Culture medium for gastric stem cell and culture method

Abstract

To provide a gastric stem cell proliferation medium that does not contain undefined components such as animal serum or cell culture supernatants, also to provide a gastric stem cell proliferation medium that resolves the non-uniformity of cultured proliferative cells, and further to provide a method for producing cultured gastric stem cells using these media.SOLUTION: The present invention provides a gastric stem cell proliferation medium that contains at least one selected from NF-κB signaling pathway activators and EGF-Erk signaling inhibitors. The present invention also provides a method for producing cultured gastric stem cells using the medium.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a culture medium for gastric stem cells and a culture method. [Background technology]

[0002] The stomach is a specialized digestive organ that breaks down food with proteases under highly acidic conditions, sterilizes attached bacteria, and promotes the absorption of nutrients in the downstream intestinal tract. The stomach lumen is covered with a complex epithelial cell group called gastric glands, and the surface mucus cells present in the upper part of the gastric glands secrete large amounts of glycoproteins called mucins to form a mucus layer, which protects the stomach tissue from the highly acidic proteolytic enzyme solution by isolating it from gastric juice. These surface mucus cells are constantly supplied by stem cells in the neck present below. The surface mucus cells differentiate and mature one after another from stem cells, and after completing their role within a few days, they fall off from the upper part of the gastric glands and are replaced by new surface mucus cells. The stomach is divided into the body, which secretes gastric acid and digestive enzymes, and the pyloric antrum, which mainly secretes hormones and mucus, but it is thought that stem cells in the body of the stomach also differentiate into cervical mucus cells, parietal cells that secrete gastric acid, and chief cells that secrete digestive enzymes.

[0003] In disease research for many years, primary cultured cells of adult tissues with limited proliferation ability, such as cancer cell lines that proliferate permanently or that can be cultured for only a short period of time, have been used. However, with the discovery of culture conditions for proliferating Lgr5-positive stem cells in small intestinal tissue in a test tube (Non-Patent Document 1, Patent Document 1), new culture techniques have been developed in which tissue cells are taken from diseased organs such as cancer and normal tissues outside the body, proliferated and cultured for a long period of time, and analyzed. In particular, a technology for creating biological mini-tissues called "organoids" by culturing in a test tube by culturing and growing proliferative cells of adult tissues in a 3D culture has been rapidly developed. It has become possible to extract various cells, including stem cells, from normal tissues and diseased tissues, increase and differentiate them in a test tube, create mini-tissues, analyze them in detail, and even search for therapeutic drugs. Since the culture conditions for proliferating small intestinal tissue in a test tube have been optimized, and Lgr5-positive cells are also present in other tissues, a technology has been developed in which various tissues are cultured in a test tube as organoids in a similar medium.

[0004] Such a culture method has also been reported for gastric stem cells (Non-Patent Documents 2-4). Specifically, cell growth factors such as Wnt, R-Spondin, and FGF10, as well as the peptide hormone gastrin, are included. However, many of these media contain many unidentified components, including animal serum and cell culture supernatant, and problems have been pointed out in terms of lot management. In addition, when the cells are grown in culture, they spontaneously differentiate and multiple types of cells are mixed, and this heterogeneity has also been considered to be a culture issue. Furthermore, since the medium is not specialized for gastric stem cells, there is also an issue that there is no medium that can selectively grow the produced stem cells. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] WO2010 / 090513 [Non-patent literature]

[0006] [Non-Patent Document 1] Sato T et al. Nature, 459, 259-262, 2009 [Non-Patent Document 2] Baker N et al. Cell Stem Cell 6, 25-36, 2010 [Non-Patent Document 3] Huebner AJ et al. Nature Cell Biology 25, 390-403, 2023 [Non-Patent Document 4] Mahe, MM et al. Curr Protoc Mouse Biology 3, 217-240, 2013 Summary of the Invention [Problem to be solved by the invention]

