O-phosphoserine-producing microorganism and method for producing O-phosphoserine or L-cysteine ​​using the same

Abstract

The present application relates to a microorganism having weakened erythronate-4-phosphate dehydrogenase protein activity; a method for producing O-phosphoserine, cysteine ​​and cysteine ​​derivatives using the same; a composition for producing O-phosphoserine containing the microorganism; and use of the microorganism for producing O-phosphoserine, cysteine ​​and cysteine ​​derivatives.

Description

O-phosphoserine-producing microorganism and method for producing O-phosphoserine or L-cysteine ​​using the same

[0001] The present application relates to a microorganism having weakened erythronate-4-phosphate dehydrogenase protein activity; a method for producing O-phosphoserine, cysteine, and cysteine ​​derivatives using the same; a composition for producing O-phosphoserine comprising the microorganism; and a use of the microorganism for producing O-phosphoserine, cysteine, and cysteine ​​derivatives.

[0002]

[0003] L-cysteine ​​is an important amino acid in sulfur metabolism in all living organisms, and is used in the synthesis of proteins in the body, such as keratin in hair, glutathione, biotin, methionine, and other sulfur-containing metabolites, as well as a precursor for coenzyme A biosynthesis.

[0004] Methods for producing L-cysteine ​​using microorganisms are known, including 1) a method for biologically converting D,L-ATC (D,L-2-aminothiazoline-4-carboxylic acid) using microorganisms, 2) a direct fermentation method for producing L-cysteine ​​using Escherichia coli (European Patent EP0885962B; Wada M and Takagi H, Appl. Microbiol. Biochem., 73:48-54, 2006), and 3) a method for fermenting and producing OPS using microorganisms and then converting it into L-cysteine ​​by reacting it with sulfide under the catalytic action of O-phosphoserine sulfhydrylase (OPSS) (U.S. Patent Publication No. US 8557549 B2).

[0005] At this time, in order to produce high yield cysteine ​​by the above method 3), there is a need to produce an excessive amount of the precursor O-phosphoserine (OPS).

[0006]

[0007] The present inventors have developed a microorganism producing O-phosphoserine with weakened erythronate-4-phosphate dehydrogenase protein activity, a method for producing O-phosphoserine using the microorganism, a method for producing cysteine ​​or a derivative thereof using the microorganism, and a composition for producing O-phosphoserine comprising the microorganism, thereby completing the present application.

[0008]

[0009] One object of the present application is to provide a microorganism producing O-phosphoserine with weakened erythronate-4-phosphate dehydrogenase protein activity.

[0010] Another object of the present application is to provide a method for producing O-phosphoserine, which comprises a step of culturing the microorganism of the present application in a medium.

[0011] Another object of the present application is to provide a method for producing cysteine ​​or a derivative thereof, comprising the steps of: a) culturing the microorganism of the present application in a medium to produce O-phosphoserine or a medium containing the same; and b) contacting O-phosphoserine sulfliydrylase (OPSS) or a microorganism expressing the same, the O-phosphoserine produced in step a) or a medium containing the same, and sulfide.

[0012] Another object of the present application is to provide a composition for producing O-phosphoserine comprising the microorganism of the present application.

[0013] Another object of the present application is to provide a use of the microorganism of the present application for producing O-phosphoserine, cysteine ​​or derivatives of cysteine.

[0014]

[0015] The present application utilizes a microorganism that produces O-phosphoserine with weakened erythronate-4-phosphate dehydrogenase protein activity compared to its intrinsic activity, thereby enabling high-efficiency production of O-phosphoserine. Furthermore, when the O-phosphoserine thus produced is converted into cysteine ​​and its derivatives through an enzymatic reaction, cysteine ​​can be produced more efficiently and environmentally friendly than chemical synthesis methods.

[0016]

[0017] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below.

[0018] Additionally, numerous papers and patents are referenced and cited throughout this specification. The disclosures of these cited papers and patents are incorporated herein by reference in their entirety, thereby providing a clearer understanding of the technical field to which this application pertains and the content of this application.

[0019] One aspect of the present application provides a microorganism producing O-phosphoserine with weakened erythronate-4-phosphate dehydrogenase protein activity.

[0020] In the present application, the term "erythronate-4-phosphate dehydrogenase" refers to an enzyme that oxidizes erythronate-4-phosphate to 3-hydroxy-4-phospho-hydroxy-α-ketobutyrate in the pyridoxine biosynthetic metabolic pathway of microorganisms. In the present application, the erythronate-4-phosphate dehydrogenase may be used interchangeably with "PdxB". Specifically, the erythronate-4-phosphate dehydrogenase is known in the art, and the protein and gene sequences of the erythronate-4-phosphate dehydrogenase can be obtained from known databases, such as, but not limited to, NCBI's GenBank. More specifically, the erythronate-4-phosphate dehydrogenase is described by SEQ ID NO: 1. It may have and / or comprise an amino acid sequence, or consist essentially of or consist of said amino acid sequence.

[0021] In addition, the erythronate-4-phosphate dehydrogenase of the present application may include an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with the amino acid sequence set forth in SEQ ID NO: 1. In addition, it is obvious that an erythronate-4-phosphate dehydrogenase having an amino acid sequence in which a part of the sequence is deleted, modified, substituted, conservatively substituted, or added is also included within the scope of the present application, as long as it has such homology or identity and exhibits an effect corresponding to the erythronate-4-phosphate dehydrogenase of the present application.

[0022] Even if the present application describes a "polypeptide or protein comprising an amino acid sequence described by a specific sequence number," a "polypeptide or protein consisting of an amino acid sequence described by a specific sequence number," or a "polypeptide or protein having an amino acid sequence described by a specific sequence number," it is obvious that a protein having an amino acid sequence in which a portion of the sequence is deleted, modified, substituted, conservatively substituted, or added can also be used in the present application, as long as it has the same or corresponding activity as the polypeptide consisting of the amino acid sequence of the corresponding sequence number. For example, this includes cases in which the protein has an addition of a sequence that does not alter the function of the protein at the N-terminus and / or C-terminus, a mutation that may occur naturally, a silent mutation thereof, or a conservative substitution.

[0023] For example, if the amino acid sequence has sequence additions or deletions, naturally occurring mutations, silent mutations or conservative substitutions that do not alter the function of the erythronate-4-phosphate dehydrogenase of the present application at the N-terminus, C-terminus and / or within the amino acid sequence.

[0024] The term "conservative substitution" in this application refers to the replacement of one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. For example, positively charged (basic) amino acids include arginine, lysine, and histidine; negatively charged (acidic) amino acids include glutamic acid and aspartate; aromatic amino acids include phenylalanine, tryptophan, and tyrosine; and hydrophobic amino acids include alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, and tryptophan. Additionally, amino acids can be classified into those with electrically charged side chains and those with uncharged side chains. Charged side chain amino acids include aspartic acid, glutamic acid, lysine, arginine, and histidine. Uncharged side chain amino acids can be further classified into nonpolar amino acids or polar amino acids. Nonpolar amino acids include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline. Polar amino acids include serine, threonine, cysteine, tyrosine, asparagine, and glutamine. Typically, conservative substitutions have little or no effect on the activity of the resulting polypeptide. Typically, conservative substitutions may have little or no effect on the activity of a protein or polypeptide.

[0025] Additionally, erythronate-4-phosphate dehydrogenase may include deletions or additions of amino acids that have minimal impact on the properties and secondary structure of the polypeptide. For example, the polypeptide may be conjugated to a signal (or leader) sequence at the N-terminus of the protein that is involved in co-translational or post-translational protein transfer. The polypeptide may also be conjugated to other sequences or linkers to enable identification, purification, or synthesis of the polypeptide.

[0026] In this application, the terms "homology" or "identity" refer to the degree of similarity between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms "homology" and "identity" are often used interchangeably.

[0027] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences can generally hybridize with all or part of the sequence under moderate or high stringency conditions. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that take codon degeneracy into account.

[0028] Whether any two polynucleotide or polypeptide sequences are homologous, similar or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387(1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST or ClustalW of the National Center for Biotechnology Information Database.

[0029] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information, for example, using a GAP computer program such as that of Needleman et al. (1970), J Mol Biol. 48:443, as disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a comparison matrix as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979). 14: A weighted comparison matrix of 6745 (or a permutation matrix of EDNAFULL (EMBOSS version of NCBI NUC4.4)); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0030] As used herein, the term "corresponding to" refers to an amino acid residue at a position listed in a polypeptide, or an amino acid residue that is similar, identical, or homologous to the residue listed in the polypeptide. Identifying an amino acid at a corresponding position may be determining a specific amino acid in a sequence that references a particular sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related or reference protein.

