AAVRH74 vector for gene therapy of muscular dystrophy

Abstract

Provided herein are modified AAV capsid proteins, particles, nucleic acid vectors, and compositions thereof, as well as methods of their use.

Description

[Technical field]

[0001] Related Applications This application claims the benefit under 35 USC § 119(e) of U.S. Provisional Patent Application No. 63 / 179,097, filed April 23, 2021, and U.S. Provisional Patent Application No. 63 / 327,410, filed April 5, 2022, the entire contents of each of which are incorporated herein by reference.

[0002] Reference to sequence listing submitted as a text file via EFS-WEB This application contains a Sequence Listing that has been submitted in ASCII format via EFS-Web and is incorporated herein by reference in its entirety. The ASCII copy, created on April 22, 2022, is named U120270077WO00-SEQ-COB and is 119,114 bytes in size. [Background technology]

[0003] background Gene therapy has the potential to treat subjects suffering from or at risk of suffering from genetic diseases. Improved AAV vectors for carrying gene payloads will be beneficial for the development of gene therapy for certain diseases that affect muscle tissue and / or function, for example. Muscle diseases, such as muscular dystrophies, can result from a myriad of conditions, including congenital or acquired somatic mutations, injuries, and exposure to harmful compounds. In some cases, muscle diseases result in life-threatening complications or lead to severe symptoms and / or death. Although a myriad of factors are involved in regulating muscle diseases, including muscular dystrophies, effective treatments remain limited. Summary of the Invention

[0004] overview The present disclosure is based, at least in part, on the recognition that certain amino acid substitutions in one or more capsid proteins of recombinant AAVrh74 particles and / or modifications of AAV nucleic acid vectors encapsidated by AAVrh74 capsids result in improved properties (e.g., transduction of specific cell types) compared to wild-type AAVrh74 particles or unmodified AAV nucleic acid vectors encapsidated by AAVrh74 capsids. Modifications of capsid proteins (e.g., amino acid substitutions) and modifications of nucleic acid vectors (e.g., substitutions or deletions of D sequences and insertions of transcription regulator binding elements) can confer various beneficial properties to AAVrh74 particles, such as enhanced binding to specific cell types, enhanced interaction with cells and / or their biological machinery, enhanced transduction of cells, enhanced expression of transgenes in cells, among other properties. Combinations of multiple modifications (e.g., combinations of various capsid protein modifications and / or nucleic acid vector modifications) can have synergistic effects on various properties of the AAVrh74 particles into which they are incorporated.

[0005] According to some aspects, the modification of the AAV nucleic acid vector comprises modification of the left or right inverted terminal repeat (ITR) of the vector. In some embodiments, the modification of the AAV nucleic acid vector comprises replacement of the D sequence in either the left or right ITR of the AAV vector. For example, in some embodiments, the modification of the AAV nucleic acid vector comprises replacement of a sequence in the AAV nucleic acid vector (e.g., the D sequence in the ITR) with another sequence (e.g., the S sequence or the glucocorticoid receptor binding element (GRE)). Replacement of a sequence in the AAV nucleic acid vector (e.g., the D sequence in the ITR) with another sequence (e.g., the S sequence or the GRE) can increase the transduction efficiency and / or transgene expression level of the AAV particle comprising the AAV nucleic acid vector.

[0006] According to some aspects, the recombinant AAVrh74 particles disclosed herein comprise, in some embodiments, a capsid protein having one or more amino acid substitutions in addition to a modified AAV nucleic acid vector. Encapsidation of the modified AAV nucleic acid vector in an AAVrh74 capsid having one or more amino acid substitutions may result in improved properties of the AAV particle comprising the modified AAV nucleic acid vector and the capsid having one or more amino acid substitutions relative to the corresponding unmodified AAV nucleic acid vector and / or the AAV particle comprising the capsid not comprising the amino acid substitutions. In some embodiments, the improved property is an improved transduction efficiency, i.e., an improved efficiency of the AAV particle to deliver a gene payload to a cell of interest.

[0007] According to some aspects of the present disclosure, capsid protein is provided.In some embodiments, it comprises the amino acid substitution at the position corresponding to Y447, T494, K547, N665 and / or Y733 of wild type AAVrh74 capsid protein of SEQ ID NO: 1, wherein capsid protein is AAVrh74 serotype capsid protein.In some embodiments, the substitution is Y447F, T494V, K547R, N665R and / or Y733F.

[0008] According to some aspects, AAVrh74 particles are provided. In some embodiments, the AAVrh74 particles comprise the capsid protein disclosed herein. In some embodiments, the AAVrh74 particles further comprise a nucleic acid vector, wherein the nucleic acid vector comprises a first inverted terminal repeat (ITR) comprising a first D sequence and a second ITR comprising a second D sequence, wherein the first D sequence or the second D sequence is replaced with an S sequence. In some embodiments, the S sequence comprises, consists essentially of, or consists of the nucleotide sequence TATTAGATCTGATGGCCGCT (SEQ ID NO: 17).

[0009] In some embodiments, the AAVrh74 particle comprises a nucleic acid vector, wherein the nucleic acid vector comprises a first inverted terminal repeat (ITR) comprising a first D sequence and a second ITR comprising a second D sequence, wherein the first D sequence and / or the second D sequence is replaced with a glucocorticoid receptor binding element (GRE). In some embodiments, the GRE comprises, consists essentially of, or consists of the nucleotide sequence AGAACANNNTGTTCT (SEQ ID NO: 18), or its reverse or reverse complement, where each N is independently T, C, G, or A.

[0010] According to some aspects of the present disclosure, a composition is provided that comprises AAV capsid protein or AAV particle.In some embodiments, the composition disclosed herein comprises the AAVrh74 capsid protein disclosed herein.In some embodiments, the composition disclosed herein comprises the AAVrh74 particle disclosed herein.

[0011] According to some aspects, a method of contacting a cell is provided herein. In some embodiments, the method comprises contacting a cell with a composition comprising an AAVrh74 particle, wherein the AAVrh74 particle comprises a capsid protein and a nucleic acid vector, (i) wherein the capsid protein comprises amino acid substitutions at positions corresponding to Y447, T494, K547, N665 and / or Y733 of the wild-type AAVrh74 capsid protein of SEQ ID NO:1, optionally wherein the substitutions are Y447F, T494V, K547R, N665R, and / or Y733F; and / or (ii) wherein the nucleic acid vector comprises a first inverted terminal repeat (ITR) comprising a first D sequence and a second ITR comprising a second D sequence, wherein the first D sequence or the second D sequence is replaced with an S sequence, optionally wherein the S sequence comprises, consists essentially of, or consists of the nucleotide sequence TATTAGATCTGATGGCCGCT (SEQ ID NO: 17).

[0012] In some embodiments, the method includes contacting a cell with a composition comprising an AAVrh74 particle, the AAVrh74 particle comprising a capsid protein and a nucleic acid vector, (i) wherein the capsid protein comprises amino acid substitutions at positions corresponding to Y447, T494, K547, N665 and / or Y733 of the wild-type AAVrh74 capsid protein of SEQ ID NO:1, optionally wherein the substitutions are Y447F, T494V, K547R, N665R, and / or Y733F; and / or (ii) wherein the nucleic acid vector comprises a first inverted terminal repeat (ITR) comprising a first D sequence and a second ITR comprising a second D sequence, wherein the first D sequence and / or the second D sequence is replaced with a glucocorticoid receptor binding element (GRE), optionally wherein the GRE comprises, consists essentially of, or consists of the nucleotide sequence AGAACANNNTGTTCT (SEQ ID NO: 18), or its reverse or reverse complement, wherein each N is independently T, C, G, or A.

[0013] In some embodiments, the capsid protein comprises amino acid substitutions at positions corresponding to Y447, T494, K547, N665 and / or Y733 of the wild-type AAVrh74 capsid protein of SEQ ID NO:1, optionally wherein the substitutions are Y447F, T494V, K547R, N665R and / or Y733F. In some embodiments, the nucleic acid vector comprises a first ITR and a second ITR, wherein the first D sequence or the second D sequence is replaced with an S sequence, optionally wherein the S sequence comprises, consists essentially of, or consists of the nucleotide sequence TATTAGATCTGATGGCCGCT (SEQ ID NO: 17).

[0014] In some embodiments, the nucleic acid vector comprises a first ITR and a second ITR, wherein the first D sequence and / or the second D sequence is replaced with a GRE, optionally wherein the GRE comprises, consists essentially of, or consists of the nucleotide sequence AGAACANNNTGTTCT (SEQ ID NO: 18), or its reverse or reverse complement, where each N is independently T, C, G, or A. In some embodiments, the capsid protein comprises amino acid substitutions at positions corresponding to Y447, T494, K547, N665 and / or Y733 of the wild-type AAVrh74 capsid protein of SEQ ID NO:1, and the nucleic acid vector comprises a first ITR and a second ITR, wherein the first D sequence or the second D sequence is replaced with an S sequence, optionally wherein the substitutions are Y447F, T494V, K547R, N665R and / or Y733F, and optionally wherein the S sequence comprises, consists essentially of, or consists of the nucleotide sequence TATTAGATCTGATGGCCGCT (SEQ ID NO:17).

[0015] In some embodiments, the capsid protein comprises amino acid substitutions at positions corresponding to Y447, T494, K547, N665 and / or Y733 of the wild-type AAVrh74 capsid protein of SEQ ID NO:1, and the nucleic acid vector comprises a first ITR and a second ITR, wherein the first D sequence and / or the second D sequence are replaced with a GRE, optionally wherein the substitutions are Y447F, T494V, K547R, N665R and / or Y733F, and optionally wherein the GRE comprises, consists essentially of, or consists of the nucleotide sequence AGAACANNNTGTTCT (SEQ ID NO: 18), or its reverse or reverse complement, where each N is independently T, C, G, or A.

[0016] In some embodiments, the capsid protein comprises amino acid substitutions of the wild-type AAVrh74 capsid protein of SEQ ID NO:1 at positions corresponding to: (a) Y447 and Y733, optionally where the substitutions are Y447F and Y733F; (b) Y447, Y733, and N665, optionally where the substitutions are Y447F, Y733F, and N665R; (c) Y447, Y733, and T494, optionally where the substitutions are Y447F, Y733F, and T494V; (d) Y447, Y733, and K547, optionally where the substitutions are Y447F, Y733F, and K547R; or (e) Y447, Y733, N665, T494, and K547, optionally wherein the substitutions are Y447F, Y733F, N665R, T494V, and K547R.

[0017] In some embodiments, the first and second ITRs are AAV2 serotype ITRs or AAV3 serotype ITRs, respectively. In some embodiments, the first D sequence is replaced with an S sequence, or the first D sequence is replaced with a GRE. In some embodiments, the second D sequence is replaced with an S sequence, or the second D sequence is replaced with a GRE. In some embodiments, the S sequence comprises, consists essentially of, or consists of the nucleotide sequence TATTAGATCTGATGGCCGCT (SEQ ID NO: 17), or the GRE comprises, consists essentially of, or consists of the nucleotide sequence AGAACANNNTGTTCT (SEQ ID NO: 18), or its reverse or reverse complement, where each N is independently T, C, G, or A.

[0018] In some embodiments, the transduction efficiency of the AAVrh74 particles is at least 2-fold higher than that of wild-type AAVrh74 particles. In some embodiments, the packaging efficiency of the AAVrh74 particles is decreased compared to that of wild-type AAVrh74 particles. In some embodiments, the composition further comprises a pharma- ceutically acceptable carrier. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a muscle cell. In some embodiments, the cell is a skeletal muscle cell. In some embodiments, the cell is a gastrocnemius cell or a tibialis anterior cell.

[0019] In some embodiments, the nucleic acid vector comprises a regulatory element. In some embodiments, the regulatory element comprises a promoter, an enhancer, a silencer, an insulator, a response element, an initiation site, a termination signal, or a ribosome binding site. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is an inducible promoter. In some embodiments, the promoter is a tissue-specific promoter, a cell type-specific promoter, or a synthetic promoter. In some embodiments, the nuclear vector comprises the nucleotide sequence of a gene of interest. In some embodiments, the gene of interest encodes a therapeutic or diagnostic protein.

[0020] In some embodiments, the contacting occurs in vivo. In some embodiments, the method further comprises administering to the subject a composition comprising the AAVrh74 particles. In some embodiments, the cell is in a subject.

[0021] In some embodiments, the subject is a human. In some embodiments, the subject is at risk for or suffers from a muscle disease, optionally wherein the muscle disease is amyotrophic lateral sclerosis, Charcot-Marie-Tooth disease, multiple sclerosis, muscular dystrophy, myasthenia gravis, myopathy, myositis, peripheral neuropathy, or spinal muscular atrophy. In some embodiments, the muscle disease is Duchenne muscular dystrophy, optionally wherein the subject has a mutation in the dystrophin gene. In some embodiments, the muscle disease is limb-girdle muscular dystrophy. In some embodiments, the muscle disease is X-linked myotubular myopathy, optionally wherein the subject has a mutation in the MTM1 gene.

[0022] In some embodiments, the composition is administered to the subject by subcutaneous injection, by intramuscular injection, by intravenous injection, by intraperitoneal injection, or orally. In some embodiments, the contacting is effected in vitro or ex vivo. [Brief description of the drawings]

[0023] [Figure 1A-1B]Figures 1A-1B show the transduction efficiency of wild-type (WT) and YF mutant ssAAVrh74 vectors in human HeLa (Figure 1A) and mouse C2C12 (Figure 1B) cells. Cells were transduced with each vector at the indicated vector genome copy number (vgs) / cell for 2 h at 37°C, and transgene expression was visualized under a fluorescent microscope 72 h after transduction. Data were quantified using ImageJ software. The left panel shows EGFP fluorescence in cells after transduction. The data in the right panel of Figure 1A show quantification of transgene expression (pixels / field) after transduction at 1,000 vgs / cell (left, light bars) or 3,000 vgs / cell (right, dark bars) for each of the WT, Y733F, and Y447+733F ssAAVrh74 vectors. Data in the right panel of Figure 1B show quantification of transgene expression (pixels2 / field) following transduction at 3,000 vgs / cell (left, light bars) or 9,000 vgs / cell (right, dark bars) for WT, Y733F, and Y447+733F ssAAVrh74 vectors, respectively.

