells.FIGS.6A-6D: Characterization of LNPs used in the lymphoreplete lymphoma model. (A) Capillary electrophoresis of IVT mRNA for the three batches of CAR19-41BBzIVT mRNA and CAR19-28z. Spleen SORT LNPs were formulated with CAR19-41BBz mRNA and Cre mRNA. Size distribution (B), polydispersity index (PDI) (C), and zeta potential (D) were measured. FIGS. 7A-7E: Spleen SORT LNP-mediated in situ CAR T cell generation reduced liver tumor burden in a lymphoreplete lymphoma model. (A) Protocol followed to create the lymphoreplete syngeneic model of B cell lymphoma in Balb / c mice and treatment plan. After tumor engraftment, Balb / c mice were divided into groups: Saline control, Cre mRNA Spleen SORT LNP treatment, and CAR19-41BBz mRNA Spleen SORT LNP treatment. (B) Design of mRNA used in the therapeutic model. (C) Bioluminescent tracking of luciferase- expressing lymphoma tumors (n = 12). (D) Livers taken from tumor bearing mice at 5 weeks after treatment (n = 2). (E) Abdominal circumference of mice after 3.5, 4, and 4.5 weeks of treatment (n = 12). One way ANOVA with multiple comparisons (Dunnett). FIG. 8: Survival curve of the first round of aggressive lymphoreplete B cell lymphoma model. FIGS. 9A-9F: Treatment with CAR19-41BBz mRNA Spleen SORT alleviates tumor burden. (A) Protocol followed to create the lymphoreplete syngeneic model of B cell lymphoma in Balb / c mice and treatment plan. After tumor engraftment, Balb / c mice were divided into two groups: Saline control (n = 5) and CAR19-41BBz mRNA Spleen SORT LNPs (n = 9). (B) Design of mRNA used in the therapeutic model. (C) Bioluminescent tracking of luciferase-expressing lymphoma tumors. Abdominal circumference of mice at week four (D) and five (E) of treatment. (F) Survival analysis comparison of the two treatment groups. Unpaired T test (two tailed). Kaplan-Meier simple survival analysis with Logrank (Mantel-Cox test). FIGS. 10A-10F: Survival extension of aggressive lymphoreplete lymphoma model after LNP-mediated in situ CAR T cell generation. (A) Protocol followed to create the lymphoreplete syngeneic model of B cell lymphoma in Balb / c mice and treatment plan. After tumor engraftment, Balb / c mice were divided into two groups: Saline control (n = 6), CAR19-41BBz mRNA Spleen SORT LNPs (n = 6), and CAR19-28z mRNA Spleen SORT LNPs (n = 5). (B) Design of mRNA used in the therapeutic model. (C) BLI imaging of luciferase-expressing lymphoma tumors. (D) BLI values of tumor-beating mice over time.(E) BLI values of mice after 3 weeks of treatment. (F) Survival analysis comparison of the three treatment groups. Unpaired T test (two tailed). Kaplan-Meier simple survival analysis with Logrank (Mantel-Cox test). FIGS. 11A-11D: Lymphocyte tumor infiltration increased after treatment with CAR19-41BBz mRNA Spleen SORT LNPs. (A) Tumor tissue isolated from tumor-bearing mice in FIG. 7 were stained to quantify CD3+ T cells (red), and DAPI+ nuclei (blue) and imaged using confocal microscopy. (B) Tumor infiltrating lymphocytes were quantified from the confocal images (n=14). (C) Similarly, tumor tissue isolated from tumor-bearing mice in FIG. 9 were stained to quantify CD3+ T cells and imaged using confocal microscopy. (D) Tumor infiltrating lymphocytes were quantified from the confocal images (n=10). One way ANOVA with multiple comparisons (Dunnett). Unpaired T test (two-tailed). FIG. 12: Tumor infiltrating lymphocytes in Saline group. Tumor tissues from the livers of saline treated mice in figure 3 were sectioned and stained for CD3+ T cells. Confocal images were used for the quantification of tumor infiltrating lymphocytes. FIG. 13: Tumor infiltrating lymphocytes in mRNA Cre group. Tumor tissues from the livers of mRNA Cre mice in figure 3 were sectioned and stained for CD3+ T cells. Confocal images were used for the quantification of tumor infiltrating lymphocytes. FIG. 14: Tumor infiltrating lymphocytes in mRNA CAR19-41BBz group. Tumor tissues from the livers of mRNA CAR19-42BBz mice in figure 3 were sectioned and stained for CD3+ T cells. Confocal images were used for the quantification of tumor infiltrating lymphocytes. FIG. 15: Tumor infiltrating lymphocytes in saline group. Tumor tissues from the livers of saline treated mice in figure 4 were sectioned and stained for CD3+ T cells. Confocal images were used for the quantification of tumor infiltrating lymphocytes.DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS The presently disclosed methods for in situ generation of CAR T cells. The presently disclosed methods allow for selective LNP mRNA delivery, such as selective LNP mRNA delivery to extrahepatic targets such as for example to the spleen or the lungs. The presently disclosed methods may be beneficial in that they do not involve antibody targeting (Cheng et al., 2020). The presently disclosed methods involve the addition of a supplemental fifth lipid of defined chemical properties that enables selective ORgan targeting (SORT) to LNPs. In some embodiments, the SORT molecule is an anionic lipid. In some embodiments, the SORT LNPs of the presently disclosed methods exhibit spleen specific tropism, including delivery to T cells. The presently disclosed methods may be useful for mRNA in situ CAR T cell transfection. In some embodiments, the present methods may be useful to treat cancer, such as lymphoma. The presently disclosure provides methods of transfecting T cells after intravenous injection, including up to 5.8% CD8+ T cells. CAR T cells produced in situ according to the presently disclosed methods can reduce the tumor burden in an aggressive model and decrease the number of lesions in the livers. In addition, CAR T cells produced in situ according to the presently disclosed methods reduced the abdominal circumference of mice treated with CAR mRNA. CAR T cells produced in situ according to the presently disclosed methods extended the survival of mice in the less aggressive lymphoma model. The production of CAR T cells in situ according to the present methods led to an increase in the tumor infiltrating lymphocytes of the liver lesions, possibly explaining (without being bound by theory) to the observed smaller abdominal circumferences and less metastatic lesions in the liver of the mice. In some embodiments, the presently disclosed methods facilitate in situ CAR T cell therapy of B cell lymphoma. The presently disclosed methods contemplate use of other CARs to treat equally or more aggressive tumors. Furthermore, as the field continues to design more potent CARs to target hematological malignancies as well as solid tumors, the present methods provide a promising way to produce in situ CAR T cells for diverse applications. A. CAR T cells Adoptive immunotherapy traditionally involves the transfer of autologous antigen- specific T cells generated ex vivo. Provided herein are methods of generating antigen-specific T cell by genetic engineering in situ. Novel specificities in T cells have been successfully generated through the genetic transfer of transgenic T cell receptors or chimeric antigenreceptors (CARs). CARs are synthetic receptors consisting of a targeting moiety that is associated with one or more signaling domains in a single fusion molecule. In general, the binding moiety of a CAR consists of an antigen-binding domain of a single-chain antibody (scFv), comprising the light and variable fragments of a monoclonal antibody joined by a flexible linker. Binding moieties based on receptor or ligand domains have also been used successfully. The signaling domains for first generation CARs are derived from the cytoplasmic region of the CD3ζ or the Fc receptor gamma chains. CARs have successfully allowed T cells to be redirected against antigens expressed at the surface of tumor cells from various malignancies including lymphomas and solid tumors. i. Chimeric Antigen Receptors Chimeric antigen receptor (CAR) molecules are recombinant fusion protein and are distinguished by their ability to both bind antigen and transduce activation signals via immunoreceptor activation motifs (ITAMs) present in their cytoplasmic tails in order to activate genetically modified immune effector cells for killing, proliferation, and cytokine production. Receptor constructs utilizing an antigen-binding moiety (for example, generated from single chain antibodies (scFv)) afford the additional advantage of being “universal” in that they bind native antigen on the target cell surface in an HLA-independent fashion. Embodiments of the CARs described herein include nucleic acids encoding an antigen-specific CAR polypeptide comprising an intracellular signaling domain, a transmembrane domain, and an extracellular domain comprising an antigen-binding domain. A CAR may recognize an epitope comprised of the shared space between one or more antigens. Optionally, a CAR can comprise a hinge domain positioned between the transmembrane domain and the antigen binding domain. A CAR may further comprise a signal peptide that directs expression of the CAR to the cell surface. For example, a CAR may comprise a signal peptide from GM-CSF. A CAR may also be co-expressed with a membrane-bound cytokine to improve persistence. For example, a CAR may be co-expressed with membrane-bound IL-15. Depending on the arrangement of the domains of the CAR and the specific sequences used in the domains, immune effector cells expressing the CAR may have different levels activity against target cells. Different CAR sequences may be introduced into immune effector cells to generate engineered cells, the engineered cells selected for elevated SRC, and the selected cells tested for activity to identify the CAR constructs predicted to have the greatest therapeutic efficacy.A chimeric antigen receptor can be produced by any means known in the art, though preferably it is produced using recombinant DNA techniques. A nucleic acid sequence encoding the several regions of the chimeric antigen receptor can be prepared and assembled into a complete coding sequence by standard techniques of molecular cloning (genomic library screening, PCR, primer-assisted ligation, scFv libraries from yeast and bacteria, site- directed mutagenesis, etc.). The resulting coding region can be inserted into an expression vector and used to transform a suitable expression host allogeneic or autologous immune effector cells, such as a T cell or an NK cell.The chimeric construct may be introduced into immune effector cells as naked DNA or in a suitable vector. Methods of stably transfecting cells by electroporation using naked DNA are known in the art. See, e.g. , U.S. Pat. No. 6,410,319. Naked DNA generally refers to the DNA encoding a chimeric receptor contained in a plasmid expression vector in proper orientation for expression. Alternatively, a viral vector (e.g., a retroviral vector, adenoviral vector, adeno- associated viral vector, or lentiviral vector) can be used to introduce the chimeric construct into immune effector cells. Suitable vectors for use in accordance with the method of the present invention are non-replicating in the immune effector cells. A large number of vectors are known that are based on viruses, where the copy number of the virus maintained in the cell is low enough to maintain the viability of the cell, such as, for example, vectors based on HIV, SV40, EBV, HSV, or BPV. ii. Antigen binding domainsAn antigen binding domain may comprise complementary determining regions of a monoclonal antibody, variable regions of a monoclonal antibody, and / or antigen binding fragments thereof. The antigen binding regions or domains may comprise a fragment of the VH and VL chains of a single-chain variable fragment (scFv) derived from a particular mouse, humanized, or human monoclonal antibody. The fragment can also be any number of different antigen binding domains of an antigen- specific antibody. The fragment may be an antigen-specific scFv encoded by a sequence that is optimized for human codon usage for expression in human cells. In certain aspects, VH and VL domains of a CAR are separated by a linker sequence, such as a Whitlow linker.The prototypical CAR encodes a scFv comprising VH and VL domains derived from one monoclonal antibody (mAb), coupled to a transmembrane domain and one or more cytoplasmic signaling domains (e.g. costimulatory domains and signaling domains). Thus, a CAR may comprise the LCDR1-3 sequences and the HCDR1-3 sequences of an antibody that binds to coronavirus spike protein. In further aspects, however, two of more antibodies thatbind to an antigen of interest are identified and a CAR is constructed that comprises: (1) the HCDR1-3 sequences of a first antibody that binds to the antigen; and (2) the LCDR1-3 sequences of a second antibody that binds to the antigen. Such a CAR that comprises HCDR and LCDR sequences from two different antigen binding antibodies may have the advantage of preferential binding to particular conformations of an antigen (e.g., pre-fusion conformations of Spike protein).Alternatively, a CAR may be engineered using VH and VL chains derived from different mAbs to generate a panel of CAR+ immune effector cells. The antigen binding domain of a CAR may contain any combination of the LCDR1-3 sequences of a first antibody and the HCDR1-3 sequences of a second antibody.Hi. Hinge domainsA CAR polypeptide may include a hinge domain positioned between the antigen binding domain and the transmembrane domain. In some cases, a hinge domain may be included in CAR polypeptides to provide adequate distance between the antigen binding domain and the cell surface or to alleviate possible steric hindrance that could adversely affect antigen binding or effector function of CAR-modified immune effector cells. The hinge domain may comprise a sequence that binds to an Fc receptor, such as FcyR2a or FcyRla. For example, the hinge sequence may comprise an Fc domain from a human immunoglobulin (e.g., IgGl, IgG2, IgG3, IgG4, IgAl, IgA2, IgM, IgD or IgE) that binds to an Fc receptor.A CAR hinge domain may be derived from human immunoglobulin (Ig) constant region or a portion thereof including the Ig hinge, or from human CD8 a transmembrane domain and CD8a-hinge region. A CAR hinge domain may comprise a hinge-CI E-CI h region of antibody isotype IgG4. The hinge domain (and / or the CAR) may not comprise a wild type human IgG4 CH2 and CH3 sequence. Point mutations may be introduced in antibody heavy chain CH2 domain to reduce glycosylation and non-specific Fc gamma receptor binding of CAR-modified immune effector cells.A CAR hinge domain may comprise an Ig Fc domain that comprises at least one mutation relative to wild type Ig Fc domain that reduces Fc-receptor binding. For example, the CAR hinge domain can comprise an IgG4-Fc domain that comprises at least one mutation relative to wild type IgG4-Fc domain that reduces Fc-receptor binding. A CAR hinge domain may comprise an IgG4-Fc domain having a mutation (such as an amino acid deletion or substitution) at a position corresponding to L235 and / or N297 relative to the wild type IgG4- Fc sequence. For example, a CAR hinge domain can comprise an IgG4-Fc domain having aL235E and / or a N297Q mutation relative to the wild type IgG4-Fc sequence. A CAR hinge domain may comprise an IgG4-Fc domain having an amino acid substitution at position L235 for an amino acid that is hydrophilic, such as R, H, K, D, E, S, T, N or Q, or that has similar properties to an “E,” such as D. A CAR hinge domain may comprise an IgG4-Fc domain having an amino acid substitution at position N297 for an amino acid that has similar properties to a “Q,” such as S or T.The hinge domain may comprise a sequence that is about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to an IgG4 hinge domain, a CD8a hinge domain, a CD28 hinge domain, or an engineered hinge domain. iv. Transmembrane domains or Co-stimulatory MoleculesThe antigen- specific extracellular domain and the intracellular signaling-domain may be linked by a transmembrane domain or a co-stimulatory molecule. Polypeptide sequences that can be used as part of transmembrane domain include, without limitation, the human CD4 transmembrane domain, the human CD28 transmembrane domain, the transmembrane human CD3z domain, a cysteine mutated human CD3z domain, or other transmembrane domains from other human transmembrane signaling proteins, such as CD 16, CD8, and erythropoietin receptor. For example, the transmembrane domain may comprise a sequence at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to one of those provided in U.S. Patent Publication No. 2014 / 0274909 (e.g. a CD8 and / or a CD28 transmembrane domain) or U.S. Patent No. 8,906,682 (<?.g. a CD8a transmembrane domain), both incorporated herein by reference. Transmembrane regions may be derived from (i.e. comprise at least the transmembrane region / s) of) the alpha, beta or zeta chain of the T-cell receptor, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154. In certain specific aspects, the transmembrane domain can be 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a CD8a transmembrane domain or a CD28 transmembrane domain. v. Signaling domainsThe signaling domains or intracellular signaling domain of a CAR is responsible for activation of at least one of the normal effector functions of the immune cell engineered to express the CAR. The term “effector function” refers to a specialized function of a differentiated cell. Effector function of a T cell, for example, may be cytolytic activity or helper activity including the secretion of cytokines. Effector function in a naive, memory, or memory-type T cell includes antigen-dependent proliferation. Thus the term “intracellular signaling domain” refers to the portion of a protein that transduces the effector functionsignal and directs the cell to perform a specialized function. The intracellular signaling domain may be derived from the intracellular signaling domain of a native receptor. Examples of such native receptors include the zeta chain of the T-cell receptor or any of its homologs (e.g., eta, delta, gamma, or epsilon), MB1 chain, B29, Fc RIII, Fc RI, and combinations of signaling molecules, such as CD3z and CD28, CD27, 4-1BB / CD137, ICOS / CD278, IL-2R0 / CD122, IL-2Ra / CD132, DAP10, DAP12, CD40, OX40 / CD134, and combinations thereof, as well as other similar molecules and fragments. Intracellular signaling portions of other members of the families of activating proteins can be used.While the entire intracellular signaling domain may be employed, in many cases it will not be necessary to use the entire intracellular polypeptide. To the extent that a truncated portion of the intracellular signaling domain may find use, such truncated portion may be used in place of the intact chain as long as it still transduces the effector function signal. The term “intracellular signaling domain” is thus meant to include a truncated portion of the intracellular signaling domain sufficient to transduce the effector function signal, upon CAR binding to a target. One or multiple cytoplasmic domains may be employed, as so-called third generation CARs have at least two or three signaling domains fused together for additive or synergistic effect, for example the CD28 and 4-1BB can be combined in a CAR construct. In certain specific aspects, the intracellular signaling domain comprises a sequence 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a CD3z intracellular domain, a CD28 intracellular domain, a CD137 intracellular domain, or a domain comprising a CD28 intracellular domain fused to the 4-1BB intracellular domain.B. Anionic LipidsIn some aspects, the present disclosure provides one or more lipids with one or more hydrophobic components and a permanently anionic group. One anionic group that may be used in the permanently anionic lipid is a phosphate group. The phosphate group may be a compound which is deprotonated and possesses a negative charge at a pH below 8, 9, 10, 11, 12, 13 or 14. The anionic group that may be used in the permanently anionic lipid is a carboxylic acid group. The carboxylic acid group may be a compound which is deprotonated and possesses a negative charge at a pH below 3, 4, 5, 6, or 7. The hydrophobic components may be one or more C6-C24 alkyl or alkenyl groups. The compound may have one hydrophobic group, two hydrophobic groups, or three hydrophobic groups.In some embodiments, the permanently anionic lipid has a structure of the formula:B) wherein:R1 and R2 are each independently alkyl(C8-C24), alkenyl(C8-C24), or a substituted version of either group; R3is hydrogen, alkyl(C≤6), or substituted alkyl(C≤6), or −Y1−R4, wherein: Y1 is alkanediyl(C≤6) or substituted alkanediyl(C≤6); and R4is acyloxy(C≤8-24)or substituted acyloxy(C≤8-24). C. Ionizable Lipids In some aspects of the present disclosure, composition containing compounds containing lipophilic and cationic components, wherein the cationic component is ionizable, are provided. In some embodiments, these cationic ionizable lipids are dendrimers, which are a polymer exhibiting regular dendritic branching, formed by the sequential or generational addition of branched layers to or from a core and are characterized by a core, at least one interior branched layer, and a surface branched layer. (See Petar R. Dvornic and Donald A. Tomalia in Chem. in Britain, 641-645, August 1994.) In other embodiments, the term “dendrimer” as used herein is intended to include, but is not limited to, a molecular architecture with an interior core, interior layers (or “generations”) of repeating units regularly attached to this initiator core, and an exterior surface of terminal groups attached to the outermost generation. A “dendron” is a species of dendrimer having branches emanating from a focal point which is or can be joined to a core, either directly or through a linking moiety to form a larger dendrimer. In some embodiments, the dendrimer structures have radiating repeating groups from a central core which doubles with each repeating unit for each branch. In some embodiments, the dendrimers described herein may be described as a small molecule, medium-sized molecules, lipids, or lipid-like material. These terms may be used to described compounds described herein which have a dendron like appearance (e.g., molecules which radiate from a single focal point).While dendrimers are polymers, dendrimers may be preferable to traditional polymers because they have a controllable structure, a single molecular weight, numerous and controllable surface functionalities, and traditionally adopt a globular conformation after reaching a specific generation. Dendrimers can be prepared by sequentially reactions of each repeating unit to produce monodisperse, tree-like and / or generational structure polymeric structures. Individual dendrimers consist of a central core molecule, with a dendritic wedge attached to one or more functional sites on that central core. The dendrimeric surface layer can have a variety of functional groups disposed thereon including anionic, cationic, hydrophilic, or lipophilic groups, according to the assembly monomers used during the preparation. In some embodiments, the ionizable cationic lipid is a dendrimer or dendron further defined by the formula: Core-Repeating Unit-Terminating Group (D-I) wherein the core is linked to the repeating unit by removing one or more hydrogen atoms from the core and replacing the atom with the repeating unit and wherein: the core has the formula: (D-II) wherein:X1 is amino or alkylamino(C≤12), dialkylamino(C≤12), heterocycloalkyl(C≤12), heteroaryl(C≤12), or a substituted version thereof; R1 is amino, hydroxy, or mercapto, or alkylamino(C≤12), dialkylamino(C≤12), or a substituted version of either of these groups; and a is 1, 2, 3, 4, 5, or 6; or the core has the formula: (D-III) wherein: X2is N(R5)y; R5 is hydrogen, alkyl(C≤18), or substituted alkyl(C≤18); and y is 0, 1, or 2, provided that the sum of y and z is 3; R2 is amino, hydroxy, or mercapto, or alkylamino(C≤12), dialkylamino(C≤12), or a substituted version of either of these groups;b is 1, 2, 3, 4, 5, or 6; and z is 1, 2, 3; provided that the sum of z and y is 3; or the core has the formula: (D-IV) wherein:X3 is −NR6−, wherein R6 is hydrogen, alkyl(C≤8), or substituted alkyl(C≤8), −O−, or alkylaminodiyl(C≤8), alkoxydiyl(C≤8), arenediyl(C≤8), heteroarenediyl(C≤8), heterocycloalkanediyl(C≤8), or a substituted version of any of these groups; R3 and R4 are each independently amino, hydroxy, or mercapto, or alkylamino(C≤12), dialkylamino(C≤12), or a substituted version of either of these groups; or a group of the formula: −N(Rf)f(CH2CH2N(Rc))eRd, ore and f are each independently 1, 2, or 3; provided that the sum of e and f is 3; Rc, Rd, and Rf are each independently hydrogen, alkyl(C≤6), or substituted alkyl(C≤6); c and d are each independently 1, 2, 3, 4, 5, or 6; or the core is alkylamine(C≤18), dialkylamine(C≤36), heterocycloalkane(C≤12), or a substituted version of any of these groups; wherein the repeating unit comprises a degradable diacyl and a linker; the degradable diacyl group has the formula: II)wherein: A1and A2are each independently −O− , -S-, or −NRa−, wherein: Ra is hydrogen, alkyl(C≤6), or substituted alkyl(C≤6); Y3is alkanediyl(C≤12), alkenediyl(C≤12), arenediyl(C≤12), or a substituted version of any of these groups; or a group of the formula: orX3and X4are alkanediyl(C≤12), alkenediyl(C≤12), arenediyl(C≤12), or a substituted version of any of these groups; Y5 is a covalent bond, alkanediyl(C≤12), alkenediyl(C≤12), arenediyl(C≤12), or a substituted version of any of these groups; and R9is alkyl(C≤8)or substituted alkyl(C≤8); the linker group has the formula: I) wherein:Y1is alkanediyl(C≤12), alkenediyl(C≤12), arenediyl(C≤12), or a substituted version of any of these groups; and wherein when the repeating unit comprises a linker group, then the linker group comprises an independent degradable diacyl group attached to both the nitrogen and the sulfur atoms of the linker group if n is greater than 1, wherein the first group in the repeating unit is a degradable diacyl group, wherein for each linker group, the next repeating unit comprises two degradable diacyl groups attached to the nitrogen atom of the linker group; and wherein n is the number of linker groups present in the repeating unit; and the terminating group has the formula: II) wherein:Y4is alkanediyl(C≤18)or an alkanediyl(C≤18)wherein one or more of the hydrogen atoms on the alkanediyl(C≤18)has been replaced with −OH, −F, −Cl, −Br, −I, −SH, −OCH3, −OCH2CH3, −SCH3, or −OC(O)CH3; R10is hydrogen, carboxy, hydroxy, or aryl(C≤12), alkylamino(C≤12), dialkylamino(C≤12), N-heterocycloalkyl(C≤12), −C(O)N(R11)−alkanediyl(C≤6)−heterocycloalkyl(C≤12), −C(O)−alkyl- amino(C≤12), −C(O)−dialkylamino(C≤12), −C(O)−N-heterocyclo- alkyl(C≤12), wherein: R11 is hydrogen, alkyl(C≤6), or substituted alkyl(C≤6); wherein the final degradable diacyl in the chain is attached to a terminating group; n is 0, 1, 2, 3, 4, 5, or 6; or a pharmaceutically acceptable salt thereof. In some embodiments, the terminating group is further defined by the formula: II) wherein:Y4is alkanediyl(C≤18); and R10 is hydrogen. In some embodiments, A1and A2are each independently −O− or −NRa−. In some embodiments of the dendrimer or dendron of formula (D-I), the core is further defined by the formula: (D-III) wherein: X2 is N(R5)y; R5is hydrogen or alkyl(C≤8), or substituted alkyl(C≤18); and y is 0, 1, or 2, provided that the sum of y and z is 3; R2is amino, hydroxy, or mercapto, or alkylamino(C≤12), dialkylamino(C≤12), or a substituted version of either of these groups; b is 1, 2, 3, 4, 5, or 6; and z is 1, 2, 3; provided that the sum of z and y is 3.In some embodiments of the dendrimer or dendron of formula (D-I), the core is further defined by the formula: (D-IV) wherein:X3is −NR6−, wherein R6is hydrogen, alkyl(C≤8), or substituted alkyl(C≤8), −O−, or alkylaminodiyl(C≤8), alkoxydiyl(C≤8), arenediyl(C≤8), heteroarenediyl(C≤8), heterocycloalkanediyl(C≤8), or a substituted version of any of these groups; R3 and R4 are each independently amino, hydroxy, or mercapto, or alkylamino(C≤12), dialkylamino(C≤12), or a substituted version of either of these groups; or a group of the formula: −N(Rf)f(CH2CH2N(Rc))eRd, ore and f are each independently 1, 2, or 3; provided that the sum of e and f is 3; Rc, Rd, and Rf are each independently hydrogen, alkyl(C≤6), or substituted alkyl(C≤6); c and d are each independently 1, 2, 3, 4, 5, or 6. In some embodiments of the dendrimer or dendron of formula (I), the terminating group is represented by the formula: ),Y4is alkanediyl(C≤18); and R10 is hydrogen. In some embodiments of the dendrimer or dendron of formula (D-I), the core is further defined as:, , , ,In some embodiments of the dendrimer or dendron of formula (D-I), the degradable diacyl is further defined as: .In some embodiments of the dendrimer or dendron of formula (D-I), the linker is further defined as ), wherein Y1is alkanediyl(C≤8)or substituted alkanediyl(C≤8).1. In some embodiments of the dendrimer or dendron of formula (D-I), the dendrimer or dendron is selected from