5'-UTR with improved translation efficiency, synthetic nucleic acid molecule containing the same, and vaccine or therapeutic composition containing the same

Abstract

The present invention relates to a synthetic nucleic acid molecule containing a 5'-UTR with improved translation efficiency and a vaccine / therapeutic composition containing the same, more specifically, to a 5'-UTR polynucleotide prepared containing a specific motif and with improved translation efficiency, a synthetic nucleic acid molecule containing the same, and a vaccine / therapeutic composition containing the synthetic nucleic acid molecule. The 5'-UTR polynucleotide according to the present invention has improved translation efficiency and can effectively induce expression of a target protein, and is therefore useful in various RNA-based applications, such as vaccines and in vivo / ex vivo gene therapy agents.

Description

[Technical field]

[0001] The present invention relates to a synthetic nucleic acid molecule comprising a 5'-UTR with improved translation efficiency and a vaccine / therapeutic composition comprising the same, more specifically, to a 5'-UTR polynucleotide prepared containing a specific motif and with improved translation efficiency, a synthetic nucleic acid molecule comprising the same, and a vaccine / therapeutic composition comprising the synthetic nucleic acid molecule. [Background technology]

[0002] Untranslated regions (UTRs) within mRNAs have been reported to play a pivotal role in regulating both mRNA stability and mRNA translation. UTRs have been shown to affect translation initiation, elongation, and termination, as well as mRNA stabilization and subcellular distribution through their interactions with RNA-binding proteins (Jackson RJ, et al., Nat Rev Mol Cell Biol. Vol. 11(2), pp. 113-127, 2010). Depending on the specific motif within the UTR, it can either enhance or decrease mRNA turnover (Barrett LW, et al., Cell Mol Life Sci. Vol. 69(21), pp. 3613-34, 2012). Also, data on mRNA half-life and corresponding UTR sequences have been published ('t Hoen PA, et al., Nucleic Acids Res.Vol. 39(2), pp. 556-566, 2012).

[0003] UTRs are sections of an mRNA molecule that are upstream of the start codon and downstream of the stop codon of the mRNA, i.e., sequences that are not translated. These regions are exons because they are transcribed together with the coding region and therefore present in the mature mRNA. The UTRs that are upstream of the start codon of the mRNA are called 5'UTRs and, once transcribed, possess the so-called Kozak sequence, in particular with sequences that correspond to the (remaining 3') part of the promoter.

[0004] The Kozak consensus sequence, Kozak consensus, or Kozak sequence, is a sequence known to be present in eukaryotic mRNA and has the consensus (gcc)gccRccAUGG. The Kozak consensus sequence plays an important role in the initiation of the translation process. The sequence was named after Marilyn Kozak, who derived its importance. This sequence in the mRNA molecule is recognized by the ribosome at the translation start site, from which the protein is coded by that mRNA molecule. The ribosome requires this sequence, or a possible variant of it, to initiate translation.

[0005] The sequences are identified by the notation (gcc)gccRccAUGG, which summarizes the data analyzed by Kozak from highly diverse sources (about 699 in total) as follows: lower case letters denote the most common base at a position where the base may still vary; upper case letters indicate highly conserved bases, i.e., "AUGG" sequences are invariant or vary rarely, if at all, and "R" indicates that a purine (adenine or guanine) is always observed at this position (Kozak argues that adenine is more frequent); sequences in brackets ((gcc)) are of uncertain significance.

[0006] Although many means and methods have been published for increasing mRNA stability, reducing immunogenic responses caused by mRNA administered to a cell or organism, and increasing expression efficiency (i.e., transcription and / or translation efficiency) (US 10080809, US 2018-0353618, US 2019-0144883), there remains a need for improvements, particularly with regard to additional or alternative means for increasing expression efficiency (i.e., transcription and / or translation efficiency), since expression efficiency is an essential parameter for the anticipated medical application, since it determines, for example, the administration and administration interval of the mRNA drug and ultimately the bioavailability of the final product, i.e., the encoded peptide or protein. At the same time, there remains a need to further reduce the production costs of mRNA drugs, increase the yield of the mRNA molecules generated, and increase the available space within the generated mRNA molecules for the actual transgene, i.e., the coding region encoding the polypeptide of interest.

[0007] On the other hand, genetic vaccines began to be developed after it was reported that when DNA and RNA encoding a target gene are directly injected into an animal, the target gene is expressed in the living animal and this expression can confer immunity (Wolff JA et al. Science, 247:1465-8, 1990).

[0008] Genetic vaccination allows to induce a desired immune response against a selected antigen, such as a characteristic component of the bacterial surface, a virus particle, a tumor antigen, etc. Overall, vaccination is one of the central achievements of modern medicine. However, effective vaccines are currently available only for a limited number of diseases. Thus, infectious diseases that cannot be prevented by vaccination still affect millions of people every year.

[0009] In gene therapy or gene vaccination, DNA and RNA can be used as nucleic acid molecules for gene administration, and it is known that DNA is relatively stable and easy to handle compared to RNA. However, in the case of DNA, potential risks may occur if the administered DNA fragment is inserted into the patient's genome at an undesired position, damaging the gene. In addition, undesired anti-DNA antibodies may appear, and another problem is that the expression level of peptides or proteins expressed by DNA administration and subsequent transcription / translation is limited. The presence or absence of certain transcription factors that regulate DNA transcription has a major impact on the expression level of the administered DNA, and in the absence of certain transcription factors, sufficient amounts of RNA are not produced by DNA transcription, and as a result, the level of peptides or proteins produced by translation is also limited.

[0010] On the other hand, when using RNA as a tool for gene administration, RNA does not require transcription, does not need to enter the nucleus like DNA, and can directly synthesize proteins in the cytoplasm, so there is no risk of it entering cell chromosomes and causing undesired genetic damage. In addition, it has a shorter half-life than DNA and does not induce long-term genetic modification (Sayour EJ, et al., J Immunother Cancer Vol. 3, 13, 2015). A typical RNA vaccine is activated only for a short period of time when delivered into a cell, expressing the target protein, and is destroyed by an enzymatic reaction within a few days, while a specific immune response to the expressed target antigen (protein) remains.

[0011] In addition, when RNA is used as a tool for gene administration, it does not need to pass through the nuclear membrane, but only through the cell membrane, so that even if a smaller amount is used than DNA, the same amount of target protein can be expressed as with DNA. In addition, since RNA itself has immunogenicity, the same immune effect can be obtained even if only a small amount is administered compared to DNA. By using RNA instead of DNA for gene vaccination, the risk of undesired genome integration and the generation of anti-DNA antibodies is minimized or prevented. However, RNA is considered to be a very unstable molecular species that can be easily degraded by ubiquitous RNase.

[0012] Although many developments have been made in the past few years as an efficient method for mRNA vaccination that can induce adaptive immune responses, at this time, inefficient translation of mRNA due to early degradation of antigens or inefficient release of mRNA in cells still remains in the field. Furthermore, there is a dire need to reduce the dose of mRNA vaccines to alleviate potential safety concerns and to make the vaccine available in the third world.

[0013] There are many problems with the delivery of nucleic acids to produce a desired response in biological systems. Nucleic acid-based therapeutics, such as vaccines, hold great promise, but to realize this potential, there remains a need to more effectively deliver nucleic acids to the appropriate site within a cell or organism.

[0014] However, the use of nucleic acids for therapeutic and prophylactic purposes currently faces two problems. First, free RNA is vulnerable to nuclease digestion in plasma. Second, free RNA has limited ability to access intracellular compartments where the relevant translation machinery resides. Lipid nanoparticles formed from cationic lipids with other lipid components such as neutral lipids, cholesterol, PEG, pegylated lipids and oligonucleotides have been attempted to block RNA degradation in plasma and promote cellular uptake of nucleic acids.