[0007] The present invention aims to provide a gastric stem cell proliferation medium that does not contain unidentified components such as animal serum and cell culture supernatant. It also aims to provide a gastric stem cell proliferation medium that selectively proliferates the produced stem cells, thereby resolving the heterogeneity of cultured proliferated cells. It also aims to provide a method for producing cultured gastric stem cells using these media. [Means for solving the problem]

[0008] As a result of intensive research aimed at solving the above problems, the present inventors discovered a gastric stem cell proliferation medium containing only chemical components and recombinant purified proteins, and completed the present invention. In particular, the present invention provides a gastric stem cell proliferation medium containing factors that activate the NF-κB signal pathway, such as Tnfsf12 and TNFα, as factors that maintain stemness. The present invention also provides a gastric stem cell proliferation medium containing an EGF-Erk signal inhibitor that suppresses differentiation of stem cells into surface mucous cells. Furthermore, the present invention provides cultured gastric stem cells prepared from gastric tissue.

[0009] That is, the present invention includes the following aspects. [1] A gastric stem cell proliferation medium containing at least one of an activator of the NF-κB signal pathway and an EGF-Erk signal inhibitor. [2] The gastric stem cell proliferation medium described in [1], wherein the activator of the NF-κB signal pathway is selected from the group consisting of recombinant proteins of the TNF family, recombinant proteins of the interleukin family, betulinic acid, prostratin, PMA, and calcimycin (A23187). [3] The activators of the NF-κB signal pathway are TNFSF1 (TNF-α), TNFSF2 (TNF-β, LT-α), TNFSF3 (LT-β), TNFSF4 (OX40L, CD252, gp34), TNFSF5 (CD40L, CD154, gp39), TNFSF6 (FasL, CD95L, Apo1L), and TNFSF7. (CD27L, CD70), TNFSF8(CD30L, CD153), TNFSF9(4-1BBL, APCs), TNFSF10(TRAIL, Apo2L), TNFSF11(RANKL, TRANCE, OPGL, ODF), TNFSF12(TWEAK, Apo3L), TNFSF13(APRIL, TALL-2, TRDL-1), TNFSF13B (BAFF, BLYS, The gastric stem cell proliferation medium according to [1], wherein the gastric stem cell proliferation medium is selected from the group consisting of THANK), TNFSF14 (LIGHT, HVEML, LT-γ), TNFSF15 (VEGI, TL1A), TNFSF18 (GITRL), EDA-A1, and EDA-A2. [4] The gastric stem cell proliferation medium described in [1], wherein the activator of the NF-κB signal pathway is selected from the group consisting of TNFSF10 (TRAIL, Apo2L) and TNFSF12 (TWEAK, Apo3L). [5] A gastric stem cell proliferation medium according to any one of [1] to [4], wherein the EGF-Erk signal inhibitor is an EGF receptor kinase inhibitor or an Erk inhibitor. [6] A gastric stem cell proliferation medium according to [1]-[4], wherein the EGF-Erk signal inhibitor is erlotinib or SCH772984. [7] A method for producing cultured gastric stem cells using the gastric stem cell proliferation medium described in [1]-[6] Effect of the Invention

[0010] The proliferation medium of the present invention makes it possible to stably culture and proliferate gastric stem cells in an undifferentiated state for a long period of time in a medium containing only chemically specified components. This overcomes the problem of lot management associated with the contamination of unknown components derived from animal serum, and facilitates a stable supply of the medium as a commercial product. [Brief description of the drawings]