[0031] For example, any amino acid sequence can be aligned with SEQ ID NO: 1, and based on this, each amino acid residue of the amino acid sequence can be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue in SEQ ID NO: 1. For example, a sequence alignment algorithm such as that described in the present application can identify the position of an amino acid, or the position at which a modification such as a substitution, insertion, or deletion occurs, by comparing it to a query sequence (also referred to as a “reference sequence”).

[0032] For such alignment, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) can be used, but is not limited thereto, and any sequence alignment program known in the art, pairwise sequence comparison algorithm, etc. can be appropriately used.

[0033]

[0034] The term "O-phosphoserine (OPS)" used in this application refers to a phosphoric acid ester of serine, which is a component of various proteins. OPS is a precursor of L-cysteine, and can be converted into cysteine ​​by reacting with sulfide under the catalytic action of OPS sulfhydrylase (OPSS), but is not limited thereto (U.S. Registered Publication No. US 8557549 B2).

[0035] The term "microorganism producing O-phosphoserine" in the present application refers to a microorganism that naturally has the ability to produce O-phosphoserine or a microorganism that has been given the ability to produce O-phosphoserine to a parent strain that does not have the ability to produce O-phosphoserine. For the purpose of the present application, the microorganism producing O-phosphoserine is characterized by having the activity of the PdxB protein weakened and the desired ability to produce O-phosphoserine increased, and may be a genetically modified microorganism or a recombinant microorganism, but is not limited thereto.

[0036] In this application, the term "strain" or "microorganism" includes both wild-type microorganisms and microorganisms that have undergone genetic modification naturally or artificially, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein or product, as a microorganism whose specific mechanism has been weakened or strengthened due to causes such as the insertion of an external gene or the enhancement or inactivation of the activity of an endogenous gene.

[0037] The microorganism of the present application may be a microorganism having O-phosphoserine production ability.

[0038] The microorganism of the present application may be a microorganism that naturally has O-phosphoserine production ability, or a microorganism in which O-phosphoserine production ability is conferred on a parent strain that does not have O-phosphoserine production ability, but is not limited thereto.

[0039] For example, the strain of the present application may be a recombinant strain having increased O-phosphoserine production ability by weakening the PdxB protein activity compared to the intrinsic activity in a natural wild-type microorganism or a microorganism that produces O-phosphoserine. The recombinant strain having increased O-phosphoserine production ability may be a microorganism having increased O-phosphoserine production ability compared to a natural wild-type microorganism or an unmodified microorganism having the intrinsic activity of the PdxB protein.

[0040] The microorganism of the present application may be a microorganism having increased O-phosphoserine production ability compared to a microorganism in which the initiation codon of a polynucleotide encoding erythronate-4-phosphate dehydrogenase is GTG or ATG, but is not limited thereto. For example, the recombinant strain with increased productivity has an O-phosphoserine productivity of about 1% or more, specifically, about 1% or more, about 10% or more, about 20% or more, about 29% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 100% or more, about 101% or more, about 102% or more, about 103% or more, about 104% or more, about 105% or more, about 106% or more, or about 107% or more (the upper limit is not particularly limited, and for example, about 300% or less, about 200% or less, about 150% or less, about 110% or less, about The productivity of the recombinant strain may be increased by about 109% or less or about 108% or less, but is not limited thereto, as long as it has a positive value of increase compared to the productivity of the parent strain or the non-modified microorganism before mutation. In another example, the recombinant strain with increased productivity may have an O-phosphoserine productivity increased by about 1.01-fold or more, about 1.02-fold or more, about 1.03-fold or more, about 1.04-fold or more, about 1.05-fold or more, about 1.06-fold or more, or about 1.07-fold or more (the upper limit is not particularly limited, and may be, for example, about 10-fold or less, about 5-fold or less, about 3-fold or less, about 2-fold or less, or about 1.5-fold or less) compared to the parent strain or the non-modified microorganism before mutation, but is not limited thereto.

[0041] In this application, the term "unmodified microorganism" does not exclude a strain that contains a mutation that can occur naturally in a microorganism, and may refer to a wild-type strain or a natural strain itself, or a strain before its characteristics are changed by genetic mutation caused by natural or artificial factors. For example, the unmodified microorganism may refer to a strain in which the activity of the erythronate-4-phosphate dehydrogenase protein described herein is not weakened or has not been weakened compared to the intrinsic activity. The "unmodified microorganism" may be used interchangeably with "pre-modified strain," "pre-modified microorganism," "unmutated strain," "unmodified microorganism," or "reference microorganism."

[0042] As another example of the present application, the microorganism of the present application may be a microorganism capable of producing O-phosphoserine, and the type thereof is not particularly limited. The microorganism of the present application may be either a prokaryotic cell or a eukaryotic cell, but may specifically be a prokaryotic cell. The prokaryotic cell may include, for example, a microbial strain belonging to the genus Escherichia, the genus Erwinia, the genus Seratia, the genus Providencia, the genus Corynebacterium, and the genus Brevibacterium, and may specifically be a microorganism of the genus Escherichia, and more specifically, Escherichia coli, but is not limited thereto. In particular, in the case of the Escherichia genus microorganism of the present application, OPS and L-serine can be produced through SerA, SerC and SerB, which are enzymes of the L-serine biosynthetic pathway (Ahmed Zahoor, Computational and structural biotechnology journal, vol 3, 2012 October; Wendisch VF et al., Curr Opin Microbiol. 2006 Jun;9(3):268-74; Peters-Wendisch P et al., Appl Environ Microbiol. 2005 Nov;7 1(ll):7 139-44.). The above “unmodified microorganism” microorganism may be a microorganism in which the start codon of the polynucleotide encoding erythronate-4-phosphate dehydrogenase is ATG or GTG, but is not limited thereto. More specifically, the above "unmodified microorganism" may be a microorganism comprising a polynucleotide consisting of sequence number 2. In the present application, the term "attenuation" of polypeptide activity is a concept that includes both a decrease in activity compared to the intrinsic activity or no activity.The above weakening may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, and attenuation.

[0043] The above weakening may also include cases where the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide originally possessed by the microorganism due to mutation of the polynucleotide encoding the polypeptide, etc., cases where the overall polypeptide activity level and / or concentration (expression amount) within the cell is lower than that of the natural strain due to inhibition of expression of the gene of the polynucleotide encoding the polypeptide or inhibition of translation into a polypeptide, cases where the polynucleotide is not expressed at all, and / or cases where the polypeptide has no activity even if the polynucleotide is expressed. The above "intrinsic activity" refers to the activity of a specific polypeptide originally possessed by the parent strain, wild type, or unmodified microorganism before the change in trait when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with "activity before modification." The term "inactivation, deficiency, reduction, downregulation, deterioration, attenuation" of the activity of a polypeptide relative to its intrinsic activity means that the activity of a particular polypeptide is lowered compared to the activity that the parent strain or unmodified microorganism originally had prior to the transformation.

[0044] Attenuation of the activity of such polypeptides can be accomplished by any method known in the art, including but not limited to, and can be achieved by application of various methods well known in the art (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).

[0045]

[0046] Specifically, the weakening of the polypeptide activity of the present application is

[0047] 1) Deletion of all or part of a gene encoding a polypeptide;

[0048] 2) Modification of the expression control region (or expression control sequence) so as to reduce the expression of the gene encoding the polypeptide;

[0049] 3) Modification of the amino acid sequence constituting the polypeptide (e.g., deletion / substitution / addition of one or more amino acids in the amino acid sequence) so as to eliminate or weaken the activity of the polypeptide;

[0050] 4) Modification of the gene sequence encoding the polypeptide such that the activity of the polypeptide is eliminated or weakened (e.g., deletion / substitution / addition of one or more nucleotide bases in the nucleotide sequence of the polypeptide gene such that the polypeptide is modified such that the activity of the polypeptide is eliminated or weakened);

[0051] 5) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;

[0052] 6) Introduction of an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to a transcript of the gene encoding the polypeptide;

[0053] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of a gene encoding a polypeptide to form a secondary structure to which ribosome attachment is impossible;

[0054] 8) Addition of a promoter that is transcribed in the opposite direction to the 3' end of the open reading frame (ORF) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE); or

[0055] 9) It may be a combination of two or more of the above 1) to 8), but is not particularly limited thereto.

[0056] for example,

[0057] The above 1) deletion of part or all of the gene encoding the polypeptide may be the removal of the entire polynucleotide encoding the endogenous target polypeptide in the chromosome, replacement with a polynucleotide having some nucleotides deleted, or replacement with a marker gene.