[0024] [Diagram 2] FIG. 2 shows the transduction efficiency of wild-type ("WT") and Y733+447F+T494V triple mutant ("TM") ssAAVrh74 vectors in primary human skeletal muscle cells. Cells were transduced with each vector at the indicated multiplicity of infection (vgs / cell) and transgene expression levels were quantified as described above in FIGS. 1A-1B. The left panel shows EGFP fluorescence in skeletal muscle cells after transduction. The right panel shows quantification of transgene expression (pixels2 / field) after transduction at 1,000 vgs / cell (left, light bars) or 3,000 vgs / cell (right, dark bars) for WT and TM AAVrh74 vectors, respectively.

[0025] [Figure 3A]Figures 3A-3B show the transduction efficiency of ssAAV-rh74 mutants in HeLa cells. Figure 3A shows GFP fluorescence 72 hours after transduction of wild-type (WT) or capsid mutant ssAAVrh74 vectors at 3,000 vgs / cell. [Figure 3B] FIG. 3B shows quantification of GFP fluorescent transduction data (transgene expression measured as pixels2 / field of view).

[0026] [Figure 4A] Figures 4A-4C show the transduction efficiency of wild-type ("WT") ssAAVrh74 vectors or ssAAVrh74 vectors with a substitution of the D sequence in its left ITR ("LC1") or the D sequence in its right ITR ("LC2"). Figure 4A shows transgene expression mediated by WT, LC1, or LC2 ssAAVrh74 vectors in HeLa cells. The left panel shows hrGFP fluorescence in HeLa cells after transduction with 1,000 vgs / cell, 3,000 vgs / cell, or 10,000 vgs / cell of each ssAAVrh74 vector, respectively. The right panel shows quantification of transgene expression (pixels / field) following transduction with WT, LC1, or LC2 AAVrh74 vectors at 1,000 vgs / cell (left bars of each set of bars), 3,000 vgs / cell (middle bars), or 10,000 vgs / cell (right bars), respectively. [Figure 4B] Figure 4B shows vector genome copy numbers (copies per μg of DNA x 108) in HeLa cells transduced with WT, LC1, or LC2 ssAAVrh74 vectors. Each set of three bars shows copy numbers after transduction at 1,000 vgs / cell (left bar), 3,000 vgs / cell (middle bar), or 10,000 vgs / cell (right bar). [Figure 4C]Figure 4C shows transgene expression mediated by WT, LC1, or LC2 ssAAVrh74 vectors in primary human skeletal muscle cells. The left panel shows hrGFP fluorescence in primary human skeletal muscle cells after transduction with 1,000 vgs / cell, 3,000 vgs / cell, or 10,000 vgs / cell of each ssAAVrh74 vector, respectively. The right panel shows quantification of transgene expression (pixels2 / field) after transduction with 1,000 vgs / cell (left bar of each set of bars), 3,000 vgs / cell (middle bar), or 10,000 vgs / cell (right bar), respectively, for WT, LC1, or LC2 AAVrh74 vectors. For both Figures 3A and 3B, cells were transduced with each vector at the indicated multiplicity of infection (vgs / cell) for 2 h at 37°C, and transgene expression was visualized under a fluorescent microscope 72 h post-transduction. Data were quantified using ImageJ software.

[0027] [Diagram 5] 5 shows the transduction efficiency of HeLa cells using wild type ("WT") ssAAVrh74 vector, Y447+733F+T494V triple mutant ("TM") ssAAVrh74 vector, and Y447+733F+T494V triple mutant ssAAVrh74 vector with an additional substitution of the D sequence in the left ITR ("OptX"). HeLa cells were transduced at 1,000 vgs / cell and transduction efficiency was determined 72 hours post-transduction. [Figure 6A] Figures 6A-6B show the transduction efficiency of WT, TM, and OptX ssAAV-rh74 vectors in HeLa cells as measured by flow cytometric quantification of GFP fluorescence (Figure 6A) and flow cytometric quantification of mean GFP fluorescence (Figure 6B). WT, TM, and OptX are as defined above in Figure 5. HeLa cells were transduced at 1,000 vgs / cell and transduction efficiency was determined 72 hours post-transduction. [Figure 6B]Figures 6A-6B show the transduction efficiency of WT, TM, and OptX ssAAV-rh74 vectors in HeLa cells as measured by flow cytometric quantification of GFP fluorescence (Figure 6A) and flow cytometric quantification of mean GFP fluorescence (Figure 6B). WT, TM, and OptX are as defined above in Figure 5. HeLa cells were transduced at 1,000 vgs / cell and transduction efficiency was determined 72 hours post-transduction.

[0028] [Figure 7A-7B] Figures 7A-7D show efficacy of WT and OptX ssAAVrh74 vectors in vivo following intravenous administration of 1x1012 vgs / mouse in C57B16 mice. Figure 7A shows transgene expression in the gastrocnemius (GA) muscle, and Figure 7B shows transgene expression in the tibialis anterior (TA) muscle, quantified following intravenous administration of vector. [Figure 7C-7D] Figure 7C shows vector genome copy number quantified in various tissues harvested 8 weeks after vector administration. Figure 7D shows relative transgene expression measured in liver, GA, and TA after vector administration. Transgene expression data was quantified using NIH ImageJ software analysis of fluorescent microscopy images.

[0029] [Figure 8A-8B] Figures 8A-8D show the efficacy of WT, GenX, and GenY vectors in vitro. Figure 8A shows the schematic structure of the WT (D sequence at the ITR end distal to the end of the nucleic acid vector), GenX (one D sequence replaced), and GenY (one D sequence part replaced with GRE) genomes. Figure 8B shows the transduction efficiency of GenX and GenY AAVrh74 vectors in mouse C2C12 cells in the absence or presence of tyrphostin ("Tyr."). [Fig. 8C-8D]Figure 8C shows the transduction efficiency of WT, GenX, and GenY AAVrh74 vectors in primary human skeletal muscle cells. Cells were transduced with each vector at the indicated vector genome copy number per cell at 37°C for 2 hours, and transgene expression was visualized under a fluorescent microscope 72 hours after transduction. Transgene expression was quantified using NIH ImageJ software analysis of fluorescent microscope images. Figure 8D shows the vector genome copy number quantified in primary human skeletal muscle cells transduced with WT, GenX, and GenY AAVrh74 vectors.

[0030] [Figure 9A-9B] Figures 9A-9B show the efficacy of the OptX AAVrh74 vector. Figure 9A shows reverse transcription quantitative PCR (RT-qPCR) measurements of hrGFP mRNA copy number per μg of total RNA extracted from liver, diaphragm, and heart tissues from mice administered PBS, wild-type AAVrh74 particles containing the hrGFP transgene ("WT"), or OptX AAVrh74 particles containing the hrGFP transgene ("OptX"). Figure 9B shows the relative expression levels of hrGFP in liver, diaphragm, and heart tissue samples from mice administered WT or OptX AAVrh74 particles containing the hrGFP transgene. [Figure 10A-10B] Figures 10A-10B show control measurements of gene expression in liver, diaphragm, and heart tissues from mice administered PBS, WT or OptX AAVrh74 particles containing the hrGFP transgene. Figure 10A shows the expression of β-actin measured by RT-qPCR. Figure 10B shows cycle threshold (CT) values ​​from RT-qPCR measurements of β-actin.

[0031] [Figure 11A-11B]Figures 11A-11B show the efficacy of OptY AAVrh74 vectors. Figure 11A shows fluorescence microscopy images of liver, gastrocnemius ("GA"), and tibialis anterior ("TA") tissue sections from mice administered Y447+733F+T494V triple mutant AAVrh74 particles containing the hrGFP transgene ("TM") or OptY AAVrh74 particles containing the hrGFP transgene ("OptY"). ​​Figure 11B shows quantification of hrGFP transgene expression from the fluorescence microscopy images. [Figure 12] FIG. 12 shows quantification of vector genome copy numbers in liver, heart, diaphragm, gastrocnemius muscle ("GA muscle"), and tibialis anterior muscle ("TA muscle") tissues of mice administered Y447+733F+T494V triple mutant AAVrh74 particles containing the hrGFP transgene ("TM") or OptY AAVrh74 particles containing the hrGFP transgene ("OptY"). [Figure 13] FIG. 13 shows quantification of hrGFP mRNA expression per vector genome copy number in liver, heart, diaphragm, gastrocnemius muscle ("GA muscle"), and tibialis anterior muscle ("TA muscle") tissues of mice administered Y447+733F+T494V triple mutant AAVrh74 particles containing the hrGFP transgene ("TM") or OptY AAVrh74 particles containing the hrGFP transgene ("OptY"). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0032] Detailed Description The present disclosure is based, at least in part, on the development of adeno-associated virus (AAV) capsid proteins, particles, genomes, nucleic acid vectors, and plasmids that are useful for delivering various cargoes to specific cells to facilitate transgene expression in the cells. The present disclosure is, at least in part, related to the discovery that the incorporation of amino acid substitutions in AAVrh74 capsid proteins and / or nucleotide sequence modifications (e.g., substitutions or deletions) in AAV nucleic acid vectors results in improved transduction efficiency and / or transgene expression. The AAV capsid proteins, particles, genomes, nucleic acid vectors, and plasmids disclosed herein may be used in a variety of applications, including, but not limited to, compositions and methods (e.g., therapeutic methods). The therapeutic methods disclosed herein include those that are useful in the treatment of diseases (e.g., muscular disorders such as muscular dystrophy) in subjects in need thereof.

[0033] Provided herein are compositions including AAV capsid proteins, AAV particles, nucleic acids contained within the AAV particles that include one or more modifications in one or more ITRs, and methods of using the compositions to transduce a cell of interest (e.g., to treat a disease or condition in a subject).

[0034] Capsid Protein Provided herein is an AAV capsid protein having one or more mutations characterized by amino acid substitution.In some embodiments, the AAV capsid protein disclosed herein comprises an amino acid substitution at one or more positions corresponding to Y447, T494, K547, N665, or Y733 of wild-type AAVrh74 capsid protein of SEQ ID NO: 1.In some embodiments, the amino acid substitution is selected from Y447F, T494V, K547R, N665R, and / or Y733F. In some embodiments, the AAV capsid protein disclosed herein includes amino acid substitutions at positions corresponding to: Y447 and Y733; Y447, Y733, and N665; Y447, Y733, and T494; Y447, Y733, and K547; or Y447, Y733, N665, T494, and K547 of the wild-type AAVrh74 capsid protein of SEQ ID NO:1. In some embodiments, the AAV capsid protein disclosed herein includes amino acid substitutions at positions corresponding to: Y447F and Y733F; Y447F, Y733F, and N665R; Y447F, Y733F, and T494V; Y447F, Y733F, and K547R; or Y447F, Y733F, N665R, T494V, and K547R of the wild-type AAVrh74 capsid protein of SEQ ID NO:1.

[0035] In some embodiments, the AAV capsid protein as disclosed herein is a VP1 protein, a VP2 protein, or a VP3 protein. The VP1, VP2, and VP3 capsid proteins are each encoded from the same segment of the AAV genome and differ at their N-termini due to alternative mRNA splicing. Example of the amino acid sequence of the AAVrh74 capsid protein: [ka]

[0036] An example of a nucleotide sequence encoding the AAVrh74 capsid protein: [ka]

[0037] The different capsid proteins VP1, VP2, and VP3 are defined according to the numbering of the full-length VP1 protein. In some embodiments, for the AAVrh74 capsid protein, the VP1 capsid protein is defined by amino acids 1-738 of SEQ ID NO:1; the VP2 capsid protein is defined by amino acids 138-738 of SEQ ID NO:1; and the VP3 capsid protein is defined by amino acids 204-738 of SEQ ID NO:1. The numbering of the AAV capsid proteins is provided according to the VP1 sequence. For example, Y447 refers to the tyrosine at position 447 of SEQ ID NO:1 in the VP1 protein or the corresponding tyrosine in the VP2 or VP3 protein. Similarly, T494, K547, N665, and Y733 refer to a threonine at position 494, a lysine at position 547, an asparagine at position 665, and a tyrosine at position 733 of SEQ ID NO:1 in the VP1 protein, or the corresponding amino acids in the VP2 or VP3 protein, respectively.

[0038] The AAV capsid protein disclosed herein can be of any serotype, or can be a chimeric capsid protein (i.e., comprising segments from capsid proteins of more than one serotype). In some embodiments, the AAV capsid protein disclosed herein is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrhlO, or AAVrh74 capsid protein. In some embodiments, the AAV capsid protein as provided herein is of serotype rh74. The amino acid sequences of capsid proteins of other AAV serotypes are known, and can be aligned with SEQ ID NO:1 (AAVrhl74 capsid protein) using techniques known in the art. Examples of amino acid sequences of AAV capsid proteins of various serotypes are provided below: Example of wild-type AAV1 capsid protein

change

[0039] Example of wild-type AAV2 capsid protein

change

change

[0040] Example of wild-type AAV4 capsid protein

change

change

[0041] Example of wild-type AAV6 capsid protein

change

change

[0042] Example of wild-type AAV8 capsid protein

change

change

[0043] Example of wild-type AAV10 capsid protein

change

[0044] Example of wild-type AAV12 capsid protein [ka] Example of wild-type AAVrh10 capsid protein [ka]

[0045] Nucleic acids encoding capsid proteins are also provided herein. The nucleic acids may include sequences encoding the capsid proteins disclosed herein (e.g., capsid proteins containing one or more amino acid substitutions). The sequences encoding the capsid proteins disclosed herein can be determined by those skilled in the art by known methods. The nucleic acids encoding the capsid proteins may include a promoter or other regulatory sequence operably linked to the coding sequence. The nucleic acids encoding the capsid proteins may be in the form of a plasmid, mRNA, or another nucleic acid that can be used by the enzymes or machinery of the host cell to produce the capsid protein. The nucleic acids encoding the capsid proteins as provided herein can be used to make AAV particles that can be used to deliver genes to cells. Methods for making AAV particles are known in the art. See, e.g., Scientific Reports volume 9, Article number: Methods Mol Biol. 2012; 798: 267-284; and www.thermofisher.com / us / en / home / clinical / cell-gene-therapy / gene-therapy / aav-production-workflow.html. Examples of nucleic acid sequences encoding capsid proteins are provided below.