[0011] [Figure 1] FIG. 1A is a micrograph of gastric epithelial cell organoids prepared by culturing in STO medium supplemented with TNFSF12 and STO medium not containing TNSFS12 in Example 1. FIG. 1B-E shows gene expression of Ki67 (FIG. 1B), Gkn2 (FIG. 1C), Muc5ac (FIG. 1D), and Aqp3 (FIG. 1E) in the prepared gastric stem cell organoids. FIG. 1F is a fluorescent micrograph showing the results of immunostaining of frozen sections of the prepared gastric epithelial cell organoids. [Diagram 2] FIG. 2A is a micrograph of gastric epithelial cell organoids prepared by culturing in STO medium containing TNFα and STO medium not containing TNFα in Example 2. FIG. 2B-E shows gene expression of Ki67 (FIG. 2B), Gkn2 (FIG. 2C), Muc5ac (FIG. 2D), and Aqp3 (FIG. 2E) in the prepared gastric stem cell organoids. FIG. 2F is a fluorescent micrograph showing the results of immunostaining of frozen sections of the prepared gastric epithelial cell organoids. [Diagram 3] FIG. 3A is a micrograph of gastric epithelial cell organoids prepared by culturing in STO medium containing erlotinib and STO medium not containing erlotinib in Example 3. FIG. 3B-E shows gene expression of Ki67 (FIG. 3B), Gkn2 (FIG. 3C), Muc5ac (FIG. 3D), and Aqp3 (FIG. 3E) in the prepared gastric stem cell organoids. FIG. 3F is a fluorescent micrograph showing the results of immunostaining of frozen sections of the prepared gastric epithelial cell organoids. [Figure 4]Figure 4A is a micrograph of gastric epithelial cell organoids prepared by culturing in STO medium containing SCH772984 and STO medium not containing SCH772984 in Example 4. Figures 4B-E are diagrams showing gene expression of Ki67 (Figure 4B), Gkn2 (Figure 4C), Muc5ac (Figure 4D), and Aqp3 (Figure 4E) in the prepared gastric stem cell organoids. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0012] The present invention will be described in detail below. The following embodiments are merely illustrative for explaining the present invention, and are not intended to limit the present invention to these embodiments. The present invention can be embodied in various forms without departing from the gist of the present invention.

[0013] The gastric stem cell proliferation medium according to the first aspect of the present invention comprises at least one of an activator of the Nuclear factor-kappa B (NF-κB) signal pathway and an inhibitor of Epidermal growth factor-Extracellular signal-regulated kinase (EGF-Erk) signal pathway.

[0014] The activator of the NF-κB signal pathway may be any one of NF-κB activators selected from the group consisting of recombinant proteins of the TNF (Tumor Necrosis Factor) family, recombinant proteins of the interleukin family, and low molecular weight compounds such as betulinic acid, prostratin, PMA (phorbol 12-myristate 13-acetate), and calcimycin (A23187).

[0015] The recombinant proteins of the TNF family include TNFSF1 (TNF-α), TNFSF2 (TNF-β, LT-α), TNFSF3 (LT-β), TNFSF4 (OX40L, CD252, gp34), TNFSF5 (CD40L, CD154, gp39), TNFSF6 (FasL, CD95L, Apo1L), TNFSF7 (CD27L, CD70), TNFSF8 (CD30L, CD153), TNFSF9 (4-1BBL, APCs), TNFSF10 (TRAIL, Apo2L), TNFSF11 (RANKL, TRANCE, OPGL, ODF), TNFSF12 (TWEAK, Apo3L), TNFSF13 (APRIL, TALL-2, TRDL-1), TNFSF13B (BAFF, BLYS, THANK), TNFSF14 (LIGHT, HVEML, LT-γ), TNFSF15 (VEGI, TL1A), TNFSF18 (GITRL), EDA-A1, EDA-A2 are preferred, with TNFSF10 (TRAIL, Apo2L) and TNFSF12 (TWEAK, Apo3L) being more preferred.

[0016] The recombinant proteins of the interleukin family include IL-1A, IL-1B, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17. , IL-18, IL-19, IL20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-34, IL-36, IL-37, IL-38, and L-39.

[0017] The EGF-Erk signal inhibitor in the gastric stem cell proliferation medium according to the first embodiment has an inhibitory activity of preferably 50% or more, more preferably 70% or more, even more preferably 80% or more, particularly preferably 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, or 95% or more, compared to the EGF activity level in the absence of the inhibitor. The EGF-Erk signal inhibitory activity can be evaluated by measuring the phosphorylation state of the EGF receptor or ERK protein by Western blotting or the like using a method known to those skilled in the art (Reference: Chen et al., Kidney International 82(1):45-52, 2012.).