[0058] In addition, the above 2) modification of the expression control region (or expression control sequence) may be a mutation in the expression control region (or expression control sequence) by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, or replacement with a sequence having weaker activity. The expression control region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.

[0059] In addition, the modification of the amino acid sequence or polynucleotide sequence of the above 3) and 4) may be, but is not limited to, a mutation in the sequence of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide, such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof, so as to weaken the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have weaker activity, or an amino acid sequence or polynucleotide sequence improved to have no activity. For example, the expression of a gene may be inhibited or weakened by introducing a mutation in the polynucleotide sequence to form a stop codon, but is not limited thereto.

[0060] In addition, the above 5) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a lower polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.

[0061] The introduction of an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to the transcript of the gene encoding the polypeptide 6) above can be described, for example, with reference to the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].

[0062] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of a gene encoding a polypeptide to form a secondary structure to which ribosome attachment is impossible may render mRNA translation impossible or slow it down.

[0063] 8) Addition of a promoter transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE) may weaken the activity by creating an antisense nucleotide complementary to the transcript of the gene encoding the polypeptide.

[0064] Specifically, the microorganism producing O-phosphoserine of the present application may have, but is not limited to, a weakened erythronate-4-phosphate dehydrogenase protein activity compared to the intrinsic activity.

[0065] Specifically, the start codon of a gene transcript encoding a polypeptide can be modified to attenuate the activity of the erythronate-4-phosphate dehydrogenase protein.

[0066] In this application, the term "initiation codon" means three nucleotides corresponding to the translation start point when the coding sequence of mRNA (messenger RNA) is translated into protein.

[0067] In the present application, the microorganism of the present application may be a microorganism in which the initiation codon of a polynucleotide encoding erythronate-4-phosphate dehydrogenase is TTG or CTG, but is not limited thereto.

[0068] In this application, the term "polynucleotide" means a polymer of nucleotides in which nucleotide units (monomers) are covalently bonded to form a long chain, a DNA or RNA strand of a certain length or longer, and more specifically, a polynucleotide fragment encoding the variant.

[0069] More specifically, the microorganism of the present application may be a microorganism comprising a polynucleotide consisting of SEQ ID NO: 3 and SEQ ID NO: 4.

[0070] The polynucleotide of the present application may have various modifications made to the coding region within a range that does not change the amino acid sequence of the variant of the present application, taking into account the degeneracy of the codon or the codon preferred in the organism that is intended to express the variant of the present application. Specifically, the polynucleotide of the present application may have or include a base sequence having at least 70%, at least 75%, at least 6%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and less than 100% homology or identity with the sequence of SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4, or may consist of or consist essentially of a base sequence having at least 70%, at least 75%, at least 6%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and less than 100% homology or identity with the sequence of SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4, but is not limited thereto.

[0071] In addition, the polynucleotide of the present application may include, without limitation, a probe that can be prepared from a known genetic sequence, for example, a sequence that can hybridize under stringent conditions with a complementary sequence to all or part of the polynucleotide sequence of the present application. The term "stringent conditions" refers to conditions that enable specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, conditions in which polynucleotides having high homology or identity hybridize with each other, polynucleotides having 70% or more, 75% or more, 6% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity hybridize with each other, and polynucleotides having lower homology or identity do not hybridize with each other, or conditions in which washing is performed once, specifically twice or three times, at a salt concentration and temperature equivalent to 60°C, 1ХSSC, 0.1% SDS, specifically 60°C, 0.1ХSSC, 0.1% SDS, and more specifically 68°C, 0.1ХSSC, 0.1% SDS, which are washing conditions of typical southern hybridization, are performed.

[0072] Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Therefore, the polynucleotides of the present application may also include isolated nucleic acid fragments that are complementary in their entirety, as well as substantially similar nucleic acid sequences.

[0073] Specifically, a polynucleotide having homology or identity with the polynucleotide of the present application can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. In addition, the Tm value may be, but is not limited to, 60°C, 63°C, or 65°C, and can be appropriately adjusted by a person skilled in the art depending on the purpose.

[0074] The appropriate stringency for hybridizing the polynucleotides depends on the length and degree of complementarity of the polynucleotides, variables which are well known in the art (e.g., J. Sambrook et al., supra).

[0075]

[0076] Specifically, the microorganism producing O-phosphoserine of the present application may be a microorganism in which the erythronate-4-phosphate dehydrogenase protein activity is not inactivated, but is not limited thereto.

[0077] More specifically, the microorganism producing O-phosphoserine of the present application may be, but is not limited to, a microorganism that does not have a polynucleotide encoding erythronate-4-phosphate dehydrogenase.

[0078]

[0079] For the purposes of the present application, the microorganism may include an expression vector for expressing the mutant polynucleotide in a host, thereby having the erythronate-4-phosphate dehydrogenase protein activity weakened compared to the intrinsic activity, but is not limited thereto.

[0080] The vector of the present application may comprise a DNA construct comprising a base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression control region (or expression control sequence) so as to enable expression of the target polypeptide in a suitable host. The expression control region may comprise a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences regulating the termination of transcription and translation. The vector may be capable of replicating or functioning independently of the host genome after being transformed into a suitable host cell, or may be integrated into the genome itself.

[0081] The vector used in the present application is not particularly limited, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ series, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, pSK series, pSKH series, and pET series can be used as plasmid vectors. Specifically, pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pSK, pSKH130, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors, etc. can be used.

[0082] For example, a polynucleotide encoding a target polypeptide can be inserted into a chromosome via a vector for intracellular chromosomal insertion. The insertion of the polynucleotide into the chromosome can be achieved by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker for confirming the chromosomal insertion can be additionally included. The selection marker is used to select cells transformed with the vector, i.e., to confirm the insertion of the target nucleic acid molecule. Markers that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or expression of a surface polypeptide, can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, so that transformed cells can be selected.

[0083] The term "transformation" in this application refers to introducing a vector containing a polynucleotide encoding a target polypeptide into a host cell or microorganism so that the polypeptide encoded by the polynucleotide can be expressed in the host cell. The transformed polynucleotide may be located within the chromosome of the host cell or located extrachromosomally, as long as it can be expressed in the host cell. In addition, the polynucleotide includes DNA and / or RNA encoding the target polypeptide. The polynucleotide may be introduced in any form as long as it can be introduced into the host cell and expressed. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all elements necessary for autonomous expression. The expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal, all of which are operably linked to the polynucleotide. The above expression cassette may be in the form of a self-replicating expression vector. Furthermore, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell, but is not limited thereto.

[0084] Additionally, the term "operably linked" as used herein means that the polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates transcription of the polynucleotide encoding the target variant of the present application.

[0085]

[0086] In the microorganism of the present application, modification of part or all of the polynucleotide may be induced by, but is not limited to, (a) homologous recombination using a vector for chromosome insertion into the microorganism or genome editing using engineered nucleases (e.g., CRISPR-Cas9) and / or (b) treatment with light and / or chemicals such as ultraviolet rays and radiation. The method for modifying part or all of the gene may include a method using DNA recombination technology. For example, a nucleotide sequence or vector containing a nucleotide sequence homologous to a target gene may be injected into the microorganism to cause homologous recombination, thereby causing deletion of part or all of the gene. The injected nucleotide sequence or vector may include, but is not limited to, a dominant selection marker.

[0087] For example, various methods known in the art can be used to replace the initiation codon of target genes on the chromosome of the microorganism of the present application with TTG or CTG. For example, the initiation codon sequence of pdxB endogenous to the microorganism can be replaced on the chromosome. Alternatively, the corresponding gene with the replaced initiation codon sequence can be introduced into the microorganism in the form of a plasmid.

[0088]

[0089] The O-phosphoserine producing microorganism of the present invention may additionally have enhanced YhhS protein activity compared to the intrinsic activity.

[0090] In the present application, the term "YhhS" refers to a polypeptide exhibiting O-phosphoserine (OPS) export activity, specifically, a membrane protein having the activity to export OPS out of a cell. In the present application, the YhhS may be a YhhS MFS (major facilitator superfamily) transporter, which is a membrane protein having the activity to export OPS out of a cell. The YhhS has been identified as a protein exhibiting OPS export activity from Escherichia coli in which growth inhibition is released under conditions in which an excess amount of OPS is present.