[0046] An example of a nucleotide sequence encoding the AAV1 capsid protein: [ka]

[0047] An example of a nucleotide sequence encoding the AAV2 capsid protein: [ka]

[0048] An example of a nucleotide sequence encoding the AAV3 capsid protein: [ka]

[0049] An example of a nucleotide sequence encoding the AAV4 capsid protein: [ka]

[0050] An example of a nucleotide sequence encoding the AAV5 capsid protein: [ka]

[0051] An example of a nucleotide sequence encoding an AAV6 capsid protein: [ka]

[0052] An example of a nucleotide sequence encoding an AAV7 capsid protein: [ka]

[0053] An example of a nucleotide sequence encoding an AAV8 capsid protein: [ka]

[0054] An example of a nucleotide sequence encoding an AAV9 capsid protein: [ka]

[0055] An example of a nucleotide sequence encoding the AAV10 capsid protein: [ka]

[0056] Nucleic Acid Vectors According to some aspects, provided herein is a nucleic acid vector that may be encapsidated by any one of a wild-type AAV capsid or an AAV capsid as provided herein (e.g., a capsid protein comprising one or more amino acid substitutions). In some embodiments, a nucleic acid vector as provided herein comprises a first inverted terminal repeat (ITR) and a second ITR. In some embodiments, the first ITR is modified. In some embodiments, the second ITR is modified. In some embodiments, the modification of the ITR comprises a replacement of the entire D sequence or a replacement of a portion of the D sequence. In some embodiments, the modification of the ITR comprises a deletion of the entire D sequence (e.g., the D sequence of the left ITR or the right ITR) or a deletion of a portion of the D sequence (e.g., the 10 nucleotides of the ITR distal to the end of the nucleic acid vector). For example, the modification of the ITR may comprise a deletion or replacement of 1-20 nucleotides of the D sequence in some embodiments.

[0057] In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides of the D sequence distal to the end of the nucleic acid vector are deleted or replaced. In some embodiments, 10 nucleotides of the D sequence distal to the end of the nucleic acid vector are deleted or replaced. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides of the middle of the D sequence are deleted or replaced (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive nucleotides starting from 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides from the 3' or 5' end of the D sequence). In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides of the D sequence proximal to the end of the nucleic acid vector are deleted or replaced. In some embodiments, 10 nucleotides of the D sequence proximal to the end of the nucleic acid vector are deleted or replaced. In some embodiments, the D sequence comprises the sequence provided in SEQ ID NO: 16. In some embodiments, the D sequence is defined by the sequence provided in SEQ ID NO: 16. In embodiments where a part or the entirety of the D sequence of an ITR (e.g., the D sequence of the left ITR or the right ITR of a nucleic acid vector described herein) is replaced, the replacement sequence can be any of the alternative sequences described herein, such as an S sequence or a GRE.

[0058] The nucleic acid vector may comprise one or more sequences including one or more heterologous nucleic acid sequences encoding a gene of interest (e.g., a protein or polypeptide of interest) and an inverted terminal repeat (ITR) sequence (e.g., a wild-type ITR sequence or a modified ITR sequence) flanking the one or more heterologous nucleic acid sequences. In some embodiments, the nucleic acid vector is encapsidated in an AAV capsid that forms an AAV particle. In some embodiments, the nucleic acid vector disclosed herein is encapsidated by a wild-type AAVrh74 capsid or another AAV capsid disclosed herein, such as an AAV capsid that comprises one or more amino acid substitutions.

[0059] In some embodiments, the nucleic acid vector comprises native AAV genes or native AAV nucleotide sequences.In some embodiments, one or more native AAV genes or native AAV nucleotide sequences can be removed from the nucleic acid vector.In some embodiments, one or more native AAV genes or native AAV nucleotide sequences can be removed from the nucleic acid vector and replaced with a gene of interest. The nucleic acid vector can be of any AAV serotype, such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrhlO, or AAVrh74, or a combination of serotypes.In some embodiments, the nucleic acid vector encapsidated in AAV capsid forms a pseudotype AAV particle, such that the nucleic acid vector is of a different serotype from the AAV capsid that it is encapsidated in.For example, the nucleic acid vector of serotype AAV2 can be encapsidated in the capsid of serotype AAVrhl74.

[0060] In some embodiments, the nucleic acid vector is single-stranded and comprises a first inverted terminal repeat (ITR) and a second ITR. As disclosed herein, the first ITR refers to the ITR at the 5' end of the nucleic acid vector, and the second ITR refers to the ITR at the 3' end of the nucleic acid vector. Each ITR in its native or wild type form is 145 nucleotides or about 145 nucleotides in length (for example, about 140 nucleotides, about 145 nucleotides, about 150 nucleotides, about 155 nucleotides, about 160 nucleotides, or about 165 nucleotides) and comprises a D sequence. Each ITR can be independently of any AAV serotype (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrhlO, or AAVrhl74), or both ITRs can be of the same serotype. ITRs are described, for example, in Grimm et al. J. Virol. 80(1):426-439 (2006). Exemplary left ITR sequences are provided below. The right ITR has a nucleotide sequence that is the reverse complement of the corresponding left ITR (e.g., the AAV2 right ITR has a nucleotide sequence that is the reverse complement of the AAV2 left ITR).

[0061] Example of wild-type AAV1 left ITR: TTGCCCACTCCCTCTCTGCGCGCTCGCTCGCTCGGTGGGGCCTGCGGACCAAAGGTCCGCAGACGGCAGAGGTCTCCTCTGCCGGCCCCACCGAGCGAGCGAGCGCGAGAGGGAGTGGGCAACTCCATCACTAGGGGTAA (SEQ ID NO: 35) Example of wild-type AAV2 left ITR: TTGGCCACTCCCTCTCGCGCTCGCTCGCTCACTGAGGCCGGCGACCAAAGGTGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT (sequence number 12) Example of wild-type AAV3 left ITR: TTGGCCACTCCCTATGCGCACTCGCTCGCTCGGTGGGGCCTGGCGACCAAAGGTCGCCAGACGGATGCTTTGCACGTCGGCCCACCGAGCGAGCGAGTGCGCCATAGAGGGAGTGGCCAACTCCATCATAGGTATGGC (sequence number 13)

[0062] Example of wild-type AAV4 left ITR: TTGGCCACTCCCTATGCGCGCTCGCTCACTCACTCGGCCCTGGAGACCAAAGGTCTCCAGACTGCCGCCCTTGGCGGCAGGCCGAGTGAGTGAGCGAGCGCCGCATAGAGGGAGTGGCCAACTCCATCATCTAGGTTTGCCC (sequence number 36) Example of wild-type AAV5 left ITR: CTCTCCCCCTGTCGCGTTCGCTCGCTCGCTGGCTCGTTTGGGGGGTGGCAGCTCAAAGAGCTGCCAGACGGCCCTCTGGCCGTCGCCCCCCAAACGAGCCAGCGAGCGAGCGAACGCGACAGGGGGAGAGTGCCACACTCTCAAGCAAGGGGGTTTTGTA (sequence number 14) Example of wild-type AAV6 left ITR: TTGCCCACTCCCTCTATGCGCGCTCGCTCGCTCGGTGGGGCCTGCGGACCAAAGGTCCGCAGACGGCAGAGCTCTGCTCGCCCCACCGAGCGAGCGAGCGCGCATAGAGGGAGTGGGCAACTCCATCTAGGGGA (sequence number 15)

[0063] In some embodiments, the nucleic acid vector comprises a modification (e.g., deletion or substitution) of the D sequence of the ITR. In some embodiments, the nucleic acid vector comprises a modification (e.g., deletion or substitution) of the D sequence of the left ITR. In some embodiments, the nucleic acid vector comprises a modification (e.g., deletion or substitution) of the D sequence of the right ITR. In some embodiments, the nucleic acid vector comprises a modification (e.g., deletion or substitution) of the D sequence of both the left and right ITR. In some embodiments, the nucleic acid vector comprises a modification (e.g., deletion or substitution) of either the left or right ITR but not both (i.e., the nucleic acid vector comprises a modification of only one ITR).

[0064] The ITR sequence includes a terminal sequence at the 5' or 3' end of the AAV genome that forms a palindromic double-stranded T-shaped hairpin structure, and an additional sequence that remains single-stranded (i.e., not part of the T-shaped hairpin structure), which is referred to as the D sequence. The D sequence of an ITR is typically approximately 20 (e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) nucleotides located at the distal (relative to the end of the nucleic acid vector) end of the ITR (i.e., the 3' end of the left ITR or the 5' end of the right ITR), and corresponds to the sequence of CTCCATCACTAGGGGTTCCT (SEQ ID NO: 16) of the wild-type AAV2 left ITR of SEQ ID NO: 12. The D sequence of an ITR, in some embodiments, comprises, consists essentially of, or consists of the nucleic acid sequence CTCCATCACTAGGGGTTCCT (SEQ ID NO: 16).

[0065] In some embodiments, the D sequence of the ITR (e.g., the first ITR or the second ITR) of the nucleic acid vector disclosed herein is completely or partially removed. In some embodiments, the D sequence of both ITRs of the nucleic acid vector disclosed herein is completely or partially removed. In some embodiments, the D sequence of the ITR (e.g., the first ITR or the second ITR) is completely or partially replaced with a non-AAV sequence (i.e., a nucleotide sequence not from an AAV nucleic acid). In some embodiments, the D sequence of the ITR (e.g., the first ITR or the second ITR) is completely or partially replaced with an S sequence. In some embodiments, the S sequence comprises, consists essentially of, or consists of the nucleic acid sequence TATTAGATCTGATGGCCGCT (SEQ ID NO: 17). In some embodiments, the S sequence has at least 70% identity (e.g., at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity) to the sequence TATTAGATCTGATGGCCGCT (SEQ ID NO: 17).

[0066] In some embodiments, the S sequence has less than 95% identity (e.g., less than 90% identity, less than 85% identity, less than 80% identity, less than 75% identity, or less than 70% identity) with the sequence TATTAGATCTGATGGCCGCT (SEQ ID NO: 17). In some embodiments, the S sequence has about 70% to about 95% identity (e.g., about 95% identity, about 90% identity, about 85% identity, about 80% identity, about 75% identity, or about 70% identity) with the sequence TATTAGATCTGATGGCCGCT (SEQ ID NO: 17). In some embodiments, the S sequence has fewer than 6 mismatches (e.g., fewer than 5, fewer than 4, fewer than 3, fewer than 2, one, or zero mismatches) with the sequence TATTAGATCTGATGGCCGCT (SEQ ID NO: 17). In some embodiments, the S sequence has 1, 2, 3, 4, 5, or 6 mismatches to the sequence TATTAGATCTGATGGCCGCT (SEQ ID NO: 17). In some embodiments, the S sequence has a length of or about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides.

[0067] In some embodiments, the D sequence of the ITR (for example, the first ITR or the second ITR) is replaced in whole or in part with a glucocorticoid receptor binding element (GRE). In some embodiments, the GRE is inserted into a nucleic acid vector (i.e., instead of replacing a portion of the ITR). For example, the GRE may be inserted inside the D sequence of the ITR, upstream of the D sequence of the ITR, or downstream of the D sequence of the ITR.

[0068] Glucocorticoid receptor binding elements are also known as glucocorticoid responsive elements or glucocorticoid response elements. GREs are nucleotide sequences to which glucocorticoid receptors bind, which are typically located about 100-2,000 base pairs upstream from the transcription start site of a gene in their native locus. The present disclosure is based, in part, on the discovery that a portion of the D sequence of AAV2 shares partial homology with the consensus half-site of GRE and with each other, and that the glucocorticoid receptor signaling pathway is activated following AAV2 infection or transduction. In some embodiments, replacement of part or all of the D sequence of the AAV ITR with GRE increases the expression of a transgene encoded by a nucleic acid vector encapsidated in an AAV particle.

[0069] In some embodiments, the GRE comprises, consists essentially of, or consists of at least 8 contiguous nucleotides (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 contiguous nucleotides) of the nucleic acid sequence AGAACANNNTGTTCT (SEQ ID NO: 18), or its reverse or reverse complement, where each N is independently T, C, G, or A. In some embodiments, the GRE has at least 70% identity (e.g., at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity) to at least 8 contiguous nucleotides (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 contiguous nucleotides) of the sequence AGAACANNNTGTTCT (SEQ ID NO: 18), or its reverse or reverse complement, where each N is independently T, C, G, or A.

[0070] In some embodiments, the GRE has less than 95% identity (e.g., less than 90% identity, less than 85% identity, less than 80% identity, less than 75% identity, or less than 70% identity) to at least 8 contiguous nucleotides (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 contiguous nucleotides) of the sequence AGAACANNTGTTCT (SEQ ID NO: 18), or its reverse or reverse complement, where each N is independently T, C, G, or A. In some embodiments, the GRE has about 70% to about 95% identity (e.g., about 95% identity, about 90% identity, about 85% identity, about 80% identity, about 75% identity, or about 70% identity) to at least 8 contiguous nucleotides (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 contiguous nucleotides) of the sequence AGAACANNNTGTTCT (SEQ ID NO: 18), or its reverse or reverse complement, where each N is independently T, C, G, or A.

[0071] In some embodiments, the GRE has fewer than 6 mismatches (e.g., fewer than 5, fewer than 4, fewer than 3, fewer than 2, 1, or zero mismatches) to the sequence AGAACANNNTGTTCT (SEQ ID NO: 18), or its reverse or reverse complement, where each N is independently T, C, G, or A. In some embodiments, the GRE has 1, 2, 3, 4, 5, or 6 mismatches to the sequence AGAACANNNTGTTCT (SEQ ID NO: 18), or its reverse or reverse complement, where each N is independently T, C, G, or A. In some embodiments, the GRE has a length of or about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. In some embodiments, the GRE has a length of 15 nucleotides. In some embodiments, the GRE comprises, consists essentially of, or consists of the nucleic acid sequence AGAACANNNTGTTCT (SEQ ID NO: 18), or its reverse or reverse complement, where each N is independently T, C, G, or A.

