Ammonia-oxidizing nitrosomonas eutropha strain d23
Optimized strains of Nitrosomonas eutropha (N. eutropha) address the need for effective beneficial bacteria by enhancing growth rates, NH4+ oxidation, and resistance, thereby inhibiting pathogenic bacteria and offering therapeutic benefits for various conditions.
Patent Information
- Application Number
- JP2025042370
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2015-03-13
- Filing Date
- 2025-03-17
- Publication Date
- 2025-06-17
AI Technical Summary
There is a need for improved beneficial bacteria that can effectively inhibit the growth of pathogenic bacteria.
The development of optimized strains of Nitrosomonas eutropha (N. eutropha) designated as D23, D23-100, or AOB D23-100, which exhibit enhanced properties such as optimized growth rate, NH4+ oxidation rate, and resistance to ammonium ions, thereby inhibiting pathogenic bacteria growth and producing nitric oxide precursors.
The optimized N. eutropha strains demonstrate improved capabilities in inhibiting pathogenic bacteria growth, treating diseases associated with low nitrite levels, and providing therapeutic benefits for skin disorders and body odor, while also promoting a healthy microbial environment.
Smart Images

Figure 2025090806000001_ABST
Abstract
Description
Technical Field
[0001] This application claims priority to Greek Patent Application No. 20140100217 filed on April 15, 2014, US Provisional Patent Application No. 62 / 002084 filed on May 22, 2014, US Provisional Patent Application No. 62 / 012811 filed on June 16, 2014, US Provisional Patent Application No. 62 / 053588 filed on September 22, 2014, and Greek Patent Application No. 20150100115 filed on March 13, 2015, the contents of which are hereby incorporated by reference in their entirety.
[0002] Sequence Listing This application is electronically filed in ASCII format and includes a sequence listing which is hereby incorporated by reference in its entirety. The ASCII copy created on April 13, 2015, is named N2060 - 7001WO.txt and is 3,590,980 bytes in size.
Background Art
[0003] Beneficial bacteria can be used to inhibit the growth of pathogenic bacteria. Bacteria and other microorganisms are ubiquitous in the environment. The discovery of pathogenic bacteria and the germ theory of disease have had a great impact on health and disease states. Bacteria are a normal part of the environment of all living things. In the intestine, these bacteria are non - pathogenic under normal conditions and actually improve health by making the normal intestinal contents less hospitable to disease - causing organisms. Disease prevention is achieved in several ways, such as nutrients being consumed and leaving few nutrients for pathogens, conditions such as an inhospitable pH and oxygen pressure for pathogens being created, compounds toxic to pathogens being produced, pathogens being consumed as food by these microorganisms, pathogens being left with little physical space to use, and specific binding sites being occupied and leaving few binding sites available for pathogens. The presence of these desirable bacteria is considered useful for the prevention of disease states.
[0004] There is a need in the art for improved beneficial bacteria that can inhibit the growth of pathogenic bacteria. SUMMARY OF THE INVENTION MEANS FOR SOLVING THE PROBLEM
[0005] The present disclosure provides, inter alia, optimized strains of Nitrosomonas eutropha (N. eutropha) designated as D23, D23-100, or AOB D23-100, and these terms may be used interchangeably throughout the present disclosure.
[0006] Ammonia-oxidizing bacteria of the genus Nitrosomonas are ubiquitous Gram-negative obligate chemolithoautotrophic bacteria that have the unique ability to generate energy solely from the conversion of ammonia to nitrite.
[0007] The N. eutropha bacteria disclosed in the present application have desirable properties such as the ability to inhibit the growth of pathogenic bacteria and an enhanced ability to produce nitric oxide (NO) and nitric oxide (NO2 - ) precursors, e.g., optimized properties. Using the N. eutropha herein, e.g., optimized N. eutropha, e.g., a purified optimized N. eutropha preparation, diseases, e.g., diseases associated with low nitrite levels, skin disorders, and diseases caused by pathogenic bacteria can be treated. When referring to N. eutropha throughout the present disclosure, it may refer to an optimized strain of N. eutropha or a purified optimized N. eutropha preparation.
[0008] The present disclosure provides, inter alia, Nitrosomonas eutropha (N. eutropha) bacteria, e.g., optimized N. eutropha, e.g., a purified optimized N. eutropha preparation, having at least one property selected from the following: Optimized growth rate, Optimized NH4 + Oxidation rate, and Optimization resistance to ammonium ions (NH4 + ).
[0009] This bacterium is optionally pure.
[0010] In multiple embodiments, the optimized growth rate is a rate that enables continuous culturing of N. eutropha at an OD600 (optical density at 600 nm) of about 0.15 - 0.18 and reaching an OD600 of about 0.5 - 0.6 in about 1 - 2 days. In multiple embodiments, the optimized growth rate is a doubling time of about 8 hours when cultured under batch culture conditions. In multiple embodiments, the optimized NH4 + oxidation rate is at least about 125 micromoles / minute to oxidize NH4 + to NO2 - . In multiple embodiments, the optimization resistance to NH4 + is the ability to grow for at least about 48 hours in a medium containing about 200 mM NH4 + .
[0011] In some embodiments, a purified optimized N. eutropha bacterial preparation (optionally pure) has at least two properties selected from the optimized growth rate, the optimized NH4 + oxidation rate, and the optimization resistance to NH4 + . In some embodiments, a purified optimized N. eutropha bacterial preparation (optionally pure) has the optimized growth rate, the optimized NH4 + oxidation rate, and the optimization resistance to NH4 + . In some embodiments, a purified optimized N. eutropha bacterial preparation (optionally pure) contains a chromosome that hybridizes to SEQ ID NO: 1 with very high stringency.