[0015] Therefore, the present inventors have made extensive efforts to solve the above problems and develop a 5'-UTR with improved translation efficiency. As a result, they have confirmed that a 5'-UTR with improved translation efficiency can be obtained by selecting an artificial nucleic acid molecule that does not generate secondary structures by combining 30 bp long artificial nucleic acid molecules, has a small amount of uridine, and does not contain sequences that reduce stability, thereby completing the present invention. Summary of the Invention [Problem to be solved by the invention]

[0016] An object of the present invention is to provide a 5'-UTR polynucleotide having improved translation efficiency. Another object of the present invention is to provide a synthetic nucleic acid molecule comprising a 5'-UTR polynucleotide having improved translation efficiency. It is yet another object of the present invention to provide a vaccine composition comprising the synthetic nucleic acid molecule. [Means for solving the problem]

[0017] In order to achieve the above object, the present invention provides an isolated 5'-UTR (untranslated region) polynucleotide having a base sequence represented by a nucleic acid sequence of formula (I): [C1] AG[N 22 ]GCCACC.

[0018] The present invention also provides an isolated 5'-UTR (untranslated region) polynucleotide consisting of a nucleic acid sequence represented by the chemical formula (II): [Case 2] AGGA[N 19 ]RGCCACC Here, R means A or G.

[0019] The present invention also relates to a method for the preparation of a nucleic acid sequence comprising the steps of: The present invention provides a synthetic nucleic acid molecule comprising: a) a 5'-CAP structure; b) the 5'-UTR polynucleotide; c) one or more coding regions; d) a 3'-untranslated region (3'-UTR); and e) 10 to 1000 poly(A) tail or poly(A) tail-like sequences. The present invention also provides a vaccine composition comprising the synthetic nucleic acid molecule. The present invention also provides a use of the vaccine composition for preventing a disease. The present invention also provides a method for preventing a disease, comprising the step of administering the vaccine composition. The present invention also provides the use of said vaccine composition for the manufacture of a medicament for the prevention of a disease. [Brief description of the drawings]

[0020] [Figure 1] FIG. 2 is a schematic diagram illustrating a process of selecting 5′-UTR candidates according to one embodiment of the present invention. [Diagram 2] 1 shows a vector map of a vector prepared for confirming the performance of in vitro transcription synthesis of mRNA containing the 5'-UTR selected in one embodiment of the present invention. [Diagram 3] FIG. 2 is a diagram illustrating the structure of an mRNA containing a 5′-UTR selected in one embodiment of the present invention. [Figure 4] (A) and (B) show the results of confirming the expression efficiency of mRNA containing the 5'-UTR selected in one embodiment of the present invention in a HEK293T cell line, and (C) and (D) show the results of confirming the expression efficiency in a HeLa cell line. [Diagram 5] (A) and (B) show the results of confirming the expression efficiency of mRNA containing the 5'-UTR selected in one embodiment of the present invention in a Huh7 cell line, and (C) and (D) show the results of confirming the expression efficiency in a SNU423 cell line. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0021] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one skilled in the art to which this invention belongs. Generally, the nomenclature used herein and the laboratory procedures described below are those well known and commonly used in the art.

[0022] In the present invention, we aimed to confirm that 5'-UTRs with improved translation efficiency, when selected from all combinations according to a certain logic rather than extracted from genes existing in nature, have superior performance to 5'-UTRs existing in nature.

[0023] That is, in one embodiment of the present invention, the translation efficiency of the selected 5'-UTR polynucleotide was improved by carrying out the steps of removing combinations that may have secondary structures from 30 polynucleotide combinations as shown in Figure 1; selecting sequences for improving capping efficiency; removing UUU and UUUU motifs; removing 15% or more uridines; and removing sequences with low stability (Figure 1). Thus, in one aspect, the present invention provides a method for producing a method for manufacturing a semiconductor device comprising the steps of: The present invention relates to an isolated 5'-UTR (untranslated region) polynucleotide having a base sequence represented by the nucleic acid sequence of formula (I): [C1] AG[N 22 ]GCCACC

[0024] In another aspect, the present invention provides a method for producing a method for manufacturing a semiconductor device comprising the steps of: The present invention relates to an isolated 5'-UTR (untranslated region) polynucleotide having a base sequence represented by the nucleic acid sequence of formula (II): [Case 2] AGGA[N 19 ]RGCCACC Here, R means A or G. In the present invention, the 5′-UTR can be characterized as being any one of the base sequences shown in SEQ ID NOs: 1 to 33. [Table 1]

[0025] In the present invention, the term "UTR" refers to an "untranslated region" located upstream (5') and / or downstream (3') of a coding region of a nucleic acid molecule described herein, and thus typically flanks said coding region. Thus, the term "UTR" generally includes 3'-untranslated regions ("3'-UTRs") and 5'-untranslated regions ("5'-UTRs"). UTRs typically include or can consist of nucleic acid sequences that are not translated into protein. UTRs usually include "regulatory elements".

[0026] The term "regulatory element" refers to a nucleic acid sequence having gene regulatory activity, the ability to affect the expression, particularly the transcription or translation, of a transcribable nucleic acid sequence to which it is operably (in cis or trans). The term includes promoters, enhancers, internal ribosome entry sites (IRES), introns, leaders, transcription termination signals, such as polyadenylation signals and poly-U sequences, and other expression control elements. Regulatory elements can act constitutively or in a time- and / or cell-specific manner. Alternatively, regulatory elements can exert their function through the interaction (e.g., recruitment and binding) of regulatory proteins that can modulate (induce, enhance, decrease, abrogate, or prevent) the expression, particularly the transcription, of a gene.

[0027] A UTR is preferably "operably linked" to a coding region, i.e., placed in a functional relationship, in a manner that controls (i.e., mediates or regulates, preferably enhances) the expression of the coding sequence.

[0028] In the present invention, the term "5'-UTR" refers to a portion of a nucleic acid molecule that is located 5' (i.e., "upstream") of an open reading frame and that is not translated into protein. In the context of the present invention, the 5'-UTR begins at the transcription start site and ends one nucleotide before the start codon of the open reading frame.

[0029] The 5'-UTR may contain elements that regulate gene expression, so-called "regulatory elements". Such regulatory elements may be, for example, ribosome binding sites. The 5'-UTR may be modified by post-transcriptional modifications, for example by the addition of a 5'-CAP. The 5'-UTR may therefore preferably correspond to the nucleic acid located between the 5'-CAP and the start codon, in particular the sequence of a mature mRNA, and more particularly to the sequence extending from the nucleotide located 3' of the 5'-CAP, preferably the nucleotide located immediately 3' of the 5'-CAP, to the nucleotide located 5' of the start codon (transcription start site) of the protein coding sequence, preferably the nucleotide located immediately 5' of the start codon (transcription start site) of the protein coding sequence.

[0030] The nucleotides located immediately 3' to the 5'-CAP of the mature mRNA usually correspond to the transcription start site. The length of the 5' UTR generally has less than 500, 400, 300, 250 or 200 nucleotides. In some embodiments, the length may range from 10, 20, 30 or 40 nucleotides or more, preferably 10 or 50 nucleotides or less.