[0018] The EGF-Erk signal inhibitor contained in the gastric stem cell proliferation medium of this embodiment is preferably an inhibitor with high selectivity, and examples thereof include EGF receptor kinase inhibitors such as gefitinib, cetuximab, panitumumab, and erlotinib, and Erk inhibitors such as lavoxertinib (GDC0994), SCH900353 (MK8353), ulixertinib, AZD0364 (ATG017), VX-11e (VTX-113), CC-90003, LY3214996, FR180204, ASN007, DEL-22379, VX-11e (TCS ERK 11e), ERK5-IN-1, XMD8-92, SC1 (pluripotin), and BIX. 02189, SCH772984, and the HER2 inhibitors lapatinib and trastuzumab.

[0019] The concentration of the EGF-Erk signal inhibitor contained in the gastric stem cell proliferation medium of this embodiment is preferably 1 nM to 100 μM, more preferably 5 nM to 20 μM, and even more preferably 20 nM to 10 μM. During stem cell culture, it is preferable to replace the proliferation medium with a fresh one every three days and add the EGF-Erk signal inhibitor to the proliferation medium.

[0020] When a recombinant protein of the TNF family is used as an activator of the NF-κB signal pathway contained in the gastric stem cell proliferation medium of this embodiment, the concentration of the recombinant protein of the TNF family is preferably 1 ng / mL or more and 3000 ng / mL or less, more preferably 3 ng / mL or more and 1000 ng / mL or less, and even more preferably 10 ng / mL or more and 300 ng / mL or less. During the culture of stem cells, it is preferable to replace the proliferation medium with a fresh one every three days and add the recombinant protein of the TNF family to the proliferation medium.

[0021] The gastric stem cell proliferation medium of this embodiment can be prepared using a medium used for culturing animal cells as the basal medium, which is not particularly limited as long as it can be used for culturing animal cells, such as BME medium, BGJb medium, CMRL1066 medium, Glasgow MEM medium, Improved MEM Zinc Option medium, IMDM medium, Medium 199 medium, Eagle MEM medium, αMEM medium, DMEM medium, Ham's medium, Ham's F-12 medium, RPMI1640 medium, Fischer's medium, and mixtures thereof.

[0022] The gastric stem cell proliferation medium of this embodiment may contain a serum substitute. The serum substitute may be prepared, for example, by the method described in WO98 / 30679, or a commercially available product may be used. Examples of commercially available serum substitutes include Knockout(TM) Serum Replacement (Thermo Fisher Scientific), Chemically-defined Lipid concentrated (Thermo Fisher Scientific), Glutamax(TM) (Thermo Fisher Scientific), B27 (Thermo Fisher Scientific), N2 Supplement (Thermo Fisher Scientific), and 1×Non-essential Amino Acids (Thermo Fisher Scientific).

[0023] The gastric stem cell proliferation medium of this embodiment may further contain a Wnt signal enhancer. Examples of the Wnt signal enhancer include Wnt family proteins, R-spondin family proteins, and GSK-3β inhibitors such as CHIR99021.

[0024] As the Wnt family protein, Wnt proteins derived from various organisms can be used. Among Wnt proteins derived from organisms, Wnt proteins derived from mammals are preferred. Examples of Wnt proteins from mammals include Wnt1, Wnt2, Wnt2b, Wnt3, Wnt3a, Wnt4, Wnt5a, Wnt5b, Wnt6, Wnt7a, Wnt7b, Wnt8a, Wnt8b, Wnt9a, Wnt9b, Wnt10a, Wnt10b, Wnt11, and Wnt16. Among them, Wnt3a is preferred.

[0025] The gastric stem cell proliferation medium of this embodiment may further contain a bone morphogenetic protein (BMP) inhibitor.