[0012] In some embodiments, the purified optimized N. eutropha bacterial preparation (optionally pure) has an AmoA protein having at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identity to SEQ ID NO: 6 or 12, an AmoB protein having at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identity to SEQ ID NO: 8 or 14, an amoC gene having at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identity to SEQ ID NO: 4, 10, or 16, a hydroxylamine oxidoreductase protein having at least 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identity to SEQ ID NO: 18, 20, or 22, a cytochrome c554 protein having at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identity to SEQ ID NO: 24, 26, or 28, or a cytochrome c having at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identity to SEQ ID NO: 30 or 32 M comprises a
[0013] cytochrome c552 protein.In some embodiments, the purified optimized N. eutropha bacterial preparation (optionally pure) comprises 1 - 5, 5 - 10, 10 - 15, 15 - 20, 20 - 25, 25 - 30, or all of the array characteristics of Table 2. For example, in some embodiments, the bacterium or preparation comprises an AmoA1 or AmoA2 protein (or the gene encoding it) having a mutation at position 1 of N. eutropha strain C91, e.g., a mutation to V at position 1. In some embodiments, the bacterium or preparation comprises an AmoA1 or AmoA2 protein (or the gene encoding it) having a mutation at position 160 of N. eutropha strain C91, e.g., a mutation to L at position 160. In some embodiments, the bacterium or preparation comprises an AmoA1 or AmoA2 protein (or the gene encoding it) having a mutation at position 167 of N. eutropha strain C91, e.g., a mutation to A at position 167. In some embodiments, the bacterium or preparation comprises an AmoB1 or AmoB2 protein (or the gene encoding it) having a mutation at position 33 of N. eutropha strain C91, e.g., a mutation to V at position 33. In some embodiments, the bacterium or preparation comprises an AmoB1 or AmoB2 protein (or the gene encoding it) having a mutation at position 165 of N. eutropha strain C91, e.g., a mutation to I at position 165. In some embodiments, the bacterium or preparation comprises an AmoC3 protein (or the gene encoding it) having a mutation at position 79 of N. eutropha strain C91, e.g., a mutation to A at position 79. In some embodiments, the bacterium or preparation comprises an AmoC3 protein (or the gene encoding it) having a mutation at position 271 of N. eutropha strain C91, e.g., a mutation to V at position 271. In some embodiments, the bacterium or preparation comprises a Hao1, Hao2, or Hao3 protein (or the gene encoding it) having a mutation at position 85 of N. eutropha strain C91, e.g., a mutation to S at position 85.In some embodiments, the bacterium or preparation comprises the Hao1, Hao2, or Hao3 protein (or the gene encoding the same) having a mutation at position 312 of N. eutropha strain C91, for example, E at position 312. In some embodiments, the bacterium or preparation comprises the Hao1 protein (or the gene encoding the same) having a mutation at position 163 of N. eutropha strain C91, for example, A at position 163. In some embodiments, the bacterium or preparation comprises the c554 CycA1, c554 CycA2, or c554 CycA3 protein (or the gene encoding the same) having a mutation at position 65 of N. eutropha strain C91, for example, T at position 65. In some embodiments, the bacterium or preparation comprises the c554 CycA1 protein (or the gene encoding the same) having a mutation at position 186 of N. eutropha strain C91, for example, T at position 186. In some embodiments, the bacterium or preparation comprises c having a mutation at position 63 of N. eutropha strain C91, for example, V at position 63. M 552 CycB1 or c M 552 CycB2 protein (or the gene encoding the same). In some embodiments, the bacterium or preparation comprises c having a mutation at position 189 of N. eutropha strain C91, for example, P at position 189 M 552 CycB1 or c M 552 CycB2 protein (or the gene encoding the same). In some embodiments, the bacterium or preparation comprises c having a mutation at position 206 of N. eutropha strain C91, for example, insE at position 206 M 552 CycB1 or c M 552 CycB2 protein (or the gene encoding the same). In some embodiments, the bacterium or preparation comprises c having a mutation at position 207 of N. eutropha strain C91, for example, insE at position 207 M 552 CycB1 or c MIt contains 552 CycB2 protein (or the gene encoding the same). In some embodiments, the bacterium or preparation has a mutation at position 195 of N. eutropha strain C91, for example, insD at position 195 of c M It contains 552 CycB1 protein (or the gene encoding the same). In some embodiments, the bacterium or preparation has a mutation at position 196 of N. eutropha strain C91, for example, insD at position 196 of c M It contains 552 CycB1 protein (or the gene encoding the same). In some embodiments, the bacterium or preparation has a mutation at position 197 of N. eutropha strain C91, for example, insD at position 197 of c M It contains 552 CycB1 protein (or the gene encoding the same).
[0014] Combinations of two or more sequence characteristics in Table 2 are also described. These two or more sequence characteristics may be in the same gene or in different genes. These two or more sequence characteristics may be in the same protein or in different proteins. For example, in some embodiments, the bacterium or preparation contains AmoA1 or AmoA2 protein (or the gene encoding the same) having a mutation at position 1 of N. eutropha strain C91, for example, V at position 1, and a mutation at position 160 of N. eutropha strain C91, for example, L at position 160. In some embodiments, the bacterium or preparation contains AmoA1 or AmoA2 protein (or the gene encoding the same) having a mutation at position 1 of N. eutropha strain C91, for example, V at position 1, and a mutation at position 167 of N. eutropha strain C91, for example, A at position 167. In some embodiments, the bacterium or preparation contains AmoA1 or AmoA2 protein (or the gene encoding the same) having a mutation at position 160 of N. eutropha strain C91, for example, L at position 160, and a mutation at position 167 of N. eutropha strain C91, for example, A at position 167.
[0015] In some embodiments, the bacterium or preparation comprises an AmoB1 or AmoB2 protein (or a gene encoding the same) having a mutation at position 33 of N. eutropha strain C91, for example, a mutation to V at position 33, and a mutation at position 165 of N. eutropha strain C91, for example, a mutation to I at position 165.
[0016] In some embodiments, the bacterium or preparation comprises an AmoC3 protein (or a gene encoding the same) having a mutation at position 79 of N. eutropha strain C91, for example, a mutation to A at position 79, and a mutation at position 271 of N. eutropha strain C91, for example, a mutation to V at position 271.
[0017] In some embodiments, the bacterium or preparation comprises a Hao1, Hao2, or Hao3 protein (or a gene encoding the same) having a mutation at position 85 of N. eutropha strain C91, for example, a mutation to S at position 85, and a mutation at position 312 of N. eutropha strain C91, for example, a mutation to E at position 312. In some embodiments, the bacterium or preparation comprises a Hao1 protein (or a gene encoding the same) having a mutation at position 85 of N. eutropha strain C91, for example, a mutation to S at position 85, and a mutation at position 163 of N. eutropha strain C91, for example, a mutation to A at position 163. In some embodiments, the bacterium or preparation comprises a Hao1 protein (or a gene encoding the same) having a mutation at position 312 of N. eutropha strain C91, for example, a mutation to E at position 312, and a mutation at position 163 of N. eutropha strain C91, for example, a mutation to A at position 163.
[0018] In some embodiments, the bacterium or preparation comprises a c554 CycA1 protein (or a gene encoding the same) having a mutation at position 65 of N. eutropha strain C91, for example, a mutation to T at position 65, and a mutation at position 186 of N. eutropha strain C91, for example, a mutation to T at position 186.