the group consisting of:,, or, , or;. B. Dendrimers or dendrons of Formula (X) A. In some embodiments of the lipid composition, the ionizable cationic lipid is a dendrimer or dendron of the formula . In some embodiments, the ionizable cationic lipid is a dendrimer or dendron of the formula.B. In some embodiments of the lipid composition, the ionizable cationic lipid is a dendrimer or dendron of a generation (g) having a structural formula:,or a pharmaceutically acceptable salt thereof, wherein: (a) the core comprises a structural formula (XCore):, wherein:Q is independently at each occurrence a covalent bond, -O-, -S-, -NR2-, or - CR3aR3b-; R2is independently at each occurrence R1gor -L2-NR1eR1f; R3aand R3bare each independently at each occurrence hydrogen or an optionally substituted (e.g., C1-C6, such as C1-C3) alkyl; R1a, R1b, R1c, R1d, R1e, R1f, and R1g(if present) are each independently at each occurrence a point of connection to a branch, hydrogen, or an optionally substituted (e.g., C1-C12) alkyl; L0, L1, and L2are each independently at each occurrence selected from a covalent bond, alkylene, heteroalkylene, [alkylene]-[heterocycloalkyl]-[alkylene], [alkylene]-(arylene)-[alkylene], heterocycloalkyl, and arylene; or, alternatively, part of L1form a (e.g., C4-C6) heterocycloalkyl (e.g., containing one or two nitrogen atoms and, optionally, an additional heteroatom selected from oxygen and sulfur) with one of R1cand R1d; and x1is 0, 1, 2, 3, 4, 5, or 6; and (b) each branch of the plurality (N) of branches independently comprises a structural formula (XBranch): , wherein: * indicates a point of attachment of the branch to the core; g is 1, 2, 3, or 4; Z = 2(g-1); G=0, when g=1; or G = ∑^^^^^^^^2i, when g≠1; (c) each diacycomprises a structural formula n:p ent of the diacyl group at the proximalend thereof; ** indicates a point of attachment of the diacyl group at the distal end thereof; Y3is independently at each occurrence an optionally substituted (e.g., C1-C12); alkylene, an optionally substituted (e.g., C1-C12) alkenylene, or an optionally substituted (e.g., C1-C12) arenylene; A1and A2are each independently at each occurrence -O-, -S-, or -NR4- , wherein: R4is hydrogen or optionally substituted (e.g., C1-C6) alkyl; m1and m2are each independently at each occurrence 1, 2, or 3; and R3c, R3d, R3e, and R3fare each independently at each occurrence hydrogen or an optionally substituted (e.g., C1-C8) alkyl; and (d) each linker group independently comprises a structural formula ,** indicates a point of attachment of the linker to a proximal diacyl group; *** indicates a point of attachment of the linker to a distal diacyl group; and Y1 is independently at each occurrence an optionally substituted (e.g., C1-C12) alkylene, an optionally substituted (e.g., C1-C12) alkenylene, or an optionally substituted (e.g., C1-C12) arenylene; and (e) each terminating group is independently selected from optionally substituted (e.g., C1-C18, such as C4-C18) alkylthiol, and optionally substituted (e.g., C1- C18, such as C4-C18) alkenylthiol. In some embodiments of XCore, Q is independently at each occurrence a covalent bond, -O-, -S-, -NR2-, or -CR3aR3b. In some embodiments of XCore Q is independently at each occurrence a covalent bond. In some embodiments of XCoreQ is independently at each occurrence an -O-. In some embodiments of XCore Q is independently at each occurrence a - S-. In some embodiments of XCoreQ is independently at each occurrence a -NR2and R2isindependently at each occurrence R1gor -L2-NR1eR1f. In some embodiments of XCoreQ is independently at each occurrence a -CR3aR3bR3a, and R3aand R3bare each independently at each occurrence hydrogen or an optionally substituted alkyl (e.g., C1-C6, such as C1-C3). In some embodiments of XCore, R1a, R1b, R1c, R1d, R1e, R1f, and R1g(if present) are each independently at each occurrence a point of connection to a branch, hydrogen, or an optionally substituted alkyl. In some embodiments of XCore, R1a, R1b, R1c, R1d, R1e, R1f, and R1g(if present) are each independently at each occurrence a point of connection to a branch, hydrogen. In some embodiments of XCore, R1a, R1b, R1c, R1d, R1e, R1f, and R1g(if present) are each independently at each occurrence a point of connection to a branch an optionally substituted alkyl (e.g., C1-C12). In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence selected from a covalent bond, alkylene, heteroalkylene, [alkylene]- [heterocycloalkyl]-[alkylene], [alkylene]-(arylene)-[alkylene], heterocycloalkyl, and arylene; or, alternatively, part of L1form a heterocycloalkyl (e.g., C4-C6 and containing one or two nitrogen atoms and, optionally, an additional heteroatom selected from oxygen and sulfur) with one of R1cand R1d. In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence can be a covalent bond. In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence can be a hydrogen. In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence can be an alkylene (e.g., C1-C12, such as C1-C6 or C1-C3). In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence can be a heteroalkylene (e.g., C1-C12, such as C1-C8or C1-C6). In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence can be a heteroalkylene (e.g., C2-C8alkyleneoxide, such as oligo(ethyleneoxide)). In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence can be a [alkylene]-[heterocycloalkyl]-[alkylene] [(e.g., C1-C6) alkylene]-[(e.g., C4-C6) heterocycloalkyl]-[(e.g., C1-C6) alkylene]. In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence can be a [alkylene]-(arylene)-[alkylene] [(e.g., C1-C6) alkylene]-(arylene)-[(e.g., C1-C6) alkylene]. In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence can be a [alkylene]-(arylene)-[alkylene] (e.g., [(e.g., C1-C6) alkylene]-phenylene-[(e.g., C1-C6) alkylene]). In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence can be a heterocycloalkyl (e.g., C4- C6heterocycloalkyl). In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence can be an arylene (e.g., phenylene). In some embodiments of XCore, part of L1form a heterocycloalkyl with one of R1cand R1d. In some embodiments of XCore, part of L1form a heterocycloalkyl (e.g., C4-C6heterocycloalkyl) with one of R1cand R1dand the heterocycloalkyl can contain one or two nitrogen atoms and, optionally, an additional heteroatom selected from oxygen and sulfur. In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence selected from a covalent bond, C1-C6 alkylene (e.g., C1-C3 alkylene), C2-C12 (e.g., C2-C8) alkyleneoxide (e.g., oligo(ethyleneoxide), such as -(CH2CH2O)1-4-(CH2CH2)-), [(C1- C4) alkylene]-[(C4-C6) heterocycloalkyl]-[(C1-C4) alkylene] (e.g ), and[(C1-C4) alkylene]-phenylene-[(C1-C4) alkylene] (e.g. ). In some embodiments of XCore, L0, L1, and L2are each independentlce selected from C1-C6alkylene (e.g., C1-C3alkylene), -(C1-C3alkylene-O)1-4-(C1-C3alkylene), -(C1-C3alkylene)-phenylene-(C1-C3 alkylene)-, and -(C1-C3 alkylene)-piperazinyl-(C1-C3 alkylene)-. In some embodiments of XCore,L0, L1, and L2are each independently at each occurrence C1- C6 alkylene (e.g., C1-C3 alkylene). In some embodiments, L0, L1, and L2are each independently at each occurrence C2-C12 (e.g., C2-C8) alkyleneoxide (e.g., -(C1-C3 alkylene- O)1-4-(C1-C3alkylene)). In some embodiments of XCore, L0, L1, and L2are each independently at each occurrence selected from [(C1-C4) alkylene]-[(C4-C6) heterocycloalkyl]-[(C1-C4) alkylene] (e.g., -(C1-C3alkylene)-phenylene-(C1-C3alkylene)-) and [(C1-C4) alkylene]-[(C4- C6) heterocycloalkyl]-[(C1-C4) alkylene] (e.g., -(C1-C3 alkylene)-piperazinyl-(C1-C3 alkylene)-). In some embodiments of XCore, x1is 0, 1, 2, 3, 4, 5, or 6. In some embodiments of XCore,x1is 0. In some embodiments of XCore, x1is 1. In some embodiments of XCore, x1is 2. In some embodiments of XCore, x1is 0. In some embodiments of XCore, x1is 1. In some embodiments of XCore,x1is 2. In some embodiments of XCore,x1is 3. In some embodiments of XCore x1is 4. In some embodiments of XCore x1is 5. In some embodiments of XCore, x1is 6. 2. In some embodiments of XCore, the core comprises a structural formula: ). In some embodiments of XCore, the corecomprises a structural formula .. In some embodiments of XCore, thecore comprises a structural formula ,). In someembodiments of XCore, the core comprises a structural formula(e.g., ). In some embodiments of XCore, the core comprises a structural formula: . In some embodiments of XCore, the core comprises astructural formula: ,In someembodiments of XCore, the core comprises a structural formula(e.g., ). In someembodiments of XCore, the core comprises a structural formula , wherein Q’ is -NR2- or -CR3aR3b-; q1 and q2 are each indepe omeembodiments of XCore, the core comprises a structural formula .g.,me or 1c 1d , tedme embodiments of XCore, the core comprises has a structural formu . In some embodiments of XCore, the core comprises a structura ormu a set orth in Table A and pharmaceutically acceptable salts thereof, wherein * indicates a point ofattachment of the core to a branch of the plurality of branches. In some embodiments, the example cores of Table. A are not limited to the stereoisomers (i.e., enantiomers, diastereomers) listed. Table A. Example core structures ID # Structure2A2-12A83A55A2-35A3-2 (6 rm)In some embodiments of XCore, the core comprises a structural formula selected from , , , , ,, , ,, and pharmaceutically acceptable salts thereof, wherein * indicates at of the core to a branch of the plurality of branches or H. In some embodiments, wherein * indicates a point of attachment of the core to a branch of the plurality of branches. In some embodiments of XCore, the core has the structure , wherein * indicates a point of attachment of the core to abranches or H. In some embodiments, at least 2 branches are attached to the core. In some embodiments, at least 3 branches are attached to the core. In some embodiments, at least 4 branches are attached to the core. In some embodiments of XCore, the core has the structure , wherein * indicates a point of attachment of the core to a branch of the plurality of branches or H. In some embodiments, at least 4 branches are attached to the core. In some embodiments, at least 5 branches are attached to the core. In some embodiments, at least 6 branches are attached to the core.In some embodiments, the plurality (N) of branches comprises at least 3 branches, at least 4 branches, at least 5 branches. In some embodiments, the plurality (N) of branches comprises at least 3 branches. In some embodiments, the plurality (N) of branches comprises at least 4 branches. In some embodiments, the plurality (N) of branches comprises at least 5 branches. In some embodiments of XBranch, g is 1, 2, 3, or 4. In some embodiments of XBranch, g is 1. In some embodiments of XBranch, g is 2. In some embodiments of XBranch, g is 3. In some embodiments of XBranch, g is 4. In some embodiments of XBranch, Z = 2(g-1) and when g=1, G=0. In some embodiments of XBranch, Z = 2(g-1) and G =∑^^^^^^^^2i , when g≠1. In som b di f X =1 G=0 Z=1, and each branch of the plurality ofbranches comprises a structural formula each branch of the plurality of branches comprises a structural formula . In some embodiments of XBranch, g=2, G=1, Z=2, and each branch of the plurality of branches comprises a structural formula .f XBranch, g=3, G=3, Z=4, and each branch of the plurality of branches comprises a structural formula.In some embodiments of XBranch, g=4, G=7, Z=8, and each branch of the plurality of branches comprises a structural formula .tion (g) = 1 has the structure . In some embodiments, t e en rmers or en rons described herein with a generation(g) = 1 has the structure: . An example formulation ot e dendr mers or dendrons described herein for generations 1-4 is shown in Table B. The number of diacyl groups, linker groups, and terminating groups can be calculated based on g. Table B. Formulation of Dendrimer or Dendron Groups Based on Generation (g) g = 1 g = 2 g = 3 g = 4 1# of linker 0 1 1+2 1+2+221+2+…+2g-2grp la, * indicates a point of attachment of the diacyl group at the** indicates a point of attachment of the diacyl group at the distal end thereof. In some embodiments of the diacyl group of XBranch, Y3is independently at each occurrence an optionally substituted; alkylene, an optionally substituted alkenylene, or an optionally substituted arenylene. In some embodiments of the diacyl group of XBranch, Y3is independently at each occurrence an optionally substituted alkylene (e.g., C1-C12). In some embodiments of the diacyl group of XBranch, Y3is independently at each occurrence an optionally substituted alkenylene (e.g., C1-C12). In some embodiments of the diacyl group of XBranch, Y3is independently at each occurrence an optionally substituted arenylene (e.g., C1- C12). In some embodiments of the diacyl group of XBranch, A1and A2are each independently at each occurrence -O-, -S-, or -NR4-. In some embodiments of the diacyl group of XBranch, A1and A2are each independently at each occurrence -O-. In some embodiments of the diacyl group of XBranch, A1and A2are each independently at each occurrence -S-. In some embodiments of the diacyl group of XBranch, A1and A2are each independently at each occurrence -NR4- and R4is hydrogen or optionally substituted alkyl (e.g., C1-C6). In some embodiments of the diacyl group of XBranch, m1and m2are each independently at each occurrence 1, 2, or 3. In some embodiments of the diacyl group of XBranch, m1and m2are each independently at each occurrence 1. In some embodiments of the diacyl group of XBranch, m1and m2are each independently at each occurrence 2. In some embodiments of the diacyl group of XBranch, m1and m2are each independently at each occurrence 3. In some embodiments of the diacyl group of XBranch, R3c, R3d, R3e, and R3fare each independently at each occurrence hydrogen or an optionally substituted alkyl. In some embodiments of the diacyl group of XBranch, R3c, R3d, R3e, and R3fare each independently at each occurrence hydrogen. In some embodiments of the diacyl group of XBranch, R3c, R3d, R3e,and R3fare each independently at each occurrence an optionally substituted (e.g., C1-C8) alkyl. In some embodiments of the diacyl group, A1is -O- or -NH-. In some embodiments of the diacyl group, A1is -O-. In some embodiments of the diacyl group, A2is -O- or -NH-. In some embodiments of the diacyl group, A2is -O-. In some embodiments of the diacyl group, Y3is C1-C12(e.g., C1-C6, such as C1-C3) alkylene. In some embodiments of the diacyl group, the diacyl group independently at each occurrence comprises a structural formula (e.g.,R3c,In some embodiments, linker group independently comprises a structural formula , ** indicates a point of attachment of the linker to a proximal diacyl group,and *** indicates a point of attachment of the linker to a distal diacyl group. In some embodiments of the linker group of XBranchif present, Y1is independently at each occurrence an optionally substituted alkylene, an optionally substituted alkenylene, or an optionally substituted arenylene. In some embodiments of the linker group of XBranchif present, Y1 is independently at each occurrence an optionally substituted alkylene (e.g., C1- C12). In some embodiments of the linker group of XBranchif present, Y1is independently at each occurrence an optionally substituted alkenylene (e.g., C1-C12). In some embodiments of the linker group of XBranchif present, Y1is independently at each occurrence an optionally substituted arenylene (e.g., C1-C12). In some embodiments of the terminating group of XBranch, each terminating group is independently selected from optionally substituted alkylthiol and optionally substituted alkenylthiol. In some embodiments of the terminating group of XBranch, each terminating group is an optionally substituted alkylthiol (e.g., C1-C18, such as C4-C18). In some embodiments of the terminating group of XBranch, each terminating group is optionally substituted alkenylthiol (e.g., C1-C18, such as C4-C18).In some embodiments of the terminating group of XBranch, each terminating group is independently C1-C18alkenylthiol or C1-C18alkylthiol, and the alkyl or alkenyl moiety is optionally substituted with one or more substituents each independently selected from halogen, C6-C12aryl, C1-C12alkylamino, C4-C6N-heterocycloalkyl , -OH, -C(O)OH, −C(O)N(C1-C3 alkyl)−(C1-C6 alkylene)−(C1-C12 alkylamino), −C(O)N(C1-C3 alkyl)−(C1-C6 alkylene)−(C4-C6N-heterocycloalkyl), −C(O)−(C1-C12alkylamino), and −C(O)−(C4-C6N- heterocycloalkyl), and the C4-C6 N-heterocycloalkyl moiety of any of the preceding substituents is optionally substituted with C1-C3alkyl or C1-C3hydroxyalkyl. In some embodiments of the terminating group of XBranch, each terminating group is independently C1-C18(e.g., C4-C18) alkenylthiol or C1-C18(e.g., C4-C18) alkylthiol, wherein the alkyl or alkenyl moiety is optionally substituted with one or more substituents each independently selected from halogen, C6-C12 aryl (e.g., phenyl), C1-C12 (e.g., C1-C8) alkylamino (e.g., C1-C6 mono-alkylamino (such as -NHCH2CH2CH2CH3) or C1-C8 di- alkylamino (such as )), C4-C6 N-heterocycloalkyl(e.g., N-pyrrolidinyl ( )), -OH, - C(O)OH, −C(O)N(C1-C3 alkyl)−(C1-C6alkylene)−(C1-C12alkylamino (e.g., mono- or di- N- di-alkylamino)), and −C(O)−(C4-C6 N-heterocycloalkyl ), wherein the C4-C6 N-heterocycloalkyl moiety of any of ths optionally substituted with C1-C3 alkyl or C1-C3 hydroxyalkyl. In some embodiments of the terminating group of XBranch, each terminating group is independently C1-C18 (e.g., C4-C18) alkylthiol, wherein the alkyl moiety is optionally substituted with one substituent -OH. In some embodiments of the terminating group of XBranch, each terminating group is independently C1- C18(e.g., C4-C18) alkylthiol, wherein the alkyl moiety is optionally substituted with onesubstituent selected from C1-C12(e.g., C1-C8) alkylamino (e.g., C1-C6mono-alkylamino (such as -NHCH2CH2CH2CH3) or C1-C8 di-alkylamino (such as ,6 N-heterocycloalkyl (e.g., N-pyrrolidinyl ), N-piperidinyl( ), N-azepanyl ( )). In some embodiments of the terminating group of XBranch, each terminating group is independently C1-C18 (e.g., C4-C18) alkenylthiol or C1-C18 (e.g., C4- C18) alkylthiol. In some embodiments of the terminating group of XBranch, each terminating group is independently C1-C18 (e.g., C4-C18) alkylthiol. In some embodiments of the terminating group of XBranch, each terminating group is independently a structural set forth in Table C. In some embodiments, the dendrimers or dendrons described herein can comprise a terminating group or pharmaceutically acceptable salt, or thereof selected in Table C. In some embodiments, the example terminating group of Table C are not limiting of the stereoisomers (i.e., enantiomers, diastereomers) listed. Table C. Example terminating group / peripheries structures ID # StructureID # StructureID # StructureID # Structure romtose set ort n a e an parmaceutca y accepta e sats tereo. Table D. Example Ionizable Cationic Lipo-dendrimers ID # Structure2A9- SC143A5- SC104A3- SC125A2- 2-5A3- 1-SC85A4- 1-SC85A5- SC125A2- 4-5A3- C12H25S 2- C12H25S O5A4- C12H25S 2- C12H25S O2A2- g2-2A11- g2-3A3- g2-2A11- g3-2A11- g3-1A2- g4-1A2- g4-4A3- g2-4A3- g2-1A2- g3-2A2- g3-5A2- 4-SC85A2- 2-SC84A3- SC75A4- 2-SC63A5- g2-C. Modifying the functional groups and / or the chemical properties of the core, repeating units, and the surface or terminating groups, their physical properties can be modulated. Some properties which can be varied include, but are not limited to, solubility, toxicity, immunogenicity and bioattachment capability. Dendrimers are often described by their generation or number of repeating units in the branches. A dendrimer consisting of only the core molecule is referred to as Generation 0, while each consecutive repeating unit along all branches is Generation 1, Generation 2, and so on until the terminating or surface group. In some embodiments, half generations are possible resulting from only the first condensation reaction with the amine and not the second condensation reaction with the thiol. Preparation of dendrimers requires a level of synthetic control achieved through series of stepwise reactions comprising building the dendrimer by each consecutive group. Dendrimer synthesis can be of the convergent or divergent type. During divergent dendrimer synthesis, the molecule is assembled from the core to the periphery in a stepwise process involving attaching one generation to the previous and then changing functional groups for the next stage of reaction. Functional group transformation is necessary to prevent uncontrolled polymerization. Such polymerization would lead to a highly branched molecule that is not monodisperse and is otherwise known as a hyperbranched polymer. Due to steric effects, continuing to react dendrimer repeat units leads to a sphere shaped or globularmolecule, until steric overcrowding prevents complete reaction at a specific generation and destroys the molecule's monodispersity. Thus, in some embodiments, the dendrimers of G1- G10 generation are specifically contemplated. In some embodiments, the dendrimers comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 repeating units, or any range derivable therein. In some embodiments, the dendrimers used herein are G0, G1, G2, or G3. However, the number of possible generations (such as 11, 12, 13, 14, 15, 20, or 25) may be increased by reducing the spacing units in the branching polymer. Additionally, dendrimers have two major chemical environments: the environment created by the specific surface groups on the termination generation and the interior of the dendritic structure which due to the higher order structure can be shielded from the bulk media and the surface groups. Because of these different chemical environments, dendrimers have found numerous different potential uses including in therapeutic applications. In some aspects, the dendrimers that may be used in the present compositions are assembled using the differential reactivity of the acrylate and methacrylate groups with amines and thiols. The dendrimers may include secondary or tertiary amines and thioethers formed by the reaction of an acrylate group with a primary or secondary amine and a methacrylate with a mercapto group. Additionally, the repeating units of the dendrimers may contain groups which are degradable under physiological conditions. In some embodiments, these repeating units may contain one or more germinal diethers, esters, amides, or disulfides groups. In some embodiments, the core molecule is a monoamine which allows dendritic polymerization in only one direction. In other embodiments, the core molecule is a polyamine with multiple different dendritic branches which each may comprise one or more repeating units. The dendrimer may be formed by removing one or more hydrogen atoms from this core. In some embodiments, these hydrogen atoms are on a heteroatom such as a nitrogen atom. In some embodiments, the terminating group is a lipophilic groups such as a long chain alkyl or alkenyl group. In other embodiments, the terminating group is a long chain haloalkyl or haloalkenyl group. In other embodiments, the terminating group is an aliphatic or aromatic group containing an ionizable group such as an amine (−NH2) or a carboxylic acid (−CO2H). In still other embodiments, the terminating group is an aliphatic or aromatic group containing one or more hydrogen bond donors such as a hydroxide group, an amide group, or an ester. In some embodiments, the compositions may further comprise a molar ratio of the ionizable lipids to the total lipid composition from about 15 to about 60. In some embodiments, the molar ratio is from about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, to about 60or any range derivable therein. In some embodiments, the molar ratio is from about 30 to about 45. The cationic ionizable lipids of the present disclosure may contain one or more asymmetrically-substituted carbon or nitrogen atoms, and may be isolated in optically active or racemic form. Thus, all chiral, diastereomeric, racemic form, epimeric form, and all geometric isomeric forms of a chemical formula are intended, unless the specific stereochemistry or isomeric form is specifically indicated. Cationic ionizable lipids may occur as racemates and racemic mixtures, single enantiomers, diastereomeric mixtures and individual diastereomers. In some embodiments, a single diastereomer is obtained. The chiral centers of the cationic ionizable lipids of the present disclosure can have the S or the R configuration. Furthermore, it is contemplated that one or more of the cationic ionizable lipids may be present as constitutional isomers. In some embodiments, the compounds have the same formula but different connectivity to the nitrogen atoms of the core. Without wishing to be bound by any theory, it is believed that such cationic ionizable lipids exist because the starting monomers react first with the primary amines and then statistically with any secondary amines present. Thus, the constitutional isomers may present the fully reacted primary amines and then a mixture of reacted secondary amines. Chemical formulas used to represent cationic ionizable lipids of the present disclosure will typically only show one of possibly several different tautomers. For example, many types of ketone groups are known to exist in equilibrium with corresponding enol groups. Similarly, many types of imine groups exist in equilibrium with enamine groups. Regardless of which tautomer is depicted for a given formula, and regardless of which one is most prevalent, all tautomers of a given chemical formula are intended. The cationic ionizable lipids of the present disclosure may also have the advantage that they may be more efficacious than, be less toxic than, be longer acting than, be more potent than, produce fewer side effects than, be more easily absorbed than, and / or have a better pharmacokinetic profile (e.g., higher oral bioavailability and / or lower clearance) than, and / or have other useful pharmacological, physical, or chemical properties over, compounds known in the prior art, whether for use in the indications stated herein or otherwise. In addition, atoms making up the cationic ionizable lipids of the present disclosure are intended to include all isotopic forms of such atoms. Isotopes, as used herein, include those atoms having the same atomic number but different mass numbers. By way of general example and without limitation, isotopes of hydrogen include tritium and deuterium, and isotopes of carbon include13C and14C.It should be recognized that the particular anion or cation forming a part of any salt form of a cationic ionizable lipids provided herein is not critical, so long as the salt, as a whole, is pharmacologically acceptable. Additional examples of pharmaceutically acceptable salts and their methods of preparation and use are presented in Handbook of Pharmaceutical Salts: Properties, and Use (2002), which is incorporated herein by reference. D. Additional Lipids in the Lipid Nanoparticles In some aspects of the present disclosure, compositions containing one or more lipids are mixed with the cationic ionizable lipids to create a composition. In some embodiments, the polymers are mixed with 1, 2, 3, 4, or 5 different types of lipids. It is contemplated that the cationic ionizable lipids can be mixed with multiple different lipids of a single type. In some embodiments, the cationic ionizable lipids compositions comprise at least a steroid or a steroid derivative, a PEG lipid, and a phospholipid. Steroids and Steroid Derivatives In some aspects of the present disclosure, the cationic ionizable lipids are mixed with one or more steroid or a steroid derivative to create a composition. In some embodiments, the steroid or steroid derivative comprises any steroid or steroid derivative. As used herein, in some embodiments, the term “steroid” is a class of compounds with a four ring 17 carbon cyclic structure which can further comprises one or more substitutions including alkyl groups, alkoxy groups, hydroxy groups, oxo groups, acyl groups, or a double bond between two or more carbon atoms. In one aspect, the ring structure of a steroid comprises three fused cyclohexyl rings and a fused cyclopentyl ring as shown in the formula below: . In some embodiments, a stomprises the ring structure above with one or more non-alkyl substitutions. In some embodiments, the steroid or steroid derivative is a sterol wherein the formula is further defined as: .In some embodiments of the present disclosure, the steroid or steroid derivative is a cholestane or cholestane derivative. In a cholestane, the ring structure is further defined by the formula: As described above, includes one or more non-alkylsubstitution of the above ring system. In some embodiments, the cholestane or cholestane derivative is a cholestene or cholestene derivative or a sterol or a sterol derivative. In other embodiments, the cholestane or cholestane derivative is both a cholestere and a sterol or a derivative thereof.