[0091] Specifically, the YhhS can be used interchangeably with the YhhS MFS transporter. The amino acid sequence of the YhhS in the present application can be obtained from the known database, NCBI's GenBank. The YhhS of the present application may be a protein having or including the amino acid sequence represented by SEQ ID NO: 7, or a protein consisting of or consisting essentially of the amino acid sequence represented by SEQ ID NO: 7, but is not limited thereto. In addition, the YhhS of the present application may have or include an amino acid sequence having at least 70%, 80%, 90%, 95%, or 99% homology or identity with the amino acid sequence represented by SEQ ID NO: 7, as long as it exhibits the activity of YhhS. In addition, the YhhS of the present application may be composed of or consist essentially of an amino acid sequence having at least 70%, 80%, 90%, 95%, or 99% homology or identity with the amino acid sequence set forth in SEQ ID NO: 7, but is not limited thereto. In addition, the polynucleotide encoding the YhhS may have or include a base sequence encoding the amino acid sequence set forth in SEQ ID NO: 8. In addition, the polynucleotide encoding the YhhS may be composed of or consist essentially of a base sequence encoding the amino acid sequence set forth in SEQ ID NO: 7. The polynucleotide encoding the YhhS of the present application may have various modifications in the coding region within a range that does not change the amino acid sequence of the YhhS protein due to the degeneracy of the codon or in consideration of the codon preferred in an organism that is to express the YhhS protein. The polynucleotide encoding YhhS of the present application may have or include a base sequence having at least 70%, 80%, 90%, 95%, or 99% homology or identity with the base sequence of SEQ ID NO: 8, but less than 100%.In addition, the polynucleotide encoding YhhS of the present application may be composed of or essentially composed of a base sequence having at least 70%, 80%, 90%, 95%, or 99%, and less than 100%, homology or identity with the base sequence of SEQ ID NO: 8, but is not limited thereto.

[0092]

[0093] The O-phosphoserine producing microorganism of the present application may additionally have introduced or enhanced protein activity of YhhS, phosphoserine aminotransferase (SerC), or a combination thereof.

[0094] Since the SerC above has the activity of converting the 3-phosphohydroxypyruvate into O-phosphoserine, a microorganism that is mutated to introduce or strengthen the SerC activity has the characteristic of accumulating O-phosphoserine and can be usefully used for the production of O-phosphoserine. The SerC of the present application may be a protein having or including the amino acid sequence represented by SEQ ID NO: 9, or a protein consisting of or essentially consisting of the amino acid sequence represented by SEQ ID NO: 9, but is not limited thereto. In addition, the SerC of the present application may have or include an amino acid sequence having at least 70%, 80%, 90%, 95%, or 99% homology or identity with the amino acid sequence represented by SEQ ID NO: 9, as long as it exhibits the activity of SerC. In addition, the SerC of the present application may be composed of or consist essentially of an amino acid sequence having at least 70%, 80%, 90%, 95%, or 99% homology or identity with the amino acid sequence set forth in SEQ ID NO: 9, but is not limited thereto. In addition, the polynucleotide encoding the SerC may have or include a base sequence encoding the amino acid sequence set forth in SEQ ID NO: 10. In addition, the polynucleotide encoding the SerC may be composed of or consist essentially of a base sequence encoding the amino acid sequence set forth in SEQ ID NO: 9. The polynucleotide encoding the SerC of the present application may have various modifications in the coding region within a range that does not change the amino acid sequence of the SerC protein due to the degeneracy of the codon or in consideration of the codon preferred in an organism that is to express the SerC protein. The polynucleotide encoding SerC of the present application may have or include a base sequence having at least 70%, 80%, 90%, 95%, or 99% homology or identity with the base sequence of SEQ ID NO: 10, but less than 100%.In addition, the polynucleotide encoding SerC of the present application may be composed of or essentially composed of a base sequence having at least 70%, 80%, 90%, 95%, or 99%, and less than 100%, homology or identity with the base sequence of SEQ ID NO: 10, but is not limited thereto.

[0095]

[0096] The O-phosphoserine producing microorganism of the present application may additionally have a weakened activity of phosphoserine phosphatase (SerB) compared to the endogenous activity.

[0097] Since the SerB above has the activity of converting O-phosphoserine into L-serine, a microorganism mutated to have weakened SerB activity has the characteristic of accumulating O-phosphoserine and can be usefully used for the production of O-phosphoserine. The SerB of the present application may be a protein having or including the amino acid sequence represented by SEQ ID NO: 5, or a protein consisting of or essentially consisting of the amino acid sequence represented by SEQ ID NO: 5, but is not limited thereto. In addition, the SerB of the present application may have or include an amino acid sequence having at least 70%, 80%, 90%, 95%, or 99% homology or identity with the amino acid sequence represented by SEQ ID NO: 5, as long as it exhibits the activity of SerB. In addition, the SerB of the present application may be composed of or essentially composed of an amino acid sequence having at least 70%, 80%, 90%, 95%, or 99% homology or identity with the amino acid sequence set forth in SEQ ID NO: 5, but is not limited thereto. In addition, the polynucleotide encoding the SerB may have or include a base sequence encoding the amino acid sequence set forth in SEQ ID NO: 6. In addition, the polynucleotide encoding the SerB may be composed of or essentially composed of a base sequence encoding the amino acid sequence set forth in SEQ ID NO: 5. The polynucleotide encoding the SerB of the present application may have various modifications in the coding region within a range that does not change the amino acid sequence of the SerB protein due to the degeneracy of the codon or in consideration of the codon preferred in an organism that is to express the SerB protein. The polynucleotide encoding SerB of the present application may have or include a base sequence having at least 70%, 80%, 90%, 95%, or 99% homology or identity with the base sequence of SEQ ID NO: 6, but less than 100%.In addition, the polynucleotide encoding SerB of the present application may be composed of or essentially composed of a base sequence having at least 70%, 80%, 90%, 95%, or 99%, and less than 100%, homology or identity with the base sequence of SEQ ID NO: 6, but is not limited thereto.

[0098]

[0099] In this application, the term "enhancement" of polypeptide activity means that the activity of the polypeptide is increased compared to the intrinsic activity. The enhancement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may all include exhibiting an activity that was not originally present, or exhibiting an activity that is enhanced compared to the intrinsic activity or the activity before modification. The "intrinsic activity" refers to the activity of a specific polypeptide that a parent strain or an unmodified microorganism originally had before the trait change when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with "activity before modification." "Enhanced," "upregulated," "overexpressed," or "increased" the activity of a polypeptide relative to its intrinsic activity means that the activity and / or concentration (expression amount) of the specific polypeptide is improved compared to the activity and / or concentration (expression amount) that the parent strain or unmodified microorganism originally had prior to the transformation.

[0100] The above enhancement can be achieved by introducing an exogenous polypeptide, or by enhancing the activity and / or concentration (expression level) of an endogenous polypeptide. Whether the activity of the polypeptide is enhanced can be determined by an increase in the level of activity, expression level, or amount of product excreted from the polypeptide.

[0101] Enhancement of the activity of the above polypeptide can be achieved by applying various methods well known in the art, and is not limited as long as the activity of the target polypeptide can be enhanced compared to that of the microorganism before modification. Specifically, it may be achieved by using genetic engineering and / or protein engineering, which are routine methods of molecular biology and are well known to those skilled in the art, but is not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0102] Specifically, the enhancement of the polypeptide of the present application is

[0103] 1) Increase in the intracellular copy number of a polynucleotide encoding a polypeptide;

[0104] 2) Modification of the gene expression control region on the chromosome encoding the polypeptide (e.g., mutation in the expression control region, replacement with a sequence having stronger activity, or insertion of a sequence having stronger activity);

[0105] 3) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;

[0106] 4) Modification of the amino acid sequence of the polypeptide so as to enhance polypeptide activity;

[0107] 5) Modification of the polynucleotide sequence encoding the polypeptide so as to enhance the activity of the polypeptide (e.g., modification of the polynucleotide sequence of the polypeptide gene so as to encode a polypeptide modified so as to enhance the activity of the polypeptide);

[0108] 6) Introduction of a foreign polypeptide exhibiting the activity of the polypeptide or a foreign polynucleotide encoding the same;

[0109] 7) Codon optimization of a polynucleotide encoding a polypeptide;

[0110] 8) Analyzing the tertiary structure of the polypeptide and selecting the exposed portion to modify or chemically modify; or

[0111] 9) It may be a combination of two or more of the above 1) to 8), but is not particularly limited thereto.

[0112] More specifically,

[0113] The increase in the intracellular copy number of the polynucleotide encoding the polypeptide described above may be achieved by introducing into the host cell a vector capable of replicating and functioning independently of the host, to which the polynucleotide encoding the polypeptide is operably linked. Alternatively, the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into the chromosome of the host cell. The introduction into the chromosome may be performed by introducing into the host cell a vector capable of inserting the polynucleotide into the chromosome of the host cell, but is not limited thereto. The vector is as described above.