[0031] In still another aspect, the present invention provides a method for producing a nucleic acid sequence comprising, in order from 5' to 3', a) 5'-CAP structure; b) the isolated 5'-UTR polynucleotide; c) one or more coding regions; d) the 3'-untranslated region (3'-UTR); and e) 10 to 1000 poly(A) tails or poly(A) tail-like sequences; The present invention relates to a synthetic nucleic acid molecule comprising:

[0032] The 5'-CAP of native mRNA increases the stability of the mRNA upon nuclear export and is bound to mRNA cap-binding protein (CBP) which forms mature circular mRNA species, thus providing mRNA stability at the cellular and translational stages through the association of poly(A)-binding protein with CBP. The cap further assists in the removal of the 5'-proximal intron during mRNA splicing.

[0033] In the present invention, 5'-CAP is typically a modified nucleotide (CAP analogue), in particular a guanine nucleotide added to the 5' end of an mRNA molecule. Preferably, 5'-CAP is added using a 5'-5'-triphosphate bond (also named m7GpppN). Further examples of 5'-CAP structures are glyceryl, inverted deoxy abasic moiety, 4',5' methylene nucleotide, 1-(β-D-erythrofuranosyl) nucleotide, 4'-thio nucleotide, carbocyclic nucleotide, 1,5-anhydrohexitol nucleotide, L-nucleotide, α-nucleotide, modified base nucleotide, threo-pentofuranosyl nucleotide, acyclic 3',4'-seco nucleotide, acyclic 3,4-dihydroxybutyl nucleotide. acyclic 3,5-dihydroxypentyl nucleotide, a 3'-3'-inverted nucleotide moiety, a 3'-3'-inverted abasic moiety, a 3'-2'-inverted nucleotide moiety, a 3'-2'-inverted abasic moiety, 1,4-butanediol phosphate, 3'-phosphoramidate, hexyl phosphate, aminohexyl phosphate, 3'-phosphate, 3'-phosphorothioate, phosphorodithioate, or bridging or non-bridging methylphosphonate moieties. These modified 5'-CAP structures can be used to modify the mRNA sequences of the synthetic nucleic acid molecules of the invention.

[0034] Additional modified 5'-CAP structures that can be used in the present invention are CAP1 (additional methylation of the ribose of the nucleotide adjacent to m7GpppN), CAP2 (additional methylation of the ribose of the second nucleotide downstream of m7GpppN), CAP3 (additional methylation of the ribose of the third nucleotide downstream of m7GpppN), CAP4 (additional methylation of the ribose of the fourth nucleotide downstream of m7GpppN), ARCA (anti-reverse CAP analog), modified ARCA (e.g., phosphothioate modified ARCA), inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine and 2-azido-guanosine.

[0035] In the present invention, the 5'-CAP structure can be formed by chemical RNA synthesis or in vitro RNA transcription using a cCAP analog (co-transcriptional capping), or the CAP structure can be formed in vitro using a capping enzyme (e.g., a commercially available capping kit).

[0036] In the present invention, a CAP analog refers to a non-polymerizable di-nucleotide that has the CAP function of promoting translation or localization and / or preventing degradation of an RNA molecule when introduced at the 5' end of the RNA molecule. Non-polymerizable means that the CAP analog does not have a 5' triphosphate and is only attached at the 5' end, and therefore cannot be extended in the 3' direction by template-dependent RNA polymerase.

[0037] CAP analogues are m7GpppA, m7GpppA mpG, unmethylated CAP analogs; dimethylated CAP analogs, trimethylated CAP analogs (e.g., m2,2,7GpppA), dimethylated symmetric CAP analogs (e.g., m7Gpppm7A), or anti-retrograde CAP analogs (e.g., ARCA; m7,2'OmeGpppA, m7,2'dGpppA, m7,3'OmeGpppA, m7,3'dGpppA and their tetraphosphate derivatives).

[0038] Additional CAP analogs have been previously described (US 7,074,596, WO2008 / 016473, WO2008 / 157688, WO2009 / 149253, WO2011 / 015347, and WO2013 / 059475).

[0039] In the present invention, the 5'-CAP structure is m7GpppA m The gene may be characterized as being selected from the group consisting of, but not limited to, m7,3'OmeApppG, m7,3'OmeApppG and m7GpppA.

[0040] In the present invention, the coding region may be characterized by encoding one or more proteins selected from the group consisting of antigenic proteins, allergenic proteins, therapeutic proteins, and fragments, variants, or derivatives of the above proteins, but is not limited thereto.

[0041] In the present invention, the antigenic protein may be at least one selected from the group consisting of a tumor antigen, a pathogenic antigen, an autoantigen, an alloantigen, and an allergic antigen, but is not limited thereto.

[0042] In the present invention, the term "tumor antigen" refers to an antigenic (poly-)peptide or protein derived from or associated with a (preferably malignant) tumor or cancer disease. The terms "cancer" and "tumor" as used herein are used interchangeably to refer to a neoplasm characterized by uncontrolled and generally rapid cell growth with a tendency to invade surrounding tissues and metastasize to distant body sites. The terms include benign and malignant neoplasms. Malignant tumors of cancer are usually characterized by anaplasia, invasiveness and metastasis; benign malignant tumors usually do not have these characteristics. The terms "cancer" and "tumor" refer in particular to neoplasms characterized by tumor growth, as well as cancers of the blood and lymphatic system. "Tumor antigens" are usually derived from tumor / cancer cells, preferably from mammalian tumor / cancer cells, and may be located in or on tumor cells, tumors, e.g., systemic or solid tumors, of mammalian, preferably human origin. "Tumor antigens" generally include tumor-specific antigens (TSAs) and tumor-associated antigens (TAAs). TSAs usually result from tumor-specific mutations and are specifically expressed by tumor cells. More commonly, TAAs are generally presented by tumors and "normal" (healthy, non-tumor) cells.