[0004] In some embodiments, the compositions may further comprise a molar ratio of the steroid to the total lipid composition from about 10 to about 60. In some embodiments, the molar ratio is from about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, to about 60 or any range derivable therein. In some embodiments, the molar ratio is from about 25 to about 50 such as 30. Polymer conjugated lipids In some aspects of the present disclosure, the polymers are mixed with one or more polymer conjugated lipid such as PEGylated lipids (or PEG lipid) to create a dendrimer composition. In some embodiments, the present disclosure comprises using any lipid to which a PEG group has been attached. In some embodiments, the PEG lipid is a diglyceride which also comprises a PEG chain attached to the glycerol group. In other embodiments, the PEG lipid is a compound which contains one or more C6-C24 long chain alkyl or alkenyl group or a C6-C24 fatty acid group attached to a linker group with a PEG chain. Some non- limiting examples of a PEG lipid includes a PEG modified phosphatidylethanolamine and phosphatidic acid, a PEG ceramide conjugated, PEG modified dialkylamines and PEG modified 1,2-diacyloxypropan-3-amines, PEG modified diacylglycerols and dialkylglycerols. In some embodiments, PEG modified diastearoylphosphatidylethanolamine or PEG modified dimyristoyl-sn-glycerol. In some embodiments, the PEG modification is measured by the molecular weight of PEG component of the lipid. In some embodiments, the PEG modification has a molecular weight from about 100 to about 15,000. In some embodiments,the molecular weight is from about 200 to about 500, from about 400 to about 5,000, from about 500 to about 3,000, or from about 1,200 to about 3,000. The molecular weight of the PEG modification is from about 100, 200, 400, 500, 600, 800, 1,000, 1,250, 1,500, 1,750, 2,000, 2,250, 2,500, 2,750, 3,000, 3,500, 4,000, 4,500, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 12,500, to about 15,000. Some non-limiting examples of lipids that may be used in the present invention are taught by U.S. Patent 5,820,873, WO 2010 / 141069, or U.S. Patent 8,450,298, which is incorporated herein by reference. In another aspect, the PEG lipid has the formula: wherein: R12and R13are eachlkenyl(C≤24), or a substituted version of either of these groups; Re is hydrogen, alkyl(C≤8), or substituted alkyl(C≤8); and x is 1-250. In some embodiments, Reis alkyl(C≤8)such as methyl. R12and R13are each independently alkyl(C≤4-20). In some embodiments, x is 5-250. In one embodiment, x is 5-125 or x is 100- 250. In some embodiments, the PEG lipid is 1,2-dimyristoyl-sn-glycerol, methoxypolyethylene glycol.
[0005] In another aspect, the PEG lipid has the formula: S n2 OOn3 wherein: n1 is aependently selected from an integer between 1 and 29. In some embodiments, n1is 5, 10, 15, 20, 25, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100, or any range derivable therein. In some embodiments, n1is from about 30 to about 50. In some embodiments, n2 is from 5 to 23. In some embodiments, n2 is 11 to about 17. In some embodiments, n3is from 5 to 23. In some embodiments, n3is 11 to about 17. In some embodiments, the compositions may further comprise a molar ratio of the PEG lipid to the ionizable total lipid composition from about 0.25, 0.5, 0.75, 1, 1.5, 2, 2.5, 3,4, 5, 6, 8, 10, 12, to about 12.5 or any range derivable therein. In some embodiments, the molar ratio is from about 1 to about 6. Phospholipids In some aspects of the present disclosure, the polymers are mixed with one or more phospholipids to create a composition. In particular, the phospholipids, in some embodiments, is a neutral phospholipid. In some embodiments, any lipid which also comprises a phosphate group. In some embodiments, the phospholipid is a structure which contains one or two long chain C6-C24 alkyl or alkenyl groups, a glycerol or a sphingosine, one or two phosphate groups, and, optionally, a small organic molecule. In some embodiments, the small organic molecule is an amino acid, a sugar, or an amino substituted alkoxy group, such as choline or ethanolamine. In some embodiments, the phospholipid is a phosphatidylcholine. In some embodiments, the phospholipid is distearoylphosphatidylcholine or dioleoylphosphatidylethanolamine. In some embodiments, the compositions may further comprise a molar ratio of the phospholipid to the total lipid composition from about 5 to about 50. In some embodiments, the molar ratio is from about 5, 10, 15, 20, 25, 30, 35, 40, 45, to about 50 or any range derivable therein. In some embodiments, the molar ratio is from about 20 to about 40. E. Nucleic Acids In some aspects of the present disclosure, the compositions comprise one or more nucleic acids. In some embodiments, the composition comprises one or more nucleic acids present in a weight ratio to the ionizable lipid from about 5:1 to about 1:100. In some embodiments, the weight ratio of nucleic acid to dendrimer is from about 5:1, 2.5:1, 1:1, 1:5, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, 1:50, 1:60, 1:70, 1:80, 1:90, or 1:100, or any range derivable therein. In addition, it should be clear that the present disclosure is not limited to the specific nucleic acids disclosed herein. The present invention is not limited in scope to any particular source, sequence, or type of nucleic acid, however, as one of ordinary skill in the art could readily identify related homologs in various other sources of the nucleic acid including nucleic acids from non-human species (e.g., mouse, rat, rabbit, dog, monkey, gibbon, chimp, ape, baboon, cow, pig, horse, sheep, cat and other species). In some embodiments, the mRNA comprises from about 250 to about 15,000 nucleotides, from about 500 to about 5,000 nucleotides, from about 800 to about 2,500 nucleotides, or from about 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700,750, 800, 850, 900, 1,000, 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 11,000, 12,000, 13,000, 14,000, to about 15,000 nucleotides, or any range derivable therein. In some embodiments, the composition comprises a molar ratio of lipid components to nucleic acid components of from about 1,000:1 to about 5,000:1, from about 2,000:1 to about 4,000:1, or from about 1,000:1, 1,500:1, 2,000:1, 2,500:1, 3,000:1, 3,500:1, 4,000:1, 4,500:1, to about 1,500:1, or any range derivable therein. In some embodiments, the composition comprises an N:P ratio of from about 1:1 to about 20:1, from about 2:1 to about 10:1, from about 4:1 to about 8:1, or from about 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, to about 20:1, or any range derivable therein. Modified Nucleobases In some embodiments, the nucleic acids of the present disclosure comprise one or more modified nucleosides comprising a modified sugar moiety. Such compounds comprising one or more sugar-modified nucleosides may have desirable properties, such as enhanced nuclease stability or increased binding affinity with a target nucleic acid relative to an oligonucleotide comprising only nucleosides comprising naturally occurring sugar moieties. In some embodiments, modified sugar moieties are substituted sugar moieties. In some embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of substituted sugar moieties. In some embodiments, modified sugar moieties are substituted sugar moieties comprising one or more non-bridging sugar substituent, including but not limited to substituents at the 2' and / or 5' positions. Examples of sugar substituents suitable for the 2'- position, include, but are not limited to: 2'-F, 2'-OCH3 (“OMe” or “O-methyl”), and 2'- O(CH2)2OCH3 (“MOE”). In certain embodiments, sugar substituents at the 2' position is selected from allyl, amino, azido, thio, O-allyl, O--C1-C10 alkyl, O--C1-C10 substituted alkyl; OCF3, O(CH2)2SCH3, O(CH2)2--O--N(Rm)(Rn), and O--CH2--C(=O)--N(Rm)(Rn), where each Rm and Rn is, independently, H or substituted or unsubstituted C1-C10alkyl. Examples of sugar substituents at the 5'-position, include, but are not limited to: 5'-methyl (R or S); 5'- vinyl, and 5'-methoxy. In some embodiments, substituted sugars comprise more than one non-bridging sugar substituent, for example, T-F-5'-methyl sugar moieties (see, e.g., PCT International Application WO 2008 / 101157, for additional 5',2'-bis substituted sugar moieties and nucleosides).Nucleosides comprising 2'-substituted sugar moieties are referred to as 2'-substituted nucleosides. In some embodiments, a 2'-substituted nucleoside comprises a 2'-substituent group selected from halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O, S, or N(Rm)- alkyl; O, S, or N(Rm)-alkenyl; O, S or N(Rm)-alkynyl; O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2--O--N(Rm)(Rn) or O--CH2--C(=O)-- N(Rm)(Rn), where each Rmand Rnis, independently, H, an amino protecting group or substituted or unsubstituted C1-C10 alkyl. These 2'-substituent groups can be further substituted with one or more substituent groups independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy (S-alkyl), halogen, alkyl, aryl, alkenyl and alkynyl. In some embodiments, a 2'-substituted nucleoside comprises a 2'-substituent group selected from F, NH2, N3, OCF3, O--CH3, O(CH2)3NH2, CH2—CH=CH2, O--CH2—CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O--(CH2)2--O--N(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (O--CH2--C(=O)--N(Rm)(Rn) where each Rm and Rn is, independently, H, an amino protecting group or substituted or unsubstituted C1-C10 alkyl. In some embodiments, a 2'-substituted nucleoside comprises a sugar moiety comprising a 2'-substituent group selected from F, OCF3, O--CH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2--O--N(CH3)2, --O(CH2)2O(CH2)2N(CH3)2, and O--CH2--C(=O)-- N(H)CH3. In some embodiments, a 2'-substituted nucleoside comprises a sugar moiety comprising a 2'-substituent group selected from F, O--CH3, and OCH2CH2OCH3. Certain modified sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety. In some such embodiments, the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms. Examples of such 4' to 2' sugar substituents, include, but are not limited to: --[C(Ra)(Rb)]n--, -- [C(Ra)(Rb)]n--O--, --C(RaRb)--N(R)--O-- or, --C(RaRb)--O--N(R)--; 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)--O-2' (LNA); 4'-(CH2)--S-2'; 4'-(CH2)2--O-2' (ENA); 4'-CH(CH3)--O-2' (cEt) and 4'- CH(CH2OCH3)--O-2', and analogs thereof (see, e.g., U.S. Patent 7,399,845); 4'- C(CH3)(CH3)--O-2' and analogs thereof, (see, e.g., WO 2009 / 006478); 4'-CH2--N(OCH3)-2' and analogs thereof (see, e.g., WO2008 / 150729); 4'-CH2--O--N(CH3)-2' (see, e.g., US2004 / 0171570, published Sep. 2, 2004); 4'-CH2--O--N(R)-2', and 4'-CH2--N(R)--O-2'-, wherein each R is, independently, H, a protecting group, or C1-C12alkyl; 4'-CH2--N(R)--O-2', wherein R is H, C1-C12 alkyl, or a protecting group (see, U.S. Patent. 7,427,672); 4'-CH2-- C(H)(CH3)-2' (see, e.g., Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4'-CH2--C(=CH2)-2' and analogs thereof (see, PCT International Application WO 2008 / 154401). In some embodiments, such 4' to 2' bridges independently comprise from 1 to 4 linked groups independently selected from --[C(Ra)(Rb)]n--, --C(Ra)=C(Rb)--, --C(Ra)=N--, -- C(=NRa)--, --C(=O)--, --C(=S)--, --O--, --Si(Ra)2--, --S(=O)x--, and --N(Ra)--; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each Raand Rbis, independently, H, a protecting group, hydroxyl, C1-C12alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)--H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); and each J1and J2is, independently, H, C1-C12alkyl, substituted C1-C12alkyl, C2-C12alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20aryl, acyl (C(=O)--H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl, or a protecting group. Nucleosides comprising bicyclic sugar moieties are referred to as bicyclic nucleosides or BNAs. Bicyclic nucleosides include, but are not limited to, (A) α-L-Methyleneoxy (4'- CH2--O-2') BNA, (B) β-D-Methyleneoxy (4'-CH2--O-2') BNA (also referred to as locked nucleic acid or LNA), (C) Ethyleneoxy (4'-(CH2)2--O-2') BNA, (D) Aminooxy (4'-CH2--O-- N(R)-2') BNA, (E) Oxyamino (4'-CH2--N(R)--O-2') BNA, (F) Methyl(methyleneoxy) (4'- CH(CH3)--O-2') BNA (also referred to as constrained ethyl or cEt), (G) methylene-thio (4'- CH2--S-2') BNA, (H) methylene-amino (4'-CH2-N(R)-2') BNA, (I) methyl carbocyclic (4'- CH2--CH(CH3)-2') BNA, (J) propylene carbocyclic (4'-(CH2)3-2') BNA, and (K) Methoxy(ethyleneoxy) (4'-CH(CH2OMe)-O-2') BNA (also referred to as constrained MOE or cMOE). Additional bicyclic sugar moieties are known in the art, for example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 129(26) 8362-8379 (Jul. 4, 2007); Elayadi et al., Curr.Opinion Invens. Drugs, 2001, 2, 5561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; U.S. Patents 7,053,207, 6,268,490, 6,770,748, 6,794,499, 7,034,133, 6,525,191, 6,670,461, and 7,399,845; WO 2004 / 106356, WO 1994 / 14226, WO 2005 / 021570, and WO 2007 / 134181; U.S. Patent Publication Nos. US 2004 / 0171570, US 2007 / 0287831, and US 2008 / 0039618; U.S. Serial Nos. 12 / 129,154, 60 / 989,574, 61 / 026,995, 61 / 026,998, 61 / 056,564, 61 / 086,231, 61 / 097,787, and 61 / 099,844; and PCT International Applications Nos. PCT / US2008 / 064591, PCT / US2008 / 066154, and PCT / US2008 / 068922. In some embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, a nucleoside comprising a 4'-2' methylene-oxy bridge, may be in the α-L configuration or in the β-D configuration. Previously, α-L-methyleneoxy (4'-CH2--O-2') bicyclic nucleosides have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In some embodiments, substituted sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5'-substituted and 4'-2' bridged sugars; PCT International Application WO 2007 / 134181, wherein LNA is substituted with, for example, a 5'-methyl or a 5'-vinyl group). In some embodiments, modified sugar moieties are sugar surrogates. In some such embodiments, the oxygen atom of the naturally occurring sugar is substituted, e.g., with a sulfer, carbon or nitrogen atom. In some such embodiments, such modified sugar moiety also comprises bridging and / or non-bridging substituents as described above. For example, certain sugar surrogates comprise a 4'-sulfur atom and a substitution at the 2'-position (see, e.g., published U.S. Patent Application US 2005 / 0130923) and / or the 5' position. By way of additional example, carbocyclic bicyclic nucleosides having a 4'-2' bridge have been described (see, e.g., Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740). In some embodiments, sugar surrogates comprise rings having other than 5-atoms. For example, in some embodiments, a sugar surrogate comprises a six-membered tetrahydropyran. Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, C J. Bioorg. & Med. Chem. (2002) 10:841-854), and fluoro HNA (F-HNA).In some embodiments, the modified THP nucleosides of Formula VII are provided wherein q1, q2, q3, q4, q5, q6and q7are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6 and q7 is other than H. In some embodiments, at least one of q1, q2, q3, q4, q5, q6 and q7is methyl. In some embodiments, THP nucleosides of Formula VII are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is fluoro and R2 is H, R1 is methoxy and R2is H, and R1is methoxyethoxy and R2is H. Many other bicyclo and tricyclo sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds (see, e.g., review article: Leumann, J. C, Bioorganic & Medicinal Chemistry, 2002, 10, 841-854). Combinations of modifications are also provided without limitation, such as 2'-F-5'- methyl substituted nucleosides (see PCT International Application WO 2008 / 101157 for other disclosed 5',2'-bis substituted nucleosides) and replacement of the ribosyl ring oxygen atom with S and further substitution at the 2'-position (see U.S. Patent Publication US 2005 / 0130923) or alternatively 5'-substitution of a bicyclic nucleic acid (see PCT International Application WO 2007 / 134181 wherein a 4'-CH2--O-2' bicyclic nucleoside is further substituted at the 5' position with a 5'-methyl or a 5'-vinyl group). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (see, e.g., Srivastava et al., 2007). In some embodiments, the present invention provides oligonucleotides comprising modified nucleosides. Those modified nucleotides may include modified sugars, modified nucleobases, and / or modified linkages. The specific modifications are selected such that the resulting oligonucleotides possess desirable characteristics. In some embodiments, oligonucleotides comprise one or more RNA-like nucleosides. In some embodiments, oligonucleotides comprise one or more DNA-like nucleotides. In some embodiments, nucleosides of the present invention comprise one or more unmodified nucleobases. In certain embodiments, nucleosides of the present invention comprise one or more modified nucleobases. In some embodiments, modified nucleobases are selected from: universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases as defined herein. 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil; 5-propynylcytosine; 5- hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5- bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7- deazaguanine and 7-deazaadenine, 3-deazaguanine and 3-deazaadenine, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases as defined herein. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine([5,4-b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido[5,4- b][1,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g., 9-(2-aminoethoxy)-H-pyrimido[5,4-13][1,4]benzoxazin-2(3H)-one), carbazole cytidine (2H- pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido[3',2':4,5]pyrrolo[2,3- d]pyrimidin-2-one). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7- deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in U.S. Patent 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; those disclosed by Englisch et al., 1991; and those disclosed by Sanghvi, Y. S., 1993. Representative United States Patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, U.S. Patents 3,687,808; 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121; 5,596,091; 5,614,617; 5,645,985; 5,681,941; 5,750,692; 5,763,588; 5,830,653 and 6,005,096, each of which is herein incorporated by reference in its entirety. In some embodiments, the present invention provides oligonucleotides comprising linked nucleosides. In such embodiments, nucleosides may be linked together using any internucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters (P=O), phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates (P=S). Representative non-phosphorus containing internucleoside linking groups include, but are not limited to, methylenemethylimino (--CH2--N(CH3)--O--CH2--), thiodiester (--O--C(O)--S--), thionocarbamate (--O--C(O)(NH)--S--); siloxane (--O--Si(H)2--O--); and N,N'- dimethylhydrazine (--CH2--N(CH3)--N(CH3)--). Modified linkages, compared to naturalphosphodiester linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In some embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Representative chiral linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art. The oligonucleotides described herein contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), α or β such as for sugar anomers, or as (D) or (L) such as for amino acids etc. Included in the antisense compounds provided herein are all such possible isomers, as well as their racemic and optically pure forms. Neutral internucleoside linkages include without limitation, phosphotriesters, methylphosphonates, MMI (3'-CH2--N(CH3)--O-5'), amide-3 (3'-CH2--C(=O)--N(H)-5'), amide-4 (3'-CH2--N(H)--C(=O)-5'), formacetal (3'-O--CH2--O-5'), and thioformacetal (3'-S-- CH2--O-5'). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2component parts. Additional modifications may also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide and the 5' position of 5' terminal nucleotide. For example, one additional modification of the ligand conjugated oligonucleotides of the present invention involves chemically linking to the oligonucleotide one or more additional non-ligand moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., 1989), cholic acid (Manoharan et al., 1994), a thioether, e.g., hexyl-5-tritylthiol (Manoharan et al., 1992; Manoharan et al., 1993), a thiocholesterol (Oberhauser et al., 1992), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., 1991; Kabanov et al., 1990; Svinarchuk et al., 1993), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., 1995; Shea et al.,1990), a polyamine or a polyethylene glycol chain (Manoharan et al., 1995), or adamantane acetic acid (Manoharan et al., 1995), a palmityl moiety (Mishra et al., 1995), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., 1996). Representative United States patents that teach the preparation of such oligonucleotide conjugates include, but are not limited to, U.S. Patents 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, each of which is herein incorporated by reference. F. Cancer and Hyperproliferative Diseases While hyperproliferative diseases can be associated with any disease which causes a cell to begin to reproduce uncontrollably, the prototypical example is cancer. One of the key elements of cancer is that the cell’s normal apoptotic cycle is interrupted and thus agents that interrupt the growth of the cells are important as therapeutic agents for treating these diseases. In some embodiments, the target gene or transcript with which the guide polynucleotide may form a complex may be found in a human cell, such as a cancer cell. In some embodiments, the compounds of the disclosure may interfere with gene expression in a human cell, such as an cancer cell. The methods described in the present disclosure contemplate interference with gene expression of either or both a healthy cell or a cancerous cell. In this disclosure, the cell membrane disrupting compounds described herein may be used to lead to decreased cell counts and as such can potentially be used to treat a variety of types of cancer lines. In some aspects, it is anticipated that the compounds and compositions described herein may be used to treat virtually any malignancy. Cancer cells that may be treated with the compounds or compositions of the present disclosure include but are not limited to cells from the skin, bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestine, gum, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, pancreas, testis, tongue, cervix, or uterus. In addition, the cancer may specifically be of the following histological type, though it is not limited to these: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; giant andspindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyp; adenocarcinoma, familial polyposis coli; solid carcinoma; carcinoid tumor, malignant; branchiolo-alveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma; acidophil carcinoma; oxyphilic adenocarcinoma; basophil carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; nonencapsulating sclerosing carcinoma; adrenal cortical carcinoma; endometroid carcinoma; skin appendage carcinoma; apocrine adenocarcinoma; sebaceous adenocarcinoma; ceruminous adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; infiltrating duct carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; Paget's disease, mammary; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma w / squamous metaplasia; thymoma, malignant; ovarian stromal tumor, malignant; thecoma, malignant; granulosa cell tumor, malignant; androblastoma, malignant; sertoli cell carcinoma; Leydig cell tumor, malignant; lipid cell tumor, malignant; paraganglioma, malignant; extra-mammary paraganglioma, malignant; pheochromocytoma; glomangiosarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malignant melanoma in giant pigmented nevus; epithelioid cell melanoma; blue nevus, malignant; sarcoma; fibrosarcoma; fibrous histiocytoma, malignant; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; mixed tumor, malignant; Mullerian mixed tumor; nephroblastoma; hepatoblastoma; carcinosarcoma; mesenchymoma, malignant; Brenner tumor, malignant; phyllodes tumor, malignant; synovial sarcoma; mesothelioma, malignant; dysgerminoma; embryonal carcinoma; teratoma, malignant; struma ovarii, malignant; choriocarcinoma; mesonephroma, malignant; hemangiosarcoma; hemangioendothelioma, malignant; Kaposi's sarcoma; hemangiopericytoma, malignant; lymphangiosarcoma; osteosarcoma; juxtacortical osteosarcoma; chondrosarcoma; chondroblastoma, malignant; mesenchymal chondrosarcoma; giant cell tumor of bone; Ewing's sarcoma; odontogenic tumor, malignant; ameloblastic odontosarcoma; ameloblastoma, malignant; ameloblastic fibrosarcoma; pinealoma, malignant; chordoma; glioma, malignant; ependymoma;astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroblastoma; primitive neuroectodermal; cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; meningioma, malignant; neurofibrosarcoma; neurilemmoma, malignant; granular cell tumor, malignant; malignant lymphoma; Hodgkin's disease; paragranuloma; malignant