[0019] In some embodiments, the bacterium or preparation has mutations at any two or more of the following amino acid positions: 63, 189, 194, 195, 196, 197, 206, and 207 of c M 552 CycB1 protein (or the gene encoding the same). For example, these two or more amino acid positions can include 63 and 189, 63 and 194, 63 and 195, 63 and 196, 63 and 197, 63 and 206, 63 and 207, 189 and 194, 189 and 195, 189 and 196, 189 and 194, 189 and 195, 189 and 196, 189 and 197, 189 and 206, 189 and 207, 194 and 195, 194 and 196, 194 and 197, 194 and 206, 194 and 207, 195 and 196, 195 and 197, 195 and 206, 195 and 207, 196 and 197, 196 and 206, 196 and 207, 197 and 206, 197 and 207, or 206 and 207. In some embodiments, the bacterium or preparation has any two or more mutations selected from the group consisting of I63V, S189P, D194G, 195insD, 196insD, 197insD, 206insE, and 207insE of c MIt contains the 552 CycB1 protein (or the gene encoding the same). For example, two or more of these mutations can be selected from the group consisting of I63V and S189P, I63V and D194G, I63V and 195insD, I63V and 196insD, I63V and 197insD, I63V and 206insE, I63V and 207insE, S189P and D194G, S189P and 195insD, S189P and 196insD, S189P and 197insD, S189P and 206insE, S189P and 207insE, D194G and 195insD, D194G and 196insD, D194G and 197insD, D194G and 206insE, D194G and 207insE, 195insD and 196insD, 195insD and 197insD, 195insD and 206insE, 195insD and 207insE, 196insD and 197insD, 196insD and 206insE, 196insD and 207insE, 197insD and 206insE, 197insD and 207insE, and 206insE and 207insE.
[0020] In some embodiments, the bacterium or preparation has a mutation at any two or more of the following amino acid positions: 63, 189, 206, and 207. M It contains the 552 CycB2 protein (or the gene encoding the same). For example, two or more of these amino acid positions can include 63 and 189, 63 and 206, 63 and 207, 189 and 206, 189 and 207, or 206 and 207. In some embodiments, the bacterium or preparation has any two or more mutations selected from the group consisting of I63V, S189P, 206insE, and 207insE. M It contains the 552 CycB2 protein (or the gene encoding the same). For example, two or more of these mutations can be selected from the group consisting of I63V and S189P, I63V and 206insE, I63V and 207insE, S189P and 206insE, S189P and 207insE, and 206insE and 207insE.
[0021] Combinations of three or more array characteristics of Table 2 are also described. For example, in some embodiments, the bacterium or preparation has an AmoA1 or AmoA2 protein (or a gene encoding the same) having a mutation at position 1 of N. eutropha strain C91, e.g., a mutation at position 1 of V, and a mutation at position 160 of N. eutropha strain C91, e.g., a mutation at position 160 of L, and a mutation at position 167 of N. eutropha strain C91, e.g., a mutation at position 167 of A.
[0022] In some embodiments, the bacterium or preparation has a Hao1 protein (or a gene encoding the same) having a mutation at position 85 of N. eutropha strain C91, e.g., a mutation at position 85 of S, and a mutation at position 312 of N. eutropha strain C91, e.g., a mutation at position 312 of E, and a mutation at position 163 of N. eutropha strain C91, e.g., a mutation at position 163 of A.
[0023] In some embodiments, the bacterium or preparation has a mutation at any three or more (e.g., 4, 5, 6, 7, or all) of the following amino acid positions: 63, 189, 194, 195, 196, 197, 206, and 207 M 552 CycB1 protein (or a gene encoding the same). For example, these three mutations can be at positions 195, 196, and 197. In some embodiments, the bacterium or preparation has any three or more (e.g., 4, 5, 6, 7, or all) mutations selected from the group consisting of I63V, S189P, D194G, 195insD, 196insD, 197insD, 206insE, and 207insE M 552 CycB1 protein (or a gene encoding the same). For example, these three mutations can be 195insD, 196insD, and 197insD.
[0024] In some embodiments, the bacterium or preparation has a mutation at any three or more (e.g., all) of the following amino acid positions: 63, 189, 206, and 207 of c M 552 CycB2 protein (or the gene encoding it). In some embodiments, the bacterium or preparation has any three or more (e.g., all) mutations selected from the group consisting of I63V, S189P, 206insE, and 207insE of c M 552 CycB2 protein (or the gene encoding it).
[0025] In some embodiments, the bacterium or preparation contains mutations in at least two genes, for example, at least two genes listed in Table 2, relative to the N. eutropha strain C91. These two genes are, for example, AmoA1 and AmoA2, AmoA1 and AmoB1, AmoA1 and AmoB2, AmoA1 and AmoC1, AmoA1 and AmoC2, AmoA1 and AmoC3, AmoA1 and Hao1, AmoA1 and Hao2, AmoA1 and Hao3, AmoA1 and c554 CycA1, AmoA1 and c554 CycA2, AmoA1 and c554 CycA3, AmoA1 and cM552 CycB1, AmoA1 and cM552 CycB2, AmoA2 and AmoB1, AmoA2 and AmoB2, AmoA2 and AmoC1, AmoA2 and AmoC2, AmoA2 and AmoC3, AmoA2 and Hao1, AmoA2 and Hao2, AmoA2 and Hao3, AmoA2 and c554 CycA1, AmoA2 and c554 CycA2, AmoA2 and c554 CycA3, AmoA2 and cM552 CycB1, AmoA2 and cM552 CycB2, AmoB1 and AmoB2, AmoB1 and AmoC1, AmoB1 and AmoC2, AmoB1 and AmoC3, AmoB1 and Hao1, AmoB1 and Hao2, AmoB1 and Hao3, AmoB1 and c554 CycA1, AmoB1 and c554 CycA2, AmoB1 and c554 CycA3, AmoB1 and cM552 CycB1, AmoB1 and cM552 CycB2, AmoB2 and AmoC1, AmoB2 and AmoC2, AmoB2 and AmoC3, AmoB2 and Hao1, AmoB2 and Hao2, AmoB2 and Hao3, AmoB2 and c554 CycA1, AmoB2 and c554 CycA2, AmoB2 and c554 CycA3, AmoB2 and cM552 CycB1, AmoB2 and cM552 CycB2, AmoC1 and AmoC2, AmoC1 and AmoC3, AmoC1 and Hao1, AmoC1 and Hao2, AmoC1 and Hao3, AmoC1 and c554 CycA1, AmoC1 and c554 CycA2, AmoC1 and c554 CycA3, AmoC1 and cM552 CycB1, AmoC1 and cM552CycB2, AmoC2 and AmoC3, AmoC2 and Hao1, AmoC2 and Hao2, AmoC2 and Hao3, AmoC2 and c554 CycA1, AmoC2 and c554 CycA2, AmoC2 and c554 CycA3, AmoC2 and cM552 CycB1, AmoC2 and cM552 CycB2, AmoC3 and Hao1, AmoC3 and Hao2, AmoC3 and Hao3, AmoC3 and c554 CycA1, AmoC3 and c554 CycA2, AmoC3 and c554 CycA3, AmoC3 and cM552 CycB1, AmoC3 and cM552 CycB2, Hao1 and Hao2, Hao1 and Hao3, Hao1 and c554 CycA1, Hao1 and c554 CycA2, Hao1 and c554 CycA3, Hao1 and cM552 CycB1, Hao1 and cM552 CycB2, Hao2 and Hao3, Hao2 and c554 CycA1, Hao2 and c554 CycA2, Hao2 and c554 CycA3, Hao2 and cM552 CycB1, Hao2 and cM552 CycB2, Hao3 and c554 CycA1, Hao3 and c554 CycA2, Hao3 and c554 CycA3, Hao3 and cM552 CycB1, Hao3 and cM552 CycB2, c554 CycA1 and c554 CycA2, c554 CycA1 and c554 CycA3, c554 CycA1 and cM552 CycB1, c554 CycA1 and cM552 CycB2, c554 CycA2 and c554 CycA3, c554 CycA2 and cM552 CycB1, c554 CycA2 and cM552 CycB2, c554 CycA3 and cM552 CycB1, c554 CycA3 and cM552 CycB2, or cM552 CycB1 and cM552 It may be CycB2.