[0026] The BMP inhibitor may be at least one selected from the group consisting of BMP receptor serine threonine kinase inhibitors K02288, LDN-214117, LDN-193189, ML347, LDN-212854, Dorsomorphin, and DMH1. Alternatively, the BMP inhibitor may be at least one selected from the group consisting of chordin-like proteins (noggin, gremlin, and chordin) containing a chordin domain, which are BMP binding proteins that inhibit BMP signals, as well as follistatin, follistatin-related proteins containing a follistatin domain, DAN, DAN-like proteins containing a DAN cysteine ​​knot domain, sclerostin / SOST, and α-2 macroglobulin.

[0027] The gastric stem cell growth medium of this embodiment may further comprise one or more (or all) of a growth factor from the fibroblast growth factor family (FGF, e.g., FGF2, FGF7, FGF9, or FGF10), a ROCK inhibitor such as Y-27632, N-acetylcysteine, penicillin, streptomycin, and gastrin.

[0028] The method for producing cultured gastric stem cells according to a second aspect of the present invention comprises the step of culturing gastric tissue in a growth medium containing at least one of an activator of the NF-κB signal pathway and an EGF-Erk signal inhibitor. The gastric stem cell growth medium according to the present invention makes it possible to stably culture and grow gastric stem cells in an undifferentiated state for a long period of time. The method for producing cultured gastric stem cells according to the present invention may be carried out according to standard methods such as those disclosed in Non-Patent Documents 2-4, except for using the gastric stem cell growth medium according to the present invention. EXAMPLES

[0029] The present invention will be described below with reference to examples, but the present invention is not limited to the following examples.

[0030] [Example 1] (1-1) Preparation of gastric stem cell medium Gastric stem cell medium was prepared by adding various cell growth factors and small molecule inhibitors to the gastrointestinal epithelial cell growth medium described in Non-Patent Document 4. Specifically, 1 / 100 amount of N2 (Nacalai tesque), 1 / 100 amount of NeuroBrew-21 (Miltenyi Biotec), HEPES to a final concentration of 10 mM were added to commercially available Advanced DMEM / F-12 medium (manufactured by Thermo Ficher SCIENTIFIC), and penicillin and streptomycin were added to a final concentration of 100 U / mL and 100 μg / mL, respectively. In addition, recombinant proteins of the following cell growth factors were added to the final concentrations described below. 100 ng / mL Wnt3a protein (R&D Systems), 1 mg / mL R-spondin1 protein, 100 ng / mL FGF10, 10 nM gastrin (Sigma). Furthermore, the BMP signal inhibitor LDN-193189 (Hello Bio) was added to a final concentration of 0.1 μM, and each low molecular weight compound was added to a final concentration of 1 mM N-acetylcysteine ​​(Sigma Aldrich) and 10 μM Y-27632 (BLD Pharm) to prepare "STO medium."

[0031] (1-2) Preparation of TNFSF12-supplemented medium A medium was prepared by adding TNFSF12 to the STO medium described in Example (1-1). A medium without TNFSF12 was also prepared as a control.

[0032] (1-3) Cultivation of gastric epithelial cell organoids in TNFSF12-supplemented medium According to the method described in Non-Patent Document 4, gastric glands were collected from the stomach tissue of adult C57BL / 6J mice (Japan SLC) and embedded in Matrigel (Corning). Matrigel containing gastric glands was seeded on a 24-well plate and cultured for 6 days in STO medium containing TNFSF12 prepared in (Example 1-2) to produce gastric epithelial cell organoids. In addition, as a negative control, it was similarly cultured in STO medium without TNSFS12 (Figure 1A).

[0033] To confirm the properties of the gastric stem cell organoids, RNA was extracted from the organoids and gene expression was confirmed by quantitative RT-PCR. As a result, gastric epithelial cell organoids cultured in STO medium supplemented with TNFSF12 showed increased expression of Ki67, a gastric stem cell marker, compared to the control (Figure 1B), and decreased expression of Gkn2, Muc5ac, and Aqp3, which are differentiated surface mucous cell markers (Figure 1C, D, E).