[0072] In some embodiments, the GRE comprises, consists essentially of, or consists of at least 8 contiguous nucleotides (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 contiguous nucleotides) of the nucleic acid sequence GGTACANNNTGTYCT (SEQ ID NO: 19), or its reverse or reverse complement, where each N is independently T, C, G, or A, and where Y is T or C. In some embodiments, the GRE has at least 70% identity (e.g., at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity) to at least 8 contiguous nucleotides (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 contiguous nucleotides) of the sequence GGTACANNNTGTYCT (SEQ ID NO: 19), or its reverse or reverse complement, where each N is independently T, C, G, or A, and where Y is T or C.

[0073] In some embodiments, the GRE has less than 95% identity (e.g., less than 90% identity, less than 85% identity, less than 80% identity, less than 75% identity, or less than 70% identity) to at least 8 contiguous nucleotides (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 contiguous nucleotides) of the sequence GGTACANNNTGTYCT (SEQ ID NO: 19), or its reverse or reverse complement, where each N is independently T, C, G, or A, and where Y is T or C. In some embodiments, the GRE has about 70% to about 95% identity (e.g., about 95% identity, about 90% identity, about 85% identity, about 80% identity, about 75% identity, or about 70% identity) to at least 8 contiguous nucleotides (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 contiguous nucleotides) of the sequence GGTACANNNTGTYCT (SEQ ID NO: 19), or its reverse or reverse complement, where each N is independently T, C, G, or A, and where Y is T or C.

[0074] In some embodiments, the GRE has fewer than 6 mismatches (e.g., fewer than 5, fewer than 4, fewer than 3, fewer than 2, 1, or zero mismatches) to the sequence GGTACANNNTGTYCT (SEQ ID NO: 19), or its reverse or reverse complement, where each N is independently T, C, G, or A, and where Y is T or C. In some embodiments, the GRE has 1, 2, 3, 4, 5, or 6 mismatches to the sequence GGTACANNNTGTYCT (SEQ ID NO: 19), or its reverse or reverse complement, where each N is independently T, C, G, or A, and where Y is T or C. In some embodiments, the GRE has a length of or about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. In some embodiments, the GRE has a length of 15 nucleotides. In some embodiments, the GRE comprises, consists essentially of, or consists of the nucleic acid sequence GGTACANNNTGTYCT (SEQ ID NO: 19), or its reverse or reverse complement, where each N is independently T, C, G, or A, and where Y is T or C.

[0075] In some embodiments, the GRE comprises, consists essentially of, or consists of at least 8 contiguous nucleotides (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 contiguous nucleotides) of the nucleic acid sequence AGAACAGGATGTTCT (SEQ ID NO: 20), or its reverse or reverse complement. In some embodiments, the GRE has at least 70% identity (e.g., at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity) to at least 8 contiguous nucleotides (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 contiguous nucleotides) of the sequence AGAACAGGATGTTCT (SEQ ID NO:20), or its reverse or reverse complement.

[0076] In some embodiments, the GRE has less than 95% identity (e.g., less than 90% identity, less than 85% identity, less than 80% identity, less than 75% identity, or less than 70% identity) with at least 8 contiguous nucleotides (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 contiguous nucleotides) of the sequence AGAACAGGATGTTCT (SEQ ID NO: 20), or its reverse or reverse complement. In some embodiments, the GRE has about 70% to about 95% identity (e.g., about 95% identity, about 90% identity, about 85% identity, about 80% identity, about 75% identity, or about 70% identity) with at least 8 contiguous nucleotides (e.g., 8, 9, 10, 11, 12, 13, 14, or 15 contiguous nucleotides) of the sequence AGAACAGGATGTTCT (SEQ ID NO: 20), or its reverse or reverse complement.

[0077] In some embodiments, the GRE has fewer than 6 mismatches (e.g., fewer than 5, fewer than 4, fewer than 3, fewer than 2, 1, or zero mismatches) to the sequence AGAACAGGATGTTCT (SEQ ID NO:20) or its reverse or reverse complement. In some embodiments, the GRE has 1, 2, 3, 4, 5, or 6 mismatches to the sequence AGAACAGGATGTTCT (SEQ ID NO:20) or its reverse or reverse complement. In some embodiments, the GRE has a length of or about 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. In some embodiments, the GRE has a length of 15 nucleotides. In some embodiments, the GRE comprises, consists essentially of, or consists of the nucleic acid sequence AGAACAGGATGTTCT (SEQ ID NO: 20), or its reverse or reverse complement.

[0078] Another example of a GRE sequence useful according to the present disclosure is 5'-GGCACAGTGTGGTCT-3' (SEQ ID NO: 21). Other GRE sequences can be used, including, for example, GRE sequences known in the art.

[0079] In some embodiments, the substitution of the D sequence comprises the replacement of at least 5 nucleotides (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides) of the D sequence with a different nucleotide sequence (e.g., an S sequence or a portion thereof, or a GRE or a portion thereof). In some embodiments, the substitution of the D sequence comprises the replacement of 10 nucleotides of the D sequence. In some embodiments, the substitution of the D sequence comprises the replacement of the 3'-most 10 nucleotides of the D sequence. In some embodiments, the substitution of the D sequence comprises the replacement of the 5'-most 10 nucleotides of the D sequence. In some embodiments, the substitution of the D sequence comprises the replacement of an internal portion of the D sequence (i.e., not including the terminal nucleotides), such as 10 nucleotides of an internal portion of the D sequence.

[0080] In some embodiments, the deletion of a D sequence comprises the deletion of at least 5 nucleotides of the D sequence (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides). In some embodiments, the deletion of a D sequence comprises the deletion of 10 nucleotides of the D sequence. In some embodiments, the deletion of a D sequence comprises the deletion of the 10 3'-most nucleotides of the D sequence. In some embodiments, the deletion of a D sequence comprises the deletion of the 10 5'-most nucleotides of the D sequence. In some embodiments, the deletion of a D sequence comprises the deletion of an internal portion of the D sequence (i.e., not including the terminal nucleotides), such as 10 nucleotides of an internal portion of the D sequence.

[0081] In some embodiments, the nucleic acid vector as disclosed herein comprises one or more regulatory elements.Regulatory element refers to the nucleotide sequence or structural component of nucleic acid vector that is involved in regulating the expression of the components of nucleic acid vector (for example, the gene of interest contained therein).Regulatory element includes, but is not limited to, promoter, enhancer, silencer, insulator, response element, initiation site, termination signal, and ribosome binding site.

[0082] Promoters include constitutive promoters, inducible promoters, tissue-specific promoters, cell type-specific promoters, and synthetic promoters. For example, the nucleic acid vectors disclosed herein can include viral promoters or promoters from mammalian genes that are generally active in promoting transcription. Non-limiting examples of constitutive viral promoters include herpes simplex virus (HSV), thymidine kinase (TK), Rous sarcoma virus (RSV), Simian virus 40 (SV40), mouse mammary tumor virus (MMTV), Ad E1A, and cytomegalovirus (CMV) promoters. Non-limiting examples of constitutive mammalian promoters include various housekeeping gene promoters, such as exemplified by the β-actin promoter.

[0083] Inducible promoters or other inducible regulatory elements may also be used to achieve a desired expression level of a gene of interest (e.g., a protein or polypeptide of interest). Non-limiting examples of suitable inducible promoters include those from genes such as cytochrome P450 genes, heat shock protein genes, metallothionein genes, and hormone-inducible genes such as estrogen gene promoters. Another example of an inducible promoter is the tetVP16 promoter, which responds to tetracycline.

[0084] Tissue-specific promoters or other tissue-specific regulatory elements are also contemplated herein. Non-limiting examples of such promoters that may be used include muscle-specific promoters. Synthetic promoters are also contemplated herein. Synthetic promoters may contain regions, for example, known promoters, regulatory elements, transcription factor binding sites, enhancer elements, repressor elements, and the like.

[0085] In some embodiments, the nucleic acid provided herein comprises a nucleotide sequence that encodes a product (e.g., a protein or polypeptide product). In some embodiments, the nucleotide sequence comprises the nucleotide sequence of a gene of interest. In some embodiments, the gene of interest encodes a therapeutic or diagnostic protein or polypeptide. In some embodiments, the therapeutic or diagnostic protein or polypeptide is an antibody, a peptibody, a growth factor, a clotting factor, a hormone, a membrane protein, a cytokine, a chemokine, an activating or inhibitory peptide that acts on a cell surface receptor or ion channel, a cell-permeable peptide that targets an intracellular process, a thrombolytic agent, an enzyme, a bone morphogenetic protein, a nuclease, a protein used for gene editing, an Fc fusion protein, an anticoagulant, or a protein or polypeptide that can be detected using laboratory tests. In some embodiments, the nucleic acid provided herein comprises a nucleotide sequence that encodes a guide RNA or other nucleic acid used for gene editing, optionally in addition to a protein used for gene editing.

[0086] In some embodiments, the product encoded by the nucleic acid disclosed herein is a detectable molecule. A detectable molecule is a molecule that can be visualized (e.g., using the naked eye, under a microscope, or using a light detection device such as a camera). In some embodiments, a detectable molecule is a fluorescent molecule, a bioluminescent molecule, or a molecule that provides color (e.g., β-galactosidase, β-lactamase, β-glucuronidase, or spheroidenone). In some embodiments, a detectable molecule is a fluorescent, bioluminescent, or enzymatic protein or a functional peptide or polypeptide thereof.

[0087] In some embodiments, the fluorescent protein is blue fluorescent protein, cyan fluorescent protein, green fluorescent protein, yellow fluorescent protein, orange fluorescent protein, red fluorescent protein, or functional peptide or polypeptide thereof. The blue fluorescent protein may be Azurite, EBFP, EBFP2, mTagBFP, or Y66H. The cyan fluorescent protein may be ECFP, AmCyan1, Cerulean, CyPet, mECFP, Midori-ishi Cyan, mTFP1, or TagCFP. The green fluorescent protein may be AcGFP, Azami Green, EGFP, Emarald, GFP, or a mutated form of GFP (e.g., GFP-S65T, mWasabi, Stemmer, Superfolder GFP, TagGFP, TurboGFP, or ZsGreen). The yellow fluorescent protein may be EYFP, mBanana, mCitrine, PhiYFp, TagYFP, Topaz, Venus, YPet, or ZsYellow1. The orange fluorescent protein may be DsRed, RFP, DsRed2, DsRed-Express, Ds-Red-monomer, Tomato, tdTomato, Kusabira Orange, mKO2, mOrange, mOrange2, mTangerine, TagRFP, or TagRFP-T. The red fluorescent protein may be AQ142, AsRed2, dKeima-Tandem, HcRed1, tHcRed, Jred, mApple, mCherry, mPlum, mRasberry, mRFP1, mRuby, or mStrawberry.

[0088] In some embodiments, the detectable molecule is a bioluminescent protein, or a functional peptide or polypeptide thereof. Non-limiting examples of bioluminescent proteins are firefly luciferase, click beetle luciferase, Renilla luciferase, and luciferase from Oplophorus gracilirostris. In some embodiments, the detectable molecule can be any polypeptide or protein that can be detected using methods known in the art. Non-limiting methods of detection include fluorescent imaging, luminescent imaging, bright field imaging, and imaging facilitated by immunofluorescence or immunohistochemical staining. Additional features of AAV particles, nucleic acid vectors, and capsid proteins are described in U.S. Patent Publication No. 2017 / 0356009, the contents of which are incorporated by reference in their entirety.

[0089] AAV particles According to some aspects, AAV particles are provided herein. AAV particles are supramolecular assemblies of 60 individual capsid protein subunits that form a non-enveloped T-1 icosahedral lattice that can protect a 4.7-kb single-stranded DNA genome. Mature AAV particles have a diameter of approximately 20 nm, and the capsid is formed from three structural capsid proteins, VP1, VP2, and VP3, with molecular weights of 87, 73, and 62 kDa, respectively, in a ratio of approximately 1:1:18. The 60 capsid proteins are arranged in an antiparallel β-stranded barreloid configuration, resulting in a well-defined directionality and high resistance to degradation.

[0090] In some embodiments, the AAV particle comprises an empty capsid (e.g., a capsid without cargo). In some embodiments, the AAV particle comprises a capsid encapsidated with a nucleic acid (e.g., a nucleic acid vector comprising a gene of interest, such as a nucleic acid vector disclosed herein). In some embodiments, the nucleic acid encapsidated in the AAV capsid to generate the AAV particle comprises a nucleic acid vector disclosed herein. In some embodiments, the AAV particle disclosed herein comprises a capsid protein comprising one or more mutations, e.g., one or more amino acid substitutions.

[0091] It is contemplated herein that any of the capsid protein mutations (e.g., amino acid substitutions) disclosed herein can be combined with any of the nucleic acid vector modifications (e.g., sequence deletions or substitutions) disclosed herein. For example, an AAV particle described herein can have an AAVrh74 capsid protein (e.g., a wild-type AAVrh74 capsid protein or one containing one or more amino acid substitutions) and an AAV nucleic acid vector (e.g., an AAV2 nucleic acid vector) containing a modification (e.g., a deletion or substitution of a D sequence, and / or an insertion of a non-AAV sequence such as a GRE).

[0092] In some embodiments, the AAV particles disclosed herein comprise a capsid protein that comprises amino acid substitutions at positions corresponding to Y447, T494, K547, N665, and Y733 of the wild-type AAVrh74 capsid protein of SEQ ID NO: 1. In some embodiments, the AAV particles disclosed herein comprise a capsid protein that comprises one or more amino acid substitutions corresponding to Y447F, T494V, K547R, N665R, and Y733F of the wild-type AAVrh74 capsid protein of SEQ ID NO: 1. In some embodiments, the AAV particles disclosed herein comprise a capsid protein comprising amino acid substitutions at one or more positions corresponding to Y447, T494, K547, N665, and Y733 of the wild-type AAVrh74 capsid protein of SEQ ID NO:1, and further comprise a nucleic acid vector comprising a modification (e.g., a deletion or substitution) of the D sequence of the ITR (e.g., a modification of the D sequence of the right ITR, the left ITR, or both the right and left ITRs).