[0043] In the present invention, the tumor antigen may be a tumor-associated protein or nucleic acid sequence, each nucleic acid sequence encoding another peptide or protein; and the at least one nucleic acid sequence may be selected from the group consisting of 5T4, 707-AP, 9D7, AFP, AlbZIP HPG1, alpha-5-beta-1-integrin, alpha-5-beta-6-integrin, alpha-actinin-4 / m, alpha-methylacyl-coenzyme A racemase, AT-4, ARTC1 / m, B7H4, BAGE-1, BCL-2, bcr / abl, beta-catenin / m, BING-4, BRCA1 / m, BRCA2 / m, CA 1 5-3 / CA 27-29, CA 19-9, CA72-4, CA125, calreticulin, CAMEL, CASP-8 / m, cathepsin B, B), cathepsin L, CD19, CD20, CD22, CD25, CDE30, CD33, CD4, CD52, CD55, CD56, CD80, CDC27 / m, CDK4 / m, CDKN2A / m, CEA, CLCA2, CML28, CML66, COA-1 / m, coactosin-like protein, collage XXIII, COX-2, CT-9 / BRD6, Cten, cyclin B1, cyclin D1, cyp-B, CYPB1, DAM-10, DAM-6, DEK-CAN, EFTU D2 / m, EGFR, ELF2 / m, EMMPRIN, EpCam, EphA2, EphA3, ErbB3, ETV6-AML1, EZH2, FGF-5, FN, Frau-1, G250, GAGE-1, GAGE-2, GAGE-3, GAGE-4, G AGE-5, GAGE-6, GAGE7b, GAGE-8, GDEP, GnT-V, gp100, GPC3, GPNMB / m, HAGE, HAST-2, hepsin, Her2 / neu, HERVK-MEL, HLA-A*0201-R1 7I, HLA-A11 / m, HLA-A2 / m, HNE, homeobox NKX3.1, HOM-TES-14 / SCP-1, HOM-TES-85, HPV-E6, HPV-E7, HSP70-2M, HST-2, hTERT, iCE, IGF-1R, IL-13Ra2, IL-2R, IL-5, immature laminin receptor, kallikrein-2, kallikrein-4, i67, KIAA0205, KIAA0205 / m, KK-LC-1, K-Ras / m, LAGE-A1, LDLR-FUT, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAG E-A6, MAGE-A9, MAGE-A10, MAGE-A12, MAGE-B1, MAGE-B2, MAGE-B3, MAGE-B4, MAGE-B5, MAGE-B6, MAGE-B10, MAGE-B16, MAGE-B17, MAGE-C1, MAGE-C2, MAGE-C 3, MAGE-D1, MAGED2, MAGE-D4, MAGE-E1, MAGE-E2, MAGE-F1, MAGE-HI, MAGEL2, mammaglobin A, MART-1 / melan-A, MART-2, MART-2 / m, substrate protein 22, MC1 R, M-CSF, ME 1 / m, mesothelin, MG50 / PXDN, MMP1-1, MN / CA IX-antigen, MRP-3, MUC-1, MUC-2, MUM-1 / m, MUM-2 / m, MUM-3 / m, myosin class I / m, NA88-A, N-acetylglucosaminyltransferase-V, neo-PAP, neo-PAP / m, NFYC / m, NGEP, NMP22, NPM / ALK, N-Ras / m, NSE, NY-ESO-1, NY-ESOB, OA1, OFA-iLRP, OGT, OGT / m, OS-9, OS-9 / m, osteocalcin, osteopontin, pi5, p190minor bcr-abl, p53, p53 / m, PAGE-4, PAI-1, PAI-2, PAP, PART-1, PATE, PDEF, Pim-1-kinase, Pin-1, Pml / PARα, POTE, PRAME, PRDX5 / m, prostein, proteinase-3, PSA, PSCA, PSGR, PSM, PSMA, PTPRK / m, RAGE-1, RBAF600 / m, RHAMM / CD1 68, RU1, RU2, S-100, SAGE, SART-1, SART-2, SART-3, SCC, SIRT2 / m, Sp1 7, SSX-1, SSX-2 / HOM-MEL-40, SSX-4, STAMP-1, STEAP-1, survivin, survivin-2B, SYT-SSX-1, SYT-SSX-2, TA-90, TAG-72, TARP, TEL-AML1, TGF-β, TGF-β RII, TGM-4, TPI / m, TRAG-3, TRG, TRP-1, TRP-2 / 6b, TRP / INT2, TRP-p8, tyrosinase, UPA, VEGFR1, VEGFR-2 / FLK-1, WT1 and the immunoglobulin genotype of lymphoid blood cells, or the T cell receptor genotype of lymphoid blood cells, or a homologue, fragment, variant or derivative of said tumor antigen.

[0044] In the present invention, the tumor antigen may be characterized as being selected from the group consisting of NYESO-1, HER-2 / neu, MAGE-1, tyrosinase, MUC1, CEA, Mam-A, hTERT, Syalyl-Tn, WT1, alpha-fetoprotein, CA-125, gp-100, p53, Ras, Src, EGFRvIII, PSMA, GD2, Bcr-abl, survivin, PSA, EphA2, PAP, AFP, EpCAM, ALK, mesothelin, PSCA, MART-1, Melan-A, SCP-1, SPAG9, AKAP4 and OY-TES-1, but is not limited thereto. In the present invention, the pathogenic antigen may be characterized as being selected from the group consisting of bacterial, viral, fungal and protozoan antigens.

[0045] In the present invention, the pathogenic antigen may be derived from influenza virus, respiratory syncytial virus (RSV), coronavirus, herpes simplex virus (HSV), human papillomavirus (HPV), human immunodeficiency virus (HIV), Plasmodium, Staphylococcus aureus, Dengue virus, Chlamydia trachomatis, cytomegalovirus (CMV), Hepatitis B virus (HBV), Mycobacterium tuberculosis, rabies virus, and yellow fever virus, or any isoforms, homologues, fragments, mutants, or derivatives of these proteins. In the present invention, the viral antigen may be characterized as being a coronavirus, but is not limited thereto.

[0046] In the present invention, the coronavirus may be human coronavirus 229E (HCoV-229E), human coronavirus OC43 (HCoV-OC43), severe acute respiratory syndrome coronavirus (SARS-CoV), human coronavirus NL63 (HCoV-NL63), New Haven coronavirus, human coronavirus HKU1, Middle East respiratory syndrome coronavirus (MERS-CoV) or severe acute respiratory syndrome coronavirus 2 (SARS-Cov-2).

[0047] In the present invention, the 3'-UTR may be characterized as being selected from the group consisting of β-globin 3'UTR; CYBA 3'UTR; albumin 3'UTR; growth hormone (GH) 3'UTR; VEEV 3'UTR; Hepatitis B virus (HBV) 3'UTR; α-globin 3'UTR; DEN 3'UTR; PAV barley yellow dwarf virus (BYDV-PAV) 3'UTR; elongation factor 1 α1 (EEF1A1) 3'UTR; manganese superoxide dismutase (MnSOD) 3'UTR; β subunit of mitochondrial H(+)-ATP synthase (β-mRNA) 3'UTR; GLUT1 3'UTR; MEF2A 3'UTR; β-F1-ATPase 3'UTR; functional fragments thereof, and combinations thereof, but are not limited thereto.

[0048] In the present invention, the term "3'-UTR" typically refers to a portion of an mRNA located between the protein coding region (i.e., open reading frame, coding region) and the poly(A) sequence of the mRNA. The 3'-UTR of an mRNA is not translated into an amino acid sequence. The 3'-UTR sequence is generally encoded by a gene that is transcribed into the respective mRNA during the gene expression process. This genomic sequence is first transcribed into a premature mRNA that contains an optional intron. The premature mRNA is then further processed into a mature mRNA during the maturation process. Such maturation process includes steps such as 5'-capping, splicing of the premature mRNA to excise the optional intron, and modification of the 3' end such as polyadenylation of the 3' end of the premature mRNA, and selective endo- or exonuclease cleavage.

[0049] In the present invention, a 3'-UTR corresponds to a sequence of a mature mRNA that is located 3' to, preferably immediately 3' to, the stop codon of the protein coding region and extends 5' to, preferably immediately 5' to, the poly(A) sequence to the nucleotide. The term "corresponding" means that the 3'-UTR sequence can be an RNA sequence, such as the mRNA sequence used to define the 3'-UTR sequence, or a DNA sequence that corresponds to these RNA sequences.

[0050] In the present invention, the synthetic nucleic acid molecule further comprises a poly(A) tail or a poly(A) tail-like sequence. In further embodiments, the terminal group on the poly-A tail can be incorporated for stabilization. In other embodiments, the poly-A tail comprises a des-3' hydroxyl tail.

[0051] During RNA processing, long chains of adenine nucleotides (poly-A tails) can be added to polynucleotides, e.g., mRNA molecules, to increase stability. Immediately after transcription, the 3' end of the transcript can be cleaved to free the 3' hydroxyl. Poly-A polymerase then adds a chain of adenine nucleotides to the RNA. A process called polyadenylation adds a poly-A tail, which can be, for example, about 80 to about 250 residues long, including about 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, or 250 residues long. A poly-A tail can also be added after the construct has exited the nucleus.

[0052] According to the present invention, the terminal group on the polyA tail can be incorporated for stabilization. The polynucleotides of the present invention can include des-3' hydroxyl tails. They can also include structural moieties or 2'-O methyl modifications as taught by Junjie Li et al. (Current Biology, Vol. 15, 1501-1507, August 23, 2005, the contents of which are incorporated herein by reference in their entirety).