[0114] 2) Replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence having strong activity may be, for example, a mutation in the sequence such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further enhance the activity of the expression control region, or replacement with a sequence having stronger activity. The expression control region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, it may be, but is not limited to, replacing the original promoter with a strong promoter.

[0115] Examples of known strong promoters include, but are not limited to, the CJ1 to CJ7 promoters (US Patent No. US 7662943 B2), the lac promoter, the trp promoter, the trc promoter, the tac promoter, the lambda phage PR promoter, the PL promoter, the tet promoter, the gapA promoter, the SPL7 promoter, the SPL13 (sm3) promoter (US Patent No. US 10584338 B2), the O2 promoter (US Patent No. US 10273491 B2), the tkt promoter, and the yccA promoter.

[0116] The above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a higher polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.

[0117] The modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be, but is not limited to, a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity, or an amino acid sequence or polynucleotide sequence improved to have increased activity. The replacement may be specifically performed by inserting the polynucleotide into a chromosome by homologous recombination, but is not limited thereto. The vector used at this time may additionally include a selection marker to confirm whether or not the chromosome has been inserted. The selection marker is as described above.

[0118] The introduction of the foreign polynucleotide exhibiting the activity of the polypeptide as described above 6) may be the introduction into the host cell of a foreign polynucleotide encoding a polypeptide exhibiting the same / similar activity as the polypeptide. The foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same / similar activity as the polypeptide. The method used for the introduction may be performed by a person skilled in the art by appropriately selecting a known transformation method, and the polypeptide may be produced by expressing the introduced polynucleotide in the host cell, thereby increasing its activity.

[0119] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be codon optimization of an endogenous polynucleotide to increase transcription or translation within a host cell, or codon optimization of a foreign polynucleotide to achieve optimized transcription or translation within a host cell.

[0120] The above 8) analyzing the tertiary structure of a polypeptide and selecting an exposed portion to modify or chemically modify may be done by, for example, comparing the sequence information of the polypeptide to be analyzed with a database storing the sequence information of known proteins, determining a template protein candidate based on the degree of sequence similarity, confirming the structure based on this, and selecting an exposed portion to modify or chemically modify, and modifying or modifying it.

[0121] Such enhancement of polypeptide activity may be, but is not limited to, an increase in the activity or concentration or expression level of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microbial strain, or an increase in the amount of a product produced from the polypeptide.

[0122]

[0123] Additionally, the above microorganism may be a microorganism that further reduces the ability of OPS to enter and decompose cells.

[0124] In addition to the above-described contents regarding the OPS producing microorganism, contents disclosed in U.S. Registration Publication No. US 8557549 B2 or U.S. Publication No. 2012-0190081 may be used as reference material for this application, but are not limited thereto.

[0125]

[0126] Another aspect of the present application provides a method for producing O-phosphoserine, comprising the step of culturing the microorganism of the present application in a medium.

[0127] The method for producing O-phosphoserine of the present application may include a step of culturing the microorganism of the present application in a medium.

[0128] The term "cultivation" in this application refers to growing the microorganisms of this application under appropriately controlled environmental conditions. The cultivation process of this application can be performed using appropriate media and culture conditions known in the art. This cultivation process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the cultivation may be batch, continuous, or fed-batch, but is not limited thereto.

[0129] In this application, the term "medium" refers to a material containing nutrients as a main component necessary for culturing the microorganism of this application, and supplies nutrients and growth factors, including water, which is essential for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganism of this application may be any medium used for culturing general microorganisms without particular limitation, but the microorganism of this application may be cultured under aerobic conditions while controlling temperature, pH, etc. in a general medium containing an appropriate carbon source, nitrogen source, phosphorus source, inorganic compound, amino acid, and / or vitamin.

[0130] In the present application, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted to reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.

[0131] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc.; peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.

[0132] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.

[0133] The above medium may contain metal salts such as magnesium sulfate or iron sulfate, and may also contain amino acids, vitamins, and suitable precursors. These media or precursors may be added to the culture in batch or continuous manner, but are not limited thereto.

[0134] For example, the culture of a recombinant microorganism in which SerB activity is weakened compared to the intrinsic activity can be induced by inducing serine requirement of the microorganism, so that glycine or serine can be additionally included in the medium. Glycine can be provided in the form of purified glycine, a yeast extract containing glycine, or tryptone, and the concentration included in the culture medium can be usually 0.1 to 10 g / L, specifically 0.5 to 3 g / L. In addition, serine can be provided in the form of purified serine, a yeast extract containing serine, or tryptone, and the concentration included in the culture medium can be usually 0.1 to 5 g / L, specifically 0.1 to 1 g / L.

[0135] In addition, during the cultivation of the microorganism of the present application, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during the cultivation, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. In addition, in order to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or in order to maintain the anaerobic and microaerobic state, nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection, but is not limited thereto.

[0136] In the culture of the present application, the culture temperature can be maintained at 20 to 45°C, specifically 25 to 40°C, and the culture can be performed for about 10 to 160 hours, but is not limited thereto.

[0137] O-phosphoserine produced by the culture of the present invention may be secreted into the medium or remain within the cells.

[0138]

[0139] The method for producing O-phosphoserine of the present application may additionally include a step of preparing a microorganism of the present application, a step of preparing a medium for culturing the microorganism, or a combination thereof (in any order), for example, before the culturing step.

[0140] The O-phosphoserine production method of the present application may further include a step of recovering O-phosphoserine from the culture medium (the medium in which the culture is performed) or the microorganism according to the above-described cultivation. The recovering step may be additionally included after the culturing step.

[0141] The above recovery may be performed by collecting the desired O-phosphoserine using a suitable method known in the art, depending on the culture method of the microorganism of the present application, such as a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallized protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, and the desired O-phosphoserine can be recovered from the medium or microorganism using a suitable method known in the art.

[0142] Additionally, the O-phosphoserine production method of the present application may additionally include a purification step. The purification may be performed using any suitable method known in the art. In one example, when the O-phosphoserine production method of the present application includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously, regardless of the order, or may be performed simultaneously or integrated into a single step, but is not limited thereto.

[0143] In the method of the present application, “microorganism”, “O-phosphoserine”, etc. are as described in the other embodiments above.

[0144]

[0145] Another aspect of the present application provides a method for producing cysteine ​​or a derivative thereof, comprising the steps of: culturing the microorganism of the present application in a medium to produce O-phosphoserine or a medium containing the same; and b) contacting O-phosphoserine sulfliydrylase (OPSS) or a microorganism expressing the same, the O-phosphoserine produced in step a) or a medium containing the same, and a sulfide.

[0146] In the method of the present application, “microorganism”, “O-phosphoserine”, etc. are as described in the other embodiments above.

[0147] Specifically, the method may be a method for producing cysteine ​​or a derivative thereof, comprising the steps of culturing an O-phosphoserine-producing microorganism in a medium in which erythronate-4-phosphate dehydrogenase protein activity is weakened compared to the intrinsic activity, thereby producing O-phosphoserine or a medium containing the same; and reacting the O-phosphoserine sulfhydrylase or the microorganism expressing the same, and the O-phosphoserine produced in the step or the medium containing the same with sulfide.

[0148] In this application, the term "derivative" means a similar compound obtained by chemically changing a part of a compound, usually a compound in which a hydrogen atom or a specific atomic group in the compound is replaced by another atom or atomic group.

[0149] In this application, the term “cysteine ​​derivative” means a compound in which a hydrogen atom or a specific atomic group of cysteine ​​is replaced by another atom or atomic group. For example, it may be in the form where another atom or atomic group is attached to the nitrogen atom of the amine group (-NH 2) of cysteine ​​or the sulfur atom of the thiol group (-SH), and examples thereof include, but are not limited to, NAC (N-acetylcysteine), SCMC (S-Carboxymetylcysteine), BOC-CYS(ME)-OH, (R)-S-(2-Amino-2-carboxyethyl)-L-homocysteine, (R)-2-Amino-3-sulfopropionic acid, D-2-Amino-4-(ethylthio)butyric acid, 3-sulfino-L-alanine, Fmoc-Cys(Boc-methyl)-OH, Seleno-L-cystine, S-(2-Thiazolyl)-L-cysteine, S-(2-Thienyl)-L-cysteine, S-(4-Tolyl)-L-cysteine, etc.

[0150] If cysteine ​​is produced according to the method of the present application, conversion into cysteine ​​derivatives can be easily achieved by methods widely known in the art.

[0151] Specifically, the method for producing the cysteine ​​derivative may further include a step of converting the cysteine ​​produced in step b) into a cysteine ​​derivative, for example, by reacting cysteine ​​with an acetylation agent to synthesize NAC (N-acetylcysteine), or by reacting cysteine ​​with a haloacetic acid under basic conditions to synthesize SCMC (S-Carboxymetylcysteine), but is not limited thereto.