[0026] In some embodiments, the bacterium or preparation contains mutations relative to N. eutropha strain C91 in at least three genes, such as at least three (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or all) of the genes listed in Table 2. These three genes can be, for example, AmoA1 and AmoA2 and AmoA3, AmoC1 and AmoC2 and AmoC3, or Hao1 and Hao2 and Hao3.
[0027] In some embodiments, the bacterium or preparation contains at least one structural difference, such as at least one mutation, relative to a wild-type bacterium such as N. eutropha strain C91. In some embodiments, the bacterium or preparation contains nucleic acids that can be amplified using a pair of primers described herein, such as a primer containing the sequence of SEQ ID NO: 64 and a primer containing the sequence of SEQ ID NO: 65. In some embodiments, the bacterium or preparation contains nucleic acids or proteins that are at least 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, or 100% identical to the genes of FIGS. 6, 7, or 8 or the proteins encoded by the genes of FIGS. 6, 7, or 8. In some embodiments, the bacterium or preparation contains nucleic acids or proteins that are at least 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, or 100% identical to any of the sequences of SEQ ID NOs: 64-66 or the proteins encoded by any of the sequences of SEQ ID NOs: 64-66.
[0028] In some aspects, the disclosure pertains, inter alia, to an ammonia monooxygenase gene, a hydroxylamine oxidoreductase gene, a cytochrome c554 gene, or a cytochrome c mProvided is an N. eutropha bacterium containing a mutation in the 552 gene, or a purified preparation thereof. This mutation can be relative to a wild-type bacterium such as N. eutropha strain C91. This mutation can be in one or more of the amoA1 gene, amoA2 gene, amoB1 gene, amoB2 gene, and amoC3 gene. This N. eutropha bacterium, or a purified preparation thereof, can have a mutation at the positions described herein, for example, the positions described in Table 2. This N. eutropha bacterium, or a purified preparation thereof, can have a mutation, and the mutation is the mutation described herein, for example, the mutation described in Table 2.
[0029] In some embodiments, this mutation can be in one or more of the hao1 gene, hao2 gene, or hao3 gene. This N. eutropha bacterium, or a purified preparation thereof, can have a mutation at the positions described herein, for example, the positions described in Table 2. This N. eutropha bacterium, or a purified preparation thereof, can have a mutation, and the mutation is the mutation described herein, for example, the mutation described in Table 2.
[0030] In some embodiments, this mutation can be in one or more of the c554 cycA1 gene, c554 cycA2 gene, and c554 cycA3 gene. This N. eutropha bacterium, or a purified preparation thereof, can have a mutation at the positions described herein, for example, the positions described in Table 2. This N. eutropha bacterium, or a purified preparation thereof, can have a mutation, and the mutation is the mutation described herein, for example, the mutation described in Table 2.
[0031] In some embodiments, this mutation is in the c M 552 cycB1 gene and c MIt can be in one or more of the 552 cycB2 genes. This N. eutropha bacterium, or a purified preparation thereof, may have a mutation at the positions described herein, for example, the positions described in Table 2. This N. eutropha bacterium, or a purified preparation thereof, may have a mutation, and the mutation is the mutation described herein, for example, the mutation described in Table 2.
[0032] In certain embodiments, the N. eutropha bacterium, or a purified preparation thereof, described in the previous four paragraphs can be based on an N. eutropha bacterium having at least one property selected from the following, for example, optimized N. eutropha, for example, a purified optimized N. eutropha preparation: Optimal growth rate, Optimized NH4 + Oxidation rate, and Optimized resistance to ammonium ions (NH4 + ).
[0033] In certain embodiments, the N. eutropha bacterium, or a purified preparation thereof, described in the previous five paragraphs may have mutations at at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 positions of one or more of the amoA1 gene, amoA2 gene, amoB1 gene, amoB2 gene, amoC3 gene, hao1 gene, hao2 gene, hao3 gene, c554 cycA1 gene, c554 cycA2 gene, c554 cycA3 gene, c M 552 cycB1 gene, and one or more of the c554 cycB2 genes.
[0034] In some embodiments, the present N. eutropha bacteria have an optimized growth rate, such as the optimized growth rate described herein, and structural differences, such as mutations (e.g., relative to a wild-type strain such as N. eutropha strain C91), such as the mutations described herein, such as the mutations in Table 2. In some embodiments, the present N. eutropha bacteria have an optimized + NH4 + oxidation rate, such as the optimized NH4 + oxidation rate described herein, and structural differences, such as mutations (e.g., relative to a wild-type strain such as N. eutropha strain C91), such as the mutations described herein, such as the mutations in Table 2. In some embodiments, the present N. eutropha bacteria have an optimized + resistance to NH4, such as the optimized resistance to NH4 described herein, and structural differences, such as mutations (e.g., relative to a wild-type strain such as N. eutropha strain C91), such as the mutations described herein, such as the mutations in Table 2.