[0093] In some embodiments, the AAV particle comprises a nucleic acid vector comprising a capsid protein and a substitution of the D sequence of the ITR with an S sequence, comprising an amino acid substitution at one or more positions corresponding to Y447, T494, K547, N665, and Y733 of the wild-type AAVrh74 capsid protein of SEQ ID NO: 1. In some embodiments, the amino acid substitution corresponds to Y447F, T494V, K547R, N665R, and Y733F of the wild-type AAVrh74 capsid protein of SEQ ID NO: 1. In some embodiments, the S sequence comprises, consists essentially of, or consists of the nucleotide sequence TATTAGATCTGATGGCCGCT (SEQ ID NO: 17). In some embodiments, a portion or the entirety of the D sequence of the ITR (e.g., the D sequence of the left ITR) is replaced with an S sequence.

[0094] In some embodiments, the AAV particle comprises a capsid protein comprising amino acid substitutions corresponding to Y447F and Y733F of the wild-type AAVrh74 capsid protein of SEQ ID NO: 1, and a nucleic acid vector comprising a substitution of the D sequence of the ITR with an S sequence. In some embodiments, the S sequence comprises, consists essentially of, or consists of the nucleotide sequence TATTAGATCTGATGGCCGCT (SEQ ID NO: 17). In some embodiments, a portion or the entirety of the D sequence of the ITR (e.g., the D sequence of the left ITR) is replaced with the S sequence.

[0095] In some embodiments, the AAV particle comprises a capsid protein comprising amino acid substitutions corresponding to Y447F, T494V, and Y733F of the wild-type AAVrh74 capsid protein of SEQ ID NO: 1, and a nucleic acid vector comprising a replacement of the D sequence of the ITR with an S sequence. In some embodiments, the S sequence comprises, consists essentially of, or consists of the nucleotide sequence TATTAGATCTGATGGCCGCT (SEQ ID NO: 17). In some embodiments, a portion or the entirety of the D sequence of the ITR (e.g., the D sequence of the left ITR) is replaced with the S sequence.

[0096] In some embodiments, the AAV particle comprises a capsid protein comprising an amino acid substitution at one or more positions corresponding to Y447, T494, K547, N665, and Y733 of the wild-type AAVrh74 capsid protein of SEQ ID NO: 1, and a nucleic acid vector comprising a deletion of all or a portion of the D sequence of the ITR of the nucleic acid vector. In some embodiments, the amino acid substitution corresponds to Y447F and Y733F of the wild-type AAVrh74 capsid protein of SEQ ID NO: 1. In some embodiments, the amino acid substitution corresponds to Y447F, T494V, and Y733F of the wild-type AAVrh74 capsid protein of SEQ ID NO: 1. In some embodiments, the amino acid substitution corresponds to Y447F, T494V, K547R, N665R, and Y733F of the wild-type AAVrh74 capsid protein of SEQ ID NO: 1.

[0097] In some embodiments, the AAV particle comprises a capsid protein comprising amino acid substitutions at one or more positions corresponding to Y447, T494, K547, N665, and Y733 of the wild-type AAVrh74 capsid protein of SEQ ID NO: 1, and a nucleic acid vector comprising a substitution of the D sequence of the ITR with a GRE. In some embodiments, the amino acid substitutions correspond to Y447F, T494V, K547R, N665R, and Y733F of the wild-type AAVrh74 capsid protein of SEQ ID NO: 1. In some embodiments, the GRE comprises, consists essentially of, or consists of the nucleic acid sequence GGTACANNNTGTYCT (SEQ ID NO: 19), or its reverse or reverse complement, where each N is independently T, C, G, or A, and where Y is T or C. In some embodiments, the GRE comprises, consists essentially of, or consists of the nucleic acid sequence AGAACANNTGTTCT (SEQ ID NO: 18), or its reverse or reverse complement, where each N is independently T, C, G, or A. In some embodiments, the GRE comprises, consists essentially of, or consists of the nucleic acid sequence AGAACAGGATGTTCT (SEQ ID NO: 20), or its reverse or reverse complement. In some embodiments, a portion or all of the D sequence of an ITR (e.g., the D sequence of the left ITR) is replaced with a GRE.

[0098] In some embodiments, the AAV particle comprises a capsid protein that includes amino acid substitutions corresponding to Y447F and Y733F of the wild-type AAVrh74 capsid protein of SEQ ID NO: 1, and a nucleic acid vector that includes a substitution of the D sequence of the ITR with a GRE. In some embodiments, the GRE comprises, consists essentially of, or consists of the nucleic acid sequence GGTACANNNTGTYCT (SEQ ID NO: 19), or its reverse or reverse complement, where each N is independently T, C, G, or A, and where Y is T or C. In some embodiments, the GRE comprises, consists essentially of, or consists of the nucleic acid sequence AGAACANNNTGTTCT (SEQ ID NO: 18), or its reverse or reverse complement, where each N is independently T, C, G, or A. In some embodiments, the GRE comprises, consists essentially of, or consists of the nucleic acid sequence AGAACAGGATGTTCT (SEQ ID NO: 20), or its reverse or reverse complement. In some embodiments, part or all of the D sequence of an ITR (eg, the D sequence of the left ITR) is replaced with a GRE.

[0099] In some embodiments, the AAV particle comprises a capsid protein that includes amino acid substitutions corresponding to Y447F, T494V, and Y733F of the wild-type AAVrh74 capsid protein of SEQ ID NO:1, and a nucleic acid vector that includes a substitution of the D sequence of the ITR with a GRE. In some embodiments, the GRE comprises, consists essentially of, or consists of the nucleic acid sequence GGTACANNNTGTYCT (SEQ ID NO:19), or its reverse or reverse complement, where each N is independently T, C, G, or A, and where Y is T or C. In some embodiments, the GRE comprises, consists essentially of, or consists of the nucleic acid sequence AGAACANNNTGTTCT (SEQ ID NO:18), or its reverse or reverse complement, where each N is independently T, C, G, or A. In some embodiments, the GRE comprises, consists essentially of, or consists of the nucleic acid sequence AGAACAGGATGTTCT (SEQ ID NO:20), or its reverse or reverse complement. In some embodiments, part or all of the D sequence of an ITR (eg, the D sequence of the left ITR) is replaced with a GRE.

[0100] In some embodiments, the AAV particles disclosed herein are replicating. Replicating AAV particles can replicate in a host cell (e.g., a host cell in a subject or a host cell in culture). In some embodiments, the AAV particles disclosed herein are non-replicating. Non-replicating AAV particles cannot replicate in a host cell (e.g., a host cell in a subject or a host cell in culture), but can infect a host and integrate genetic components into the host's genome for expression. In some embodiments, the AAV particles disclosed herein can infect a host cell. In some embodiments, the AAV particles disclosed herein can promote stable integration of genetic components into the genome of a host cell. In some embodiments, the AAV particles disclosed herein cannot promote integration of genetic components into the genome of a host cell.

[0101] In some embodiments, the AAV particles disclosed herein comprise a nucleic acid vector. In some embodiments, the nucleic acid vector comprises two inverted terminal repeats (ITRs) adjacent to the end of the sequence encoding the gene of interest. In some embodiments, the nucleic acid vector is comprised within the ssDNA genome of the AAV. In some embodiments, the AAV particles disclosed herein comprise one single-stranded DNA. In some embodiments, the AAV particles disclosed herein comprise two complementary DNA strands, forming a self-complementary AAV (scAAV).

[0102] In some embodiments, the nucleic acid vector that may be included in the AAV particle (e.g., a WT particle or a particle comprising a capsid comprising any one or more mutations disclosed herein) comprises an ITR that includes a modification (e.g., a deletion or substitution) of part or all of the D sequence of the ITR. In some embodiments, part or all of the D sequence of the ITR is replaced with an S sequence or a portion thereof. In some embodiments, part or all of the D sequence of the ITR is replaced with a GRE or a portion thereof. In some embodiments, part or all of the D sequence of the ITR is deleted. Further description of such modifications (e.g., deletions and substitutions) is provided elsewhere herein.

[0103] The AAV particles disclosed herein may be of any AAV serotype (e.g., AAV serotypes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13), including any derivatives (including variants of serotypes that are not naturally occurring) or pseudotypes. Non-limiting examples of derivatives and pseudotypes include AAV2-AAV3 hybrid, AAVrh.10, AAVhu.14, AAV3a / 3b, AAVrh32.33, AAV-HSC15, AAV-HSC17, AAVhu.37, AAVrh.8, CHt-P6, AAV2.5, AAV6.2, AAV2i8, AAV-HSC15 / 17, AAVM41, AAV9.45, AAV2.5T, AAV-HAE1 / 2, AAV clone 32 / 83, AAVShH10, AAV2.15, AAV2.4, AAVM41, and AAVr3.45. Such AAV serotypes and derivatives / pseudotypes, and methods for producing such derivatives / pseudotypes, are known in the art (see, e.g., Mol. Ther. 2012 Apr; 20(4):699-708. doi: 10.1038 / mt.2011.287. Epub 2012 Jan 24. The AAV vector toolkit: poised at the clinical crossroads. Asokan A, Schaffer DV, Samulski RJ.). In some embodiments, the AAV particle is a pseudotyped AAV particle that includes a nucleic acid vector that includes ITRs from one serotype (e.g., AAV2 or AAV3) and a capsid composed of capsid proteins from another serotype (i.e., a serotype other than AAV2 or AAV3, respectively).Methods for producing and using pseudotyped rAAV vectors are known in the art (see, e.g., Duan et al., J. Virol., 75:7662-7671 (2001); Halbert et al., J. Virol., 74:1524-1532 (2000); Zolotukhin et al., Methods, 28:158-167 (2002); and Auricchio et al., Hum. Molec. Genet., 10:3075-3081 (2001)).

[0104] In some embodiments, the AAV particles disclosed herein are recombinant AAV (rAAV) particles, which include, by way of example, a recombinant nucleic acid or transgene. Combinations of any of the modifications described herein (e.g., capsid protein modifications, deletions or substitutions of D sequences, and / or insertions of non-AAV sequences into the AAV genome) may result in additive or synergistic effects such that the beneficial properties of the resulting combination are equal to or greater than the sum of the effects of each individual modification. For example, an AAV particle comprising a modified capsid protein and a modified genome may have improved transduction efficiency, transgene expression, and / or packaging efficiency compared to a corresponding wild-type AAV particle that is equal to or greater than the sum of the improvements conferred by the individual capsid protein modifications and genome modifications.

[0105] Transduction efficiency According to some aspects, the transduction efficiency of the AAV particles disclosed herein is modified compared to the corresponding wild-type AAV particles.The transduction efficiency of the AAV particles can be determined, for example, by comparing the expression of the expression of the gene of interest in the cells after contacting the cells with the AAV particles, or by measuring the number of viral genome copies per cell after contacting a population of cells with the AAV particles.In some embodiments, the transduction efficiency of the AAV particles as disclosed herein (for example, the AAV particles that include modified capsid proteins (for example, including one or more amino acid substitutions), modified nucleic acid vectors (for example, modified by deletion and / or replacement of D sequence), or both modified capsid proteins (for example, including one or more amino acid substitutions) and modified nucleic acid vectors (for example, modified by deletion and / or replacement of D sequence)) is higher than the transduction efficiency of the corresponding wild-type AAV particles.

[0106] In some embodiments, the transduction efficiency of an AAV particle as disclosed herein is at least 5% higher (e.g., at least 10% higher, at least 15% higher, at least 20% higher, at least 25% higher, at least 30% higher, at least 35% higher, at least 40% higher, at least 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 150% higher, at least 200% higher, at least 250% higher, or more) than the transduction efficiency of a corresponding wild-type AAV particle.

[0107] In some embodiments, the transduction efficiency of an AAV particle as disclosed herein is at least 1.5-fold higher (e.g., at least 2-fold higher, at least 2.5-fold higher, at least 3-fold higher, at least 3.5-fold higher, at least 4-fold higher, at least 4.5-fold higher, at least 5-fold higher, at least 5.5-fold higher, at least 6-fold higher, at least 6.5-fold higher, at least 7-fold higher, at least 7.5-fold higher, at least 8-fold higher, at least 8.5-fold higher, at least 9-fold higher, at least 9.5-fold higher, at least (at least 10 fold higher, at least 10.5 fold higher, at least 11 fold higher, at least 11.5 fold higher, at least 12 fold higher, at least 12.5 fold higher, at least 13 fold higher, at least 13.5 fold higher, at least 14 fold higher, at least 14.5 fold higher, at least 15 fold higher, at least 15.5 fold higher, at least 16 fold higher, at least 16.5 fold higher, at least 17 fold higher, at least 17.5 fold higher, at least 18 fold higher, at least 18.5 fold higher, at least 19 fold higher, at least 19.5 fold higher, at least 20 fold higher, or more). In some embodiments, the transduction efficiency of an AAV particle as disclosed herein is unaltered relative to a corresponding wild-type AAV particle.

[0108] Transgene expression According to some aspects, the expression of the transgene encoded by the nucleic acid vector containing the modification disclosed herein (e.g., deletion or substitution of a sequence such as D sequence) is altered relative to the expression of the transgene encoded by the nucleic acid vector that does not contain the modification. In some embodiments, such alteration of the expression of the transgene is based on a per nucleic acid vector copy number basis (e.g., the transgene expression in the cell is altered when normalized to the total amount of nucleic acid vector in the cell). For example, in some embodiments, the modified AAV particles as disclosed herein result in greater expression of the transgene compared to the corresponding AAV particles that do not contain the same modification but deliver a comparable number of viral genomes to the cell. The relative transgene expression level can be determined, for example, by measuring the expression of the transgene in the cell by methods known in the art after contacting the cell with the AAV particle containing the modified nucleic acid vector encoding the transgene, and comparing the equivalent measurement in another cell that is contacted with the AAV particle containing the nucleic acid vector that does not contain the modification.

[0109] In some embodiments, transgene expression from a modified nucleic acid vector as disclosed herein (e.g., modified by deletion and / or substitution of D sequences) is higher than transgene expression from a corresponding nucleic acid vector that does not contain a modification. In some embodiments, transgene expression from a modified nucleic acid vector as disclosed herein is at least 5% higher (e.g., at least 10% higher, at least 15% higher, at least 20% higher, at least 25% higher, at least 30% higher, at least 35% higher, at least 40% higher, at least 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 150% higher, at least 200% higher, at least 250% higher, or more) than transgene expression from a corresponding nucleic acid vector that does not contain a modification.