[0053] The unique poly-A tail length provides certain advantages to the polynucleotides of the invention. Generally, the length of the poly-A tail, if present, is greater than 30 nucleotides in length. In other embodiments, the poly-A tail is greater than 35 nucleotides in length (e.g., greater than at least about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 nucleotides in length).

[0054] In some embodiments, the polynucleotide or region thereof is about 30 to about 3,000 nucleotides (e.g., 30 to 50, 30 to 100, 30 to 250, 30 to 500, 30 to 750, 30 to 1,000, 30 to 1,500, 30 to 2,000, 30 to 2,500, 50 to 100, 50 to 250, 50 to 500, 50 to 750, 50 to 1,000, 50 to 1,500, 50 to 2,000, 50 to 2,500, 50 to 3,000, 100 to 500, 100 to 750, 100 to 1,000, 1 00-1,500, 100-2,000, 100-2,500, 100-3,000, 500-750, 500-1,000, 500-1,500, 500-2,000, 500-2,500, 500-3,000, 1,000-1,500, 1,000-2,000, 1,000-2,500, 1,000-3,000, 1,500-2,000, 1,500-2,500, 1,500-3,000, 2,000-2,500, 2,000-3,000, and 2,500-3,000).

[0055] In some embodiments, the poly-A tail is designed for the length of the entire polynucleotide or for the length of a particular region of the polynucleotide, which may be based on the length of the coding region, the length of a particular feature or region, or based on the length of the ultimate product expressed from the polynucleotide.

[0056] In this regard, the poly-A tail may be 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100% longer in length than the polynucleotide or this feature. The poly-A tail may also be designed as a fraction of the polynucleotide to which it belongs. In this regard, the poly-A tail may be 10, 20, 30, 40, 50, 60, 70, 80 or 90% or more of the total length of the construct, a region of the construct or the total length of the construct minus the poly-A tail. Additionally, engineered binding sites and conjugations of the polynucleotide to poly-A binding proteins can improve expression.

[0057] Additionally, multiple separate polynucleotides can be linked together via their 3'-ends via PABP (poly-A binding protein) using nucleotides modified at the 3'-end of the poly-A tail. Transfection experiments can be performed in appropriate cell lines and protein production can be assayed by ELISA at 12 hours, 24 hours, 48 ​​hours, 72 hours and 7 days post-transfection.

[0058] In some embodiments, the polynucleotide of the present invention is designed to include a poly-AG quartet region. G-quartet is a cyclic hydrogen bonded sequence of four guanine nucleotides that can be formed by G-rich sequences in both DNA and RNA. In this experiment, G-quartet is incorporated into the end of poly-A tail. The resulting polynucleotide is assayed for stability, protein production and other parameters including half-life at various time points. It has been found that poly-AG quartet results in protein production from mRNA at least 75% equivalent to that seen with a poly-A tail of 120 nucleotides alone.

[0059] In the present invention, the poly(A) tail-like sequence may be any nucleic acid sequence capable of functioning as a poly(A) tail, and may be characterized in that one or more nucleotides other than adenine selected from the group consisting of uracil (U), cytosine (C) and guanine (G) are inserted between multiple adenines or at the end of the poly(A) tail, but is not limited thereto. In the present invention, the synthetic nucleic acid molecule can be characterized as being RNA.

[0060] In the present invention, the RNA may be characterized as being selected from the group consisting of mRNA, viral RNA, self-replicating RNA and replicon RNA, but is not limited thereto.

[0061] In the present invention, the synthetic nucleic acid molecule may be characterized as comprising one or more backbone-, sugar- or base-modified nucleic acids, but is not limited thereto.

[0062] Sugar modification: Modified nucleosides and nucleotides that can be incorporated into modified mRNA compounds containing mRNA sequences as described herein can be modified at the sugar moiety. For example, the 2' hydroxyl group (OH) can be modified or replaced with a number of different "oxy" or "deoxy" substituents. Examples of "oxy"-2' hydroxyl group modifications include alkoxy or aryloxy (-OR, e.g., R = H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar); polyethylene glycol (PEG), -O(CH 2 CH 2 O)nCH 2 CH 2 OR; "locked" nucleic acids (LNA) in which the 2' hydroxyl is linked, e.g., by a methylene bridge, to the 4' carbon of the same ribose sugar; and amino groups (-O-amino, where the amino group, e.g., NRR, can be alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, polyamino) or aminoalkoxy.

[0063] The "deoxy" modification includes hydrogen, amino (e.g., NH; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); the amino group can be attached to the sugar via a linker, where the linker includes one or more of the atoms C, N, and O.

[0064] The sugar group can also contain one or more carbons that have the opposite stereochemical configuration compared to the corresponding carbon in ribose. Thus, modified mRNA can include nucleotides that contain, for example, arabinose as the sugar.

[0065] Backbone Modifications: The phosphate backbone can be further modified with modified nucleosides and nucleotides, which can be incorporated into modified mRNA compounds containing mRNA sequences as described herein. The phosphate group of the backbone can be modified by replacing one or more of the oxygen atoms with other substituents. Modified nucleosides and nucleotides can also include complete replacement of unmodified phosphate moieties with modified phosphates as described herein. Examples of modified phosphate groups include, but are not limited to, phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, alkyl or aryl phosphonates, and phosphotriesters. Phosphorodithioates have both non-linked oxygens replaced by sulfur.

[0066] The phosphate linkers can also be modified by substitution of the linking oxygen to nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene-phosphonates).

[0067] Base Modifications: The modified nucleosides and nucleotides that can be incorporated into the modified mRNA compound containing the mRNA sequence as described herein can be further modified with a nucleobase moiety. Examples of nucleobases found in mRNA include, but are not limited to, adenine, guanine, cytosine, and uracil. For example, the nucleosides and nucleotides described herein can be chemically modified at the major groove face. In some embodiments, the chemical modification of the major groove can include an amino group, a thiol group, an alkyl group, or a halo group.

[0068] In a preferred embodiment of the invention, the nucleotide analogues / modifications are preferably 2-amino-6-chloropurine riboside-5'-triphosphate, 2-aminopurine-riboside-5'-triphosphate; 2-aminoadenosine-5'-triphosphate, 2'-amino-2'-deoxycytidine-triphosphate, 2-thiocytidine-5'-triphosphate, 2-thiouridine-5'-triphosphate, 2'-fluorothymidine-5'-triphosphate, 2'-O-methyl-inosine-5'-triphosphate, 4-thiouridine- 5'-triphosphate, 5-aminoallylcytidine-5'-triphosphate, 5-aminoallyluridine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, 5-bromouridine-5'-triphosphate, 5-bromo-2'-deoxycytidine-5'-triphosphate, 5-bromo-2'-deoxyuridine-5'-triphosphate, 5-iodocytidine-5'-triphosphate, 5-iodo-2'-deoxycytidine-5'-triphosphate, 5-iodouridine-5'-triphosphate, 5-iodo-2'-deoxycytidine-5'-triphosphate, '-Deoxyuridine-5'-triphosphate, 5-methylcytidine-5'-triphosphate, 5-methyluridine-5'-triphosphate, 5-propynyl-2'-deoxycytidine-5'-triphosphate, 5-propynyl-2'-deoxyuridine-5'-triphosphate, 6-azacytidine-5'-triphosphate, 6-azauridine-5'-triphosphate, 6-chloropurine riboside-5'-triphosphate, 7-deazaadenosine-5'-triphosphate, 7-deazaguanosine-5'-triphosphate, 8- The base modification is selected from azaadenosine-5'-triphosphate, 8-azidoadenosine-5'-triphosphate, benzimidazole-riboside-5'-triphosphate, N1-methyladenosine-5'-triphosphate, N1-methylguanosine-5'-triphosphate, N6-methyladenosine-5'-triphosphate, O6-methylguanosine-5'-triphosphate, pseudouridine-5'-triphosphate, or puromycin-5'-triphosphate, xanthosine-5'-triphosphate.