[0035] In some embodiments, the present N. eutropha bacteria contain nucleic acids that can be amplified using a pair of primers described herein, such as a primer containing the sequence of SEQ ID NO: 64 and a primer containing the sequence of SEQ ID NO: 65.
[0036] In certain aspects, the present disclosure provides an N. eutropha bacterium (optionally pure) containing a chromosome that hybridizes to SEQ ID NO: 1 under high stringency.
[0037] In multiple embodiments, this chromosome hybridizes to SEQ ID NO: 1 under very high stringency. In multiple embodiments, the present N. eutropha bacterium (optionally pure) contains genes that are at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to one or more of the genes in FIGS. 6-8 (e.g., 10, 20, 30, 40, 50, 100, or all of the genes in any one or more of FIGS. 6, 7, and 8).
[0038] In multiple embodiments, the present N. eutropha bacterium (optionally pure) lacks any plasmid that is at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 2 (pNeut1) or SEQ ID NO: 3 (pNeut2) as described by Stein et al. Whole-genome analysis of the ammonia-oxidizing bacterium, Nitrosomonas eutropha C91: implications for niche adaptation. Environmental Microbiology (2007) 9(12), 2993-3007. In multiple embodiments, the present N. eutropha (optionally pure) lacks one or more genes present on the plasmid of SEQ ID NO: 2 or SEQ ID NO: 3. For example, the present N. eutropha (optionally pure) may lack at least 2, 3, 4, 5, 10, 15, or 20 genes present on either or both of pNeut1 and pNeut2. While pNeut1 contains 55 protein-coding sequences, pNeutP2 contains 52 protein-coding sequences. In multiple embodiments, the present N. eutropha bacterium (optionally pure) lacks any plasmid.
[0039] In certain aspects, the present disclosure provides an N. eutropha bacterium (optionally pure) that includes one or more of an amoA1 gene that is at least about 98.9% identical to SEQ ID NO: 7 and an amoA2 gene that is at least about 98.8% identical to SEQ ID NO: 13.
[0040] In certain aspects, the present disclosure provides an N. eutropha bacterium (optionally pure) that includes one or more of an AmoA1 protein that is at least about 99.0% identical to SEQ ID NO: 6 and an AmoA2 protein that is at least about 99.0% identical to SEQ ID NO: 12.
[0041] In certain embodiments, the present disclosure provides N. eutropha bacteria (optionally pure) that include one or more of an amoB1 gene that is at least about 99.2% identical to SEQ ID NO: 9 and an amoB2 gene that is at least about 99.2% identical to SEQ ID NO: 15.
[0042] In multiple embodiments, the N. eutropha bacteria (optionally pure) further include one or more of an amoA1 or amoA2 gene that is at least about 98.9% identical to SEQ ID NO: 7 or 13.
[0043] In certain embodiments, the present disclosure provides N. eutropha bacteria (optionally pure) that include one or more of an AmoB1 protein that is at least about 99.6% identical to SEQ ID NO: 8 and an AmoB1 protein that is at least about 99.6% identical to SEQ ID NO: 14.
[0044] In multiple embodiments, the N. eutropha bacteria (optionally pure) further include one or more of an AmoA1 protein that is at least about 99.0% identical to SEQ ID NO: 6 and an AmoA2 protein that is at least about 99.0% identical to SEQ ID NO: 12.
[0045] In certain embodiments, the present disclosure provides N. eutropha bacteria (optionally pure) that include one or more of an amoC1 gene that is at least about 99.9% identical to SEQ ID NO: 5, an amoC2 gene that is at least about 99.9% identical to SEQ ID NO: 11, and an amoC3 gene that is at least about 99.0% identical to SEQ ID NO: 17.
[0046] In multiple embodiments, the N. eutropha bacteria (optionally pure) further include one or more of an amoA1 gene that is at least about 98.9% identical to SEQ ID NO: 7, an amo2 gene that is at least about 98.9% identical to SEQ ID NO: 13, an amoB1 gene that is at least about 99.2% identical to SEQ ID NO: 9, and an amoB2 gene that is at least about 99.2% identical to SEQ ID NO: 15.
[0047] In certain embodiments, the disclosure provides N. eutropha bacteria (optionally pure) comprising an AmoC3 protein that is at least about 99.4% identical to SEQ ID NO: 16.
[0048] In multiple embodiments, the N. eutropha bacteria (optionally pure) further comprises one or more of an AmoA1 protein that is at least about 99.0% identical to SEQ ID NO: 6, an AmoA2 protein that is at least about 99.0% identical to SEQ ID NO: 12, an AmoB1 protein that is at least about 99.6% identical to SEQ ID NO: 8, and an AmoB1 protein that is at least about 99.6% identical to SEQ ID NO: 14.
[0049] In certain embodiments, the disclosure provides N. eutropha bacteria (optionally pure) comprising one or more of a hao1 gene that is at least about 99.1% identical to SEQ ID NO: 19, a hao2 gene that is at least about 99.5% identical to SEQ ID NO: 21, and a hao3 gene that is at least about 99.3% identical to SEQ ID NO: 23.
[0050] In multiple embodiments, the N. eutropha bacteria (optionally pure) further comprises one or more of an amoA1 gene that is at least about 98.9% identical to SEQ ID NO: 7, an amo2 gene that is at least about 98.9% identical to SEQ ID NO: 13, an amoB1 gene that is at least about 99.2% identical to SEQ ID NO: 9, an amoB2 gene that is at least about 99.2% identical to SEQ ID NO: 15, an amoC1 gene that is at least about 99.9% identical to SEQ ID NO: 5, an amoC2 gene that is at least about 99.9% identical to SEQ ID NO: 11, and an amoC3 gene that is at least about 99.0% identical to SEQ ID NO: 17.
[0051] In certain embodiments, the disclosure provides N. eutropha bacteria (optionally pure) comprising one or more of a Hao1 protein that is at least about 99.6% identical to SEQ ID NO: 18, a Hao2 protein that is at least about 99.7% identical to SEQ ID NO: 20, and a Hao3 protein that is at least about 99.7% identical to SEQ ID NO: 22.
[0052] In multiple embodiments, the N. eutropha bacterium (optionally pure) further comprises an AmoA1 protein that is at least about 99.0% identical to SEQ ID NO: 6, an AmoA2 protein that is at least about 99.0% identical to SEQ ID NO: 12, an AmoB1 protein that is at least about 99.6% identical to SEQ ID NO: 8, an AmoB1 protein that is at least about 99.6% identical to SEQ ID NO: 14, or an AmoC3 protein that is at least about 99.4% identical to SEQ ID NO: 16.