[0034] In addition, frozen sections of the gastric epithelial cell organoids were prepared and immunofluorescence staining was performed using a specific antibody for KI67. It was shown that the number of KI67-positive stem cells increased in gastric epithelial organoids cultured in STO medium supplemented with TNFSF12 (Figure 1F). From the above, it was revealed that the stem cell proliferation medium supplemented with TNFSF12 of the present invention is a medium that suppresses the differentiation of gastric tissue stem cells and selectively proliferates stem cells.

[0035] The primer sequences used for RT-qPCR are as follows: Muc5ac Fw: CAGGACTCTCTGAAATCGTACCA Muc5ac Rv: AAGGCTCGTACCACAGGGA Gkn2 Fw: ATGAAACCCCTCGTGGCATTT Gkn2 Rv: TGTCTCCTGGATATTGCCTCC Ki67 Fw: ATCATTGACCGCTCCTTTAGGT Ki67 Rv: GCTCGCCTTGATGGTTCCT Stmn1 FW: TCTGTCCCCGATTTCCCCC Stmn1 Rv: AGCTGCTTCAAGACTTCCGC

[0036] [Example 2] (2-1) Preparation of TNFα-supplemented medium The STO medium described in Example (1-1) was supplemented with TNFα to prepare a medium, and an STO medium not containing TNFα was prepared as a negative control.

[0037] (2-2) Cultivation of gastric epithelial cell organoids in TNFα-supplemented medium According to the method described in Non-Patent Document 4, gastric glands were collected from the stomach tissue of adult C57BL / 6J mice and embedded in Matrigel. Matrigel containing gastric glands was seeded on a 24-well plate and cultured for 6 days in STO medium containing TNFα prepared in (2-1) to produce gastric epithelial cell organoids. In addition, as a negative control, it was similarly cultured in STO medium without TNFα (Figure 2A).

[0038] Gene expression of the prepared gastric epithelial cell organoid was confirmed by quantitative RT-PCR. The primers used were the same as those described in (1-2). As a result, the gastric epithelial organoid cultured in STO medium supplemented with TNFα showed increased expression of Ki67, a gastric stem cell marker, compared to the control (Figure 2B), and decreased expression of Gkn2, Muc5ac, and Aqp3, which are differentiated surface mucous cell markers (Figures 2C, D, E). In addition, frozen sections of the gastric epithelial cell organoid were prepared and immunostained using a specific antibody for KI67, and it was revealed that the number of KI67-positive cells increased in the gastric epithelial organoid cultured in STO medium supplemented with TNFα (Figure 2F). In other words, it was revealed that the cell growth medium supplemented with TNFα of the present invention suppresses the differentiation of gastric tissue stem cells and selectively proliferates stem cells.

[0039] [Example 3] (3-1) Preparation of medium containing EGFR inhibitor erlotinib The STO medium described in Example (1-1) was supplemented with erlotinib, an EGFR inhibitor, to prepare a medium. In addition, an STO medium not containing erlotinib was prepared as a negative control.

[0040] (3-2) Cultivation of gastric epithelial organoids in a medium containing the EGFR inhibitor erlotinib According to the method described in Non-Patent Document 4, gastric glands were collected from the stomach tissue of adult C57BL / 6J mice and embedded in Matrigel. Matrigel containing gastric glands was seeded on a 24-well plate and cultured for 6 days in STO medium containing erlotinib prepared in (3-1) to produce gastric epithelial organoids. In addition, as a negative control, it was similarly cultured in STO medium without erlotinib (Figure 3A).

[0041] Gene expression of the prepared gastric epithelial cell organoid was analyzed by quantitative RT-PCR. The primers used were the same as those described in (1-2). As a result, the gastric epithelial cell organoid cultured in a medium containing erlotinib showed increased expression of Ki67, a gastric stem cell marker, compared to the control (Figure 3B), and decreased expression of Gkn2, Mac5ac, and Aqp3, which are differentiated surface mucous cell markers (Figures 3C, D, E). Next, frozen sections of the gastric epithelial cell organoid were prepared and immunofluorescent stained with a specific antibody for KI67. It was revealed that the number of KI67-positive cells increased in the gastric epithelial cell organoid cultured in the STO medium containing erlotinib (Figure 3F). In other words, it was revealed that the STO medium containing erlotinib of the present invention suppresses the differentiation of gastric gland stem cells.