[0069] Preferably, the nucleotide for the base modification is selected from the group of base-modified nucleotides consisting of 5-methylcytidine-5'-triphosphate, 7-deazaguanosine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, and pseudouridine-5'-triphosphate.

[0070] In some embodiments, the modified nucleoside is a pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, pseudouridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 2'-O-methyl-uridine, 5-methyl-uridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyluridine, 2-thio-uridine, 5-methoxy-uridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl-4 ... Includes lysine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, and 4-methoxy-2-thio-pseudouridine.

[0071] In some embodiments, the modified nucleoside is 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, 5-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-cytidine, 5-methyl-cytidine, 5-hydroxy ... These include 1-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, and 4-methoxy-1-methyl-pseudoisocytidine.

[0072] In other embodiments, the modified nucleoside is 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentyladenosine, Examples of adenosine include adenine, N6-(cis-hydroxyisopentyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, and 2-methoxy-adenine.

[0073] In other embodiments, modified nucleosides include inosine, 1-methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio-guanosine.

[0074] In some embodiments, the nucleotide can be modified at the major groove face and can include a substitution of hydrogen at C-5 of uracil with a methyl or halo group. In certain embodiments, the modified nucleoside is 5'-O-(1-thiophosphate)-adenosine, 5'-O-(1-thiophosphate)-cytidine, 5'-O-(1-thiophosphate)-guanosine, 5'-O-(1-thiophosphate)-uridine, or 5'-O-(1-thiophosphate)-pseudouridine.

[0075] In further embodiments, the modified mRNA is selected from the group consisting of 6-aza-cytidine, 2-thio-cytidine, α-thio-cytidine, pseudo-iso-cytidine, 5-aminoallyl-uridine, 5-iodo-uridine, N1-methyl-pseudouridine, 5,6-dihydrouridine, α-thio-uridine, 4-thio-uridine, 6-aza-uridine, 5-hydroxy-uridine, deoxy-thymidine, 5-methyl-uridine, pyrrolo-cytidine, inosine, Nucleoside modifications may be selected from α-thio-guanosine, 6-methyl-guanosine, 5-methyl-cytidine, 8-oxo-guanosine, 7-deaza-guanosine, N1-methyl-adenosine, 2-amino-6-chloro-purine, N6-methyl-2-amino-purine, pseudo-iso-cytidine, 6-chloro-purine, N6-methyl-adenosine, α-thio-adenosine, 8-azido-adenosine, 7-deaza-adenosine. In yet another aspect, the present invention relates to a vaccine composition comprising a synthetic nucleic acid molecule.

[0076] In the present invention, a "vaccine" is typically understood to be a prophylactic or therapeutic substance that provides at least one antigen, preferably an antigenic peptide or protein. "Providing at least an antigen" means, for example, that the vaccine comprises the antigen or that the vaccine comprises, for example, a molecule encoding an antigen. Thus, it is particularly envisaged that the vaccine of the present invention comprises at least one synthetic nucleic acid (RNA) molecule encoding at least one antigenic (poly-)peptide or protein as defined herein, which may be derived, for example, from a tumor antigen, a bacterial, viral, fungal or protozoan antigen, an autoantigen, an allergen or an alloantigen, and which, when expressed and presented to the immune system, preferably induces an immune response against the respective antigen. However, synthetic nucleic acid (RNA) molecules encoding non-antigenic (poly-)peptides or proteins of interest can also be used in the vaccine of the present invention. In the present invention, the synthetic nucleic acid molecule may be characterized as being complexed with one or more lipids to form lipid nanoparticles or liposomes.

[0077] In the present invention, the synthetic nucleic acid (RNA) molecule can be provided in a complexed form, i.e. complexed or associated with one or more (poly-)cationic compounds, preferably (poly-)cationic polymers, (poly-)cationic peptides or proteins, such as protamine, (poly-)cationic polysaccharides and / or (poly-)cationic lipids. In this context, the term "complexed" or "associated" refers to an essentially stable combination of at least one synthetic nucleic acid (RNA) molecule as a larger complex or assembly, without being covalently bound to said one or more compounds.

[0078] Lipids According to preferred embodiments, the synthetic nucleic acid (RNA) molecules of the present invention are complexed or associated with lipids, particularly cationic and / or neutral lipids, to form one or more lipid nanoparticles or liposomes. Thus, in some embodiments, the synthetic nucleic acid (RNA) molecules of the present invention can be provided in the form of lipid-based dosage forms, particularly liposomes and / or lipid nanoparticles comprising said synthetic nucleic acid (RNA) molecules.

[0079] Lipid Nanoparticles According to some preferred embodiments, the synthetic nucleic acid (RNA) molecules of the present invention are complexed or associated with lipids (particularly cationic and / or neutral lipids) to form one or more lipid nanoparticles.

[0080] Preferably, the lipid nanoparticles (LNPs) can comprise: (a) at least one synthetic nucleic acid molecule (RNA) of the invention; (b) a cationic lipid; (c) an aggregation reducing agent (e.g., a polyethylene glycol (PEG) lipid or a PEG-modified lipid); (d) optionally, a non-cationic lipid (e.g., a neutral lipid); and (e) optionally, a sterol.

[0081] In some embodiments, the LNPs can comprise, in addition to at least one synthetic nucleic acid molecule (RNA) of the invention, (i) at least one cationic lipid; (ii) a neutral lipid; (iii) a sterol, e.g., cholesterol; and a PEG-lipid in a molar ratio of about 20-60% cationic lipid: 5-25% neutral lipid: 25-55% sterol; and 0.5-15% PEG-lipid.

[0082] In some embodiments, the synthetic nucleic acid molecules (RNA) of the present invention can be formulated into aminoalcohol lipidoids. The aminoalcohol lipidoids that can be used in the present invention can be prepared by the methods described in U.S. Patent No. 8,450,298, the entire contents of which are incorporated herein by reference.

[0083] Liposomes In some embodiments, the synthetic nucleic acid (RNA) molecules of the present invention are formulated into liposomes. Cationic lipid-based liposomes can form complexes with negatively charged nucleic acids (e.g., RNA) through electrostatic interactions, producing complexes that offer biocompatibility, low toxicity, and the potential for large-scale production required for in vivo clinical applications. Liposomes can fuse with plasma membranes for absorption; first, within the cell, liposomes are processed through the phagocytic pathway, and the nucleic acid is subsequently released from the endosome / carrier into the cytoplasm. Liposomes have long been recognized as drug delivery vehicles due to their excellent biocompatibility, in that they are essentially analogs of biological membranes and can be manufactured from both natural and synthetic phospholipids.

[0084] Liposomes are typically composed of a lipid bilayer that may consist of cationic, anionic or neutral (phospho) lipids and cholesterol surrounding an aqueous core. The lipid bilayer and the aqueous space may all contain hydrophobic or hydrophilic compounds, respectively. Liposomes may have one or more lipid membranes. Liposomes may be single-layered, called unilamellar, or multi-layered, called multilamellar.

[0085] In vivo, the properties and behavior of liposomes can be modified by adding hydrophilic polymer coatings, such as polyethylene glycol (PEG), to the liposome surface to provide steric stability, and liposomes can be used for specific targeting by attaching ligands (e.g., antibodies, peptides, and carbohydrates) to their surface or to the termini of attached PEG chains.