[0053] In certain embodiments, the present disclosure provides an N. eutropha bacterium (optionally pure) that comprises one or more of a cycA1 gene that is at least about 98.1% identical to SEQ ID NO: 25, a cycA2 gene that is at least about 98.8% identical to SEQ ID NO: 27, and a cycA3 gene that is at least about 99.4% identical to SEQ ID NO: 28.
[0054] In multiple embodiments, the N. eutropha bacterium (optionally pure) further comprises one or more of an amoA1 gene that is at least about 98.9% identical to SEQ ID NO: 7, an amo2 gene that is at least about 98.9% identical to SEQ ID NO: 13, an amoB1 gene that is at least about 99.2% identical to SEQ ID NO: 9, an amoB2 gene that is at least about 99.2% identical to SEQ ID NO: 15, an amoC1 gene that is at least about 99.9% identical to SEQ ID NO: 5, an amoC2 gene that is at least about 99.9% identical to SEQ ID NO: 11, an amoC3 gene that is at least about 99.0% identical to SEQ ID NO: 17, a hao1 gene that is at least about 99.1% identical to SEQ ID NO: 19, a hao2 gene that is at least about 99.5% identical to SEQ ID NO: 21, and a hao3 gene that is at least about 99.3% identical to SEQ ID NO: 23.
[0055] In certain embodiments, the present disclosure provides an N. eutropha bacterium (optionally pure) that comprises one or more of a CycA1 protein that is at least about 99.2% identical to SEQ ID NO: 24, a CycA2 protein that is at least about 99.7% identical to SEQ ID NO: 26, and a CycA3 protein that is at least about 99.7% identical to SEQ ID NO: 28.
[0056] In multiple embodiments, the present N. eutropha bacteria (optionally pure) further comprises one or more of an AmoA1 protein that is at least about 99.0% identical to SEQ ID NO: 6, an AmoA2 protein that is at least about 99.0% identical to SEQ ID NO: 12, an AmoB1 protein that is at least about 99.6% identical to SEQ ID NO: 8, an AmoB1 protein that is at least about 99.6% identical to SEQ ID NO: 14, an AmoC3 protein that is at least about 99.4% identical to SEQ ID NO: 16, a Hao1 protein that is at least about 99.6% identical to SEQ ID NO: 18, a Hao2 protein that is at least about 99.7% identical to SEQ ID NO: 20, and a Hao3 protein that is at least about 99.7% identical to SEQ ID NO: 22.
[0057] In certain embodiments, the present disclosure provides an N. eutropha bacterium (optionally pure) that comprises one or more of a cycB1 gene that is at least about 96.8% identical to SEQ ID NO: 31 and a cycB2 gene that is at least about 97.2% identical to SEQ ID NO: 33.
[0058] In multiple embodiments, the present N. eutropha bacteria (optionally pure) further comprises one or more of an amoA1 gene that is at least about 98.9% identical to SEQ ID NO: 7, an amo2 gene that is at least about 98.9% identical to SEQ ID NO: 13, an amoB1 gene that is at least about 99.2% identical to SEQ ID NO: 9, an amoB2 gene that is at least about 99.2% identical to SEQ ID NO: 15, an amoC1 gene that is at least about 99.9% identical to SEQ ID NO: 5, an amoC2 gene that is at least about 99.9% identical to SEQ ID NO: 11, an amoC3 gene that is at least about 99.0% identical to SEQ ID NO: 17, a hao1 gene that is at least about 99.1% identical to SEQ ID NO: 19, a hao2 gene that is at least about 99.5% identical to SEQ ID NO: 21, a hao3 gene that is at least about 99.3% identical to SEQ ID NO: 23, a cycA1 gene that is at least about 98.1% identical to SEQ ID NO: 25, a cycA2 gene that is at least about 98.8% identical to SEQ ID NO: 27, and a cycA3 gene that is at least about 99.4% identical to SEQ ID NO: 28.
[0059] In certain embodiments, the disclosure provides N. eutropha bacteria (optionally pure) comprising one or more of a CycB1 protein that is at least about 97.2% identical to SEQ ID NO: 30 or a CycB2 protein that is at least about 98.8% identical to SEQ ID NO: 32.
[0060] In a plurality of embodiments, the N. eutropha bacteria (optionally pure) further comprises one or more of an AmoA1 protein that is at least about 99.0% identical to SEQ ID NO: 6, an AmoA2 protein that is at least about 99.0% identical to SEQ ID NO: 12, an AmoB1 protein that is at least about 99.6% identical to SEQ ID NO: 8, an AmoB1 protein that is at least about 99.6% identical to SEQ ID NO: 14, an AmoC3 protein that is at least about 99.4% identical to SEQ ID NO: 16, a Hao1 protein that is at least about 99.6% identical to SEQ ID NO: 18, a Hao2 protein that is at least about 99.7% identical to SEQ ID NO: 20, a Hao3 protein that is at least about 99.7% identical to SEQ ID NO: 22, a CycA1 protein that is at least about 99.2% identical to SEQ ID NO: 24, a CycA2 protein that is at least about 99.7% identical to SEQ ID NO: 26, and a CycA3 protein that is at least about 99.7% identical to SEQ ID NO: 28.
[0061] In certain embodiments, the disclosure provides N. eutropha bacteria (optionally pure) comprising one or more genes according to SEQ ID NOs: 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, and 33.
[0062] In certain embodiments, the disclosure provides N. eutropha bacteria (optionally pure) comprising one or more proteins according to SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, and 32.
[0063] In certain embodiments, the disclosure provides N. eutropha bacteria (optionally pure) comprising a protein that is a mutant with respect to at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, or all of the amino acid positions listed in Table 2 of N. eutropha strain C91.
[0064] In certain embodiments, the disclosure provides N. eutropha bacteria (optionally pure) comprising a protein that is a mutant with respect to all of the amino acid positions listed in Table 2 of N. eutropha strain C91.
[0065] In certain embodiments, the disclosure provides N. eutropha bacteria of strain D23 (optionally pure), and 25 vials of said bacteria designated as AOB D23-100 were deposited with the ATCC Patent Depository under the accession number PTA-121157 on April 8, 2014.
[0066] In multiple embodiments, the present N. eutropha bacteria (optionally pure) are transgenic.
[0067] In multiple embodiments, the present N. eutropha bacteria (optionally pure) have at least one property selected from an optimized growth rate, an optimized NH4 + oxidation rate, and an optimized resistance to NH4 + .
[0068] In multiple embodiments, the present N. eutropha bacteria (optionally pure) have at least two properties selected from an optimized growth rate, an optimized NH4 + oxidation rate, and an optimized resistance to NH4 + .