[0152] The above cysteine ​​derivatives can be used primarily as pharmaceutical raw materials, as antitussives, cough relievers, and as treatments for bronchitis, bronchial asthma, and pharyngitis, but are not limited thereto.

[0153] In the present application, the term "O-phosphoserine sulfhydrylase (OPSS)" refers to an enzyme that catalyzes a reaction that converts O-phosphoserine into cysteine ​​by providing a thiol group (SH group) to the O-phosphoserine. The enzyme may have been first discovered in Aeropymm pernix, Mycobacterium tuberculosis, Mycobacterium megmatics, and Trichomonas vaginalis (Mino K and Ishikawa K, FEBSletters, 551:133-138, 2003; Bums KE et al. J. Am. Chem. Soc, 127: 11602-11603, 2005). In addition, the O-phosphoserine sulfhydrylase includes not only the wild-type O-phosphoserine sulfhydrylase, but also a variant that exhibits an activity equivalent to or greater than the biological activity of the wild-type O-phosphoserine sulfhydrylase, which is a sequence in which a part of the polynucleotide sequence encoding the O-phosphoserine sulfhydrylase is deleted, substituted, or added, and may also include all of the O-phosphoserine sulfhydrylases disclosed in U.S. Patent Publication No. US 8,557,549 B2 and U.S. Patent Publication No. US 9,127,324 B2 and variants thereof.

[0154] The above sulfide is provided in the form of a liquid or gas due to differences in pH, pressure, and solubility, as well as in the solid form commonly used in the relevant technical field, and is sulfide (S 2- ), thiosulfate (S203) 2-) etc., any sulfide that can be converted into a thiol group (SH group) can be used without limitation. Specifically, Na2S, NaSH, H2S, (NH4)2S, and Na2S2O3 that provide a thiol group to O-phosphoserine can be used, but are not limited thereto. The above reaction is a reaction that provides one thiol group to one O-phosphoserine reactor to produce one cysteine ​​or cysteine ​​derivative, and the amount of sulfide added during the reaction may be 0.1 to 3 times the molar concentration of O-phosphoserine, specifically, may be 1 to 2 times, but is not limited thereto.

[0155] Additionally, the present application may further include a step of recovering cysteine ​​produced through the above reaction step. At this time, the desired cysteine ​​may be separated, purified, and collected from the reaction solution using a suitable reaction known in the art.

[0156]

[0157] Another aspect of the present application provides a composition for producing O-phosphoserine, comprising a microorganism having an erythronate-4-phosphate dehydrogenase protein activity weakened compared to the intrinsic activity of the microorganism.

[0158] The composition of the present application may further comprise any suitable excipient commonly used in compositions for producing O-phosphoserine, and such excipients may be, for example, but are not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents.

[0159] In the composition of the present application, “microorganism” and “O-phosphoserine”, etc. are as described in the other embodiments above.

[0160]

[0161] Another aspect of the present application provides a use for producing a derivative of O-phosphoserine, cysteine ​​or cysteine ​​of a microorganism having an erythronate-4-phosphate dehydrogenase protein activity weakened compared to the intrinsic activity of the microorganism.

[0162]

[0163] The present application will be described in more detail below through examples. However, the following examples are merely preferred embodiments intended to illustrate the present application and are therefore not intended to limit the scope of the present application. Furthermore, technical details not described herein can be readily understood and implemented by those skilled in the technical field of the present application or similar fields.

[0164]

[0165] Example 1: Production of a strain with enhanced YhhS expression and evaluation of OPS production capacity.

[0166] 1-1. Construction of a plasmid to enhance yhhS expression

[0167] Using the wild Escherichia coli (ATCC27325) chromosomal DNA as a template and the primer pair of SEQ ID NO: 11 and SEQ ID NO: 12, a gene fragment in the upstream region of the wild-type promoter of the yhhS gene, where homologous recombination occurs on the chromosome, was obtained. In addition, using pCL_Ptrc-gfp (WO2016024771A1) as a template and the primer pair of SEQ ID NO: 13 and SEQ ID NO: 14, the Ptrc promoter was obtained. In addition, using the Escherichia coli (ATCC27325) chromosomal DNA as a template and the primer pair of SEQ ID NO: 15 and SEQ ID NO: 16, a gene fragment in the downstream region of the wild-type promoter of the yhhS gene, where homologous recombination occurs on the chromosome, was obtained. The primer sequences used above are as shown in Table 1 below.

[0168]

[0169] Sequence number name sequence (5'→ 3')11yhhS UP FCTGCAGGAATTCGATGAAGGTAACCACTTTTTCCG12yhhS UP RGAGTTGCAGCAAGCGGAGGATCACCACATTTTTAC13Ptrc FAATGTGGTGATCCTCCGCTTGCTGCAACTCTCTCA14Ptrc RTACGGGTTCGGGCATGATAGCTCTCCTGTGTGAAA15yhhS Down FCACAGGAGAGCTATCATGCCCGAACCCGTAGCCGA16yhhS Down RGTCGACTAGCGTGATAGCGGTTTTGCCTTTACTGGC

[0170] To obtain the above fragments, the polymerase SolgTM Pfu-X DNA polymerase was used, and PCR amplification was performed under the conditions of denaturation at 95°C for 2 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, polymerization at 72°C for 60 seconds, and then polymerization at 72°C for 5 minutes. The upstream fragment of the yhhS promoter, the Ptrc promoter fragment, and the downstream fragment of the yhhS promoter obtained through the above process were cloned using an in-fusion cloning kit (Clontech Laboratories, Inc.) together with the chromosomal transformation vector pSKH130 (US Patent Publication No. 2020-0048619) digested with EcoRV restriction enzyme, thereby obtaining a recombinant plasmid, which was named pSKH_Ptrc-yhhS. The above pSKH130 vector is a vector containing an R6K replicon dependent on PI protein (pir gene), a SacB (Levansucrase) gene, and a kanamycin resistance gene.

[0171]

[0172] 1-2. Production of strains with enhanced YhhS expression

[0173] Using the strain CA07-0012 (KCCM 11121P, U.S. Registration Publication No. US 8557549 B2) lacking endogenous phosphoserine phosphatase, we attempted to enhance the expression of the protein YhhS (SEQ ID NO: 7) with OPS excretion ability to further improve the OPS excretion ability.

[0174] Specifically, pSKH_Ptrc-yhhS, constructed in Example 1-1, was transformed into CA07-0012, a host with weakened OPS degradation ability, using electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), and then the desired strain was secured using R6K and kanamycin in the first crossing, and then a strain in which the kanamycin resistance gene was deleted and the Ptrc promoter sequence was inserted at the end of the wild-type promoter sequence of the yhhS gene was obtained through the second crossing process in a medium containing sucrose. The insertion of the Ptrc promoter sequence was confirmed through PCR amplification and genome sequencing using a primer pair of SEQ ID NOs: 17 and 18 (Table 2) capable of amplifying external regions of the homologous recombination upstream and downstream regions, respectively. The strain (CA07-0012:: Ptrc-yhhS) in which the promoter sequence was inserted using CA07-0012 as the host was named CA07-4821.

[0175]

[0176] Sequence number name sequence (5'→ 3') 17yhhSP Conf FAGTTGAGCAAAAACGCCAGT 18yhhSP Conf RGCCATACCGTACAGCCAGAC

[0177] 1-3. Evaluation of OPS production capacity of YhhS expression-enhanced strains

[0178] In order to evaluate the phosphoserine (O-phosphoserine) production ability of the YhhS expression-enhanced strain produced in the above Example 1-2, the following medium (Table 3) was used for evaluation.

[0179]

[0180] Medium ingredients preparation amount Glucose 40g KH2PO4(KP1) 6g (NH4)2SO4 17g MgSO4.7H2O 1g MnSO4.4H2O 5mg FeSO4.7H2O 10mg L-glycine 1.5g / L Yeast extract Glycine 2.5g / LCaCO3 30g / L pH 6.8

[0181] Specifically, each strain was plated onto LB solid medium and cultured overnight in an incubator at 33°C. The strains cultured overnight on LB solid medium were inoculated into 25 mL of the titer medium in Table 3, which was then cultured in an incubator at 33°C and 200 rpm for 48 hours, and the results are shown in Table 4.

[0182]

[0183] Strain name OPS (g / L) CA07-0012 1.95 CA07-4821 (CA07-0012:: Ptrc-yhhS) 2.47

[0184] As shown in Table 4, the OPS production ability of CA07-4821, a strain with enhanced YhhS expression, was confirmed to be approximately 127% of the production ability of the parent strain.