[0086] Liposomes typically exist as spherical vesicles, and sizes can range from 20 nm to several microns. Liposomes can be of different sizes, including but not limited to, multilamellar vesicles (MLVs), which can be hundreds of nanometers in diameter and contain a series of concentric bilayers separated by narrow aqueous compartments, small unicellular vesicles (SUVs), which are smaller than 50 nm in diameter, and large unilamellar vesicles (LUVs), which can be between 50 and 500 nm in diameter. Liposome designs can include, but are not limited to, opsonins or ligands to improve attachment of liposomes to unhealthy tissues or to activate events such as endocytosis. Liposomes can include low or high pH to improve delivery of pharmaceutical dosage forms. In accordance with the present invention, the vaccine composition may be characterized in that it further comprises one or more adjuvants or active agents.

[0087] An "adjuvant" or "adjuvant component" in the broadest sense is typically a pharmacological and / or immunological preparation capable of modifying, e.g. enhancing, the effect of another active agent, e.g. a therapeutic agent or a vaccine. In this context, an "adjuvant" can be understood as any compound suitable for assisting the administration and delivery of the vaccine composition of the invention. In particular, an adjuvant can preferably improve the immunostimulatory properties of the vaccine to which it is added. Also, such adjuvants can initiate or increase the immune response of the innate immune system, i.e., the non-specific immune response, without being bound thereto.

[0088] An "adjuvant" typically does not induce an adaptive immune response. So far, an "adjuvant" does not qualify as an antigen. That is, when administered, the vaccine of the present invention typically initiates an adaptive immune response by virtue of an antigenic peptide or protein that is encoded by at least one coding sequence of a synthetic nucleic acid (RNA) molecule contained in the vaccine.

[0089] Suitable adjuvants are known to those skilled in the art and can be selected from any adjuvant that is suitable in this case, i.e. that helps to induce an immune response in a mammal, and include, for example, TDM, MDP, muramyl dipeptide, Pluronic®, vitiligo solution, aluminum hydroxide, ADJUMER®, and the like. TM (polyphosphazene); aluminum phosphate gel; glucan from algae; algamulin; aluminum hydroxide gel (white spot); high protein-adsorbing aluminum hydroxide gel; low viscosity aluminum hydroxide gel; AF or SPT (emulsion of squalane (5%), Tween 80 (0.2%), Pluronic® L121 (1.25%), phosphate-buffered saline, pH 7.4); or AVRIDINE TM (propanediamine). In still another aspect, the present invention relates to use of the vaccine composition for disease prevention.

[0090] In the present invention, "disease" refers to an abnormal phenomenon arising from a tumor antigen, a bacterial, viral, fungal or protozoan antigen, an autoantigen, an allergen, or an alloantigen, and may be, but is not limited to, a cancer, a tumor, an autoimmune disease, an inflammatory disease, a viral infection, a bacterial infection, a fungal infection, and a protozoan infection. In the present invention, "prevention" refers to any action of suppressing a disease or slowing its progression by administration of the vaccine composition of the present invention. In still another aspect, the present invention relates to a method for preventing a disease, which comprises the step of administering the vaccine composition. In yet another aspect, the present invention relates to the use of said vaccine composition for the manufacture of a medicament for the prevention of a disease. EXAMPLES

[0091] The present invention will be described in more detail with reference to the following examples. It will be obvious to those skilled in the art that these examples are merely for the purpose of illustrating the present invention and are not intended to limit the scope of the present invention.

[0092] Example 1. Selection of 5'-UTR After constructing all possible combinations of 30 bp 5'-UTR polynucleotides, sequences with an average free energy of 0 that do not form specific structures such as secondary structures were selected. Sequences beginning with an AGG sequence were selected to improve capping and transcription. AUG-like sequences were further removed from some sequences. As immune sensing of TLR7 / 8 by uridine-rich elements reduces protein translation efficiency, sequences containing UUU and UUUU motifs were removed. Uridine depletion was then performed to remove 15% of the uridine from the entire sequence to increase protein translation efficiency. 5'-UTRs with CGC sequences were removed to improve mRNA stability, resulting in the selection of a total of 33 5'-UTR sequences (Figure 1).

[0093] Example 2. Preparation of 5'-UTR-containing mRNA synthetic nucleic acid 2-1. Linearization for template DNA production Linearize the plasmid using a restriction enzyme that cuts the portion after the polyA site. Isolate the linearized DNA using AMICON. Thereafter, whether the plasmid DNA was digested or not was confirmed on a 1% agarose gel.

[0094] 2-2. In vitro transcription In vitro transcription is the process of synthesizing mRNA.

[0095] The prepared template DNA was reacted with T7 RNA polymerase, buffer, NTPs (including natural and chemically modified NTPs) and other components required for IVT as shown in Table 2 at 37°C for 4 hours (hr) (HiScribe TM T7 Quick High Yield RNA Synthesis Kit, NEB E2050S, US). [Table 2]

[0096] After the reaction is complete, the DNA is treated with 1U of Dnase I per 1ug of DNA and reacted at 37°C for 15-30 minutes to remove the template DNA. After this, the IVT product with the reaction completed is purified by Invitrogen's MEGAclear TM The purified mRNA was then quantified using a Nanodrop or UV / Vis spectrophotometer and the band pattern was confirmed on an agarose gel.

[0097] 2-3. DsRNA purification Double-stranded RNA (dsRNA) generated during the IVT reaction is removed using cellulose. Cellulose Prewash: A benchtop-scale cellulose column is prepared by dissolving 0.2 g of cellulose per 1 ml of buffer A in a 50 ml tube. The compositions of buffers A and B are shown in Table 3 below. [Table 3]

[0098] IVT mRNA Loading: The IVT mRNA dissolved in 500 μl of buffer A is applied to the column prepared above. The mixture is reacted at room temperature for 30 minutes using a rotator so that the cellulose and dsRNA are bound to each other. Centrifuge at 14,000 g for 1 min and collect the flow-through and transfer to a new column. After reacting again at room temperature for 30 minutes, the mixture is centrifuged under the same conditions and the flow-through is collected. mRNA precipitation: The collected solution is subjected to isopropanol precipitation to collect a pellet, which is then dissolved in nuclease-free water.

[0099] Example 3. Confirmation of purity of produced mRNA 3-1. IP-RP UPLC To confirm the purity of the mRNA, it is analyzed using a reverse phase chromatography column such as C18 or C8. During analysis, aqueous buffers containing alkylammonium acetate series ion-pairing additives including TEAA (e.g., TBAA, TPAA, DMBAA, HAA, etc.) and ACN-based buffers are used as the mobile phase for chromatography. Organic solvents such as acetonitrile and methanol are used for column washing and storage. Weak washing buffers use buffers with a high water content, while strong washing buffers and seal washing buffers use buffers with an organic solvent content of 10-50%.

[0100] Pump A is connected with an aqueous buffer containing TEAA, and pump B is connected with an ACN-based buffer containing TEAA, and then an initial priming process is performed. The column is connected to the instrument, and the column is run for at least 5 CV under the initial gradient conditions to maintain equilibrium. During equilibration, it is confirmed that the △psi value is stabilized. mRNA is injected, and the organic solvent ratio is increased from the initial stage to reflect the gradient of the analysis. After the analysis is completed, run the column for 10 CV or more using organic solvents such as acetonitrile and methanol for column washing and storage.

[0101] 3-2. Dot blot Dot blotting is performed for the purpose of qualitatively confirming the presence of double strand RNA (dsRNA) as an impurity. As a probe, the J2 antibody is used to bind to these dsRNAs and determine their presence or absence. The IVT mRNA to be analyzed is dropped onto a positively charged nylon membrane (Merck / 11417240001) in a volume of 2 μL at a concentration of 100 to 200 ng / μL, and the membrane is allowed to dry completely at room temperature for at least 1 hour. Using a UV crosslinker, 1250uJ / CM 2 After crosslinking the sample to the membrane under one cycle condition, the membrane was reacted with 4% skim milk (in 1X TBST) blocking solution on a shaker at room temperature for 1 hour. The primary antibody for J2 is diluted 1:5000 in blocking solution and incubated overnight at 4°C on a shaker.