[0069] In multiple embodiments, the present N. eutropha bacteria (optionally pure) have an optimized growth rate, an optimized NH4 + oxidation rate, and an optimized resistance to NH4 + .
[0070] In multiple embodiments, the N. eutropha bacteria described herein (e.g., strain D23) are substantially free of bacteria, other ammonia-oxidizing bacteria, fungi, viruses, or pathogens (e.g., animal pathogens, e.g., human pathogens), or any combination thereof.
[0071] In certain aspects, the present disclosure provides a composition comprising the N. eutropha bacteria described herein (e.g., strain D23) and substantially free of other organisms.
[0072] In certain aspects, the present disclosure provides a composition comprising the N. eutropha bacteria described herein (e.g., strain D23) and further comprising a second organism (e.g., a second strain or species) and substantially free of other organisms (e.g., strains or species). In multiple embodiments, the second organism is an ammonia-oxidizing bacteria. In multiple embodiments, the second organism is selected from the group consisting of Nitrosomonas, Nitrosococcus, Nitrosospria, Nitrosocystis, Nitrosolobus, Nitrosovibrio, Lactobacillus, Streptococcus, and Bifidobacter, and combinations thereof.
[0073] The present disclosure also provides a composition comprising the N. eutropha bacteria described herein (e.g., strain D23) and further comprising second and third organisms (e.g., of other strains or species) and substantially free of other organisms (e.g., strains or species). The present disclosure also provides a composition comprising the N. eutropha bacteria described herein (e.g., strain D23) and further comprising 2, 3, 4, 5, 6, 7, 8, 9, or 10 other organisms (e.g., of other strains or species) and substantially free of other organisms (e.g., strains or species).
[0074] In some embodiments, the present disclosure provides a composition comprising a cell suspension of an actively dividing culture of N. eutropha bacteria having an OD600 of at least about 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.6, 0.7, or 0.8, substantially free of other organisms.
[0075] In some embodiments, the present disclosure provides a composition for topical administration comprising the N. eutropha bacteria described herein (e.g., strain D23) and a pharmaceutically or cosmetically acceptable excipient suitable for topical administration. In a plurality of embodiments, the composition is substantially free of other organisms. In a plurality of embodiments, the composition further comprises a second organism (e.g., of another strain or species). In a plurality of embodiments, the composition further comprises 2, 3, 4, 5, 6, 7, 8, 9, or 10 other organisms (e.g., of other strains or species). The second organism can be, for example, an ammonia-oxidizing bacterium. In a plurality of embodiments, the second organism is selected from the group consisting of Nitrosomonas, Nitrosococcus, Nitrosospira, Nitrosocystis, Nitrosolobus, Nitrosovibrio, Lactobacillus, Streptococcus, and Bifidobacter, and combinations thereof.
[0076] In a plurality of embodiments, the composition is a powder, cosmetic, cream, stick, aerosol, ointment, wipe, or dressing. In a plurality of embodiments, the composition further comprises a humectant, deodorant, fragrance, colorant, insect repellent, cleansing agent, or sunscreen. In a plurality of embodiments, the excipient is an anti-adhesive, binder, coating agent, disintegrant, filler, flavor, color, lubricant, glidant, adsorbent, preservative, or sweetener. In a plurality of embodiments, the concentration of N. eutropha in the composition is about 10 11 ~10 13 CFU / L. In a plurality of embodiments, the concentration of N. eutropha in the composition is about 10 9It is CFU / ml. In a plurality of embodiments, the mass ratio of N. eutropha to the pharmaceutical excipient can be from about 0.1 grams / L to about 100 grams / L. In some embodiments, the mass ratio of N. eutropha to the pharmaceutical excipient is 1 gram / L.
[0077] In some aspects, the composition and / or excipient can be in one or more of the forms of a liquid, solid, or gel. For example, liquid suspensions can include, but are not limited to, water, physiological saline, phosphate buffered saline, or ammonia oxidation storage buffer. Gel formulations can include, but are not limited to, agar, silica, polyacrylic acid (e.g., Carbopol®), carboxymethyl cellulose, starch, guar gum, alginate, or chitosan. In some embodiments, the formulation may be supplemented with an ammonia source including, but not limited to, ammonium chloride or ammonium sulfate. In some aspects, the present disclosure provides a composition containing at least about 10 11 CFU / L, 10 12 CFU / L, 10 13 CFU / L of the N. eutropha bacteria (e.g., strain D23) described herein in at least about 10, 20, 50, 100, 200, 500, 1,000, 2,000, or 10,000 L. In some embodiments, the composition has a concentration of at least about 10 9 CFU / L, 10 10 CFU / L, 10 11 CFU / L, or 10 12 CFU / L. In some aspects, the present disclosure provides a composition containing at least about 1, 2, 5, 10, 20, 50, 100, 200, or 500 g of the N. eutropha bacteria described herein as a dry formulation such as a powder.
[0078] In some embodiments, the present disclosure provides a clothing item comprising N. eutropha (e.g., strain D23) as described herein. In multiple embodiments, the clothing item is packaged. In multiple embodiments, the clothing item is packaged in a material that is resistant to gas exchange or a material that is resistant to water. The clothing item may be provided at a concentration that provides, for example, treatment or prevention of skin disorders, treatment or prevention of diseases or conditions associated with low nitrite levels, treatment or prevention of body odor, treatment for supplying nitric oxide to a subject, or treatment for inhibiting microbial growth.
[0079] In some embodiments, the present disclosure provides a fabric comprising N. eutropha (e.g., strain D23) as described herein.
[0080] In some embodiments, the present disclosure provides a knitting yarn comprising N. eutropha (e.g., strain D23) as described herein.
[0081] In some embodiments, the present disclosure provides a sewing thread comprising N. eutropha (e.g., strain D23) as described herein.
[0082] In some embodiments, the present disclosure provides a method of obtaining, e.g., manufacturing, (optionally pure) N. eutropha bacteria having an optimized growth rate, an optimized NH4 + oxidation rate, or an optimized resistance to NH4 + (a) culturing the bacteria under conditions that select for one or more of an optimized growth rate, an optimized NH4 (a) culturing the bacteria under conditions that select for one or more of an optimized growth rate, an optimized NH4 + oxidation rate, or an optimized resistance to NH4 + thereby producing a culture; (b) testing a sample from this culture for an optimized growth rate, an optimized NH4 + oxidation rate, or an optimized resistance to NH4 + and (c) an optimized growth rate, an optimized NH4 (c) culturing the bacteria under conditions that select for one or more of an optimized growth rate, an optimized NH4 + oxidation rate, or an optimized resistance to NH4 +Provided is a method comprising repeating a culturing step and a testing step until a bacterium having optimization resistance to [the relevant factor] is obtained.