[0110] In some embodiments, transgene expression from a modified nucleic acid vector as disclosed herein is at least 1.5-fold higher (e.g., at least 2-fold higher, at least 2.5-fold higher, at least 3-fold higher, at least 3.5-fold higher, at least 4-fold higher, at least 4.5-fold higher, at least 5-fold higher, at least 5.5-fold higher, at least 6-fold higher, at least 6.5-fold higher, at least 7-fold higher, at least 7.5-fold higher, at least 8-fold higher, at least 8.5-fold higher, at least 9-fold higher, at least 10-fold higher, at least 12-fold higher, at least 14-fold higher, at least 16-fold higher, at least 18-fold higher, at least 19-fold higher, at least 20-fold higher, at least 21-fold higher, at least 22-fold higher, at least 23-fold higher, at least 24-fold higher, at least 25-fold higher, at least 26-fold higher, at least 27-fold higher, at least 28-fold higher, at least 29-fold higher, at least 30-fold higher, at least 31-fold higher, at least 32-fold higher, at least 33-fold higher, at least 34-fold higher, at least 35-fold higher, at least 36-fold higher, at least 37-fold higher, at least 38-fold higher, at least 39-fold higher, at least 40 ... 5 times higher, at least 10 times higher, at least 10.5 times higher, at least 11 times higher, at least 11.5 times higher, at least 12 times higher, at least 12.5 times higher, at least 13 times higher, at least 13.5 times higher, at least 14 times higher, at least 14.5 times higher, at least 15 times higher, at least 15.5 times higher, at least 16 times higher, at least 16.5 times higher, at least 17 times higher, at least 17.5 times higher, at least 18 times higher, at least 18.5 times higher, at least 19 times higher, at least 19.5 times higher, at least 20 times higher, or more). In some embodiments, transgene expression from a modified nucleic acid vector as disclosed herein is unchanged compared to transgene expression from a corresponding nucleic acid vector that does not contain the modification.

[0111] Packaging Efficiency According to some aspects, the packaging efficiency of the AAV particles disclosed herein is modified compared to corresponding wild-type AAV particles.The packaging efficiency of AAV particles refers to the ability of a specific AAV capsid to encapsidate the genome of a specific virus.Packaging efficiency can be measured by those skilled in the art, such as by quantifying the ratio of capsid to viral genome (see, for example, Grimm, et al. Gene Ther. 6:1322-1330 (1999)).

[0112] In some embodiments, the packaging efficiency of an AAV particle as disclosed herein (e.g., an AAV particle comprising a modified capsid protein, a modified nucleic acid vector, or both a modified capsid protein and a modified nucleic acid vector) is higher than the packaging efficiency of the corresponding wild-type AAV particle. In some embodiments, the packaging efficiency of an AAV particle as disclosed herein is at least 5% higher (e.g., at least 10% higher, at least 15% higher, at least 20% higher, at least 25% higher, at least 30% higher, at least 35% higher, at least 40% higher, at least 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 150% higher, at least 200% higher, at least 250% higher, or more) than the packaging efficiency of the corresponding wild-type AAV particle.

[0113] In some embodiments, the packaging efficiency of an AAV particle as disclosed herein is at least 1.5-fold higher (e.g., at least 2-fold higher, at least 2.5-fold higher, at least 3-fold higher, at least 3.5-fold higher, at least 4-fold higher, at least 4.5-fold higher, at least 5-fold higher, at least 5.5-fold higher, at least 6-fold higher, at least 6.5-fold higher, at least 7-fold higher, at least 7.5-fold higher, at least 8-fold higher, at least 8.5-fold higher, at least 9-fold higher, at least 9.5-fold higher, at least at least 10 times higher, at least 10.5 times higher, at least 11 times higher, at least 11.5 times higher, at least 12 times higher, at least 12.5 times higher, at least 13 times higher, at least 13.5 times higher, at least 14 times higher, at least 14.5 times higher, at least 15 times higher, at least 15.5 times higher, at least 16 times higher, at least 16.5 times higher, at least 17 times higher, at least 17.5 times higher, at least 18 times higher, at least 18.5 times higher, at least 19 times higher, at least 19.5 times higher, at least 20 times higher, or more).

[0114] In some embodiments, the packaging efficiency of an AAV particle as disclosed herein (e.g., an AAV particle comprising a modified capsid protein, a modified nucleic acid vector, or both a modified capsid protein and a modified nucleic acid vector) is lower than the packaging efficiency of the corresponding wild-type AAV particle. In some embodiments, the packaging efficiency of an AAV particle as disclosed herein is reduced by at least 5% (e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, or more) compared to the packaging efficiency of the corresponding wild-type AAV particle.

[0115] In some embodiments, the packaging efficiency of the AAV particles disclosed herein is unaltered compared to the corresponding wild-type AAV particles. In some embodiments, both the transduction efficiency and packaging efficiency of the AAV particles as disclosed herein are modified (i.e., increased or decreased) compared to the corresponding unmodified or wild-type AAV particles (e.g., of the same serotype). In some embodiments, the immunogenicity of the AAV particles as disclosed herein is modified compared to the corresponding unmodified or wild-type AAV particles (e.g., of the same serotype).

[0116] Pharmaceutical Compositions Any one of the AAV particles, capsid proteins, or nucleic acids disclosed herein may be included in a pharmaceutical composition that includes a pharma- ceutically acceptable carrier or may be included in a pharma- ceutically acceptable carrier. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle that AAV particles, capsid proteins, or nucleic acids are included in or administered to a subject. Such pharmaceutical carriers may be sterile liquids such as water and oils, including those of petroleum (such as mineral oil), vegetable oils (such as peanut oil, soybean oil, and sesame oil), animal oils, or synthetic origin. Saline solutions and aqueous dextrose and glycerin solutions may also be employed as liquid carriers.

[0117] Non-limiting examples of pharma- ceutically acceptable carriers include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia, calcium phosphate, alginate, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, saline, syrup, methylcellulose, ethylcellulose, hydroxypropylmethylcellulose, polyacrylic acid, lubricating agents (such as talc, magnesium stearate, and mineral oil), wetting agents, emulsifying agents, suspending agents, preservatives (such as methyl-, ethyl-, and propyl-hydroxy-benzoates), and pH adjusting agents (such as inorganic and organic acids and bases), and solutions or compositions thereof.

[0118] Other examples of carriers include phosphate buffered saline, HEPES buffered saline, and water for injection, any of which may be optionally combined with one or more of calcium chloride dihydrate, disodium phosphate anhydrous, magnesium chloride hexahydrate, potassium chloride, potassium dihydrogen phosphate, sodium chloride, or sucrose. Other examples of carriers that may be used include saline (e.g., sterile, pyrogen-free saline), saline buffer solutions (e.g., citrate buffer, phosphate buffer, acetate buffer, and bicarbonate buffer), amino acids, urea, alcohol, ascorbic acid, phospholipids, proteins (e.g., serum albumin), EDTA, sodium chloride, liposomes, mannitol, sorbitol, and glycerol. USP grade carriers and excipients are particularly useful for delivery of AAV particles to human subjects.

[0119] Typically, such compositions may contain at least about 0.1% or more of a therapeutic agent (e.g., AAV particles), although the percentage of active ingredient(s) may of course vary and may conveniently be between about 1 or 2% and about 70% or 80% or more by weight or volume of the total formulation. Of course, the amount of therapeutic agent(s) (e.g., AAV particles) in each therapeutically useful composition may be adjusted so that a suitable dosage is obtained in any given unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, and other pharmacological considerations are considered by those skilled in the art of preparing such pharmaceutical formulations, and various dosages and treatment regimens may be designed accordingly.

[0120] Method of contacting cells According to some aspects, a method of contacting a cell with an AAV particle is provided herein.The method of contacting a cell may, for example, include contacting a cell in culture with a composition comprising an AAV particle.In some embodiments, contacting a cell includes adding a composition comprising an AAV particle to the supernatant of a cell culture (e.g., a cell culture on a tissue culture plate or dish) or mixing a composition comprising an AAV particle with a cell culture (e.g., a suspension cell culture).In some embodiments, contacting a cell includes mixing a composition comprising an AAV particle with another solution, such as a cell culture medium, and incubating the cell with the mixture.

[0121] In some embodiments, contacting the cell with the AAV particle comprises administering a composition comprising the AAV particle to a subject or device in which the cell is located.In some embodiments, contacting the cell comprises injecting a composition comprising the AAV particle into a subject in which the cell is located.In some embodiments, contacting the cell comprises administering a composition comprising the AAV particle directly to the cell, or in or substantially adjacent to the tissue of the subject in which the cell is located.

[0122] In some embodiments, "administering" or "administration" means providing a material to a subject in a pharmacologically useful manner. In some embodiments, the rAAV particles are administered to a subject enterally. In some embodiments, the enteral administration of the essential metal element(s) is oral. In some embodiments, the rAAV particles are administered to a subject parenterally. In some embodiments, the rAAV particles are administered to a subject subcutaneously, intraocularly, intravitreally, subretinal, intravenously (IV), intracerebroventricularly, intramuscularly, intrathecally (IT), intracisternally, intraperitoneally, via inhalation, topically, or by direct injection into one or more cells, tissues, or organs. In some embodiments, the rAAV particles are administered to a subject by injection into the hepatic artery or portal vein.

[0123] In some embodiments, the composition of AAV particles is administered to a subject to treat a disease or condition. As used herein, the term "treating" a disease means reducing the frequency or severity of at least one sign or symptom of the disease or disorder experienced by the subject. The compositions described above or elsewhere herein are typically administered to a subject in an effective amount, i.e., an amount capable of producing a desired result. The desired result will depend on the active agent administered. For example, an effective amount of rAAV particles may be an amount of particles capable of transferring an expression construct to a host organ, tissue, or cell. A therapeutically acceptable amount may be an amount capable of treating a disease, for example, muscular dystrophy. As is well known in the medical and veterinary arts, the dosage for any one subject depends on many factors, including the subject's size, body surface area, age, the specific composition administered, the active ingredient(s) in the composition, the time and route of administration, general health, and other drugs administered concomitantly.

[0124] In some embodiments, the cells disclosed herein are cells isolated or derived from a subject. In some embodiments, the cells are mammalian cells (e.g., cells isolated from or derived from a mammal). In some embodiments, the cells are human cells. In some embodiments, the cells are isolated from or derived from a particular tissue of a subject, such as muscle tissue. In some embodiments, the cells are muscle cells. In some embodiments, the cells are skeletal muscle cells or smooth muscle cells. In some embodiments, the cells are in vitro. In some embodiments, the cells are ex vivo. In some embodiments, the cells are in vivo. In some embodiments, the cells are within a subject (e.g., within a tissue or organ of a subject). In some embodiments, the cells are primary cells. In some embodiments, the cells are from a cell line (e.g., an immortalized cell line). In some embodiments, the cells are cancer cells or immortalized cells.

[0125] In some embodiments, "administering" or "administration" means providing a substance to a subject in a manner that is pharmacologically useful. In some situations, it may be desirable to deliver the AAV particles disclosed herein in a suitably formulated pharmaceutical composition disclosed herein either subcutaneously, intraocularly, intravitreal, subretinal, parenterally, intravenously (IV), intracerebroventricularly, intramuscularly, intrathecally (IT), intracisternally, orally, intraperitoneally, by oral or nasal inhalation, or by direct injection into one or more cells, tissues, or organs. In some embodiments, administration is by a route suitable for systemic delivery, such as intravenous injection. In some embodiments, administration is by a route suitable for localized delivery, such as intramuscular injection. In some embodiments, "administering" or "administration" refers to providing a material to a subject in a manner that is pharmacologically useful.

[0126] In some embodiments, the concentration of AAV particles administered to a subject is 10 6 Particles / ml to 10 14 particles / ml or up to 10 3 Particles / ml to 10 15 on the order of magnitude ranging up to about 10 particles / ml, or, for example, 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 In some embodiments, the concentration may be any value between 10 particles / ml, etc. 13 In some embodiments, the concentration of AAV particles administered to a subject is greater than 10 6 Vector genomes (vgs) / ml to 10 14 vgs / ml or 10 3 vgs / ml to 10 15 vgs / ml, or any value between any of the ranges (for example, 10 6, 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 In some embodiments, the concentration may be 10 13 AAV particles are administered at a concentration greater than vgs / ml.

[0127] The AAV particles may be administered as a single dose or may be divided into two or more administrations as may be required to achieve treatment of the particular disease or disorder to be treated. In some embodiments, 0.0001 ml to 10 ml is delivered to the subject. In some embodiments, the number of AAV particles administered to the subject is 10 per kg of the subject's body weight. 6 ~10 14 vgs range, or any value between them (for example, 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 In some embodiments, the dose of AAV particles administered to a subject may be 10 12 ~10 14 In some embodiments, the volume of the AAVrh74 composition delivered to a subject (e.g., via one or more routes of administration as described herein) is between 0.0001 ml and 10 ml.

[0128] In some embodiments, the compositions disclosed herein (e.g., those containing AAV particles) are administered to a subject once. In some embodiments, the compositions are administered to a subject multiple times (e.g., two, three, four, five, six, or more times). Repeated administration to a subject may be performed at regular intervals (e.g., daily, every other day, twice a week, weekly, twice a month, monthly, every six months, once a year, or less frequently or more frequently) as needed to treat (e.g., ameliorate or alleviate) one or more symptoms of a disease, disorder, or condition in the subject.

[0129] subject Aspects of the present disclosure relate to methods for use in subjects, such as human or non-human primate animal subjects; in host cells in situ in a subject; or in host cells derived from a subject (e.g., ex vivo or in vitro). Non-limiting examples of non-human primate animal subjects include macaques (e.g., cynomolgus or rhesus monkeys), marmosets, tamarins, spider monkeys, night monkeys, savannah monkeys, squirrel monkeys, baboons, gorillas, chimpanzees, and orangutans. In some embodiments, the subject is a human subject. Other exemplary subjects include domestic animals, such as dogs and cats; livestock animals, such as horses, cattle, pigs, sheep, goats, and chickens; and other animals, such as mice, rats, guinea pigs, and hamsters.