[0042] Example 4 (4-1) Preparation of medium supplemented with ERK inhibitor SCH772984 A medium was prepared by adding SCH772984, an ERK inhibitor, to the STO medium described in Example (1-1). In addition, a medium not containing SCH772984 was prepared as a negative control.

[0043] (4-2) Cultivation of gastric epithelial cell organoids in medium supplemented with ERK inhibitor SCH772984 According to the method described in Non-Patent Document 4, gastric glands were collected from the stomach tissue of adult C57BL / 6J mice and embedded in Matrigel. Matrigel containing gastric glands was seeded on a 24-well plate and cultured for 6 days in STO medium containing SCH772984 prepared in (4-1) to produce gastric epithelial cell organoids. As a control, the cells were similarly cultured in STO medium without SCH779284 (Figure 4A).

[0044] Gene expression of the prepared gastric epithelial cell organoid was analyzed by quantitative RT-PCR. The primers used were the same as those described in (1-2). As a result, the gastric epithelial cell organoid cultured in a medium containing erlotinib showed increased expression of Ki67, a gastric stem cell marker, compared to the control (Figure 4B), and decreased expression of Gkn2, Muc5ac, and Aqp3, which are differentiated surface mucous cell markers (Figures 4C, D, E). In other words, it was revealed that the STO medium containing SCH772984 of the present invention suppresses the differentiation of gastric gland stem cells. [Industrial Applicability]

[0045] By using the gastric stem cell proliferation medium of the present invention, it becomes possible to stably culture and proliferate stem cells in an undifferentiated state for a long period of time.

Claims

1. A gastric stem cell proliferation medium comprising at least one of an activator of the NF-κB signal pathway and an EGF-Erk signal inhibitor.

2. The gastric stem cell proliferation medium according to claim 1, wherein the activator of the NF-κB signal pathway is selected from the group consisting of recombinant proteins of the TNF family, recombinant proteins of the interleukin family, betulinic acid, prostratin, PMA, and calcimycin (A23187).

3. The activators of the NF-κB signal pathway are TNFSF1 (TNF-α), TNFSF2 (TNF-β, LT-α), TNFSF3 (LT-β), TNFSF4 (OX40L, CD252, gp34), TNFSF5 (CD40L, CD154, gp39), TNFSF6 (FasL, CD95L, Apo1L), and TNFSF7. (CD27L, CD70), TNFSF8 (CD30L, CD153), TNFSF9 (4-1BBL, APCs), TNFSF10 (TRAIL, Apo2L), TNFSF11 (RANKL, TRANCE, OPGL, ODF), TNFSF12 (TWEAK, Apo3L), TNFSF13 (APRIL, TALL-2, TRDL-1), TNFSF13B (BAFF, BLYS, 2. The gastric stem cell proliferation medium according to claim 1, wherein the medium is selected from the group consisting of THANK), TNFSF14 (LIGHT, HVEML, LT-γ), TNFSF15 (VEGI, TL1A), TNFSF18 (GITRL), EDA-A1, and EDA-A2.

4. The gastric stem cell proliferation medium according to claim 1 , wherein the activator of the NF-κB signal pathway is selected from the group consisting of TNFSF10 (TRAIL, Apo2L) and TNFSF12 (TWEAK, Apo3L).

5. The gastric stem cell proliferation medium according to any one of claims 1 to 4, wherein the EGF-Erk signal inhibitor is an EGF receptor kinase inhibitor or an Erk inhibitor.

6. The gastric stem cell proliferation medium according to any one of claims 1 to 4, wherein the EGF-Erk signal inhibitor is erlotinib or SCH779284.

7. A method for producing cultured gastric stem cells using the gastric stem cell proliferation medium according to claims 1 to 6.

Images