lymphoma, small lymphocytic; malignant lymphoma, large cell, diffuse; malignant lymphoma, follicular; mycosis fungoides; other specified non-Hodgkin's lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myeloid sarcoma; and hairy cell leukemia. In certain aspects, the tumor may comprise an osteosarcoma, angiosarcoma, rhabdosarcoma, leiomyosarcoma, Ewing sarcoma, glioblastoma, neuroblastoma, or leukemia. G. Methods of Treatment Disclosed herein includes methods for treating a subject having or suspected of having a disease or disorder, such as a genetic disease or disorder or a disease or disorder associated with a mutation to one or more genes, the method comprising administering to the subject a lipid nanoparticle composition that may be used to target and / or modify a T cell. The subject may be a mammal. The subject may be a non-human species (e.g., mouse, rat, rabbit, dog, monkey, gibbon, chimp, ape, baboon, cow, pig, horse, sheep, cat and other species). The subject may be a human. The subject may be determined to exhibit a mutation in a gene. In some embodiments, the administering comprises systemic (e.g., intravenous) administration. In some embodiments, the subject is selected from the group consisting of mouse, rat, monkey, and human. In some embodiments, the subject is a human. The present disclosure provides methods of using the compositions in conjunction with other therapeutic modalities such as surgery, chemotherapy, radiotherapy, or immunotherapy. Chemotherapy A wide variety of chemotherapeutic agents may be used in accordance with the present embodiments. The term “chemotherapy” refers to the use of drugs to treat cancer. A “chemotherapeutic agent” is used to connote a compound or composition that is administered in the treatment of cancer. These agents or drugs are categorized by their mode of activity within a cell, for example, whether and at what stage they affect the cell cycle. Alternatively, an agent may be characterized based on its ability to directly cross-link DNA, to intercalateinto DNA, or to induce chromosomal and mitotic aberrations by affecting nucleic acid synthesis.Examples of chemotherapeutic agents include alkylating agents, such as thiotepa and cyclosphosphamide; alkyl sulfonates, such as busulfan, improsulfan, and piposulfan; aziridines, such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines, including altretamine, triethylenemelamine, trietylenephosphoramide, triethiylenethiophosphoramide, and trimethylolomelamine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin; callystatin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CB 1-TM1); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards, such as chlorambucil, chlomaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, and uracil mustard; nitrosureas, such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics, such as the enediyne antibiotics (e.g., calicheamicin, especially calicheamicin gammall and calicheamicin omegall); dynemicin, including dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antiobiotic chromophores, aclacinomysins, actinomycin, authramycin, azaserine, bleomycins, cactinomycin, carabicin, carminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6- diazo-5-oxo-L-norleucine, doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins, such as mitomycin C, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, and zorubicin; anti- metabolites, such as methotrexate and 5 -fluorouracil (5-FU); folic acid analogues, such as denopterin, pteropterin, and trimetrexate; purine analogs, such as fludarabine, 6- mercaptopurine, thiamiprine, and thioguanine; pyrimidine analogs, such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine , doxifluridine, enocitabine, and floxuridine; androgens, such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, and testolactone; anti- adrenals, such as mitotane and trilostane; folic acid replenisher, such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine;diaziquone; elformithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids, such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSKpolysaccharide complex; razoxane; rhizoxin; sizofiran; spirogermanium; tenuazonic acid; triaziquone; 2,2’,2”-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside (“Ara-C”); cyclophosphamide; taxoids, e.g., paclitaxel and docetaxel gemcitabine; 6-thioguanine; mercaptopurine; platinum coordination complexes, such as cisplatin, oxaliplatin, and carboplatin; vinblastine; platinum; etoposide (VP- 16); ifosfamide; mitoxantrone; vincristine; vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; irinotecan (e.g., CPT-11); topoisomerase inhibitor RFS 2000; difluorometlhylornithine (DFMO); retinoids, such as retinoic acid; capecitabine; carboplatin, procarbazine, plicomycin, gemcitabien, navelbine, famesyl-protein transferase inhibitors, transplatinum, and pharmaceutically acceptable salts, acids, or derivatives of any of the above.RadiotherapyOther factors that cause DNA damage and have been used extensively include what are commonly known as y-rays, X-rays, and / or the directed delivery of radioisotopes to tumor cells. Other forms of DNA damaging factors are also contemplated, such as micro waves, proton beam irradiation (U.S. Patents 5,760,395 and 4,870,287), and UV-irradiation. It is most likely that all of these factors affect a broad range of damage on DNA, on the precursors of DNA, on the replication and repair of DNA, and on the assembly and maintenance of chromosomes. Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 wk), to single doses of 2000 to 6000 roentgens. Dosage ranges for radioisotopes vary widely and depend on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells.ImmunotherapyThe skilled artisan will understand that immunotherapies may be used in combination or in conjunction with methods of the embodiments. In the context of cancer treatment, immunotherapeutics, generally, rely on the use of immune effector cells and molecules to target and destroy cancer cells. Rituximab (RITUXAN®) is such an example. The immune effector may be, for example, an antibody specific for some marker on the surface of a tumor cell. The antibody alone may serve as an effector of therapy or it may recruit other cells toactually affect cell killing. The antibody also may be conjugated to a drug or toxin (chemotherapeutic, radionuclide, ricin A chain, cholera toxin, pertussis toxin, etc.) and serve merely as a targeting agent. Alternatively, the effector may be a lymphocyte carrying a surface molecule that interacts, either directly or indirectly, with a tumor cell target. Various effector cells include cytotoxic T cells and NK cells.In one aspect of immunotherapy, the tumor cell must bear some marker that is amenable to targeting, i.e., is not present on the majority of other cells. Many tumor markers exist and any of these may be suitable for targeting in the context of the present embodiments. Common tumor markers include B-cell maturation antigen, CD20, carcinoembryonic antigen, tyrosinase (p97), gp68, GPRC5D, TAG-72, HMFG, Sialyl Lewis Antigen, MucA, MucB, PLAP, laminin receptor, erb B, and pl55. An alternative aspect of immunotherapy is to combine anticancer effects with immune-stimulatory effects. Immune stimulating molecules also exist including: cytokines, such as IL-2, IL-4, IL- 12, GM-CSF, gamma-IFN, chemokines, such as MIP-1, MCP-1, IL-8, and growth factors, such as FLT3 ligand.Examples of immunotherapies currently under investigation or in use are immune adjuvants, e.g., Mycobacterium bovis, Plasmodium falciparum, dinitrochlorobenzene, and aromatic compounds (U.S. Patents 5,801,005 and 5,739,169; Hui and Hashimoto, 1998; Christodoulides et al., 1998); cytokine therapy, e.g., interferons a, p, 8, to, and K, IL-1, GM- CSF, and TNF (Bukowski et al., 1998; Davidson et al., 1998; Hellstrand et al., 1998); gene therapy, e.g., TNF, IL-1 , IL-2, and p53 (Qin et al., 1998; Austin-Ward and Villaseca, 1998; U.S. Patents 5,830,880 and 5,846,945); and monoclonal antibodies, e.g., anti-CD20, antiganglioside GM2, and anti-pl85 (Hollander, 2012; Hanibuchi et al., 1998; U.S. Patent 5,824,311). It is contemplated that one or more anti-cancer therapies may be employed with the antibody therapies described herein.In some aspects, a combination described herein includes an agent that decreases tumor immunosuppression, such as a chemokine (C-X-C motif) receptor 2 (CXCR2) inhibitor. In some embodiments, the CXCR2 inhibitor is danirixin (CAS Registry Number: 954126-98-8). Danirixin is also known as GSK1325756 or l-(4-chloro-2-hydroxy-3- piperidin-3-ylsulfonylphenyl)-3-(3-fluoro-2-methylphenyl)urea. Danirixin is disclosed, e.g., in Miller et al. Eur J Drug Metab Pharmacokinet (2014) 39: 173-181 ; and Miller et al. BMC Pharmacology and Toxicology (2015), 16:18. In some embodiments, the CXCR2 inhibitor is reparixin (CAS Registry Number: 266359-83-5). Reparixin is also known as repertaxin or (2R)-2-[4-(2-methylpropyl)phenyl]-N-methylsulfonylpropanamide. Reparixin is a non-competitive allosteric inhibitor of CXCR1 / 2. Reparixin is disclosed, e.g., in Zarbock et al. British Journal of Pharmacology (2008), 1-8. In some embodiments, the CXCR2 inhibitor is navarixin. Navarixin is also known as MK-7123, SCH527123, PS291822, or 2-hydroxy-N,N- dimethyl-3-[[2-[[(lR)-l-(5-methylfuran-2-yl)propyl]amino]-3,4-dioxocyclobuten-l- yl]amino]benzamide Navarixin is disclosed, e.g., in Ning et al. Mol Cancer Ther. 2012; 11 (6): 1353-64. In some embodiments, the CXCR2 inhibitor is AZD5069, also known as N- [2-[[(2,3-difhioropheny)methyl]thio]-6-{ [(l R,2S)-2,3-dihydroxy-l-methylpropyl]oxy}-4- pyrimidinyl]-! -azetidinesulfonamide. In some embodiments, the CXCR2 inhibitor is an anti- CXCR2 antibody, such as those disclosed in W02020 / 028479.In some aspects, a combination described herein includes an agent that activates dendritic cells, such as, for example, a TLR agonist. A “TLR agonist” as defined herein is any molecule which activates a toll-like receptor as described in Bauer et al., 2001, Proc. Natl. Acad. Sci. USA 98: 9237-9242. A TLR agonist may be a small molecule, a recombinant protein, an antibody or antibody fragment, a nucleic acid, or a protein. In certain embodiments, the TLR agonist is recombinant, a natural ligand, an immunostimulatory nucleotide sequence, a small molecule, a purified bacterial extract or an inactivated bacteria preparation.Several agonists of TLR derived from microbes have been described, such as lipopolysaccharides, peptidoglycans, flagellin and lipoteichoic acid (Aderem et al., 2000, Nature 406:782-787; Akira et al., 2001, Nat. Immunol. 2: 675-680) Some of these ligands can activate different dendritic cell subsets, that express distinct patterns of TLRs (Kadowaki et al., 2001, J. Exp. Med. 194: 863-869). Therefore, a TLR agonist could be any preparation of a microbial agent that possesses TLR agonist properties. Certain types of untranslated DNA have been shown to stimulate immune responses by activating TLRs. In particular, immunostimulatory oligonucleotides containing CpG motifs have been widely disclosed and reported to activate lymphocytes (see, United States Patent No. 6,194,388). A “CpG motif’ as used herein is defined as an unmethylated cytosine-guanine (CpG) dinucleotide. Immunostimulatory oligonucleotides which contain CpG motifs can also be used as TLR agonists according to the methods of the present invention. The immunostimulatory nucleotide sequence may be stabilized by structure modification such as phosphorothioate modification or may be encapsulated in cationic liposomes to improve in vivo pharmacokinetics and tumor targeting.In some embodiments, the immunotherapy may be an immune checkpoint inhibitor. The present disclosure may also provide compositions that inhibit an immune checkpointImmune checkpoints either turn up a signal (e.g., co- stimulatory molecules) or turn down a signal. Immune checkpoints either turn up a signal (e.g., co-stimulatory molecules) or turn down a signal. Immune checkpoint proteins that may be targeted by immune checkpoint blockade include adenosine A2A receptor (A2AR), B7-H3 (also known as CD276), B and T lymphocyte attenuator (BTLA), CCL5, CD27, CD38, CD8A, CMKLR1, cytotoxic T- lymphocyte-associated protein 4 (CTLA-4, also known as CD152), CXCL9, CXCR5, glucocorticoid-induced tumour necrosis factor receptor-related protein (GITR), HLA-DRB1, ICOS (also known as CD278), HLA-DQA1 , HLA-E, indoleamine 2,3-dioxygenase 1 (IDO1 ), killer-cell immunoglobulin (KIR), lymphocyte activation gene-3 (LAG-3, also known as CD223), Mer tyrosine kinase (MerTK), NKG7, 0X40 (also known as CD134), programmed death 1 (PD-1), programmed death-ligand 1 (PD-L1, also known as CD274), PDCD1LG2, PSMB10, STAT1 , T cell immunoreceptor with Ig and ITIM domains (TIGIT), T-cell immunoglobulin domain and mucin domain 3 (TIM-3), and V-domain Ig suppressor of T cell activation (VISTA, also known as C10orf54). In particular, the immune checkpoint inhibitors target the PD- 1 axis and / or CTLA-4.The immune checkpoint inhibitors may be drugs, such as small molecules, recombinant forms of ligand or receptors, or antibodies, such as human antibodies (e.g., International Patent Publication W02015 / 016718; Pardoll, Nat Rev Cancer, 12(4): 252-264, 2012; both incorporated herein by reference). Known inhibitors of the immune checkpoint proteins or analogs thereof may be used, in particular chimeric, humanized, or human forms of antibodies may be used. As the skilled person will know, alternative and / or equivalent names may be in use for certain antibodies mentioned in the present disclosure. Such alternative and / or equivalent names are interchangeable in the context of the present disclosure. For example, it is known that lambrolizumab is also known under the alternative and equivalent names MK-3475 and pembrolizumab.In some embodiments, a PD-1 binding antagonist is a molecule that inhibits the binding of PD-1 to its ligand binding partners. In a specific aspect, the PD-1 ligand binding partners are PD-L1 and / or PD-L2. In another embodiment, a PD-L1 binding antagonist is a molecule that inhibits the binding of PD-L1 to its binding partners. In a specific aspect, PD- L1 binding partners are PD-1 and / or B7-1. In another embodiment, a PD-L2 binding antagonist is a molecule that inhibits the binding of PD-L2 to its binding partners. In a specific aspect, a PD-L2 binding partner is PD-1. The antagonist may be an antibody, an antigen-binding fragment thereof, an immunoadhesin, a fusion protein, or an oligopeptide. Exemplary antibodies are described in U.S. Patent Nos. 8,735,553, 8,354,509, and 8,008,449,all of which are incorporated herein by reference. Other PD-1 axis antagonists for use in the methods provided herein are known in the art, such as described in U.S. Patent Application Publication Nos. 2014 / 0294898, 2014 / 022021, and 201 1 / 0008369, all of which are incorporated herein by reference.In some embodiments, a PD-1 binding antagonist is an anti-PD-1 antibody (e.g., a human antibody, a humanized antibody, or a chimeric antibody). In some embodiments, the anti-PD-1 antibody is selected from the group consisting of nivolumab, pembrolizumab, and CT-011. In some embodiments, the PD-1 binding antagonist is an immunoadhesin (e.g., an immunoadhesin comprising an extracellular or PD-1 binding portion of PD-L1 or PD-L2 fused to a constant region (e.g., an Fc region of an immunoglobulin sequence)). In some embodiments, the PD-1 binding antagonist is AMP- 224. Nivolumab, also known as MDX- 1106-04, MDX-1106, ONO-4538, BMS-936558, and OPDIVO®, is an anti-PD-1 antibody described in W02006 / 121168. Pembrolizumab, also known as MK-3475, Merck 3475, lambrolizumab, KEYTRUDA®, and SCH-900475, is an anti-PD-1 antibody described in W02009 / 114335. CT-011, also known as hBAT or hBAT-1, is an anti-PD-1 antibody described in W02009 / 101611. AMP-224, also known as B7-DCIg, is a PD-L2-Fc fusion soluble receptor described in W02010 / 027827 and WO201 1 / 066342.Another immune checkpoint protein that can be targeted in the methods provided herein is the cytotoxic T-lymphocyte-associated protein 4 (CTLA-4), also known as CD 152. The complete cDNA sequence of human CTLA-4 has the Genbank accession number LI 5006. CTLA-4 is found on the surface of T cells and acts as an “off” switch when bound to CD80 or CD86 on the surface of antigen-presenting cells. CTLA-4 is similar to the T-cell costimulatory protein, CD28, and both molecules bind to CD80 and CD86, also called B7-1 and B7-2 respectively, on antigen-presenting cells. CTLA-4 transmits an inhibitory signal to T cells, whereas CD28 transmits a stimulatory signal. Intracellular CTLA-4 is also found in regulatory T cells and may be important to their function. T cell activation through the T cell receptor and CD28 leads to increased expression of CTLA-4, an inhibitory receptor for B7 molecules.In some embodiments, the immune checkpoint inhibitor is an anti-CTLA-4 antibody (e.g., a human antibody, a humanized antibody, or a chimeric antibody), an antigen-binding fragment thereof, an immunoadhesin, a fusion protein, or oligopeptide. Anti-human-CTLA-4 antibodies (or VH and / or VL domains derived therefrom) suitable for use in the present methods can be generated using methods well known in the art. Alternatively, art-recognized anti-CTLA-4 antibodies can be used. For example, the anti-CTLA-4 antibodies disclosed inUS Patent No. 8,119,129; PCT Publn. Nos. WO 01 / 14424, WO 98 / 42752, WO 00 / 37504 (CP675,206, also known as tremelimumab; formerly ticilimumab); U.S. Patent No. 6,207,156; Hurwitz et al. (1998) Proc Natl Acad Sci USA, 95(17): 10067-10071 ; Camacho et al. (2004) J Clin Oncology, 22(145): Abstract No. 2505 (antibody CP-675206); and Mokyr et al. (1998) Cancer Res, 58:5301-5304 can be used in the methods disclosed herein. The teachings of each of the aforementioned publications are hereby incorporated by reference. Antibodies that compete with any of these art-recognized antibodies for binding to CTLA-4 also can be used. For example, a humanized CTLA-4 antibody is described in International Patent Application No. W02001 / 014424, W02000 / 037504, and U.S. Patent No. 8,017,114; all incorporated herein by reference.An exemplary anti-CTLA-4 antibody is ipilimumab (also known as 10D1, MDX- 010, MDX- 101, and Yervoy®) or antigen-binding fragments and variants thereof (see, e.g., WO 01 / 14424). In other embodiments, the antibody comprises the heavy and light chain CDRs or VRs of ipilimumab. Accordingly, in one embodiment, the antibody comprises the CDR1, CDR2, and CDR3 domains of the VH region of ipilimumab, and the CDR1, CDR2, and CDR3 domains of the VL region of ipilimumab. In another embodiment, the antibody competes for binding with and / or binds to the same epitope on CTLA-4 as the above- mentioned antibodies. In another embodiment, the antibody has an at least about 90% variable region amino acid sequence identity with the above-mentioned antibodies (e.g., at least about 90%, 95%, or 99% variable region identity with ipilimumab). Other molecules for modulating CTLA-4 include CTLA-4 ligands and receptors such as described in U.S. Patent Nos. 5844905, 5885796 and International Patent Application Nos. WO1995001994 and WO1998042752; all incorporated herein by reference, and immunoadhesins such as described in U.S. Patent No. 8329867, incorporated herein by reference.Another immune checkpoint protein that can be targeted in the methods provided herein is lymphocyte-activation gene 3 (LAG-3), also known as CD223. The complete protein sequence of human LAG-3 has the Genbank accession number NP-002277. LAG-3 is found on the surface of activated T cells, natural killer cells, B cells, and plasmacytoid dendritic cells. LAG-3 acts as an “off’ switch when bound to MHC class II on the surface of antigen-presenting cells. Inhibition of LAG-3 both activates effector T cells and inhibitor regulatory T cells. In some embodiments, the immune checkpoint inhibitor is an anti-LAG-3 antibody (e.g., a human antibody, a humanized antibody, or a chimeric antibody), an antigenbinding fragment thereof, an immunoadhesin, a fusion protein, or oligopeptide. Anti-human- LAG-3 antibodies (or VH and / or VL domains derived therefrom) suitable for use in thepresent methods can be generated using methods well known in the art. Alternatively, art- recognized anti-LAG-3 antibodies can be used. An exemplary anti-LAG-3 antibody is relatlimab (also known as BMS-986016) or antigen-binding fragments and variants thereof (see, e.g., WO 2015 / 116539). Other exemplary anti-LAG-3 antibodies include TSR-033 (see, e.g., WO 2018 / 201096), MK-4280, and REGN3767. MGD013 is an anti-LAG-3 / PD-l bispecific antibody described in WO 2017 / 019846. FS118 is an anti-LAG-3 / PD-Ll bispecific antibody described in WO 2017 / 220569.Another immune checkpoint protein that can be targeted in the methods provided herein is V-domain Ig suppressor of T cell activation (VISTA), also known as C10orf54. The complete protein sequence of human VISTA has the Genbank accession number NP_071436. VISTA is found on white blood cells and inhibits T cell effector function. In some embodiments, the immune checkpoint inhibitor is an anti-VISTA3 antibody (e.g., a human antibody, a humanized antibody, or a chimeric antibody), an antigen-binding fragment thereof, an immunoadhesin, a fusion protein, or oligopeptide. Anti-human- VISTA antibodies (or VH and / or VL domains derived therefrom) suitable for use in the present methods can be generated using methods well known in the art. Alternatively, art-recognized anti- VISTA antibodies can be used. An exemplary anti- VISTA antibody is INI-61610588 (also known as onvatilimab) (see, e.g., WO 2015 / 097536, WO 2016 / 207717, WO 2017 / 137830, WO 2017 / 175058). VISTA can also be inhibited with the small molecule CA-170, which selectively targets both PD-L1 and VISTA (see, e.g., WO 2015 / 033299, WO 2015 / 033301).Another immune checkpoint protein that can be targeted in the methods provided herein is indoleamine 2,3-dioxygenase (IDO). The complete protein sequence of human IDO has Genbank accession number NP_002155. In some embodiments, the immune checkpoint inhibitor is a small molecule IDO inhibitor. Exemplary small molecules include BMS- 986205, epacadostat (INCB24360), and navoximod (GDC-0919).Another immune checkpoint protein that can be targeted in the methods provided herein is CD38. The complete protein sequence of human CD38 has Genbank accession number NP_001766. In some embodiments, the immune checkpoint inhibitor is an anti-CD38 antibody (e.g., a human antibody, a humanized antibody, or a chimeric antibody), an antigenbinding fragment thereof, an immunoadhesin, a fusion protein, or oligopeptide. Anti-human- CD38 antibodies (or VH and / or VL domains derived therefrom) suitable for use in the present methods can be generated using methods well known in the art. Alternatively, art- recognized anti-CD38 antibodies can be used. An exemplary anti-CD38 antibody is daratumumab (see, e.g., U.S. Pat. No. 7,829,673).Another immune checkpoint protein that can be targeted in the methods provided herein is ICOS, also known as CD278. The complete protein sequence of human ICOS has Genbank accession number NP_036224. In some embodiments, the immune checkpoint inhibitor is an anti-ICOS antibody (e.g., a human antibody, a humanized antibody, or a chimeric antibody), an antigen-binding fragment thereof, an immunoadhesin, a fusion protein, or oligopeptide. Anti-human-ICOS antibodies (or VH and / or VL domains derived therefrom) suitable for use in the present methods can be generated using methods well known in the art. Alternatively, art-recognized anti-ICOS antibodies can be used. Exemplary anti-ICOS antibodies include JTX-2011 (see, e.g., WO 2016 / 154177, WO 2018 / 187191) and GSK3359609 (see, e.g., WO 2016 / 059602).Another immune checkpoint protein that can be targeted in the methods provided herein is T cell immunoreceptor with Ig and ITIM domains (TIGIT). The complete protein sequence of human TIGIT has Genbank accession number NP_776160. In some embodiments, the immune checkpoint inhibitor is an anti-TIGIT antibody (e.g., a human antibody, a humanized antibody, or a chimeric antibody), an antigen-binding fragment thereof, an immunoadhesin, a fusion protein, or oligopeptide. Anti-human-TIGIT antibodies (or VH and / or VL domains derived therefrom) suitable for use in the present methods can be generated using methods well known in the art. Alternatively, art-recognized anti-TIGIT antibodies can be used. An exemplary anti-TIGIT antibody is MK-7684 (see, e.g., WO 2017 / 030823, WO 2016 / 028656).Another immune checkpoint protein that can be targeted in the methods provided herein is 0X40, also known as CD134. The complete protein sequence of human 0X40 has Genbank accession number NP_003318. In some embodiments, the immune checkpoint inhibitor is an anti-OX40 antibody (e.g., a human antibody, a humanized antibody, or a chimeric antibody), an antigen-binding fragment thereof, an immunoadhesin, a fusion protein, or oligopeptide. Anti-human-OX40 antibodies (or VH and / or