[0185]

[0186] Example 2: Production of a strain with enhanced SerC expression and evaluation of OPS production capacity.

[0187] 2-1. Construction of a plasmid to enhance SerC expression

[0188] To insert the endogenous serC gene and its promoter into the maeB locus in the host genome, a gene fragment in the upstream region of the wild-type promoter of the maeB gene, where homologous recombination occurs, was obtained using the wild-type Escherichia coli (ATCC27325) chromosomal DNA as a template and the primer pair of SEQ ID NO: 19 and SEQ ID NO: 20. In addition, the serC gene and its wild-type promoter region were obtained using the wild-type Escherichia coli (ATCC27325) chromosomal DNA as a template and the primer pair of SEQ ID NO: 21 and SEQ ID NO: 22. In addition, a gene fragment in the wild-type promoter downstream region of the maeB gene, where homologous recombination on the chromosome occurs, was obtained using the primer pair of SEQ ID NO: 23 and SEQ ID NO: 24 using Escherichia coli (ATCC27325) chromosomal DNA as a template.

[0189] The primer sequences used here are as shown in Table 5 below.

[0190]

[0191] Sequence number name sequence (5'→ 3')19maeB UP F1CCGGGCTGCAGGAATTCGATCTTCCCAGGTCGAAGCCAGC20maeB UP R1CATATGAATGATTTCACTACAGGTTGTTCCTTTCACGTAA21Pn_serC FTTACGTGAAAGGAACAACCTGTAGTGAAATCATTCATATG22Pn_serC RATTCAGGGTAAGCGTGAGAGTTAACCGGTGACGGCGTTCGA23maeB Down F1CGAACGCCGTCACGGTTAACTCTCACGCTTACCCTGAAT24maeB Down R1GCTAGGTCGACTAGCGTGATCCCTGCAACGCATTAAATAA

[0192] To obtain the above fragments, the polymerase SolgTM Pfu-X DNA polymerase was used, and PCR amplification was performed under the conditions of denaturation at 95°C for 2 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, polymerization at 72°C for 60 seconds, and then polymerization at 72°C for 5 minutes. The upstream fragment of the maeB gene region obtained through the above process, the fragment of the serC gene region including the wild-type promoter, and the downstream fragment of the maeB promoter were cloned using an in-fusion cloning kit (Clontech Laboratories, Inc.) together with the chromosomal transformation vector pSKH130 digested with EcoRV restriction enzyme to obtain a recombinant plasmid, which was named pSKH△maeB::Pn_serC. The deleted maeB gene for the additional introduction of the serC gene into the host genome was inserted into OPS. To determine the effect on productivity, a plasmid containing the base sequence for maeB deletion was constructed. For maeB gene deletion, a gene fragment in the upstream region of the wild-type promoter of the maeB gene, where homologous recombination occurs, was obtained using the chromosomal DNA of wild Escherichia coli (ATCC27325) as a template and the primer pair of SEQ ID NO: 25 and SEQ ID NO: 26. In addition, a gene fragment in the downstream region of the wild-type promoter of the maeB gene, where homologous recombination occurs, was obtained using the chromosomal DNA of Escherichia coli (ATCC27325) as a template and the primer pair of SEQ ID NO: 27 and SEQ ID NO: 28.

[0193] The primer sequences used here are as shown in Table 6 below.

[0194]

[0195] Sequence number name sequence (5' → 3') 25△maeB UP FCTGCAGGAATTCGATCTTCCCAGGTCGAAGCCAGC 26△maeB UP RATTCAGGGTAAGCGTGAGAGGGTTGTTCCTTTCACGTAA 27△maeB Down FTTACGTGAAAGGAACAACCCTCTCACGCTTACCCTGAAT 28△maeB Down RGTCGACTAGCGTGATCCCTGCAACGCATTAAATAA

[0196] To obtain the above fragments, polymerase SolgTM Pfu-X DNA polymerase was used, and PCR amplification was performed under the following conditions: denaturation at 95°C for 2 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, polymerization at 72°C for 60 seconds, and polymerization at 72°C for 5 minutes. The upstream fragment of the maeB gene region and the downstream fragment of the maeB promoter obtained through the above process were cloned using an in-fusion cloning kit (Clontech Laboratories, Inc.) together with the chromosomal transformation vector pSKH130 digested with EcoRV restriction enzyme to obtain a recombinant plasmid, which was named pSKH△maeB.

[0197]

[0198] 2-2. Production of strains with enhanced SerC expression

[0199] The pSKH△maeB::Pn_serC constructed in the above Example 2-1 was transformed into CA07-4821 constructed in the above Example 1-2 using electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), and then a strain was obtained in which the serC gene sequence including the wild-type promoter was inserted at the base sequence location of the maeB gene through a second crossing process. The insertion of the serC gene sequence including the wild-type promoter was confirmed through PCR amplification and genome sequencing using a pair of primers of SEQ ID NOs: 29 and 30 capable of amplifying the external regions of the upstream and downstream regions of the homologous recombination region, respectively. The strain in which the above base sequence was inserted, using CA07-4821 of the above Example 1-2 as a host, was named CA07-4881.

[0200]

[0201] In addition, in order to delete maeB in the host genome, pSKH△maeB constructed in Example 2-1 was transformed into CA07-4821 constructed in Example 1-2 using electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), and then a strain with a deleted maeB gene base sequence was obtained through a second crossing process. The deletion of the maeB gene base sequence was confirmed through PCR amplification and genome sequencing using a primer pair of SEQ ID NOs: 29 and 30 capable of amplifying external regions of the upstream and downstream regions of the homologous recombination, respectively. The strain with a deleted maeB base sequence using CA07-4821 of Example 1-2 as a host was named CA07-4882.

[0202] The primer sequences used here are as shown in Table 7 below.

[0203]

[0204] Sequence number name sequence (5'→ 3') 29maeB out conf FAAAACGCCTGCTTCCGCAC 30maeB out conf RCGTGGTAATTAAGGCGTGAT

[0205] 2-3. Evaluation of OPS production capacity of strains with enhanced SerC expression

[0206] In order to evaluate the phosphoserine (O-phosphoserine) production ability of CA07-4881, CA07-4882 and the control groups CA07-0012 and CA07-4821 produced in the above Example 2-2, the evaluation was conducted using the medium of the above Example 1-3 (Table 3).

[0207]

[0208] Specifically, each strain was plated onto LB solid medium and cultured overnight in an incubator at 33°C. The strains cultured overnight on LB solid medium were inoculated into 25 mL of the titer medium in Table 3, which was then cultured in an incubator at 33°C and 200 rpm for 48 hours, and the results are shown in Table 8.

[0209]

[0210] Strain name OPS (g / L) CA07-0012 1.95 CA07-4821 (CA07-0012:: Ptrc-yhhS) 2.47 CA07-4881 (CA07-4821 △maeB::Pn_serC) 3.55 CA07-4882 (CA07-4821△maeB) 2.44

[0211] As shown in Table 8, in the case of CA07-4881, which had enhanced serC through the additional introduction of serC into the host genome, OPS production was confirmed to be approximately 144% higher than that of the parent strain CA07-4821. Meanwhile, in the strain CA07-4882, which lacks maeB, OPS production was confirmed to be no different from that of the parent strain (CA07-4821).

[0212]

[0213] Example 3: Construction of strains with weakened or defective pdxB expression and evaluation of OPS production capacity.

[0214] 3-1. Construction of plasmids for attenuating or eliminating pdxB expression

[0215] In order to reduce the expression level of the pdxB gene, we attempted to replace the start codon of the pdxB gene or create a plasmid for deletion of the pdxB gene.

[0216] Specifically, we aimed to replace the initiation codon sequence (gtg) of pdxB (SEQ ID NO: 2) with ttg or ctg. First, in order to replace the initiation codon sequence (gtg) with ttg, we used the chromosomal DNA of wild Escherichia coli (ATCC27325) as a template and the primer pair of SEQ ID NO: 31 and SEQ ID NO: 32 to obtain a gene fragment of the upstream region containing a mutation (ttg) in the wild-type initiation codon sequence of the pdxB gene where homologous recombination occurs on the chromosome.

[0217] In addition, a gene fragment of the downstream region containing a mutation (ttg) in the wild-type initiation codon sequence of the pdxB gene, where homologous recombination occurs on the chromosome, was obtained using the primer pair of SEQ ID NO: 33 and SEQ ID NO: 34 using Escherichia coli (ATCC27325) chromosomal DNA as a template.