[0102] Then, wash with 1X TBST solution for 10 minutes three times on a shaker at room temperature, and then dilute horseradish peroxidase (HRP)-conjugated goat anti-mouse (IgG) secondary antibody 1:5000 in blocking solution and react on a shaker at room temperature for 1 hour. Thereafter, the plate was washed three times with 1× TBST solution for 10 minutes each on a shaker at room temperature. The membrane was wetted with a 1:1 (v / v) mixture of ECL reagent 1 and 2 solutions, exposed for 10 seconds, and the bands were visualized using a Chemi Doc instrument.

[0103] Example 4. Confirmation of translation efficiency of produced mRNA The translation efficiency of the produced mRNA is evaluated by luciferase activity. Human embryonic kidney cell line (HEK293T, ATCC CRL-3216) and human cervix epitherlial cell (Hela, CCL2) cells were cultured in DMEM / Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin. Huh7 (human liver cancer cell line, Korea Cell Line Bank, 60104) and SNU423 (human liver cancer cell line, Korea Cell Line Bank, 00423) cells were cultured in RPMI-1640 (Gibco) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin. 250 ng of mRNA is transfected into 12-well plates using Lipofectamine 3000 (Invitrogen, Carlsbad, Calif.).

[0104] The control group was 1. Human alpha globin A (sequence modified from WO2020 / 198337): AGTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACC (SEQ ID NO: 34) 2. Cytochrome b-245α chain CYBA (WO2020 / 198337): AGTGCGCGCCTAGCAGTGTCCCAGCCGGGTTCGTGTCGCC (SEQ ID NO: 35) 3. Ref UTR no.1(US2020 / 0208145): AGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACC (SEQ ID NO: 36) 4. Ref UTR no.2(US2020 / 0208145): GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGACCCCGGCGCCGCCACC (SEQ ID NO: 37) etc. were used.

[0105] Add 20 μL of Bright-glo luciferase assay reagent to the transfected 96-well plate, incubate at room temperature for 10 minutes, and then shake the 96-well plate for 1 minute. The luciferase activity of the prepared plate is measured after setting the GloMax Navigator luminometer to an integration time of 0.3 s.

[0106] Dispense 20 μL of stop glo luciferase assay reagent from the Dual-glo kit into the plate to be measured, then leave the plate at room temperature for 10 minutes and shake for 1 minute. Luciferase activity is measured using a GloMax Navigator Luminometer.

[0107] As a result, as shown in Figures 4 and 5, it was confirmed that the translation efficiency of the mRNA containing the UTR of the present invention was significantly superior in all cell lines compared to the control group.

[0108] Although the specific parts of the present invention have been described in detail above, it is clear to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents. [Industrial Applicability]

[0109] The 5'-UTR polynucleotide according to the present invention has improved translation efficiency and can effectively induce expression of a target protein, and is therefore useful in various RNA-based applications, such as vaccines and in vivo / ex vivo gene therapy agents.

Claims

1. An isolated 5'-UTR (untranslated region) polynucleotide comprising a base sequence represented by the nucleic acid sequence of formula (I): [chemical 1] AG[N 22 ]GCCACC.

2. An isolated 5'-UTR (untranslated region) polynucleotide comprising a base sequence represented by the nucleic acid sequence of formula (II): [chemical 2] AGGA[N 19 ]RGCCACC Here, R means A or G.

3. The isolated 5'-UTR polynucleotide according to claim 1 or 2, wherein the 5'-UTR is any one of the base sequences shown in SEQ ID NOs: 1 to 33.

4. In order from 5' to 3', a) 5'-CAP structure; b) a 5'-UTR polynucleotide according to claim 1 or 2; c) one or more coding regions; d) a 3'-untranslated region (3'-UTR); and e) 10 to 1000 poly(A) tails or poly(A) tail-like sequences; A synthetic nucleic acid molecule comprising:

5. The 5'-CAP structure is 7 GpppA m pG,m 7 5. The synthetic nucleic acid molecule according to claim 4, characterized in that it is selected from the group consisting of GpppApG and m7,3'OmeApppG.

6. The synthetic nucleic acid molecule of claim 4, wherein the coding region encodes one or more proteins selected from the group consisting of antigenic proteins, allergenic proteins, therapeutic proteins, and fragments, variants, or derivatives of said proteins.

7. The synthetic nucleic acid molecule according to claim 6, wherein the antigenic protein is at least one selected from the group consisting of a tumor antigen, a pathogenic antigen, an autoantigen, an alloantigen, and an allergic antigen.

8. 8. The synthetic nucleic acid molecule of claim 7, wherein the tumor antigen is selected from the group consisting of NYESO-1, HER-2 / neu, MAGE-1, tyrosinase, MUC1, CEA, Mam-A, hTERT, Syalyl-Tn, WT1, alpha-fetoprotein, CA-125, gp-100, p53, Ras, Src, EGFRvIII, PSMA, GD2, Bcr-abl, survivin, PSA, EphA2, PAP, AFP, EpCAM, ALK, mesothelin, PSCA, MART-1, Melan-A, SCP-1, SPAG9, AKAP4 and OY-TES-1.

9. 8. The synthetic nucleic acid molecule of claim 7, wherein the pathogenic antigen is selected from the group consisting of bacterial, viral, fungal and protozoan antigens.

10. 10. The synthetic nucleic acid molecule according to claim 9, characterized in that the virus is a coronavirus.

11. The synthetic nucleic acid molecule of claim 4, wherein the poly(A) tail-like sequence has one or more nucleotides other than adenine selected from the group consisting of uracil (U), cytosine (C) and guanine (G) inserted between the multiple adenines or at the end of the poly(A) tail.

12. The synthetic nucleic acid molecule according to claim 4, characterized in that the synthetic nucleic acid molecule is RNA.

13. 13. The synthetic nucleic acid molecule according to claim 12, characterized in that the RNA is selected from the group consisting of mRNA, viral RNA, self-replicating RNA and replicon RNA.

14. The synthetic nucleic acid molecule of claim 4, characterized in that the synthetic nucleic acid molecule comprises one or more backbone, sugar or base modified nucleic acids.

15. 5. The synthetic nucleic acid molecule of claim 4, wherein the 3'-UTR is selected from the group consisting of β-globin 3'UTR; CYBA 3'UTR; albumin 3'UTR; growth hormone (GH) 3'UTR; VEEV 3'UTR; Hepatitis B virus (HBV) 3'UTR; α-globin 3'UTR; DEN 3'UTR; PAV barley yellow dwarf virus (BYDV-PAV) 3'UTR; elongation factor 1 alpha 1 (EEF1A1) 3'UTR; manganese superoxide dismutase (MnSOD) 3'UTR; β subunit of mitochondrial H(+)-ATP synthase (β-mRNA) 3'UTR; GLUT1 3'UTR; MEF2A 3'UTR; and β-F1-ATPase 3'UTR.

16. A vaccine composition comprising a synthetic nucleic acid molecule according to any one of claims 4 to 13.

17. 17. The vaccine composition of claim 16, wherein the synthetic nucleic acid molecule is complexed or associated with one or more lipids to form one or more lipid nanoparticles or liposomes.

18. The vaccine composition according to claim 16, characterized in that the vaccine composition further comprises one or more adjuvants or active agents.

Images