VL domains derived therefrom) suitable for use in the present methods can be generated using methods well known in the art. Alternatively, art-recognized anti-OX40 antibodies can be used. An exemplary anti-OX40 antibody is PF-04518600 (see, e.g., WO 2017 / 130076). ATOR-1015 is a bispecific antibody targeting CTLA4 and 0X40 (see, e.g., WO 2017 / 182672, WO 2018 / 091740, WO 2018 / 202649, WO 2018 / 002339).Another immune checkpoint protein that can be targeted in the methods provided herein is glucocorticoid-induced tumour necrosis factor receptor-related protein (GITR), also known as TNFRSF18 and AITR. The complete protein sequence of human GITR hasGenbank accession number NP_004186. In some embodiments, the immune checkpoint inhibitor is an anti-GITR antibody (e.g., a human antibody, a humanized antibody, or a chimeric antibody), an antigen-binding fragment thereof, an immunoadhesin, a fusion protein, or oligopeptide. Anti-human-GITR antibodies (or VH and / or VL domains derived therefrom) suitable for use in the present methods can be generated using methods well known in the art. Alternatively, art-recognized anti-GITR antibodies can be used. An exemplary anti-GITR antibody is TRX518 (see, e.g., WO 2006 / 105021).In one embodiment, the present application provides for a combination therapy for the treatment of cancer wherein the combination therapy comprises adoptive T cell therapy and a checkpoint inhibitor. In one aspect, the adoptive T cell therapy comprises autologous and / or allogenic T-cells. In another aspect, the autologous and / or allogenic T-cells are targeted against tumor antigens.D. SurgeryApproximately 60% of persons with cancer will undergo surgery of some type, which includes preventative, diagnostic or staging, curative, and palliative surgery. Curative surgery includes resection in which all or part of cancerous tissue is physically removed, excised, and / or destroyed and may be used in conjunction with other therapies, such as the treatment of the present embodiments, chemotherapy, radiotherapy, hormonal therapy, gene therapy, immunotherapy, and / or alternative therapies. Tumor resection refers to physical removal of at least part of a tumor. In addition to tumor resection, treatment by surgery includes laser surgery, cryosurgery, electrosurgery, and microscopically-controlled surgery (Mohs’ surgery).Upon excision of part or all of cancerous cells, tissue, or tumor, a cavity may be formed in the body. Treatment may be accomplished by perfusion, direct injection, or local application of the area with an additional anti-cancer therapy. Such treatment may be repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days, or every 1, 2, 3, 4, and 5 weeks or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. These treatments may be of varying dosages as well.Other AgentsIt is contemplated that other agents may be used in combination with certain aspects of the present embodiments to improve the therapeutic efficacy of treatment. These additional agents include agents that affect the upregulation of cell surface receptors and GAP junctions, cytostatic and differentiation agents, inhibitors of cell adhesion, agents that increase the sensitivity of the hyperproliferative cells to apoptotic inducers, or otherbiological agents. Increases in intercellular signaling by elevating the number of GAP junctions would increase the anti-hyperproliferative effects on the neighboring hyperproliferative cell population. In other embodiments, cytostatic or differentiation agents can be used in combination with certain aspects of the present embodiments to improve the anti-hyperproliferative efficacy of the treatments. Inhibitors of cell adhesion are contemplated to improve the efficacy of the present embodiments. Examples of cell adhesion inhibitors are focal adhesion kinase (FAKs) inhibitors and Lovastatin. It is further contemplated that other agents that increase the sensitivity of a hyperproliferative cell to apoptosis, such as the antibody c225, could be used in combination with certain aspects of the present embodiments to improve the treatment efficacy. The present compositions may perform one or more of these functions and then combined with another agent to enhance the activity of the present compositions.H. KitsThe present disclosure also provides kits. Any of the components disclosed herein may be combined in the form of a kit. In some embodiments, the kits comprise a composition as described above or in the claims.The kits will generally include at least one vial, test tube, flask, bottle, syringe or other container, into which a component may be placed, and preferably, suitably aliquoted. Where there is more than one component in the kit, the kit also will generally contain a second, third or other additional containers into which the additional components may be separately placed. However, various combinations of components may be comprised in a container. In some embodiments, all of the lipid nanoparticle components are combined in a single container. In other embodiments, some or all of the lipid nanoparticle components are provided in separate containers.The kits of the present invention also will typically include packaging for containing the various containers in close confinement for commercial sale. Such packaging may include cardboard or injection or blow molded plastic packaging into which the desired containers are retained. A kit may also include instructions for employing the kit components. Instructions may include variations that can be implemented.I. Chemical DefinitionsWhen used in the context of a chemical group: “hydrogen” means -H; “hydroxy” means -OH; ‘ ‘oxo” means =0; “carbonyl” means -C(=0)-; “carboxy” means -C(=0)0H (also written as -C00H or -CO2H); “halo” means independently -F, -Cl. -Br or -I;“amino” means -NH2; “hydroxyamino” means NHOH; “nitro” means NO2; imino means =NH; “cyano” means -CN; “isocyanate” means -N=C=O; “azido” means -Ns; in a monovalent context “phosphate” means -OP(O)(OH)2 or a deprotonated form thereof; in a divalent context “phosphate” means -OP(O)(OH)O- or a deprotonated form thereof; “mercapto” means -SH; and “thio” means =S; “sulfonyl” means -S(O)2-; “hydroxysulfonyl” means -S(O)2OH; “sulfonamide” means -S(O)2NH2; and “sulfinyl” means -S(O)-.In the context of chemical formulas, the symbol means a single bond, “=“ means a double bond, and “=” means triple bond. The symbol “ - “ represents an optional bond, which if present is either single or double. The symbol “==“ represents a single bond or a double bond. Thus, for example, the formulaincludesandAnd it is understood that no one such ring atom forms part of more than one double bond. Furthermore, it is noted that the covalent bond symbol when connecting one or two stereogenic atoms, does not indicate any preferred stereochemistry. Instead, it covers all stereoisomers as well as mixtures thereof. The symbolwhen drawn perpendicularly across a bondfor methyl) indicates a point of attachment of the group. It is noted that the point of attachment is typically only identified in this manner for larger groups in order to assist the reader in unambiguously identifying a point of attachment. The symbolmeans a single bond where the group attached to the thick end of the wedge is “out of the page.” The symbol “,lll|il“ means a single bond where the group attached to the thick end of the wedge is “into the page”. The symbol “>zvvx “ means a single bond where the geometry around a double bond (e.g., either E or Z) is undefined. Both options, as well as combinations thereof are therefore intended. Any undefined valency on an atom of a structure shown in this application implicitly represents a hydrogen atom bonded to that atom. A bold dot on a carbon atom indicates that the hydrogen attached to that carbon is oriented out of the plane of the paper.When a group “R” is depicted as a “floating group” on a ring system, for example, in the formula:then R may replace any hydrogen atom attached to any of the ring atoms, including a depicted, implied, or expressly defined hydrogen, so long as a stable structure is formed. When a group “R” is depicted as a “floating group” on a fused ring system, as for example in the formula:then R may replace any hydrogen attached to any of the ring atoms of either of the fused rings unless specified otherwise. Replaceable hydrogens include depicted hydrogens (e.g., the hydrogen attached to the nitrogen in the formula above), implied hydrogens (e.g., a hydrogen of the formula above that is not shown but understood to be present), expressly defined hydrogens, and optional hydrogens whose presence depends on the identity of a ring atom (e.g., a hydrogen attached to group X, when X equals -CH-), so long as a stable structure is formed. In the example depicted, R may reside on either the 5 -membered or the 6- membered ring of the fused ring system. In the formula above, the subscript letter “y” immediately following the group “R” enclosed in parentheses, represents a numeric variable. Unless specified otherwise, this variable can be 0, 1, 2, or any integer greater than 2, only limited by the maximum number of replaceable hydrogen atoms of the ring or ring system.For the chemical groups and compound classes, the number of carbon atoms in the group or class is as indicated as follows: “Cn” defines the exact number (n) of carbon atoms in the group / class. “C<n” defines the maximum number (n) of carbon atoms that can be in the group / class, with the minimum number as small as possible for the group / class in question, e.g. , it is understood that the minimum number of carbon atoms in the group “alkenyl(c<s)” or the class “alkene(c<s)” is two. Compare with “alkoxy(c<io)”, which designates alkoxy groups having from 1 to 10 carbon atoms. “Cn-n'” defines both the minimum (n) and maximum number (n') of carbon atoms in the group. Thus, “alkyl(C2-io ” designates those alkyl groups having from 2 to 10 carbon atoms. These carbon number indicators may precede or follow the chemical groups or class it modifies and it may or may not be enclosed in parenthesis, without signifying any change in meaning. Thus, the terms “C5 olefin”, “C5-olefin”, “olefin(c5)”, and “olefines” are all synonymous.The term “saturated” when used to modify a compound or chemical group means the compound or chemical group has no carbon-carbon double and no carbon-carbon triple bonds, except as noted below. When the term is used to modify an atom, it means that theatom is not part of any double or triple bond. In the case of substituted versions of saturated groups, one or more carbon oxygen double bond or a carbon nitrogen double bond may be present. And when such a bond is present, then carbon-carbon double bonds that may occur as part of keto-enol tautomerism or imine / enamine tautomerism are not precluded. When the term “saturated” is used to modify a solution of a substance, it means that no more of that substance can dissolve in that solution.The term “aliphatic” when used without the “substituted” modifier signifies that the compound or chemical group so modified is an acyclic or cyclic, but non-aromatic hydrocarbon compound or group. In aliphatic compounds / groups, the carbon atoms can be joined together in straight chains, branched chains, or non-aromatic rings (alicyclic). Aliphatic compounds / groups can be saturated, that is joined by single carbon-carbon bonds (alkanes / alkyl), or unsaturated, with one or more carbon-carbon double bonds (alkenes / alkenyl) or with one or more carbon-carbon triple bonds (alkynes / alkynyl).The term “aromatic” when used to modify a compound or a chemical group atom means the compound or chemical group contains a planar unsaturated ring of atoms that is stabilized by an interaction of the bonds forming the ring.The term “alkyl” when used without the “substituted” modifier refers to a monovalent saturated aliphatic group with a carbon atom as the point of attachment, a linear or branched acyclic structure, and no atoms other than carbon and hydrogen. The groups -CH3 (Me), -CH2CH3 (Et), -CH2CH2CH3 (n-Pr or propyl), -CH(CH3)2(z-Pr,;Pr or isopropyl), -CH2CH2CH2CH3 (n-Bu), -CH(CH3)CH2CH3(sec-butyl), -CH2CH(CH3)2(isobutyl), - C(CH3)3 (tert-butyl, t-butyl, t-Bu or 'Bu), and -CH2C(CH2)3 (neo-pentyl) are non-limiting examples of alkyl groups. The term “alkanediyl” when used without the “substituted” modifier refers to a divalent saturated aliphatic group, with one or two saturated carbon atom(s) as the point(s) of attachment, a linear or branched acyclic structure, no carbon-carbon double or triple bonds, and no atoms other than carbon and hydrogen. The groups -CH2- (methylene), -CH2CH2-, -CH2C(CH3)2CH2-, and -CH2CH2CH2- are non-limiting examples of alkanediyl groups. An “alkane” refers to the class of compounds having the formula H-R, wherein R is alkyl as this term is defined above. When any of these terms is used with the “substituted” modifier one or more hydrogen atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH. or -S(O)2NH2. The following groups are nonlimiting examples of substituted alkyl groups: -CH2OH, -CH2C1, -CF3, -CH2CN,-CH2C(O)OH, -CH2C(O)OCH3, -CH2C(O)NH2, -CH2C(O)CH3, -CH2OCH3, -CH2OC(O)CH3, -CH2NH2, -CH2N(CH3)2, and -CH2CH2C1. The term “haloalkyl” is a subset of substituted alkyl, in which the hydrogen atom replacement is limited to halo (i.e. -F, -Cl, -Br, or -I) such that no other atoms aside from carbon, hydrogen and halogen are present. The group, -CH2C1 is a non-limiting example of a haloalkyl. The term “fluoroalkyl” is a subset of substituted alkyl, in which the hydrogen atom replacement is limited to fluoro such that no other atoms aside from carbon, hydrogen and fluorine are present. The groups -CH2F, -CF3, and -CH2CF3are non-limiting examples of fluoroalkyl groups.The term “cycloalkyl” when used without the “substituted” modifier refers to a monovalent saturated aliphatic group with a carbon atom as the point of attachment, said carbon atom forming part of one or more non-aromatic ring structures, no carbon-carbon double or triple bonds, and no atoms other than carbon and hydrogen. Non-limiting examples include: -CH(CH2)2(cyclopropyl), cyclobutyl, cyclopentyl, or cyclohexyl (Cy). The term “cycloalkanediyl” when used without the “substituted” modifier refers to a divalent saturated aliphatic group with two carbon atoms as points of attachment, no carbon-carbon double or triple bonds, and no atoms other than carbon and hydrogen. The groupjs anon-limiting example of cycloalkanediyl group. A “cycloalkane” refers to the class of compounds having the formula H-R, wherein R is cycloalkyl as this term is defined above. When any of these terms is used with the “substituted” modifier one or more hydrogen atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH or -S(O)2NH2.The term “alkenyl” when used without the “substituted” modifier refers to an monovalent unsaturated aliphatic group with a carbon atom as the point of attachment, a linear or branched, acyclic structure, at least one nonaromatic carbon-carbon double bond, no carbon-carbon triple bonds, and no atoms other than carbon and hydrogen. Non-limiting examples include: -CH=CH2(vinyl), -CH=CHCH3, -CH=CHCH2CH3, -CH2CH=CH2(allyl), -CH2CH=CHCH3, and -CH=CHCH=CH2. The term “alkenediyl” when used without the “substituted” modifier refers to a divalent unsaturated aliphatic group, with two carbon atoms as points of attachment, a linear or branched, a linear or branched acyclic structure, at least one nonaromatic carbon-carbon double bond, no carbon-carbon triple bonds, and noatoms other than carbon and hydrogen. The groups -CH=CH-, -CH=C(CH3)CH2-, -CH=CHCH2-, and -CH2CH=CHCH2- are non-limiting examples of alkenediyl groups. It is noted that while the alkenediyl group is aliphatic, once connected at both ends, this group is not precluded from forming part of an aromatic structure. The terms “alkene” and “olefin” are synonymous and refer to the class of compounds having the formula H-R, wherein R is alkenyl as this term is defined above. Similarly the terms “terminal alkene” and “a-olefin” are synonymous and refer to an alkene having just one carbon-carbon double bond, wherein that bond is part of a vinyl group at an end of the molecule. When any of these terms are used with the “substituted” modifier one or more hydrogen atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(0)CH3, -S(O)2OH. or -S(O)2NH2. The groups -CH=CHF, -CH=CHC1 and -CH=CHBr are non-limiting examples of substituted alkenyl groups.The term “alkynyl” when used without the “substituted” modifier refers to a monovalent unsaturated aliphatic group with a carbon atom as the point of attachment, a linear or branched acyclic structure, at least one carbon-carbon triple bond, and no atoms other than carbon and hydrogen. As used herein, the term alkynyl does not preclude the presence of one or more non-aromatic carbon-carbon double bonds. The groups -C=CH, -C=CCH3, and -CH2C=CCH3 are non-limiting examples of alkynyl groups. An “alkyne” refers to the class of compounds having the formula H-R, wherein R is alkynyl. When any of these terms are used with the “substituted” modifier one or more hydrogen atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -0CH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH, or -S(O)2NH2.The term “aryl” when used without the “substituted” modifier refers to a monovalent unsaturated aromatic group with an aromatic carbon atom as the point of attachment, said carbon atom forming part of a one or more six-membered aromatic ring structure, wherein the ring atoms are all carbon, and wherein the group consists of no atoms other than carbon and hydrogen. If more than one ring is present, the rings may be fused or unfused. As used herein, the term does not preclude the presence of one or more alkyl or aralkyl groups (carbon number limitation permitting) attached to the first aromatic ring or any additional aromatic ring present. Non-limiting examples of aryl groups include phenyl (Ph), methylphenyl, (dimethyl)phenyl, -C6H4CH2CH3 (ethylphenyl), naphthyl, and a monovalentgroup derived from biphenyl. The term “arenediyl” when used without the “substituted” modifier refers to a divalent aromatic group with two aromatic carbon atoms as points of attachment, said carbon atoms forming part of one or more six-membered aromatic ring structure(s) wherein the ring atoms are all carbon, and wherein the monovalent group consists of no atoms other than carbon and hydrogen. As used herein, the term does not preclude the presence of one or more alkyl, aryl or aralkyl groups (carbon number limitation permitting) attached to the first aromatic ring or any additional aromatic ring present. If more than one ring is present, the rings may be fused or unfused. Unfused rings may be connected via one or more of the following: a covalent bond, alkanediyl, or alkenediyl groups (carbon number limitation permitting). Non-limiting examples of arenediyl groups include:An “arene” refers to the class of compounds having the formula H-R, wherein R is aryl as that term is defined above. Benzene and toluene are non-limiting examples of arenes. When any of these terms are used with the “substituted” modifier one or more hydrogen atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH, or -S(O)2NH2.The term “aralkyl” when used without the “substituted” modifier refers to the monovalent group -alkanediyl-aryl, in which the terms alkanediyl and aryl are each used in a manner consistent with the definitions provided above. Non-limiting examples are: phenylmethyl (benzyl, Bn) and 2-phenyl-ethyl. When the term aralkyl is used with the “substituted” modifier one or more hydrogen atom from the alkanediyl and / or the aryl group has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH, or -S(O)2NH2. Non-limiting examples of substituted aralkyls are: (3-chlorophenyl)-methyl, and 2-chloro-2-phenyl-eth- 1 -yl.The term “heteroaryl” when used without the “substituted” modifier refers to a monovalent aromatic group with an aromatic carbon atom or nitrogen atom as the point of attachment, said carbon atom or nitrogen atom forming part of one or more aromatic ring structures wherein at least one of the ring atoms is nitrogen, oxygen or sulfur, and wherein the heteroaryl group consists of no atoms other than carbon, hydrogen, aromatic nitrogen, aromatic oxygen and aromatic sulfur. Heteroaryl rings may contain 1, 2, 3, or 4 ring atoms selected from are nitrogen, oxygen, and sulfur. If more than one ring is present, the rings may be fused or unfused. As used herein, the term does not preclude the presence of one or more alkyl, aryl, and / or aralkyl groups (carbon number limitation permitting) attached to the aromatic ring or aromatic ring system. Non-limiting examples of heteroaryl groups include furanyl, imidazolyl, indolyl, indazolyl (Im), isoxazolyl, methylpyridinyl, oxazolyl, phenylpyridinyl, pyridinyl (pyridyl), pyrrolyl, pyrimidinyl, pyrazinyl, quinolyl, quinazolyl, quinoxalinyl, triazinyl, tetrazolyl, thiazolyl, thienyl, and triazolyl. The term ‘W-heteroaryl” refers to a heteroaryl group with a nitrogen atom as the point of attachment. The term “heteroarenediyl” when used without the “substituted” modifier refers to an divalent aromatic group, with two aromatic carbon atoms, two aromatic nitrogen atoms, or one aromatic carbon atom and one aromatic nitrogen atom as the two points of attachment, said atoms forming part of one or more aromatic ring structure(s) wherein at least one of the ring atoms is nitrogen, oxygen or sulfur, and wherein the divalent group consists of no atoms other than carbon, hydrogen, aromatic nitrogen, aromatic oxygen and aromatic sulfur. If more than one ring is present, the rings may be fused or unfused. Unfused rings may be connected via one or more of the following: a covalent bond, alkanediyl, or alkenediyl groups (carbon number limitation permitting). As used herein, the term does not preclude the presence of one or more alkyl, aryl, and / or aralkyl groups (carbon number limitation permitting) attached to the aromatic ring or aromatic ring system. Non-limiting examples of heteroarenediyl groups include:A “heteroarene” refers to the class of compounds having the formula H-R, wherein R is heteroaryl. Pyridine and quinoline are non-limiting examples of heteroarenes. When these terms are used with the “substituted” modifier one or more hydrogen atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN,-SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH, or -S(O)2NH2.The term “heterocycloalkyl” when used without the “substituted” modifier refers to a monovalent non-aromatic group with a carbon atom or nitrogen atom as the point of attachment, said carbon atom or nitrogen atom forming part of one or more non-aromatic ring structures wherein at least one of the ring atoms is nitrogen, oxygen or sulfur, and wherein the heterocycloalkyl group consists of no atoms other than carbon, hydrogen, nitrogen, oxygen and sulfur. Heterocycloalkyl rings may contain 1 , 2, 3, or 4 ring atoms selected from nitrogen, oxygen, or sulfur. If more than one ring is present, the rings may be fused or unfused. As used herein, the term does not preclude the presence of one or more alkyl groups (carbon number limitation permitting) attached to the ring or ring system. Also, the term does not preclude the presence of one or more double bonds in the ring or ring system, provided that the resulting group remains non-aromatic. Non-limiting examples of heterocycloalkyl groups include aziridinyl, azetidinyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, thiomorpholinyl, tetrahydrofuranyl, tetrahydrothiofuranyl, tetrahydropyranyl, pyranyl, oxiranyl, and oxetanyl. The term ‘W-heterocycloalkyl” refers to a heterocycloalkyl group with a nitrogen atom as the point of attachment. A-pyrrolidi nyl is an example of such a group. The term “heterocycloalkanediyl” when used without the “substituted” modifier refers to an divalent cyclic group, with two carbon atoms, two nitrogen atoms, or one carbon atom and one nitrogen atom as the two points of attachment, said atoms forming part of one or more ring structure(s) wherein at least one of the ring atoms is nitrogen, oxygen or sulfur, and wherein the divalent group consists of no atoms other than carbon, hydrogen, nitrogen, oxygen and sulfur. If more than one ring is present, the rings may be fused or unfused. Unfused rings may be connected via one or more of the following: a covalent bond, alkanediyl, or alkenediyl groups (carbon number limitation permitting). As used herein, the term does not preclude the presence of one or more alkyl groups (carbon number limitation permitting) attached to the ring or ring system. Also, the term does not preclude the presence of one or more double bonds in the ring or ring system, provided that the resulting group remains non-aromatic. Non- limiting examples of heterocycloalkanediyl groups include:When these terms are used with the “substituted” modifier one or more hydrogen atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3,-CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH, or -S(O)2NH2.The term “acyl” when