[0130] In some embodiments, the subject has or is suspected to have a disease or disorder that can be treated with gene therapy. In some embodiments, the subject has or is suspected to have a muscle disease or disorder. A muscle disease or disorder is typically characterized by one or more mutations in the genome that result in abnormal structure or function of one or more proteins associated with muscle development, health, maintenance and / or function. Exemplary muscle diseases and disorders include amyotrophic lateral sclerosis, Charcot-Marie-Tooth disease, multiple sclerosis, muscular dystrophies (e.g., Duchenne muscular dystrophy, facioscapular-humeral muscular dystrophy, Becker muscular dystrophy, or LGMD, such as Limb-girdle muscular dystrophy (LGMD) type 1 or LGMD type 2), myasthenia gravis, myopathy (e.g., X-linked myotubular myopathy), myositis, peripheral neuropathy, or spinal muscular atrophy.

[0131] Muscle diseases and disorders can be characterized and identified, for example, through laboratory tests and / or clinician evaluation.In some embodiments, a subject has or is suspected to have a disease related to muscle cells (for example, a disease caused by defects such as genetic mutations in one or more muscle cells or genes related thereto).In some embodiments, a nucleic acid (for example, genomic DNA, mRNA, or cDNA from a subject) isolated from or derived from a subject is identified to contain a mutation (for example, in a gene related to muscle development, health, maintenance, or function) through sequencing (for example, Sanger or next-generation sequencing).

[0132] In some embodiments, the gene related to muscle development, health, maintenance or function is dystrophin / DMD, SCN4A, DMPK, ACTA, TPM3, TPM2, TNNT1, CFL2, KBTBD13, KLHL30, KKLHL3, KLHL41, LMOD3, MYPN, MTM1, nebulin, DNM2, TTN, RYR1, MYH7, TK2, GAA (α-glucosidase), ClC1, LMNA, CAV3, DNAJB6, TRIM32, desmin, LAMA2, COL6A1, COL6A2, COL6A3, or DUX4. In some embodiments, the gene is dystrophin (DMD) or MTM1. In some embodiments, the gene is a gene whose mutation has been shown to cause limb-girdle muscular dystrophy (e.g., LGMD1 or LGMD2), such as MYOT, LMNA, CAV3, DNAJB6, DES, TNP03, HNRNPDL, CAPN3, DYSF, SGCG, SGCA, SGCB, SGCD, TCAP, TRIM32, FKRP, TTN, POMT1, ANO5, FKTN, POMT2, POMGnT1, DAG1, PLEC1, DES, TRAPPC11, GMPPB, ISPD, GAA, LIMS2, BVES, or TOR1A1P1. In some embodiments, the subject comprises a mutation in one or more genes associated with muscle development, health, maintenance, or function. In some embodiments, the methods disclosed herein provide a subject's cell (e.g., a muscle cell) having a functional form of a gene associated with muscle development, health, maintenance, or function.

[0133] example The following examples are included to demonstrate illustrative embodiments of the invention and are not to be considered limiting. Those skilled in the art should understand that the techniques disclosed in these examples represent techniques discovered to work well in the practice of the invention and thus may be considered to constitute preferred modes of its practice. However, those skilled in the art should understand in light of this disclosure that many changes can be made to the specific embodiments disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

[0134] Example 1. Development of capsid-modified next-generation AAVrh74 vectors with increased transduction efficiency in primary human skeletal muscle cells: Implications for gene therapy of muscular dystrophy It is becoming increasingly clear that the host immune response to AAV directly correlates with the dose of AAV vector administered. For example, in a gene therapy trial for X-linked myotubular myopathy, a dose of 1x10 14 Doses of AAV8 vectors up to vgs / kg have been shown to be safe, but 14 The 2x10 vgs / kg dose was associated with severe complications in three patients, with complications proving fatal in two of the patients (Hum. Gene Ther., 31: 787, 2020). 14 Although AAVrh74 vectors at a dose of vgs / kg have been shown to be well tolerated in patients with Duchenne muscular dystrophy (JAMA Neurol., 77: 1122-1131, 2020), it would be desirable to achieve clinical efficacy at significantly lower vector doses. It has previously been reported that site-directed mutagenesis of specific surface-exposed tyrosine (Y) residues to phenylalanine (F) significantly reduces doses (Proc. Natl. Acad. Sci. USA, 105: 7827-7832, 2008; Mol. Ther., 18: 2048-2056, 2010) and results in less immunogenic (Blood, 8: 121: 2224-2233, 2013) next-generation ("NextGen") AAV2 vectors.

[0135] Because most, but not all, surface-exposed Y residues are conserved in AAVrh74, we generated the corresponding Y733F single mutant ("SM") and Y733+447F double mutant (DM) AAVrh74 vectors. The transduction efficiency of these vectors expressing an EGFP reporter gene was approximately 12-fold and 16-fold higher, respectively, than that of the conventional wild-type ("WT") AAVrh74 vector in HeLa cells (Figure 1A). The YF mutant vector was also remarkably efficient in transducing the immortalized mouse myoblast C2C12 cell line (Figure 1B). Inclusion of site-directed mutagenesis of surface-exposed threonine (T) to valine (V) residues has previously been reported to further increase the transduction efficiency of AAV2 vectors (PLoS One, 8: e59142, 2013), thus further generating a Y733+Y447F+T494V triple mutant ("TM") ssAAVrh74 vector, which was up to approximately five-fold more efficient than the first-generation ssAAVrh74 vector in primary human skeletal muscle cells (Figure 2).

[0136] Furthermore, single mutants T494V, K547R, and N665R, triple mutants Y447+733F+N665R and Y447+733F+K547R, and quintuple mutant Y447+733F+N665R+T494V+K547R ssAAVrh74 vectors were generated and tested for their transduction efficiency. Each of the triple mutants, like the quintuple mutant, showed increased transduction efficiency of HeLa cells compared to the wild-type ssAAVrh74 vector, and the transduction efficiency of each of these multiple mutants was similar to the Y733+447F+T494V triple mutant (Figures 3A and 3B). Studies are currently underway to evaluate the efficacy of mutant ssAAVrh74 vectors in vivo in skeletal muscle of a mouse model. Taken together, these studies suggest that the use of the Next Gen AAVrh74 vector will lead to potentially safe and effective gene therapy for human muscular dystrophies at low doses, without the need for immunosuppression.

[0137] Example 2. Development of genomically modified X-generation single-stranded AAVrh74 vectors with improved transgene expression in primary human skeletal muscle cells Naturally occurring AAV contains a single-stranded DNA genome, and ssDNA is transcriptionally inactive and there is no RNA polymerase that can transcribe ssDNA, so viral gene expression is poor.Similarly, transgene expression levels from recombinant ssAAV vectors are also adversely affected.It has been previously reported that the D sequence in the AAV inverted terminal repeat (ITR) at the 3' end of the vector genome plays an important role in restricting transgene expression from ssAAV vectors (Proc. Natl. Acad. Sci. USA, 94: 10879-10884, 1997).A binding site has been identified in the D sequence in AAV-ITR for NF-κB negative regulator (NRF), which is known to suppress transcription. Replacement of the D sequence in the left ITR (LC1) or right ITR (LC2) with an S sequence resulted in generation X ("GenX") ssAAV vectors that mediated up to eight-fold improved transgene expression (J. Virol., 89: 952-961, 2015).

[0138] In this study, we assessed whether encapsidation of these modified ssAAV genomes in AAVrh74 capsids also led to increased transgene expression. HeLa cells were transduced with WT, LC1, and LC2 vectors expressing the hrGFP reporter gene at multiplicities of infection of 1,000, 3,000, and 10,000 vgs / cell, and hrGFP fluorescence was quantified 72 hours post-transduction. These results, shown in Figure 4A, documented approximately 5-fold and 2.5-fold increases in transgene expression mediated by LC1 and LC2 vectors, respectively, compared to ssAAVrh74 vectors encasing genomes without D sequence substitutions (p<0.01). The observed increases in transgene expression were not due to increased entry of LC1 and LC2 vectors, as documented by approximately similar numbers of vector genomes quantified by qPCR analysis of low molecular weight DNA samples isolated from cells transduced with each of these vectors (Figure 4B). The extent of transgene expression from these vectors was also assessed in primary human skeletal muscle cells transduced with each of these vectors at multiplicities of infection of 1,000, 3,000, and 10,000 vgs / cell. Quantitation of fluorescent images showed an average of approximately 13-fold increase in transgene expression for the ssLC1-AAVrh74 vector and an average of approximately 5-fold increase in transgene expression for the ssLC2-AAVrh74 vector compared to that from the conventional ssAAVrh74 vector (Figure 4C).

[0139] Based on previously published studies with NextGen AAV2 and AAV3 serotype vectors (Hum. Gene Ther. Meth., 27: 143-149, 2016), it was anticipated that encapsidation of LC1 and LC2 GenX AAV genomes into NextGen AAVrh74 capsids would be feasible to achieve significantly higher transgene expression in vivo in mouse models. To test the efficacy of such vectors, a Y733+Y447F+T494V triple mutant ("TM") ssAAVrh74 vector containing a substitution of the D sequence in the left ITR with an S sequence was generated and compared to the TM ssAAVrh74 and WT ssAAVrh74 vectors without genomic modifications. The results in Figures 5 and 6A-6B show that the TM / D sequence ("Opt") in combination with the mutant ssAAVrh74 vector significantly inhibited the expression of hrGFP from the vector, as measured by fluorescence microscopy imaging (Figure 5) and flow cytometry (Figures 6A-6B). X ") demonstrated approximately 4-fold higher transgene expression in HeLa cells compared to the WT ssAAVrh74 vector, and approximately 2-fold higher transgene expression than the TM ssAAVrh74 (no D sequence substitution). These findings have important implications for the potential use of GenX AAVrh74 vectors at even reduced doses in gene therapy for muscular dystrophy.

[0140] Example 3. Optimized (Opt) expression with increased transduction efficiency in primary human skeletal muscle cells in vitro and in mouse muscle in vivo after systemic administration X ) Development of AAVrh74 vector In one Phase I / II clinical trial using AAV9 vectors, serious adverse events such as complement activation and thrombocytopenia leading to kidney damage and cardiopulmonary insufficiency were reported. In another study, several serious adverse events such as acute kidney injury and thrombocytopenia associated with typical hemolytic uremic syndrome, and more recently, patient death, have also been reported with the use of AAV9 vectors. Sarepta Therapeutics reported results from a Phase I / II trial using AAVrh74 vectors, with vomiting as the only adverse event, and the AAVrh74 vector reduced the number of immunizations by 2x10 14 Reports have shown that it is safe to use at high doses of vgs / kg.

[0141] As described in the preceding examples, capsid-modified next generation ("NextGen") AAVrh74 vectors and genome-modified generation X ("GenX") AAVrh74 vectors are significantly more efficient than their wild-type (WT) counterparts (see also Mol. Ther., 29: 159-160, 2021; Mol. Ther., 29: 184-185, 2021). In this example, two modifications were combined and optimized ("Opt X ") AAVrh74 vector was generated. X The transduction efficiency of the AAVrh74 vector was evaluated in primary human skeletal muscle cells in vitro, and the results demonstrated that the transduction efficiency of these cells was approximately 5-fold higher than that of the wild-type AAVrh74 vector.

[0142] WT and Opt X The efficacy of the AAVrh74 vector was also evaluated in vivo in mouse muscle after systemic administration. X We demonstrate that the transduction efficiency of the AAVrh74 vector was approximately 5-fold higher in the gastrocnemius (GA; FIG. 7A) and tibialis anterior (TA; FIG. 7B) muscles. Interestingly, the transduction efficiency of the AAVrh74 vector was approximately 5-fold higher in the GA, TA, diaphragm, and heart muscles. XThe total genome copy numbers of the AAVrh74 vectors were not significantly different from each other (Fig. 7C). X These results suggest that the observed increase in transduction efficiency of AAVrh74 vectors may have resulted from improved intracellular and nuclear transport of these vectors. Taken together, these studies suggest that Opt X These results suggest that the use of AAVrh74 vectors may lead to safe and effective gene therapy for human muscular dystrophies at high doses.

[0143] Example 4. Development of genomically modified generation Y (GenY) AAVrh74 vectors with improved transgene expression in mouse skeletal muscle cell lines and primary human skeletal muscle cells The level of transgene expression from recombinant ssAAV vectors is typically relatively low as a result of ssDNA being transcriptionally inactive. Substitution of D sequences in the left inverted terminal repeat (ITR) of AAV vectors to form "generation X" ("GenX") AAV vectors results in AAV vectors that mediate up to eight-fold improved transgene expression (J. Virol., 89: 952-961, 2015). The degree of transgene expression from GenX AAVrh74 vectors is also about five-fold higher than that from wild-type (WT) AAVrh74 vectors (Mol. Ther., 29: 184-185, 2021). The distal 10 nucleotides in the AAV2 D sequence share partial homology with the consensus half-site of the glucocorticoid receptor binding element (GRE), and the glucocorticoid receptor signaling pathway is activated following AAV2 infection or AAV2 vector transduction (Mol. Ther., 24: S6, 2016).

[0144] In the current example, substitution of the distal (with respect to the end of the nucleic acid vector) 10 nucleotides in the D sequence with an authentic GRE was evaluated for its ability to increase transgene expression from an AAVrh74 vector, designated the "Generation Y" ("GenY") vector, shown diagrammatically in FIG. 8A. Transgene expression from WT and GenY AAVrh74 vectors was evaluated in C2C12 mouse skeletal muscle cells. The GenY AAVrh74 vector averaged about a 2-3 fold increase in transgene expression compared to the WT AAVrh74 vector (FIG. 8B). Transgene expression was further increased about 4-5 fold after pretreatment of the cells with tyrphostin, a specific inhibitor of the epidermal growth factor receptor protein tyrosine kinase (FIG. 8B).

[0145] The WT, GenX, and GenY vectors were also evaluated in primary human skeletal muscle cells. Transgene expression from the GenX and GenY AAVrh74 vectors was approximately 4-fold and 6-fold higher, respectively, compared to the WT AAVrh74 vector (Figure 8C). Analysis by qPCR of low molecular weight DNA samples isolated from primary human skeletal muscle cells transduced with the WT, GenX, or GenY AAVrh74 vectors showed similar vector genome copy numbers in cells transduced with each vector (Figure 8D), indicating that the observed increase in transgene expression is not due to increased entry of the GenX or GenY vectors.