[0218] Next, in order to replace the initiation codon sequence (gtg) with ctg, a gene fragment in the upstream region of the pdxB gene, where homologous recombination occurs, was obtained using the primer pair of SEQ ID NO: 31 and SEQ ID NO: 35 using Escherichia coli (ATCC27325) chromosomal DNA as a template and a wild-type initiation codon sequence containing a mutation (ctg) was used to replace the initiation codon sequence (gtg) with ctg.

[0219] In addition, a gene fragment of the downstream region containing a mutation (ctg) in the wild-type initiation codon sequence of the pdxB gene, where homologous recombination occurs on the chromosome, was obtained using the primer pair of SEQ ID NO: 36 and SEQ ID NO: 34 using Escherichia coli (ATCC27325) chromosomal DNA as a template.

[0220]

[0221] Meanwhile, in order to proceed with the deletion of pdxB, a gene fragment in the upstream region of the pdxB gene where homologous recombination occurs was obtained using the primer pair of SEQ ID NO: 37 and SEQ ID NO: 38 using the chromosomal DNA of Escherichia coli (ATCC27325) as a template. In addition, a gene fragment in the downstream region of the pdxB gene where homologous recombination occurs was obtained using the primer pair of SEQ ID NO: 39 and SEQ ID NO: 40 using the chromosomal DNA of Escherichia coli (ATCC27325) as a template.

[0222] The primer sequences used here are as shown in Table 9 below. Specifically, in the names of SEQ ID NO: 31 and SEQ ID NO: 34, n means t or c.

[0223]

[0224] Sequence number name sequence (5'→ 3')31pdxB(ntg)Up FCTGCAGGAATTCGATGCAACAGGGTGAGAATGGTT32pdxB(ttg)Up RAACAAGGATTTTCAAGTTTGTGTTACCTGTATGAGACG33pdxB(ttg)Down FCAGGTAACACAAACTTGAAAATCCTTGTTGATGAAAAT34pdxB(ntg)Down RGTCGACTAGCGTGATTGGGCGTATGGAAAGTCAGAA35pdxB(ctg)Up RAACAAGGATTTTCAGGTTTGTGTTACCTGTATGAGACG36pdxB(ctg)Down FCAGGTAACACAAACCTGAAAATCCTTGTTGATGAAAAT37△pdxB Up FCGGTGAGAGCTGATTCAGCG38△pdxB Up RGTTTGTGTTACCTGTATGAG39△pdxB Down FTCTCTTCTTCATGCTCTCTG40△pdxB Down RGATTAACGGTTTCAGTGCCG

[0225] To obtain the above fragments, polymerase SolgTM Pfu-X DNA polymerase was used, and PCR amplification was performed under the following conditions: denaturation at 95°C for 2 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and polymerization at 72°C for 60 seconds, followed by polymerization reaction at 72°C for 5 minutes.

[0226] The upstream fragment containing the pdxB initiation codon mutation and the downstream fragment containing the pdxB initiation codon mutation obtained through the above process were cloned together with the chromosomal transformation vector pSKH130 cut with EcoRV restriction enzyme using an in-fusion cloning kit (Clontech Laboratories, Inc.) to obtain recombinant plasmids, which were named pSKH_pdxB(ttg) and pSKH_pdxB(ctg), respectively.

[0227]

[0228] Meanwhile, the upstream fragment and downstream fragment for pdxB deletion obtained through the above process were cloned together with the chromosomal transformation vector pSKH130 cut with EcoRV restriction enzyme using an in-fusion cloning kit (Clontech Laboratories, Inc.) to obtain a recombinant plasmid, which was named pSKH △pdxB.

[0229]

[0230] 3-2. Creation of strains with weakened or defective pdxB expression

[0231] pSKH_pdxB(ttg) and pSKH_pdxB(ctg) prepared in the above Example 3-1 were transformed into CA07-4881 prepared in the above Example 2-2 using electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), and then a strain in which the wild start codon sequence of the pdxB gene was replaced with ttg or ctg was obtained through a second crossing process. The replacement of the pdxB start codon sequence was confirmed through PCR amplification and genome sequencing using a primer pair of SEQ ID NOs: 41 and 42 that can amplify external regions of the upstream and downstream regions of the homologous recombination region, respectively. The strain in which the initiation codon sequence was replaced with ttg using CA07-4881 of Example 2-2 as the host was named CA07-4883, and the strain in which the initiation codon sequence was replaced with ctg was named CA07-4884.

[0232]

[0233] Meanwhile, pSKH△pdxB(ttg) prepared in Example 3-1 was transformed into CA07-4881 prepared in Example 2-2 using electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), and then a strain with a deletion of the pdxB gene was obtained through a second crossing process. The deletion of the pdxB base sequence was confirmed through PCR amplification and genome sequencing using a primer pair of SEQ ID NOs: 41 and 42 capable of amplifying external regions of the upstream and downstream regions of the homologous recombination region, respectively. The strain with a deletion of the pdxB base sequence using CA07-4881 of Example 2-2 as a host was named CA07-4886.

[0234]

[0235] The primer sequences used here are as shown in Table 10 below.

[0236]

[0237] Sequence number name sequence (5'→ 3')41pdxB Conf FTCGATTGCCAGATCTGTTTG42pdxB Conf RGACGTGCCGATATCCACTTT

[0238] 3-3. Evaluation of OPS production capacity of strains with weakened or defective pdxB expression

[0239] In order to evaluate the phosphoserine (O-phosphoserine) production ability of the CA07-4883, CA07-4884, and CA07-4886 strains produced in the above Example 3-2 and the control strains CA07-0012, CA07-4821, CA07-4881, and CA07-4882, the evaluation was conducted using the medium of the above Example 1-3 (Table 3).

[0240]

[0241] Specifically, each strain was plated onto LB solid medium and cultured overnight in an incubator at 33°C. The strains cultured overnight on LB solid medium were inoculated into 25 mL of the titer medium in Table 3, which was then cultured in an incubator at 33°C and 200 rpm for 48 hours, and the results are shown in Table 11.

[0242]

[0243] Strain nameOPS(g / L)CA07-00121.95CA07-4821(CA07-0012::Ptrc-yhhS)2.47CA07-4881(CA07-4821 △maeB::Pn_serC)3.55CA07-4882(CA07-4821 △maeB)2.44CA07-4883(CA07-4881△pdxB::pdxB(ttg))3.82CA07-4884( CA07-4881△pdxB::pdxB(ctg))3.68CA07-4886(CA07-4881::△pdxB)3.25

[0244] As shown in Table 11, the OPS production ability of CA07-4883 and CA07-4884, in which the pdxB initiation codon was substituted with ttg or ctg, respectively, was confirmed to be approximately 103% and 107% of that of the parent strain (CA07-4881). On the other hand, the OPS production ability of CA07-4886, a strain lacking pdxB, was confirmed to be lower than that of the parent strain (CA07-4881).

[0245] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering its technical concept or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted to include all changes and modifications derived from the meaning and scope of the following claims and their equivalents, rather than the detailed description above.

Claims

1. A microorganism that produces O-phosphoserine and has weakened erythronate-4-phosphate dehydrogenase protein activity.

2. In the first paragraph, the microorganism is a microorganism in which the initiation codon of a polynucleotide encoding erythronate-4-phosphate dehydrogenase is substituted with TTG or CTG.

3. In the second paragraph, the microorganism has an increased ability to produce O-phosphoserine compared to a microorganism in which the initiation codon of the polynucleotide encoding erythronate-4-phosphate dehydrogenase is GTG or ATG.

4. In the first paragraph, the microorganism is a microorganism having additionally enhanced YhhS protein activity.

5. In the first paragraph, the microorganism is a microorganism whose phosphoserine phosphatase activity is further weakened.

6. In the first paragraph, the microorganism is a microorganism in which the protein activity of YhhS, phosphoserine aminotransferase or a combination thereof is additionally introduced or strengthened.

7. A microorganism according to claim 1, wherein the microorganism is a microorganism of the genus Escherichia.

8. In the 7th paragraph, the microorganism of the genus Escherichia is E. coli.

9. A method for producing O-phosphoserine, comprising the step of culturing a microorganism producing O-phosphoserine with weakened erythronate-4-phosphate dehydrogenase protein activity in a medium. 10.a) A step of culturing a microorganism producing O-phosphoserine with weakened erythronate-4-phosphate dehydrogenase protein activity in a medium to produce O-phosphoserine or a medium containing it; and b) A method for producing cysteine ​​or a derivative thereof, comprising a step of contacting O-phosphoserine sulfliydrylase (OPSS) or a microorganism expressing the same, the O-phosphoserine produced in step a) or a medium containing the same, and sulfide.