used without the “substituted” modifier refers to the group -C(O)R, in which R is a hydrogen, alkyl, cycloalkyl, alkenyl, aryl, aralkyl or heteroaryl, as those terms are defined above. The groups, -CHO, -C(0)CH3 (acetyl, Ac), -C(O)CH2CH3, -C(O)CH2CH2CH3, -C(O)CH(CH3)2, -C(O)CH(CH2)2, -C(O)C6H5, -C(O)C6H4CH3, -C(O)CH2CeH5, -C(O)(imidazolyl) are non-limiting examples of acyl groups. A “thioacyl” is defined in an analogous manner, except that the oxygen atom of the group -C(O)R has been replaced with a sulfur atom, -C(S)R. The term “aldehyde” corresponds to an alkane, as defined above, wherein at least one of the hydrogen atoms has been replaced with a -CHO group. When any of these terms are used with the “substituted” modifier one or more hydrogen atom (including a hydrogen atom directly attached to the carbon atom of the carbonyl or thiocarbonyl group, if any) has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH, or -S(O)2NH2. The groups, -C(O)CH2CF3, -CO2H (carboxyl), -CO2CH3 (methylcarboxyl), -CO2CH2CH3, -C(O)NH2(carbamoyl), and -CON(CH3)2, are non-limiting examples of substituted acyl groups.The term “alkoxy” when used without the “substituted” modifier refers to the group -OR, in which R is an alkyl, as that term is defined above. Non-limiting examples include: -OCH3 (methoxy), -OCH2CH3(ethoxy), -OCH2CH2CH3, -OCH(CH3)2(isopropoxy), -OC(CH3)3(tert-butoxy), -OCH(CH2)2, -O-cyclopentyl, and -O-cyclohexyl. The terms “cycloalkoxy”, “alkenyloxy”, “alkynyloxy”, “aryloxy”, “aralkoxy”, “heteroaryloxy”, “heterocycloalkoxy”, and “acyloxy”, when used without the “substituted” modifier, refers to groups, defined as -OR, in which R is cycloalkyl, alkenyl, alkynyl, aryl, aralkyl, heteroaryl, heterocycloalkyl, and acyl, respectively. The term “alkoxydiyl” refers to the divalent group -O-alkanediyl-, -O-alkanediyl-O-, or -alkanediyl-O-alkanediyl-. The term “alkylthio” and “acylthio” when used without the “substituted” modifier refers to the group -SR, in which R is an alkyl and acyl, respectively. The term “alcohol” corresponds to an alkane, as defined above, wherein at least one of the hydrogen atoms has been replaced with a hydroxy group. The term “ether” corresponds to an alkane, as defined above, wherein at least one of the hydrogen atoms has been replaced with an alkoxy group. When any of these terms is used with the “substituted” modifier one or more hydrogen atom has been independentlyreplaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH, or -S(O)2NH2.The term “alkylamino” when used without the “substituted” modifier refers to the group -NHR, in which R is an alkyl, as that term is defined above. Non-limiting examples include: -NHCH3 and -NHCH2CH3. The term “dialkylamino” when used without the “substituted” modifier refers to the group -NRR', in which R and R' can be the same or different alkyl groups, or R and R' can be taken together to represent an alkanediyl. Nonlimiting examples of dialkylamino groups include: -N(CHs)2 and -N(CH3)(CH2CH3). The terms “cycloalkylamino”, “alkenylamino”, “alkynylamino”, “arylamino”, “aralkylamino”, “heteroarylamino”, “heterocycloalkylamino”, “alkoxyamino”, and “alkylsulfonylamino” when used without the “substituted” modifier, refers to groups, defined as -NHR, in which R is cycloalkyl, alkenyl, alkynyl, aryl, aralkyl, heteroaryl, heterocycloalkyl, alkoxy, and alkylsulfonyl, respectively. A non-limiting example of an arylamino group is -NHCTHv The term “alkylaminodiyl” refers to the divalent group -NH-alkanediyl-, -NH-alkanediyl-NH-, or -alkanediyl-NH-alkanediyl-. The term “amido” (acylamino), when used without the “substituted” modifier, refers to the group -NHR, in which R is acyl, as that term is defined above. A non-limiting example of an amido group is -NHC(0)CH3. The term “alkylimino” when used without the “substituted” modifier refers to the divalent group =NR, in which R is an alkyl, as that term is defined above. When any of these terms is used with the “substituted” modifier one or more hydrogen atom attached to a carbon atom has been independently replaced by -OH, -F, -Cl, -Br, -I, -NH2, -NO2, -CO2H, -CO2CH3, -CN, -SH, -OCH3, -OCH2CH3, -C(O)CH3, -NHCH3, -NHCH2CH3, -N(CH3)2, -C(O)NH2, -C(O)NHCH3, -C(O)N(CH3)2, -OC(O)CH3, -NHC(O)CH3, -S(O)2OH, or -S(O)2NH2. The groups -NHC(O)OCH3and -NHC(O)NHCH3are non-limiting examples of substituted amido groups.The use of the word “a” or “an,” when used in conjunction with the term “comprising” in the claims and / or the specification may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.”Throughout this application, the term “about” is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects.As used in this application, the term “average molecular weight” refers to the relationship between the number of moles of each polymer species and the molar mass of thatspecies. In particular, each polymer molecule may have different levels of polymerization and thus a different molar mass. The average molecular weight can be used to represent the molecular weight of a plurality of polymer molecules. Average molecular weight is typically synonymous with average molar mass. In particular, there are three major types of average molecular weight: number average molar mass, weight (mass) average molar mass, and Z- average molar mass. In the context of this application, unless otherwise specified, the average molecular weight represents either the number average molar mass or weight average molar mass of the formula. In some embodiments, the average molecular weight is the number average molar mass. In some embodiments, the average molecular weight may be used to describe a PEG component present in a lipid.The term “chimeric antigen receptors (CARs),” as used herein, may refer to artificial T-cell receptors, chimeric T-cell receptors, or chimeric immunoreceptors, for example, and encompass engineered receptors that graft an artificial specificity onto a particular immune effector cell. CARs may be employed to impart the specificity of a monoclonal antibody onto a T cell, thereby allowing a large number of specific T cells to be generated, for example, for use in adoptive cell therapy. In specific embodiments, CARs direct specificity of the cell to a tumor associated antigen, for example. In some embodiments, CARs comprise an intracellular activation domain, a transmembrane domain, and an extracellular domain comprising a tumor associated antigen binding region. In particular aspects, CARs comprise fusions of single-chain variable fragments (scFv) derived from monoclonal antibodies, fused to CD3-zeta a transmembrane domain and endodomain. The specificity of other CAR designs may be derived from ligands of receptors (e.g., peptides) or from patternrecognition receptors, such as Dectins. In some embodiments, one can target malignant B cells by redirecting the specificity of T cells by using a CAR specific for the B-lineage molecule, CD 19. In certain embodiments, the spacing of the antigen-recognition domain can be modified to reduce activation-induced cell death. In certain embodiments, CARs can comprise domains for additional co-stimulatory signaling, such as CD3-zeta, FcR, CD27, CD28, CD137, DAP10, and / or 0X40. In some embodiments, molecules can be co-expressed with the CAR, including co-stimulatory molecules, reporter genes for imaging (e.g., for positron emission tomography), gene products that conditionally ablate the T cells upon addition of a pro-drug, homing receptors, chemokines, chemokine receptors, cytokines, and cytokine receptors.The terms “tumor-associated antigen” and “cancer cell antigen” are used interchangeably herein. In each case, the terms refer to proteins, glycoproteins or carbohydrates that are specifically or preferentially expressed by cancer cells.The terms “comprise,” “have” and “include” are open-ended linking verbs. Any forms or tenses of one or more of these verbs, such as “comprises,” “comprising,” “has,” “having,” “includes” and “including,” are also open-ended. For example, any method that “comprises,” “has” or “includes” one or more steps is not limited to possessing only those one or more steps and also covers other unlisted steps.The term “effective,” as that term is used in the specification and / or claims, means adequate to accomplish a desired, expected, or intended result. “Effective amount,” “Therapeutically effective amount” or “pharmaceutically effective amount” when used in the context of treating a patient or subject with a compound means that amount of the compound which, when administered to a subject or patient for treating a disease, is sufficient to effect such treatment for the disease.As used herein, the term “IC50” refers to an inhibitory dose which is 50% of the maximum response obtained. This quantitative measure indicates how much of a particular drug or other substance (inhibitor) is needed to inhibit a given biological, biochemical or chemical process (or component of a process, i.e., an enzyme, cell, cell receptor or microorganism) by half.An “isomer” of a first compound is a separate compound in which each molecule contains the same constituent atoms as the first compound, but where the configuration of those atoms in three dimensions differs.As used herein, the term “patient” or “subject” refers to a living mammalian organism, such as a human, monkey, cow, sheep, goat, dog, cat, mouse, rat, guinea pig, or transgenic species thereof. In certain embodiments, the patient or subject is a primate. Nonlimiting examples of human subjects are adults, juveniles, infants and fetuses.As generally used herein “pharmaceutically acceptable” refers to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues, organs, and / or bodily fluids of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit / risk ratio.“Pharmaceutically acceptable salts” means salts of compounds of the present invention which are pharmaceutically acceptable, as defined above, and which possess the desired pharmacological activity. Such salts include acid addition salts formed withinorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like; or with organic acids such as 1 ,2-ethanedisulfonic acid, 2-hydroxyethanesulfonic acid, 2-naphthalenesulfonic acid, 3 -phenylpropionic acid, 4,4'-methylenebis(3-hydroxy-2-ene- 1 -carboxylic acid), 4-methylbicyclo[2.2.2]oct-2-ene- 1 -carboxylic acid, acetic acid, aliphatic mono- and dicarboxylic acids, aliphatic sulfuric acids, aromatic sulfuric acids, benzenesulfonic acid, benzoic acid, camphorsulfonic acid, carbonic acid, cinnamic acid, citric acid, cyclopentanepropionic acid, ethanesulfonic acid, fumaric acid, glucoheptonic acid, gluconic acid, glutamic acid, glycolic acid, heptanoic acid, hexanoic acid, hydroxynaphthoic acid, lactic acid, laurylsulfuric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, muconic acid, o-(4-hydroxybenzoyl)benzoic acid, oxalic acid, / ?-chlorobenzenesulfonic acid, phenyl-substituted alkanoic acids, propionic acid, p-loluenesulfonic acid, pyruvic acid, salicylic acid, stearic acid, succinic acid, tartaric acid, tertiarybutylacetic acid, trimethylacetic acid, and the like. Pharmaceutically acceptable salts also include base addition salts which may be formed when acidic protons present are capable of reacting with inorganic or organic bases. Acceptable inorganic bases include sodium hydroxide, sodium carbonate, potassium hydroxide, aluminum hydroxide and calcium hydroxide. Acceptable organic bases include ethanolamine, diethanolamine, triethanolamine, tromethamine, A-methylglucamine and the like. It should be recognized that the particular anion or cation forming a part of any salt of this invention is not critical, so long as the salt, as a whole, is pharmacologically acceptable. Additional examples of pharmaceutically acceptable salts and their methods of preparation and use are presented in Handbook of Pharmaceutical Salts: Properties, and Use (P. H. Stahl & C. G. Wermuth eds., Verlag Helvetica Chimica Acta, 2002).The term “pharmaceutically acceptable carrier,” as used herein means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting a chemical agent.“Prevention” or “preventing” includes: (1) inhibiting the onset of a disease in a subject or patient which may be at risk and / or predisposed to the disease but does not yet experience or display any or all of the pathology or symptomatology of the disease, and / or (2) slowing the onset of the pathology or symptomatology of a disease in a subject or patient which may be at risk and / or predisposed to the disease but does not yet experience or display any or all of the pathology or symptomatology of the disease.A “repeat unit” is the simplest structural entity of certain materials, for example, frameworks and / or polymers, whether organic, inorganic or metal-organic. In the case of a polymer chain, repeat units are linked together successively along the chain, like the beads of a necklace. For example, in polyethylene, -[-CFhCEh-Jn-, the repeat unit is -CH2CH2-. The subscript “n” denotes the degree of polymerization, that is, the number of repeat units linked together. When the value for “n” is left undefined or where “n” is absent, it simply designates repetition of the formula within the brackets as well as the polymeric nature of the material. The concept of a repeat unit applies equally to where the connectivity between the repeat units extends three dimensionally, such as in metal organic frameworks, modified polymers, thermosetting polymers, etc. Within the context of the dendrimer, the repeating unit may also be described as the branching unit, interior layers, or generations. Similarly, the terminating group may also be described as the surface group.A “stereoisomer” or “optical isomer” is an isomer of a given compound in which the same atoms are bonded to the same other atoms, but where the configuration of those atoms in three dimensions differs. “Enantiomers” are stereoisomers of a given compound that are mirror images of each other, like left and right hands. “Diastereomers” are stereoisomers of a given compound that are not enantiomers. Chiral molecules contain a chiral center, also referred to as a stereocenter or stereogenic center, which is any point, though not necessarily an atom, in a molecule bearing groups such that an interchanging of any two groups leads to a stereoisomer. In organic compounds, the chiral center is typically a carbon, phosphorus or sulfur atom, though it is also possible for other atoms to be stereocenters in organic and inorganic compounds. A molecule can have multiple stereocenters, giving it many stereoisomers. In compounds whose stereoisomerism is due to tetrahedral stereogenic centers (e.g., tetrahedral carbon), the total number of hypothetically possible stereoisomers will not exceed 2n, where n is the number of tetrahedral stereocenters. Molecules with symmetry frequently have fewer than the maximum possible number of stereoisomers. A 50:50 mixture of enantiomers is referred to as a racemic mixture. Alternatively, a mixture of enantiomers can be enantiomerically enriched so that one enantiomer is present in an amount greater than 50%. Typically, enantiomers and / or diastereomers can be resolved or separated using techniques known in the art. It is contemplated that that for any stereocenter or axis of chirality for which stereochemistry has not been defined, that stereocenter or axis of chirality can be present in its R form, .8 form, or as a mixture of the R and S forms, including racemic and non-racemic mixtures. As used herein, the phrase “substantially free from otherstereoisomers” means that the composition contains < 15%, more preferably < 10%, even more preferably < 5%, or most preferably < 1% of another stereoisomer(s).“Treatment” or “treating” includes (1) inhibiting a disease in a subject or patient experiencing or displaying the pathology or symptomatology of the disease (e.g., arresting further development of the pathology and / or symptomatology), (2) ameliorating a disease in a subject or patient that is experiencing or displaying the pathology or symptomatology of the disease (e.g., reversing the pathology and / or symptomatology), and / or (3) effecting any measurable decrease in a disease in a subject or patient that is experiencing or displaying the pathology or symptomatology of the disease.The above definitions supersede any conflicting definition in any reference that is incorporated by reference herein. The fact that certain terms are defined, however, should not be considered as indicative that any term that is undefined is indefinite. Rather, all terms used are believed to describe the invention in terms such that one of ordinary skill can appreciate the scope and practice the present invention.J. ExamplesThe following examples are included to demonstrate preferred embodiments of the disclosure. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the disclosure, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the disclosure.Example 1: Synthesis and Characterization of LNPsFour component LNPs (0% 18: 1 PA) known to the art may be prepared from 5A2- SC8, DOPE, Cholesterol, and PEG-DMG (FIG. 2A). Synthesis details and characterization of 5A2-SC8 are provided in FIG. 3A and FIG. 3B. To achieve in situ CAR T cell production, a 10% 18: 1 PA five component Spleen SORT formulation was used. Both formulations were prepared at a 30: 1 (wt:wt) total lipid to mRNA. The details of the formulation molar ratios are included in FIG. 2B. Bioluminescence imaging (BLI) 24 hours after luciferase mRNA delivery revealed that the known 0% 18: 1 PA four component formulation primarily delivered mRNA to the liver as expected for traditional LNPs (FIG. 2C and FIG. 2E). When comparing the delivery efficacy and organ tropism to five component 10% 18: 1 PA SpleenSORT LNPs, the organ tropism shifted to primarily to the spleen with minimal to no protein activity in the liver (FIG. 2D and FIG. 2E). The size of the LNPs were not affected by the inclusion of 10% 18: 1 PA, with both frequency size distribution being almost identical (FIG. 4A). LNPs formed with and without 18:1 PA formed a homogeneous population of LNPs as shown by the low polydispersity index (FIG. 4B). The zeta potential remained neutral despite the addition of a negatively charged lipid (FIG. 4C). However, the inclusion of 10% 18:1 PA lowered the pKa of the LNP from 6.55 to 5.88 (FIG. 4D). These results were in agreement with the characterized SORT LNP mechanism of action, including lower pKa that drives spleen tropism (Dilliard et al., 2021).Example 2: Determination of Transfected Cell TypesIn order to characterize the cell types transfected within the spleen, Spleen SORT LNPs containing 10% 18: 1 PA were used to deliver two doses of 0.5 mg / kg Cre recombinase mRNA 48 hours apart to lox-stop-lox TdTom mice, resulting in deletion of the stop codon and expression of tdTom florescence. With this dosing regimen, 7% of all T cells in the spleen were transfected (FIG. 2F). To further characterize specific T cells, additional antibodies were used in flow cytometry analyses, which indicated that 5.8% of CD8+ T cells and 5.5% of CD4+ T cells were transfected (FIG. 2G). The spleen targeting LNP also transfected immune cell types such as macrophages and neutrophils (FIG. 2H). The gating strategy used to determine the cell types is included in FIG. 5.Example 3: In Situ Production of CAR T cellsFollowing confirmation that CD8+ and CD4+ T cells could be transfected by Spleen SORT LNPs, their capability to produce CAR T cells in situ was examined using an established lymphoreplete model of B cell lymphoma (Kueberuwa et al. , 2018c; Kochenderfer et al. , 2010). To generate this model, Balb / c mice were pretreated with a low dose of cyclophosphamide (100 mg / kg) which reduces immune cell levels, allowing for tumor engraftment. To mimic different stages of tumor burden (from less aggressive to more aggressive), the number of A20 luciferase-expressing cells (A20-Luc) that were injected intravenously were manipulated. Once the tumors had engrafted, mice were treated with Spleen SORT LNPs encapsulating an mRNA that coded for anti-CD19 CAR mRNA with a co-stimulatory molecule (41BB or CD28) and a CD3^ signaling domain. All mRNAs were in vitro transcribed (1VT) using an SP6 IVT protocol, and the resulting mRNAs were analyzed by TapeStation to confirm length and integrity (FIG. 6A). Afterwards, the tumor growth wasmonitored by whole-body BLI and abdominal circumference (AC). To determine a therapeutic benefit, survival analysis was performed.For the first model, IxlO6A20-Luc cells were injected after pre-treatment with cyclophosphamide (FIG. 7 A). A high number of cells resulted in fast tumor growth that mimicked a more aggressive cancer. 14 days after A20-Luc injection, mice were divided randomly into three arms: a control group injected with saline, a control group injected with Cre mRNA Spleen SORT LNPs, and a treatment group injected with an mRNA encoding an anti-CD19 CAR with 41BB co-stimulatory molecule and CD3^ signaling domain (CAR 19- 41BBz) in Spleen SORT LNPs (FIG. 7B). All mRNAs were formulated with Spleen SORT LNPs prior to being injected. The resulting LNPs were characterized to determine, size, polydispersity index and surface charge (FIGS. 6B-6D). The LNPs formulated with the CAR19-41BBz mRNA (-2,000 nt) were slightly larger than the LNPs formulated Cre mRNA (-1,000 nt). The difference in LNP sizes may be related to the difference in mRNA length. The treatment regimen was twice a week at a dose of 0.5 mg / kg.BLI imaging showed rapid tumor growth and metastasis for all three groups (FIG. 7C). The livers of mice treated with mRNA CAR19-41BBz had less metastatic tumor lesions than the saline and the Cre mRNA control groups (FIG. 7D). In addition, the AC of mice in the CAR19-41BBz treatment group were smaller than the control groups (FIG. 7E). Even though an improvement in the overall survival of the treated mice was not observed (FIG. 8), delayed tumor growth was seen up until Day 18 — as quantified by the abdominal circumference. On Days 21 and 24, the tumor had metastasized and thereafter the treatment likely lost its effect. The engraftment of the tumor was heterogeneous with some mice starting with higher tumor burden than others, which made it difficult to test the effectiveness of the CAR T cells produced in situ. Nevertheless, the pronounced difference between the Cre mRNA LNP control and CAR19-41BBz mRNA LNP groups was encouraging and prompted further evaluation of the in situ CAR-T approach using Spleen SORT LNPs.In order to control the heterogeneity observed in the previous model, treatment was started when the BLI of the mice reached IxlO7p / s (FIG. 9A). As a result, the start date varied for each mouse, but they were all within 2-3 weeks after the IV injection of A20-Luc cells. For this study, the mice were divided into two arms: a saline control and a treatment CAR19-41BBz mRNA. The treatment regimen consisted of IV injections twice a week at a dose of 0.5 mg / kg (FIG. 9B). BLI tracking of the mice showed a reduced tumor growth rate in the treatment group with some mice showing less whole-body luminescence at Day 14 (FIG. 9C). By Day 21, this effect was more pronounced, and the AC was smaller in thetreatment groups which indicated less tumor growth (FIG. 9D). At Day 28, all the mice in the saline group had reached the endpoint. The AC at the time of endpoint was compared for each group, which corresponded to Day 21 for the saline group and Day 28 for the CAR19- 41BBz treated mice. At the time of the end point, the tumor burden of the treated mice was significantly lower (p = 0.0010) (FIG. 9E). Compared to the previous model induction, the AC in the model of FIG. 7 lost statistical significance before the end point was reached. After Day 28, the tumor had grown rapidly resulting in metastasis and the loss of the therapeutic efficacy. Although not statistically significant (p = 0.09), more than half of the mice in the treatment group outlived the saline group (FIG. 9F). Although the heterogeneity of the tumor was resolved for the second model, the aggresiveness of the tumor persisted and made it challenging to observe a survival benefit. Nonetheless, the extended reduction in abdominal circumference for the treated mice was encouraging and prompted us to modify the model and further evaluate the in situ CAR-T approach using Spleen SORT LNPs in an additional model variation.In order to reduce the aggressiveness of the model, 5xl05A20-Luc cells were injected after pretreatment with cyclophosphamide (FIG. 10A). With a smaller number of cells injected, a slower engraftment of tumors was observed, indicating a less aggressive model of lymphoma. Once the BLI of the mice reached IxlO7p / s, treatment was initiated. The start dates were all within 2-3 weeks after the IV injection of A20-Luc cells. The endpoint of this experiment was based on tumor bioluminescence (IxlO9p / s). This was done to reduce the variability of tumor burden that did not manifest itself in the abdomen (e.g., in the brain and hind legs). The treatment groups consisted of saline, mRNA CAR19-41BBz, and an additional mRNA encoding an anti-CD19 CAR with CD28 co- stimulatory molecule and a CD3^ signaling domain (CAR19-28z) to study the effect of the signaling domain (FIG. 10B). The treatment regimen involved once a week treatment with 0.5 mg / kg of either CAR 19- 41BBz mRNA LNPs or CAR19-28z mRNA LNPs. BLI tracking of the tumors showed that the group treated with CAR19-41BBz mRNA had delayed tumor growth (FIG. 10C and FIG. 10D) as compared to other groups. When quantified, the tumor growth was significantly less when compared to saline and CAR19-28z (FIG. 10E). Furthermore, mice in the CAR19- 41BBz mRNA LNP group had statistically significant increased survival compared to the other two treatment groups (p = 0.0017) (FIG. 10F). The results indicate that the CD28 costimulatory signal might not be potent enough to fight such an aggressive model as the B cell lymphoma used in the study. It has been reported that CARs with CD28 cause an increaseexhaustion of the T cells (Cappell & Kochenderfer, 2021; Long et al., 2015), which could explain the lack of response seen in this treatment group.Despite these lymphoreplete B cell lymphoma models being aggressive and exhibiting rapid tumor growth, physical signs of response to treatment were observed in the CAR19- 41BBz treated groups. Since both rounds of aggressive lymphoma metastasized rapidly and created large tumor lesions in the liver, the effect of in situ CAR T cells in the reduction of metastatic lesions and abdominal circumference was investigated. To this end, tumors from the livers of mice in the aggressive models (FIG. 7 and FIG. 9) were studied. Tumors were sectioned, stained for CD3+ T cells, and imaged using confocal microscopy (FIGS. 11 A, 11B, and FIGS. 12-15). Interestingly, an increase in tumor infiltrating lymphocytes (TILs) was quantified in the CAR19-41BBz mRNA LNP treated livers compared to saline and Cre mRNA LNP treated livers (FIG. 10C). A similar increase was observed in the number of TILs from the livers treated with mRNA CAR19-41BBz in the second model (FIG. 10D). The results confirm that treatment with Spleen SORT LNPs that encapsulate mRNA CAR19- 41BBz produce in situ CAR T cells capable of infiltrating metastatic lesions in the liver.Example 4: Experimental ProceduresLipids for LNPs l,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) and 1,2-dioleoyLsn-glycero- 3-phosphate (18: 1 PA) were purchased from Avanti Polar Lipids (Alabaster, AL). Cholesterol was purchased from Sigma Aldrich. PEG-DMG (Sunbright GM-020) was purchased from NOF America Corporation. The ionizable amino lipid 5A2-SC8 was synthesized in our lab according to a previously reported protocol (Zhou et al. , 2016).Reagents for biological assaysSlide-A-Lyzer MINI Dialysis Devices, 3.5K MWCO and QUANT-iT Ribogreen reagent were purchased from ThermoFisher. MEGAscript SP6 Transcription Kit was purchased from ThermoFisher. N 1 -Methylpseudouridine-5 '-Triphosphate was purchased from TriLink. ScriptCap Cap 1 Capping System was purchased from Cellscript Inc. Cre mRNA was provided by Recode Therapeutics. Cyclophosphamide (NSC-26271) Monohydrate was purchased from Selleckchem. MSGV-1D3-28Z All IT AMs intact (Plasmid #107226) was obtained from Addgene. 