[0146] These studies have demonstrated that capsid-engineered NextGen + GenY (Opt Y ) The use of AAVrh74 vectors could further reduce the need for high vector doses, which may support the use of Opt in safe and effective gene therapy of muscular dystrophy in humans. Y These findings have important implications for the potential use of AAVrh74 vectors.

[0147] Example 5.Opt X and Opt Y In vivo efficacy of AAVrh74 vectors In this example, the efficacy of AAVrh74 vectors containing the Y733+Y447F+T494V triple mutant (TM) capsid and either a GenX (having a substitution of the D sequence with an S sequence in the left ITR) or a GenY (having a substitution in the left ITR where part of the D sequence is replaced with a GRE sequence) modified genome was tested. The TM + GenX vectors were designated "Opt X " and the TM + GenY vector is referred to as "Opt Y "It is called "

[0148] Opt X To test the vectors, C57BL / 6 mice were injected with PBS, a dose of wild-type AAVrh74 particles ("WT") or Opt X AAVrh74 particles (“Opt X The WT and Opt were administered intravenously at either dose of X The particle dose is 1x10 12 The amount of hrGFP expressed per μg total RNA in the liver (striped bars), diaphragm (solid bars), and heart (open bars) was equivalent to the viral genome. Eight weeks after administration of the particles, various tissues were collected and RNA was extracted. Reverse transcription quantitative PCR (RT-qPCR) was performed for hrGFP mRNA expressed from the vector. Figure 9A shows the amount of hrGFP per μg total RNA in the liver (striped bars), diaphragm (solid bars), and heart (open bars). The results show that Opt X Figure 9B demonstrates that the AAVrh74 vector achieved approximately 2-fold higher hrGFP expression in mouse tissues compared to WT AAVrh74. Figure 9B shows that the Opt β-actin gene expression in the diaphragm and heart was significantly increased when calculated relative to endogenous β-actin gene expression. X 1 shows that transgene expression from the AAVrh74 vector was significantly higher in the liver than that from the WT AAVrh74 vector.

[0149] 10A and 10B show that PBS, WT AAVrh74 particles, or Opt Xβ-actin mRNA expression in samples from mice administered AAVrh74 particles. The results demonstrated no difference in β-actin expression between the various samples, and Opt X The increased hrGFP expression measured in samples from mice treated with the particles is shown to be due to the improved properties of the particles.

[0150] Opt Y To test the vectors, C57BL / 6 mice were injected with PBS, a dose of AAVrh74 particles with TM capsid protein ("TM"), or Opt Y AAVrh74 particles (“Opt Y The dose of AAVrh74 particles was 1x10 12 Eight weeks after particle administration, various tissues were collected. Tissue sections were prepared and RNA was extracted. Fluorescence microscopy of tissue sections showed that Opt Y We demonstrated that hrGFP fluorescence increased in the liver, gastrocnemius muscle ("GA"), and tibialis anterior muscle ("TA") following particle administration (Figure 11A; fluorescence was quantified in Figure 11B).

[0151] The results, shown in FIG. 12 , show that the copy numbers of vector genome in the liver (diagonal striped bars), heart (open bars), diaphragm (solid bars), gastrocnemius muscle ("GA muscle"; checkered bars), and tibialis anterior muscle ("TA muscle"; horizontal striped bars) were significantly higher in mice treated with TM-only AAVrh74 particles ("TM") versus Opt Y Mice treated with particles ("Opt Y In contrast, hrGFP mRNA expression from the AAVrh74 vector differed in some tissues. As shown in FIG. 13, hrGFP expression was significantly higher in the Opt Y In mice treated with particles, there was a decrease in liver, an increase in diaphragm, an increase in gastrocnemius, and a slight increase in tibialis anterior compared to mice treated with TM only particles. The results presented in this example are Xand Opt Y We demonstrate that AAVrh74 vectors can achieve improved transgene expression profiles in vivo following intravenous administration in mice.

[0152] Equivalence and Scope While several embodiments of the present invention have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and / or structures for performing the functions and / or obtaining the results and / or one or more advantages described herein, and each such variation and / or modification is deemed to be within the scope of the embodiments of the present invention described herein. More generally, those of ordinary skill in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary, and that the actual parameters, dimensions, materials, and / or configurations will depend on the particular application(s) in which the teachings of the present invention are used.

[0153] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein.It should therefore be understood that the above embodiments are presented by way of example only, and that within the scope of the appended claims and equivalents thereto, the inventive embodiments may be practiced other than as specifically described and claimed.The inventive embodiments of the present disclosure relate to each individual feature, system, article, material, kit, and / or method described herein.In addition, combinations of two or more of such features, systems, articles, materials, kits, and / or methods are encompassed within the scope of the present disclosure, where such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent.

[0154] All definitions, as defined and used herein, should be understood to supersede any dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meaning of the defined term. All references, patents, and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, and in some cases may include the entire document. The indefinite articles "a" and "an," as used in the specification and claims, unless clearly indicated to the contrary, should be understood to mean "at least one."

[0155] The phrase "and / or," as used in the specification and claims, should be understood to mean "either or both" of the elements it coordinates (i.e., in some cases it is coordinately present and in other cases it is disjunctively present). Multiple elements listed with "and / or" should be construed in the same manner (i.e., one or more of the elements so coordinated). Other elements may optionally be present other than the elements specifically identified by the "and / or" clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to "A and / or B," when used in conjunction with open-ended language such as "comprising," may, in one embodiment, refer only to A (optionally including elements other than B); in another embodiment, refer only to B (optionally including elements other than A); in another embodiment, refer to both A and B (optionally including other elements); and so forth.

[0156] When used in this specification and the claims, "or" should be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" should be interpreted as inclusive (i.e., including at least one, but more than one, of a number or list of elements, and optionally including additional unlisted items). Only terms clearly expressed to the contrary, such as "only one of" or "exactly one of," or, when used in the claims, "consisting only of," refer to the inclusion of exactly one element of a number or list of elements. In general, the term "or," when used herein, should only be interpreted as excluding alternatives (i.e., "one or the other, but not both") when preceded by an exclusive term, such as "any of," "one of," "only one of," or "exactly one of." "Consisting essentially of," when used in the claims, should have its ordinary meaning as used in the field of patent law.

[0157] As used in this specification and claims, the phrase "at least one," with reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but may not necessarily include at least one of each and every element specifically listed in the list of elements, and does not exclude any combination of elements in the list of elements. This definition also allows for the optional presence of elements other than those specifically identified in the list of elements to which the phrase "at least one" refers, whether related to the specifically identified element or not.

[0158] Thus, as a non-limiting example, "at least one of A and B" (or, equivalently, "at least one of A or B" or, equivalently, "at least one of A and / or B") can refer, in one embodiment, to at least one, optionally including more than one A and no B (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one B and no A (and optionally including elements other than A); in another embodiment, to at least one, optionally including more than one A, and at least one, optionally including more than one B (and optionally including other elements);

[0159] Unless expressly expressed to the contrary, in any method claimed herein that includes more than one step or action, the order of the method steps or actions is not necessarily limited to the order in which the method steps or actions are described.

[0160] In the claims, as well as in the above specification, all transitional phrases such as "comprising," "including," "carrying," "having," "containing," "involving," "holding," "composed of," and the like, should be understood to be open-ended (i.e., meaning including, but not limited to). Only the transitional phrases "consisting of" and "consisting essentially of" should be closed or semi-closed transitional phrases, respectively, as expressed in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03. It should be understood that embodiments described in this document that use open-ended transitional phrases (e.g., "comprising") are also contemplated in alternative embodiments as "consisting of" and "consisting essentially of" the features recited by the open-ended transitional phrases. For example, if the disclosure describes "a composition comprising A and B," the disclosure also contemplates the alternative embodiments of "a composition consisting only of A and B" and "a composition consisting essentially of A and B."

Claims

1. An AAVrh74 particle comprising a capsid protein and a nucleic acid vector, wherein the nucleic acid vector comprises a first inverted terminal repeat (ITR) comprising a first D sequence and a second ITR comprising a second D sequence, wherein the first D sequence or the second D sequence is replaced with an alternative sequence.

2. The AAVrh74 particle of claim 1, wherein the alternative sequence is an S sequence, optionally wherein the S sequence comprises, consists essentially of, or consists of the nucleotide sequence TATTAGATCTGATGGCCGCT (SEQ ID NO: 17).

3. The AAVrh74 particle of claim 1, wherein the alternative sequence is a glucocorticoid receptor binding element (GRE), optionally wherein the GRE comprises, consists essentially of, or consists of the nucleotide sequence AGAACANNNTGTTCT (SEQ ID NO: 18), or its reverse or reverse complement, where each N is independently T, C, G, or A.

4. A composition comprising an AAVrh74 particle described in any one of claims 1 to 3.

5. 5. The composition of claim 4 for use in a method of treating a disease or condition.

6. 6. The composition for use according to claim 5, wherein the first D sequence and / or the second D sequence is replaced with an S sequence, optionally wherein the S sequence comprises, consists essentially of, or consists of the nucleotide sequence TATTAGATCTGATGGCCGCT (SEQ ID NO: 17).

7. The composition for use of claim 5, wherein the first D sequence and / or the second D sequence is replaced with a glucocorticoid receptor binding element (GRE), optionally wherein the GRE comprises, consists essentially of, or consists of the nucleotide sequence AGAACANNNTGTTCT (SEQ ID NO: 18), or its reverse or reverse complement, where each N is independently T, C, G, or A.

8. 6. The composition for use of claim 5, wherein the capsid protein comprises amino acid substitutions at positions corresponding to Y447, T494, K547, N665 and / or Y733 of the wild-type AAVrh74 capsid protein of SEQ ID NO:1, optionally wherein the substitutions are Y447F, T494V, K547R, N665R and / or Y733F.

9. The capsid protein comprises amino acid substitutions in the wild-type AAVrh74 capsid protein of SEQ ID NO:1 at positions corresponding to: (a) Y447 and Y733, optionally where the substitutions are Y447F and Y733F; (b) Y447, Y733, and N665, optionally where the substitutions are Y447F, Y733F, and N665R; (c) Y447, Y733, and T494, optionally where the substitutions are Y447F, Y733F, and T494V; (d) Y447, Y733, and K547, optionally where the substitutions are Y447F, Y733F, and K547R; or (e) Y447, Y733, N665, T494, and K547, optionally where the substitutions are Y447F, Y733F, N665R, T494V, and K547R; 9. The composition for use according to claim 8, comprising:

10. The composition for use according to claim 5, wherein the first and second ITRs are AAV2 serotype ITRs or AAV3 serotype ITRs, respectively.

11. 6. The composition for use according to claim 5, wherein the first D sequence is replaced with an S sequence or the first D sequence is replaced with a GRE.

12. 6. The composition for use according to claim 5, wherein the second D sequence is replaced with an S sequence or the second D sequence is replaced with a GRE.

13. the S sequence comprises, consists essentially of, or consists of the nucleotide sequence TATTAGATCTGATGGCCGCT (SEQ ID NO: 17); or the GRE comprises, consists essentially of, or consists of the nucleotide sequence AGAACANNTGTTCT (SEQ ID NO: 18), or its reverse or reverse complement, where each N is independently T, C, G, or A; A composition for use according to claim 5.

14. The composition for use according to claim 5, wherein the transduction efficiency of the AAVrh74 particles is at least two-fold higher than that of wild-type AAVrh74 particles.

15. The composition for use of claim 5, wherein the packaging efficiency of the AAVrh74 particles is reduced compared to wild-type AAVrh74 particles.

16. The composition for use according to claim 5, wherein the composition further comprises a pharma- ceutically acceptable carrier.

17. The method of claim 5, wherein treating comprises contacting a cell with the composition.

18. 18. The composition for use according to claim 17, wherein the cell is a mammalian cell.

19. 18. The composition for use according to claim 17, wherein the cell is a muscle cell.

20. 18. The composition for use according to claim 17, wherein the cell is a skeletal muscle cell.

21. 18. The composition for use according to claim 17, wherein the cell is a gastrocnemius muscle cell or a tibialis anterior muscle cell.

22. The composition for use according to claim 5 , wherein the nucleic acid vector comprises a regulatory element.

23. 23. The composition for use according to claim 22, wherein the regulatory element comprises a promoter, enhancer, silencer, insulator, response element, initiation site, termination signal, or ribosome binding site.

24. 24. The composition for use according to claim 23, wherein the promoter is a constitutive promoter.

25. 24. The composition for use according to claim 23, wherein the promoter is an inducible promoter.

26. 24. The composition for use according to claim 23, wherein the promoter is a tissue-specific promoter, a cell type-specific promoter, or a synthetic promoter.

27. The composition for use according to claim 5, wherein the nuclear vector comprises a nucleotide sequence of a gene of interest.

28. 28. The composition for use of claim 27, wherein the gene of interest encodes a therapeutic or diagnostic protein.

29. 18. The composition for use according to claim 17, wherein the contacting is effected in vivo.

30. 30. The composition for use according to claim 29, wherein the method of treatment further comprises administering to a subject.

31. 31. The composition for use of claim 30, wherein the cell is in a subject.

32. 31. The composition for use according to claim 30, wherein the subject is a human.

33. 31. The composition for use of claim 30, wherein the subject is at risk of suffering from or suffering from a muscle disease, optionally wherein the muscle disease is amyotrophic lateral sclerosis, Charcot-Marie-Tooth disease, multiple sclerosis, muscular dystrophy, myasthenia gravis, myopathy, myositis, peripheral neuropathy, or spinal muscular atrophy.

34. 34. The composition for use of claim 33, wherein the muscle disease is Duchenne muscular dystrophy, optionally wherein the subject has a mutation in the dystrophin gene.

35. 34. The composition for use according to claim 33, wherein the muscle disease is limb-girdle muscular dystrophy.

36. 34. The composition for use of claim 33, wherein the muscle disease is X-linked myotubular myopathy, optionally wherein the subject has a mutation in the MTM1 gene.

37. 31. The method for use of claim 30, wherein the composition is formulated for administration to a subject by subcutaneous injection, by intramuscular injection, by intravenous injection, by intraperitoneal injection, or orally.

38. 18. The composition for use according to claim 17, wherein the contacting is effected in vitro or ex vivo.

Images