4,5-Dihydro-2-(6-hydroxy-2-benzothiazolyl)-4- thiazolecarboxylic acid sodium salt (D-luciferin) was purchased from Goldbio. For flow cytometry, FITC anti-mouse CD3 Antibody, PerCP anti-mouse CD4 Antibody were purchased from BioLegend; and CD8a Monoclonal Antibody (53-6.7), Alexa Fluor 700 waspurchased from Thermo Fisher. For immunofluorescence of frozen tissue sections, Alexa Fluor 647 anti-mouse CD3 Antibody was purchased from BioLegend. Triton X-100 and Dulbecco′s Phosphate Buffered Saline were purchased from Sigma Aldrich. Cell culture Dulbecco’s Modified Eagle Medium (DMEM)—containing high glucose, sodium pyruvate, L-glutamine, and phenol red—and Roswell Park Memorial Institute (RPMI) 1640 medium were purchased from ThermoFisher Scientific. Trypsin-EDTA (0.25%) and fetal bovine serum (FBS) (10%) were purchased from Sigma-Aldrich. Penicillin-Streptomycin was purchased from Fisher Scientific. Blastidicin selection antibiotic was purchased from InvivoGen. A20 cells were gifted by Professor Yang-Xin Fu’s lab. Animal studies. C57 / BL6 mice were used for the luciferase mRNA in vivo delivery studies. Ai14 mice were used in the cell tracking experiments following administrations of LNPs with Cre mRNA. Balb / c mice were used for the tumor studies. All experiments were approved by the Institutional Animal Care & Use Committee (IACUC) of The University of Texas Southwestern Medical Center and were consistent with local, state, and federal regulations as applicable. Synthesis of 5A2-G1. To a 20-mL vial was equipped with a stirred bar and added tetraethylenepentamine (5A2, 4.0 g, 1.0 equiv.) and 2-(acryloyoxy)ethyl methacrylate (AEMA, 20.4 g, 5.25 equiv.), butylated hydroxyltoluene (BHT, 838 mg, 0.18 equiv. ) The resulting reaction mixture was stirred at 50 ℃ and 500 rpm for 24 hours under N2. The crude product was purified by flash column (silica, 30% to 50% acetone / hexanes with 3% triethylamine) to achieve the 5A2-G1 (43% yield). Rf = 0.15 (50% acetone / hexanes with 3% triethylamine, silica). Synthesis of 5A2-SC8. To a 20-mL vail was equipped with a stirred bar and added 5A2-G1 (3.9 g, 1.0 equiv.) and dimethylphenylphosphine (DMPP, 193 μL, 0.45 equiv.), 1-octanethiol (SC8, 4.71 mL, 6*1.5 equiv.) The resulting reaction mixture was stirred at 55 ℃ and 500 rpm for 48 hours under N2. The crude product was dissolved in minimal amount of CH2Cl2 and purified by flash column (neutral Al2O3, 20% to 100% of ethyl acetate / hexanes) to yield the 5A2-SC8 (59% yield). Rf = 0.2 (70% ethyl acetate / hexanes, neutral Al2O3). HRMS Calc. for C110H203N5O24S6:2170.3142, found: 2170.2966. Formulation of 5A2-SC8 SORT LNPs.5A2-SC8 LNPs were prepared by rapid hand mixing of acidic aqueous solution and ethanol solution. The ethanol solution contained 5A2-SC8, DOPE, cholesterol, PEG-DMG, and 18:1 PA in a molar ratio of 15:15:30:3:7 at a weight ratio of total lipid:mRNA 30:1 (wt / wt). The mRNA was dissolved in the 10 mM citrate buffer pH 3.0. The aqueous solution and ethanol solution were rapidly mixed for 30 seconds at a 3:1 volume ratio and were incubated at room temperature for 15 min to allow LNP assembly. For in vitro experiments, PBS solution was added to reach the final concentration. For in vivo experiments, LNPs were purified by dialysis in sterile PBS with 3.5kD cut-off for 2 hours. The volume was adjusted to the desired concentration for subsequent experiments. Characterization of LNPs. Size and zeta potential of LNPs were measured using a Malvern Zetasizer. Size and polydispersity index were measured by Dynamic Light Scattering (He-Ne laser, λ = 632 nm; detection angle = 173°) using 100 µL of fresh LNP dispersion. Zeta potential was measured after diluting LNPs to 800 µL with 1x PBS. mRNA encapsulation was measured using QUANT-iT. The global / apparent pKa of each LNP formulation was measured using the TNS assay. LNP formulations were normalized to 75 µM total lipids and incubated individually for 5 minutes with 5 µM of TNS [6-(p-Toluidino)-2-naphthalene sulfonic acid] fluorescent probe in a series of different buffers [10 mM HEPES, 10 mM MES (4- morpholineethanesulfonic acid) 10 mM ammonium acetate, and 130 mM NaCl] with a pH ranging from 2 to 11. The mean fluorescence intensity was measured in a Tecan plate reader (λ¬Ex = 324, λEm = 435) in technical replicates of 3. The global / apparent pKa was estimated by the pH at which half-maximum fluorescence was recorded after a non-linear regression line fit (GraphPad Prism). In vivo luciferase mRNA delivery All experiments were approved by the Institution Animal Care and Use Committees of The University of Texas Southwestern Medical Center and were consistent with local, state, and federal regulations as applicable. Normal wild-type C57BL / 6 female mice were maintained as a colony. When mice reached a body weight between 18-20 g, LNPs formulated with Fluc mRNA were injected intravenously (IV) at a dose of 0.3 mg / kg. After 24h, D-luciferin was injected intraperitoneally at a dose of 150 mg / kg. After 5 min, organs (lungs, liver, kidneys, and spleen) were dissected, and luciferase luminescence was imaged using an and AMI-HTX (Spectral Imaging systems). Luminescence was quantified as total luminescence (p / s). Cell tracking.All experiments were approved by the Institution Animal Care and Use Committees of The University of Texas Southwestern Medical Center and were consistent with local, state, and federal regulations as applicable. Ai14 mice were maintained as a colony. When mice reached a body weight between 18-20 g, LNPs formulated with Cre mRNA were injected IV at a dose of 0.5 mg / kg. After 48h, the mice received a second IV injection with LNP-Cre mRNA at a dose of 0.5 mg / kg. After 48h, the organs were collected and processed by flow cytometry. Flow cytometry After LNP injection, spleens were collected and passed through 100 µm cell strainer (BD-Biosciences) to obtain a single cell suspension. Additionally, blood was collected in EDTA-containing tubes to prevent clotting. The single cell suspension and the blood were treated with 1x red blood cell (RBC) lysis buffer (BioLegend) for 5 and 10 minutes respectively on ice. Lysis buffer was neutralized by adding twice the volume of cell staining buffer (BioLegend). ~1×106cells were stained with anti-mouse CD45, CD4, CD3, antibodies (all from BioLegend) and anti-mouse CD8 antibody (ebiosciences) at 1:100 dilution for 20- 30 minutes on ice. Ghost Red 780 (Tonbo Biosciences) or Live Dead Aqua (Invitrogen) was used to distinguish live vs. dead cells. Finally, the cells were washed and resuspended in 500 µL of cell staining buffer and analyzed by LSRFortessa flow cytometer (BD Biosciences). Data were analyzed by FlowJo version 10.8.1 software (BD Biosciences). Plasmid cloning Mouse anti-CD19 (CD28 co-stimulatory region and CD3 zeta signaling domain) Chimeric antigen receptor CAR19-28z was cloned from MSGV-1D3-28Z Addgene plasmid and inserted via restriction end cloning into pCS2 vector. For the CAR19-41BBz, the gene was purchased from Azenta (genewiz) by switching the CD28 co-stimulatory region of 1D3- 28Z for 41BB coding region (1D3-41BBz). Purchased DNA was then cloned into pCS2 vector by restriction end cloning. The sequences of both mRNA and DNA sequences for chimeric antigen receptors CAR19-28z and CAR19-41BBz are presented in Table 1.DIACCAG A AC CACA G GGCGCA ATAAG A ATGT TGTG G A GCGCCACAACCG AC CGTA AGCACG ACATCTATTGC CCCGCGGTGT CG A GCA GTCG G C G G GAGTGGC CG AGG TA ACT CACCTAGTACGTAGTATACG A A GTG GC CCA A GCG T ATTTCA GCTCA GC GCG C ATTA ACG G G ACACCACCGT TAA GG GT CG ACAT CCATTA G CCA ACAACATCCCCATAGCGTGGGCA C A GC AACCT CGCC CT GC CG G AGTAGGCGAA G CG GGA GT TGCGGCGCGC T TG A ACCG T ATATG G GTGTCGCA CC CCA A CC T CGGCG TCG TA CTG C A A G GCG C GCA GAG GGTC G GCG GCTCGG C CACATA eTTcGnT CGe GCTGTA G G ACG AATAT T CGCAACA TGA G GA GCGGCCCCGCA A GACGCC CGGCCGTA ATA G GTCACqG G ATCGTATT CC CACuG G G G A G GAGTACG ACAC CC CG GGGT G A C TG ACA ACCTCAC C C C CGGTGCG GC1eSA ACA G A G A A GACG G A GACAGCG G2e.lvbdai z, 7 Tca84c 2-95- ie9l189cR A87- uAN86NCD84G G ATCAAACATGC TTATGACU GGG GGACGCGCAGACGTCGCGGAACG UCGGAAGCG ACAACATGTTTGAACAG U GCTCGCGT CG GCACGGTGGAAGCA GCCCCCGTCACA CGGG AACGTGAGAGAGTTTCA TC TCT CA GG AGGGTA G GU UGCG TACTC GC TAGAT TCATGTTA GC AGGTGCCC GA AG TTGGCGTTT T CGATCTTACAAGAAGGCACAGGCACU C A GCA C A GT T C CC CT TCCGCCGTGTTAC ACUCG ACGTCTAA GG GT CGACAAT CATATTG T AA AATCTACGCGCACAC CCG CAA AACCCCATA GGC TGGGCAGC AACCT CCTTC CCA A ACA GGA ACAA AGCCGC CA GCCCG AG T AGGGCACTGTGAAG GGCG ATATTA GCAC CAGGG C AC A CACG G GG G AACCTGGGC TG CTGGAC C C C CAAT UUUCC ACTTG CGG GT TC GCCGCGG A GC GGAAAC CCCU CCG T G GTC TA CCCAAG GCT GT TGGTG T ACTTC C TCCACACCU CCU A G U CG GAGATCAGGATCTG CCAA AGTCCTGCTTG GAGUCUG AGGGTGACU GTCT TGGA GCAGATCGTGCA CCGCGG A A GTCCTGAACACTCCTGG G G UCCG U GCCC CA ACTGCAGTTGA A GACUACG GG A GGGGTCGTAGGA A C ACT TC TAG GTGCAUCGC T C CG U A T AGGCGTCG A C TGCAGGTACG GGCCATAGGAGTA CCCG GTAC C C CAGT TG ATA ACGCGG A A AACACG A ACA G A G A A GCGT CGGTACGTTG GC CA U G U2.vz, 7 -84295- 91 z- 989R B1A87A B A R N - 1 NAR86C 4DCm84G G G AACG U A UCCACACA G G GGU ACCCC C CU A A G UUCGCGG ACA G UCC CCA G G ACACGACA GCCG G G G U G GAACGG G A U A GCGC CG AACG UCCA GCC U UGCGCCG U GUUCACGCAUA A GUCU AC CG G C G ACCG G A UACG ACA A ACU A UAGA A G A U G AC CAA CU U A AGCACUCAC C CAC CG AA UCG C U A G A U G A U G UUG G A A A A AC CGG U C G G GGCCCUCCG A G G A U A G ACGUCG G U AACAAA ACCUCUG CU GGACG U AC CG AGCAU GCCGUU GACUCU ACA AGCGUA A U G UC CA GCG ACG G G UC AG AAAU G G G AUG G GACACGGCAC CA GCG ACG U GUU AUUUG U ACU A U ACU U GU GCU GCA G GAA ACCAAGGCG UC CG U A G A G A GACCCG AGCG A ACU U G A ACUCGUGGCA GCAACACU A GUCAA G G A A AAA ACU A AUCUCUGAG G GCGCUCG G U A A GG G G C GCCGC GCG ACU C G G U G G A G A G ACCCCACG A A G A GUCU A U U A UACCU GCCG A G AUCACACA G A G A UACCCAUCUGCG AGCA G GUCG G G ACCA A UG CCCA U U A AA CCCA G C GUGCGCA G G U GUCA GUCA G G A G U UCCU A A GCCGCUUCA A ACGGCA G G A A A U G U G2.v, 74-95- 91 zA89R B N87- A B R86C14m84G UCGCCGGGCCACAGCG AU CC GUCAGUUGUCCUCG GUUAA UCACCGG A UUC C CGCCAA UAGG G AG AGUCG G U UUCACU A AGCGAGGAA AAACCAAUUUCU AUCUCU UUCGGCGGA UAA GG AAC CCCGGUAGGUCGU G GAG AACACAA GU GAACUA AUAUAGG AUGUCGAA AAA UUAA AGGCGAAG GGAGGUAUCCAGAGUCGUGA GGACUUUAA AA C ACCACAAGUCUGACGG ACCCAAAA C AGGUUUCGCUGCAA UCG AA A UGAA GUGACACCAGGGUGCGAAA ACU G UGGC CAA GCGUGCGG UACUAA U A GUACG G G A AUUCAA AACAUCCACAUCAACA U A AACAGCGU UUAA GGGG UCCGCGGGCGC CCCUCG AGGUGAAA G U UGACA ACCGUGGGUA G U A UGCCUGA GCCGAAAA GG AACAA GAA GUA AAG UAG GC CAAA ACCGGAUCGC CGAUGCCGGCAUACAC CGAA A AAGAU U A GGCUAACUCUCGCCGGAUUAA GGA GGGCUGA GAUG UC CA GG G AA GCCGUAA GCCCUGCCCCACUCUG UGCCGUUCGAACUCCAA AGGCAAAACGGAUUUACUGGACG GCAA GUGGC CAGCUAG G A A UA G UU AGGCUGCUAACCUGAA G C GGUUA G GCCUCGA GCACUAUAA GAA G GU U GCGAC GUCG CC CGUA UUCUG AGCCCC CAAA AAG AUCGC CCCU G GAG GCCU U GU AAA ACGU G G A U G GU AC CAC CGC CAC CGAA AG GAU UCG GG GUC CGGUGUCA AGAUCUAA GUCGGACG AUU GCGCUAGGGU CCAGGCAAA GU A ACAGAACC ACC CUCGC CGCGCCGCUAA AC CAGAAUGCAAAA GAUCG UAA A G GACAACAGGUG AUAGGUCAAA GGUCA G AUCAGAUUCU GUCGUCA G G A GCCGGUA GGGGG UAA A G A A A A G U A U AGCA A A2.v, 7495- 8987- 8684mRNA synthesis CAR19-41BBz and CAR19-28z mRNAs described in Table 1 were made by in vitro transcription (IVT) as described before (Cheng et al., 2018). Briefly, coding regions were cloned into pCS2+MT plasmid (Addgene), then 5’, 3’ untranslated regions and polyA were cloned into the template. Finally, linearized pDNA was obtained by XhoI restriction right after the PolyA sequence. In vitro transcription was performed following IVT protocols for the SP6 promoter kit. The UTP was replaced by N1-methylpseudouridine-5'-triphosphate in the IVT reaction, and Cap-1 mRNA was used. The final product was purified by LiCl precipitation method described in the kit. The mRNA size was verified by TapeStation (Agilent). Aggressive lymphoreplete A20 lymphoma model A20-cells were transduced with lentivirus to express luciferase, A20-Luc cells positive for luciferase were selected by blastidicin incubation for 72h, expanded and kept frozen under 10% DMSO until in vivo experiments. Previously described protocols were used to create the lymphoreplete model (Kueberuwa et al., 2018a; Kueberuwa et al., 2018b). Briefly, normal wild type balb / c female mice were purchased from Invigo at 5-6 weeks old. When the mice reached 6-8 weeks of age, they were injected with cyclophosphamide 100 mg / kg to briefly debilitate the immune system and promote engraftment of tumor cells.1×106cells were injected via IV into the mice 24 hours after cyclophosphamide injection. Treatments were started at day 14 after cyclophosphamide injection to allow the immune system to recover. End point was reached when abdominal circumference (AC) reached 75mm2as measured by the average of sagittal abdominal diameter (SAD) and transverse abdominal diameter (TAD) multiplied by π constant (AC= π(SAD+TAD) / 2). Tumor was also monitored by bioluminescent imaging (BLI) using the Spectral Imaging Systems AMI-HTX at 30s of exposure. Second round of aggressive lymphoreplete A20 lymphoma model Followed the same protocol described above to establish the tumor. The same dose of cells was administered: 1×106cells, 24 hours after cyclophosphamide injection. Treatments were started once BLI signal reached 1×107p / s. End point was reached when AC reached 75mm2. Less aggressive lymphoreplete A20 lymphoma model Followed the same protocol described above to establish the tumor. The dose of cells administered was adjusted to 5×105cells. Treatments were started once bioluminescent signalreached 1×107p / s. End point was reached when the BLI signal reached 1×109p / s, right before the saturation of the image. Immunofluorescence Tumor tissues were collected at the end point of the tumor model and frozen in Tissue-Plus™ O.C.T. Compound at -80 ˚C. Tissues were cryo-sectioned by the Simmons Cancer Center Core facilities using Cryostat machine (Leica Biosystems). Tissue slides were fixed with 4% PFA followed by three washes with 1x PBS for 5 min. Then, a 10% BSA with 0.25% triton-X100 solution was used to block the tissues for 1 hour followed by staining with a 2% BSA with 0.25% Triton-X100 containing Alexa Fluor® 647 anti-mouse CD3 antibody (1:100) for 48h. Tissue slices were washed three times for 5 min with 1× PBS with 0.25% Triton-X100 and mounted with DAPI-fluoroshield. Slides were imaged at 20× magnification by confocal microscopy (LSM 700, Zeiss). Sirius red staining Tissue sections were deparaffinazed and rehydrated by the following steps: First, the slide was placed in a rack and gently put into staining jars with 100% xylene and washed twice (10 min each), and then placed in a 50% xylene (in ethanol, v / v) a staining jar with 2 distinct washes (10 min each). The slides were then washed using ethanol with different concentrations (95%, 75%, 50%, 2 washes each, 5min each). The slices were then washed twice using distilled water and submerged 10 min each, following with dropping the agents of Weigert’s haematoxylin on the samples and culturing for 8 minutes to stain the nuclei. The slides were washed for 10 minutes in running tap water, placed in picro-sirius red staining solution (0.5 g sirius red to 500 mL picric acid (1.3% in water, Sigma-Aldrich)) for one hour and then washed with acidified water (5 mL acetic acid in 1 L of water) with two changes of the washing solution. Finally, the slides were dehydrated in three changes of 100% ethanol and cleared in xylene. The section was scanned under microscopy with a 10× lens. Flow-cytometric analysis Optimized flow cytometry protocols were based on published methods (Cheng et al, 2018; Cheng et al, 2020; Zhu et al, 2014). The fresh tumor tissues were dissected into 10 cm tissue culture dishes and cut into small pieces with a sterile razor blade. The tissues were transferred into 50 mL tubes containing a 100 µm cell strainer and washed with PBS (20 mL) followed by centrifuging at 2000 rpm for 3 min. Then, tumor digestion buffer (5 mL RPMI with 1% FBS and 0.25 mL 10× digestion buffer (2 mg / mL Collagenase D, 250 units / µL DNAse I, Sigma Aldrich)) was added into the tube with pelleted tissue after removing the supernatant. The tubes were put onto a shaker at 37 ℃ and shaken for 1 hour. The sampleswere filtered using 100 µm cell strainer and washed by adding 35 mL of PBS and spinning at 2000 rpm for 3 min. The pellets were re-suspended with 2 mL ACK lysis buffer to lyse the red blood cells by incubating for 5 min on ice and washed again through centrifugation at 2000 rpm for 3 min after adding 30 mL PBS. Next, the cells (5 × 106cells / mL) were incubated with an antibody cocktail solution (1 µL each antibody to 100 µL cell staining buffer) with 0.5 µL Ghost Dye Red 780 (Tonbo Bioscience) at 2-8 ℃ for 40 min and protected from light. The labeled samples were washed 2 times with 1.5 mL cell staining buffer (BioLegend). The samples were re-suspended into 500 µL cell staining buffer. Data acquisition was performed on an LSRFortessa (BD Biosciences). In addition, single color compensation controls were run on the LSRFortessa prior to the sample data collection. FlowJo was used for data analysis. All the fluorophore-conjugated anti-mouse antibodies are used for flow cytometry were purchased from BioLegend: Pacific Blue anti-mouse CD45 (Biolegend, Cat#1031266), APC anti-mouse CD3 Antibody (Biolegend, Cat#100236), PE anti-mouse CD8a (Biolegend, Cat#162304), PerCP / Cyanine5.5 anti-mouse CD4 (Biolegend, Cat#116012), Alexa Fluor 488 anti-mouse / human CD11b (Biolegend, Cat#101217), Alexa Fluor® 594 anti-mouse F4 / 80 (Biolegend, Cat#123140). Compressive modulus measurement The unconfined compression experimental protocol was employed to measure the compressive modulus of tumor tissue according to published work (Voutouri et al, 2018; Rashid et al, 2012). Fresh tumors were collected from mice within each group after therapy and mechanical testing was performed within 4 h. Each tumor tissue was preserved in PBS and all samples remained on the ice during transportation and measurement. All samples were cut into small sizes to allow for testing (The size of each sample is detailed in Table 2) and measured at a room temperature ~22 ℃. The tumor specimens (n=8) were loaded on a mechanical testing system with a 5.6 lbf load cell (TestResources, MN, USA, 250 lbf actuator). The compression measurement of the tumor tissues was performed to a final strain of 30% with a compression rate of 0.1 mm / min. The compressive modulus was calculated from the slope of the stress-strain curve in the range of 25-30% strain (Voutouri et al, 2018). Table 2. The size of tumor tissue for measuring the compressive modulus. Length (mm) Width (mm) Thickness (mm) 6.3 4.56 3.562.69 4.07 2Statistics and reproducibility Data are reported as mean ± s.d. Statistical analysis was performed using the two- tailed t-test, or one-way ANOVA with multiple comparison test. *P <0.05, **P <0.01, ***P < 0.001, ****P < 0.0001, no significant (ns) difference using GraphPad Prism software (GraphPad Software, USA). Exact P values which < 0.0001 obtained from Excel with the same statistical analysis. The data obtained from micrograph, T7E1, and Western blot are representative images of 3 biologically independent samples (n=3). *-*-*-*-*-*-*-*-*-*-*-*-*-*-*-*-*-*-*-*-*-*-* All of the compounds, material, compositions, and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the disclosure may have focused on several embodiments or may have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations and modifications may be applied to the compounds, compositions, and methods without departing from the spirit, scope, and concept of the invention. All variationsand modifications apparent to those skilled in the art are deemed to be within the spirit, scope, and concept of the invention as defined by the appended claims.REFERENCES The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference. Amini et al., Nat. Rev. Clin. Oncol, 19, 342-355, 2022. Cappell & Kochenderfer, Nat. Rev. Clin. Oncol., 18, 715-727, 2021. Carpenito et al., Proc. Natl. Acad. Sci. U.S.A., 106, 3360-3365, 2009. Cheng et al., Adv Mater, 30, e1805308, 2018. Cheng et al., Nat. Nanotechnol., 15, 313-320, 2020. Choi et al., Res. Public Health, 19, 12366, 2022. Dilliard et al., Proc. Natl. Acad. Sci. U.S.A, 118, e2109256118, 2021. Food Drug Administration, "Center for Biologics Evaluation and Research. Approval Letter- Kymriah", www.fda.gov / media / 106989 / download 2017. Food Drug Administration, "Center for Biologics Evaluation and Research. Approval Letter- Yescarta", www.fda.gov / media / 108458 / download, 2017. Food Drug Administration, "Center for Biologics Evaluation and Research. Approval Letter- Tecartus ", www.fda.gov / media / 140415 / download 2020. Food Drug Administration, "Center for Biologics Evaluation and Research. Approval Letter- ABECMA", www.fda.gov / media / 147062 / download, 2021. Food Drug Administration, "Center for Biologics Evaluation and Research. Approval Letter- Breyanzi", www.fda.gov / media / 145712 / download 2021. Food Drug Administration, "Center for Biologics Evaluation and Research. Approval Letter- CARVYKTI", www.fda.gov / media / 156572 / download, 2022. Gu et al., Zhejiang Univ. Sci. B, 23, 793-811, 2022. Hernandez et al., JAMA Oncol., 4, 994-996, 2018. Huang et al., Mol. Ther., 16, 580-589, 2008. Kochenderfer et al., Blood, 116, 3875-3886, 2010. Kueberuwa et al., Molecular Therapy - Oncolytics, 8, 41-51, 2018a. Kueberuwa et al., J Vis Exp, e58492, 2018b. Kueberuwa et al., J. Vis. Exp., e58492, 2018c. Liang et al., Medicine (Baltimore), 99, e22510, 2020. Long et al., Nat. Med., 21, 581-590, 2015.Milone et al., Mol. Ther., 17, 1453-1464, 2009. Owen et al., Cancer Immunol. Immunother., 72, 805-814, 2023. Parayath & Stephan, Annu. Rev. Biomed. Eng., 23, 385-405, 2021. Xin et al., Front. Oncol., 12, 809754, 2022. Zhou et al., Proceedings of the National Academy of Sciences, 113, 520-525, 2016.
Claims
What Is Claimed Is:
1. A method of preparing a chimeric antigen receptor (CAR) T cell in a patient comprising administering to the patient an mRNA encapsulated in a lipid nanoparticle, wherein the lipid nanoparticle selectively binds to a spleen cell, wherein the administration results in the formation of the CAR T cell in vivo.
2. A method of preparing a chimeric antigen receptor (CAR) T cell in a patient comprising administering to the patient an mRNA encapsulated in a lipid nanoparticle, wherein the lipid nanoparticle selectively internalizes into a spleen cell, wherein the administration results in the formation of the CAR T cell in vivo.
3. The method of either claim 1 or claim 2, wherein the spleen cell is a lymphocyte.
4. The method of claim 3, wherein the lymphocyte is a T cell.
5. The method of claim 4, wherein the T cell is a CD4+ T cell.
6. The method of claim 4, wherein the T cell is a CD8+ T cell.
7. The method according to any one of claims 1-6, wherein the lipid nanoparticle has a pKaof less than 6.
8. The method of claim 7, wherein the pKa is from about 1 to about 6.
9. The method of claim 8, wherein the pKa is from about 3 to about 6.
10. The method according to any one of claims 1-9, wherein the lipid nanoparticle comprises an ionizable cationic lipid.
11. The method of claim 10, wherein the ionizable cationic lipid is a dendrimer or dendron.
12. The method of claim 11, wherein the dendrimer or dendron is further defined by the formula: Core-Repeating Unit-Terminating Group (I) wherein the core is linked to the repeating unit by removing one or more hydrogen atoms from the core and replacing the atom with the repeating unit and wherein: the core has the formula: II) wherein:X1 is amino or alkylamino(C≤12), dialkylamino(C≤12),heterocycloalkyl(C≤12), heteroaryl(C≤12), or a substituted version thereof; R1 is amino, hydroxy, or mercapto, or alkylamino(C≤12), dialkylamino(C≤12), or a substituted version of either of these groups; and a is 1, 2, 3, 4, 5, or 6; or the core has the formula: (III) wherein: X2is N(R5)y; R5 is hydrogen, alkyl(C≤18), or substituted alkyl(C≤18); and y is 0, 1, or 2, provided that the sum of y and z is 3; R2is amino, hydroxy, or mercapto, or alkylamino(C≤12), dialkylamino(C≤12), or a substituted version of either of these groups; b is 1, 2, 3, 4, 5, or 6; and z is 1, 2, 3; provided that the sum of z and y is 3; or the core has the formula: V) wherein:X3 is −NR6−, wherein R6 is hydrogen, alkyl(C≤8), or substituted alkyl(C≤8), −O−, or alkylaminodiyl(C≤8), alkoxydiyl(C≤8), arenediyl(C≤8), heteroarenediyl(C≤8), heterocycloalkanediyl(C≤8), or a substituted version of any of these groups; R3 and R4 are each independently amino, hydroxy, or mercapto, or alkylamino(C≤12), dialkylamino(C≤12), or a substituted version of either of these groups; or a group of the formula: −N(Rf)f(CH2CH2N(Rc))eRd; wherein:e and f are each independently 1, 2, or 3; provided that the sum of e and f is 3; Rc, Rd, and Rf are each independently hydrogen, alkyl(C≤6), or substituted alkyl(C≤6); c and d are each independently 1, 2, 3, 4, 5, or 6; or the core is alkylamine(C≤18), dialkylamine(C≤36), heterocycloalkane(C≤12), or a substituted version of any of these groups; wherein the repeating unit comprises a degradable diacyl and a linker; the degradable diacyl group has the formula: II) whereA1 and A2 are each independently −O− or −NRa−, wherein: Rais hydrogen, alkyl(C≤6), or substituted alkyl(C≤6); Y3 is alkanediyl(C≤12), alkenediyl(C≤12), arenediyl(C≤12), or a substituted version of any of these groups; or a group of the formula:X3and X4are alkanediyl(C≤12), alkenediyl(C≤12), arenediyl(C≤12), or a substituted version of any of these groups; Y5is a covalent bond, alkanediyl(C≤12), alkenediyl(C≤12), arenediyl(C≤12), or a substituted version of any of these groups; and R9 is alkyl(C≤8) or substituted alkyl(C≤8); the linker group has the formula: I)wherein: Y1 is alkanediyl(C≤12), alkenediyl(C≤12), arenediyl(C≤12), or a substituted version of any of these groups; and wherein when the repeating unit comprises a linker group, then the linker group comprises an independent degradable diacyl group attached to both the nitrogen and the sulfur atoms of the linker group if n is greater than 1, wherein the first group in the repeating unit is a degradable diacyl group, wherein for each linker group, the next repeating unit comprises two degradable diacyl groups attached to the nitrogen atom of the linker group; and wherein n is the number of linker groups present in the repeating unit; and the terminating group has the formula: II) wherein:Y4 is alkanediyl(C≤18) or an alkanediyl(C≤18) wherein one or more of the hydrogen atoms on the alkanediyl(C≤18)has been replaced with −OH, −F, −Cl, −Br, −I, −SH, −OCH3, −OCH2CH3, −SCH3, or −OC(O)CH3; R10 is hydrogen, carboxy, hydroxy, or aryl(C≤12), alkylamino(C≤12), dialkylamino(C≤12), N-heterocycloalkyl(C≤12), −C(O)N(R11)−alkanediyl(C≤6)−heterocycloalkyl(C≤12), −C(O)−alkylamino(C≤12), −C(O)−dialkylamino(C≤12), −C(O)−N- heterocycloalkyl(C≤12), wherein: R11is hydrogen, alkyl(C≤6), or substituted alkyl(C≤6); wherein the final degradable diacyl in the chain is attached to a terminating group; n is 0, 1, 2, 3, 4, 5, or 6; or a pharmaceutically acceptable salt thereof.
13. The method of claim 12, wherein the terminating group is further defined by the formula: II)wherein: Y4 is alkanediyl(C≤18); and R10 is hydrogen.
14. The method of either claim 12 or claim 13, wherein the core is further defined by the formula: (III) wherein:X2is N(R5)y; R5 is hydrogen or alkyl(C≤8), or substituted alkyl(C≤18); and y is 0, 1, or 2, provided that the sum of y and z is 3; R2is amino, hydroxy, or mercapto, or alkylamino(C≤12), dialkylamino(C≤12), or a substituted version of either of these groups; b is 1, 2, 3, 4, 5, or 6; and z is 1, 2, 3; provided that the sum of z and y is 3.
15. The method of either claim 12 or claim 13, wherein the core is further defined by the formula: V) wherein:X3 is −NR6−, wherein R6 is hydrogen, alkyl(C≤8), or substituted alkyl(C≤8), −O−, or alkylaminodiyl(C≤8), alkoxydiyl(C≤8), arenediyl(C≤8), heteroarenediyl(C≤8), heterocycloalkanediyl(C≤8), or a substituted version of any of these groups; R3and R4are each independently amino, hydroxy, or mercapto, or alkylamino(C≤12), dialkylamino(C≤12), or a substituted version of either of these groups; or a group of the formula: −N(Rf)f(CH2CH2N(Rc))eRd; wherein: e and f are each independently 1, 2, or 3; provided that the sum of e and f is 3; Rc, Rd, and Rf are each independently hydrogen, alkyl(C≤6), orsubstituted alkyl(C≤6); c and d are each independently 1, 2, 3, 4, 5, or 6.
16. The method according to any one of claims 12-15, wherein the core is further defined as: , , , ,17. The method according to any one of claims 12-16, wherein the dendrimer is further defined as:,;18. The method according to any one of claims 1-17, wherein the lipid nanoparticle further comprises a permanently anionic lipid.
19. The method of claim 18, wherein the permanently anionic lipid comprises a phosphate group.
20. The method according to any one of claims 1-19, wherein the permanently anionic lipid is further defined as: B) wherein:R1 and R2 are each independently alkyl(C8-C24), alkenyl(C8-C24), or a substituted version of either group; R3is hydrogen, alkyl(C≤6), or substituted alkyl(C≤6), or −Y1−R4, wherein: Y1 is alkanediyl(C≤6) or substituted alkanediyl(C≤6); and R4 is acyloxy(C≤8-24) or substituted acyloxy(C≤8-24).
21. The method of claim 20, wherein the permanently anionic lipid is further defined as:. 22.e e o acco g o ay oe o ca s - , wee e p nanoparticle further comprises a phospholipid.
23. The method according to any one of claims 1-22, wherein the lipid nanoparticle further comprises a steroid.
24. The method of claim 23, wherein the steroid is cholesterol.
25. The method according to any one of claims 1-24, wherein the lipid nanoparticle further comprises a polymer conjugated lipid.
26. The method of claim 25, wherein the polymer conjugated lipid is a PEGylated lipid.
27. The method of either claim 25 or claim 26, wherein the polymer conjugated lipid is further defined by the formula:wherein: R12 and R13 are each independently alkyl(C≤24), alkenyl(C≤24), or a substituted version of either of these groups; Re is hydrogen, alkyl(C≤8), or substituted alkyl(C≤8); and x is 1-250.
28. The method of either claim 25 or claim 26, wherein the polymer conjugated lipid is dimyristoyl-sn-glycerol or a compound of the formula: wherein:n1 is 5-250; and n2and n3are each independently 2-25.
29. The method according to any one of claims 1-28, wherein the mRNA encodes for a chimeric antigen receptor (CAR).
30. The method of claim 29, wherein the mRNA encodes for two or more chimeric antigen receptors.
31. The method according to any one of claims 1-30, wherein the mRNA further encodes for a co-stimulatory molecule.
32. The method of claim 31, wherein the mRNA encodes for two or more co-stimulatory molecules.
33. The method according to any one of claims 1-32, wherein the mRNA further encodes for a signaling domain.
34. The method of claim 33, wherein the mRNA encodes for two or more signaling domain.
35. The method according to any one of claims 1-34, wherein the mRNA further encodes for one or more cytokines.
36. The method according to any one of claims 1-35, wherein the mRNA encodes for:(i) one or more chimeric antigen receptor; (ii) one or more signaling domains; and (iii) one or more co-stimulatory molecule.
37. The method according to any one of claims 1-36, wherein the mRNA encodes for: (i) one or more chimeric antigen receptor; (ii) one or more signaling domains; (iii) one or more co-stimulatory molecule; and (iv) one or more cytokines.
38. The method according to any one of claims 29-37, wherein the chimeric antigen receptor encoded for is an antigen of a tumor marker.
39. The method of claim 38, wherein the tumor marker is CD19 or CD20.
40. The method according to any one of claims 31-39, wherein the co-stimulatory molecule encoded for is CD28 or 41BB.
41. The method according to any one of claims 33-40, wherein the signaling domain encoded for is CD3ζ.
42. The method according to any one of claims 1-41, wherein the lipid nanoparticle comprises from about 1% to about 45% of an ionizable cationic lipid as a molar percentage of the lipid nanoparticle.
43. The method of claim 42, wherein the lipid nanoparticle comprises from about 10% to about 30% of the ionizable cationic lipid as a molar percentage of the lipid nanoparticle.
44. The method according to any one of claims 1-43, wherein the lipid nanoparticle comprises from about 1% to about 40% of a permanently anionic lipid as a molar percentage of the lipid nanoparticle.
45. The method of claim 44, wherein the lipid nanoparticle comprises from about 5% to about 20% of the permanently anionic lipid as a molar percentage of the lipid nanoparticle.
46. The method according to any one of claims 1-45, wherein the lipid nanoparticle comprises from about 1% to about 45% of a phospholipid as a molar percentage of the lipid nanoparticle.
47. The method of claim 46, wherein the lipid nanoparticle comprises from about 10% to about 30% of the phospholipid as a molar percentage of the lipid nanoparticle.
48. The method according to any one of claims 1-47, wherein the lipid nanoparticle comprises from about 10% to about 70% of a steroid as a molar percentage of the lipid nanoparticle.
49. The method of claim 48, wherein the lipid nanoparticle comprises from about 25% to about 60% of the polymer conjugated lipid as a molar percentage of the lipid nanoparticle.
50. The method according to any one of claims 1-47, wherein the lipid nanoparticle comprises from about 0.01% to about 15% of a polymer conjugated lipid as a molar percentage of the lipid nanoparticle.
51. The method of claim 50, wherein the lipid nanoparticle comprises from about 0.1% to about 10% of the polymer conjugated lipid as a molar percentage of the lipid nanoparticle.
52. The method according to any one of claims 1-51, wherein the lipid nanoparticle comprises: (i) an ionizable cationic lipid; (ii) a permanently anionic lipid; and (iii) a steroid.
53. The method of claim 52, wherein the lipid nanoparticle comprises: (i) an ionizable cationic lipid; (ii) a permanently anionic lipid; (iii) a steroid; and (iv) a polymer conjugated lipid.
54. The method of claim 52, wherein the lipid nanoparticle comprises: (i) an ionizable cationic lipid; (ii) a permanently anionic lipid; (iii) a steroid; and (iv) a phospholipid.
55. The method of claim 52, wherein the lipid nanoparticle comprises: (i) an ionizable cationic lipid; (ii) a permanently anionic lipid;(iii) a steroid; (iv) a phospholipid; and (v) a polymer conjugated lipid.
56. The method according to any one of claims 1-55, wherein the method comprises systemically administering the lipid nanoparticle to the patient.
57. The method of claim 56, wherein the systemic administration is via injection.
58. The method of either claim 56 or claim 57, wherein the systemic administration is intravenous administration.
59. A method of treating a disease or disorder in a patient comprising administering to the patient a lipid nanoparticle comprising an mRNA, wherein the mRNA encodes for a chimeric antigen receptor, and the lipid nanoparticle selectively binds to a spleen cell.
60. The method of claim 59, wherein the disease is cancer.
61. The method of claim 60, wherein the cancer is a cancer of the lymph system.
62. The method of claim 61, wherein the cancer of the lymph system is lymphoma.
63. The method of claim 59, wherein the disease is a cardiovascular disease.
64. The method of claim 63, wherein the cardiovascular disease is a cardiac injury or heart failure.
65. The method of claim 59, wherein the disease or disorder is a fibrotic disease.
66. A method of modifying a lymphocyte comprising administering to a patient a lipid nanoparticle comprising a mRNA that encodes for a chimeric antigen receptor, wherein the lipid nanoparticle selectivity binds to a lymphocyte.
67. The method of claim 66, wherein the lymphocyte is a T cell.
68. The method of claim 67, wherein the T cell is a CD4+ T cell.
69. The method of claim 67, wherein the T cell is a CD8+ T cell.
70. A composition comprising: (A) a lipid nanoparticle comprising: (i) an ionizable cationic lipid; (ii) a permanently anionic lipid; and (iii) one or more additional lipids; and (B) an mRNA encoding for a chimeric antigen receptor;wherein the mRNA is encapsulated within the lipid nanoparticle and the lipid nanoparticle has an apparent pKaof less than 6.
71. The composition of claim 70, wherein the additional lipids include a steroid.
72. The composition of claim 71, wherein the steroid is cholesterol.
73. The composition according to one of claims 70-72, wherein the additional lipids include a phospholipid.
74. The composition of claim 73, wherein the phospholipid is a neutral phospholipid.
75. The composition according to any one of claims 70-74, wherein the additional lipids include a polymer conjugated lipid.
76. The composition of claim 75, wherein the polymer conjugated lipid is a PEGylated lipid.
77. The composition according to any one of claims 70-76, wherein the lipid nanoparticle comprises from about 1% to about 45% of an ionizable cationic lipid as a molar percentage of the lipid nanoparticle.
78. The composition of claim 77, wherein the lipid nanoparticle comprises from about 10% to about 30% of the ionizable cationic lipid as a molar percentage of the lipid nanoparticle.
79. The composition according to any one of claims 1-78, wherein the lipid nanoparticle comprises from about 1% to about 40% of a permanently anionic lipid as a molar percentage of the lipid nanoparticle.
80. The composition of claim 79, wherein the lipid nanoparticle comprises from about 5% to about 20% of the permanently anionic lipid as a molar percentage of the lipid nanoparticle.
81. The composition according to any one of claims 1-80, wherein the lipid nanoparticle comprises from about 1% to about 45% of a phospholipid as a molar percentage of the lipid nanoparticle.
82. The composition of claim 81, wherein the lipid nanoparticle comprises from about 10% to about 30% of the phospholipid as a molar percentage of the lipid nanoparticle.
83. The composition according to any one of claims 1-82, wherein the lipid nanoparticle comprises from about 10% to about 70% of a steroid as a molar percentage of the lipid nanoparticle.
84. The composition of claim 83, wherein the lipid nanoparticle comprises from about 25% to about 60% of the polymer conjugated lipid as a molar percentage of the lipid nanoparticle.
85. The composition according to any one of claims 1-84, wherein the lipid nanoparticle comprises from about 0.01% to about 15% of a polymer conjugated lipid as a molar percentage of the lipid nanoparticle.
86. The composition of claim 85, wherein the lipid nanoparticle comprises from about 0.1% to about 10% of the polymer conjugated lipid as a molar percentage of the lipid nanoparticle.