[0083] In a plurality of embodiments, the method comprises obtaining N. eutropha bacteria from a source such as soil or an individual's skin. In a plurality of embodiments, culturing the bacteria under conditions of selecting one or more (e.g., two or three) of an optimized growth rate, an optimized NH4 + oxidation rate, or an optimization resistance to NH4 + comprises culturing the bacteria in an N. europaea medium containing about 200 mM of NH4 + . In a plurality of embodiments, the method comprises the step of producing a pure culture. In a plurality of embodiments, the method comprises co-culturing the N. eutropha with at least one other type of ammonia-oxidizing bacteria. In a plurality of embodiments, the N. eutropha in step (a) lacks an optimized growth rate, an optimized NH4 + oxidation rate, and an optimization resistance to NH4 + . In a plurality of embodiments, step (c) comprises repeating the culturing step and the testing step until a bacterium having at least two of an optimized growth rate, an optimized NH4 + oxidation rate, and an optimization resistance to NH4 + is obtained.
[0084] In some aspects, the present disclosure provides the N. eutropha bacteria (e.g., strain D23) described herein produced by the method described above.
[0085] In some aspects, the present disclosure is a method of testing an (optionally pure) N. eutropha preparation, comprising assaying the N. eutropha for one or more of an optimized growth rate, an optimized NH4 + oxidation rate, or an optimization resistance to NH4 + ; and wherein the N. eutropha has an optimized growth rate, an optimized NH4 + oxidation rate, or...+ If it has one or more of the optimization tolerances for [the relevant factor], classifying this N. eutropha as acceptable, and, a method is provided that includes this.
[0086] In multiple embodiments, the method further includes testing the preparation for contaminating organisms. In multiple embodiments, the method further includes taking a sample from the preparation and testing the sample. In multiple embodiments, the method further includes testing the medium in which this N. eutropha is cultured. In multiple embodiments, the method further includes packaging N. eutropha from the preparation into a package. In multiple embodiments, the method further includes commercializing N. eutropha from the preparation.
[0087] In some aspects, the present disclosure provides a method for generating, for example, manufacturing N. eutropha, including contacting N. eutropha with a culture medium and culturing this N. eutropha until an OD600 of at least about 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 is reached. In some embodiments, the method includes culturing this N. eutropha until an OD600 of about 0.3 - 0.4, 0.4 - 0.5, 0.5 - 0.6, 0.6 - 0.7, or 0.7 - 0.8 is reached.
[0088] In multiple embodiments, the method further includes assaying this N. eutropha and this culture medium for contaminating organisms. In multiple embodiments, the method further includes assaying this N. eutropha for one or more (e.g., two or three) of the optimized growth rate, optimized NH4 + oxidation rate, or optimization tolerance for NH4 + In multiple embodiments, the method further includes assaying this N. eutropha for one or more (e.g., two or three) of the optimized growth rate, optimized NH4 oxidation rate, or optimization tolerance for NH4. In multiple embodiments, the method includes, for example, about 10 12Including generating at least about 10, 20, 50, 100, 200, 500, 1,000, 2,000, 5,000, or 10,000 L / day of N. eutropha at CFU / L. In some embodiments, this N. eutropha is about 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 CFU / L in concentration. In some embodiments, this N. eutropha is at least about 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 CFU / L in concentration.
[0089] In some aspects, the present disclosure is a method of generating, e.g., manufacturing N. eutropha, comprising contacting N. eutropha with a culture medium and culturing the N. eutropha until at least about 1,000 L of N. eutropha is generated at about 10 12 CFU / L.
[0090] In multiple embodiments, the method further comprises assaying the N. eutropha for one or more (e.g., two or three) of an optimized growth rate, an optimized NH4 + oxidation rate, or an optimized tolerance to NH4 + .
[0091] In multiple embodiments, the method further comprises testing the N. eutropha or the culture medium for contaminating organisms. In multiple embodiments, the N. eutropha contacting the culture medium is N. eutropha having one or more (e.g., two or three) of an optimized growth rate, an optimized NH4 + oxidation rate, or an optimized tolerance to NH4 + .
[0092] In some embodiments, the disclosure is a method of producing, e.g., manufacturing, N. eutropha, comprising: (a) contacting N. eutropha with a culture medium; and (b) culturing the N. eutropha for 1 to 2 days until the culture reaches an OD600 of about 0.5 - 0.6, thereby producing the culture.
[0093] In multiple embodiments, the method further comprises assaying the N. eutropha for one or more of an optimized growth rate, an optimized NH4 + oxidation rate, or an optimized resistance to NH4 + . In multiple embodiments, the method further comprises testing the culture for contaminating organisms, e.g., bacteria, viruses, fungi, or pathogens, or combinations thereof. In multiple embodiments, the N. eutropha of step (a) is N. eutropha having one or more (e.g., two or three) of an optimized growth rate, an optimized NH4 + oxidation rate, or an optimized resistance to NH4 + . In multiple embodiments, the method comprises producing at least about 1,000 L / day of N. eutropha at about 10 12 CFU / L.
[0094] In some embodiments, the disclosure provides N. eutropha bacteria produced by the methods described above.
[0095] In multiple embodiments, an N. eutropha preparation produced by the methods described above. In some embodiments, the preparation can contain from about 0.1 milligram to about 100 milligrams (mg) of N. eutropha.
[0096] In some embodiments, a reaction mixture comprising N. eutropha with an optical density of about 0.5 to about 0.6 may be provided. In some embodiments, the present disclosure provides a method of producing a fabric having N. eutropha, the method comprising contacting a fabric article with N. eutropha as described herein (e.g., strain D23).
[0097] In a plurality of embodiments, the method comprises creating at least 10, 100, or 1000 fabric articles. In a plurality of embodiments, the method comprises contacting the fabric article with at least 10 10 CFU of N. eutropha. In a plurality of embodiments, the method further comprises packaging the fabric.
[0098] In certain embodiments, the present disclosure provides a method of obtaining a formulation of N. eutropha, the method comprising combining contacting N. eutropha as described herein (e.g., strain D23) with a pharmaceutically or cosmetically acceptable excipient.
[0099] In a plurality of embodiments, the method further comprises mixing the N. eutropha and the excipient. In a plurality of embodiments, the method is performed under conditions substantially free of contaminating organisms, such as bacteria, viruses, fungi, or pathogens.
[0100] In certain embodiments, the present disclosure provides a method of packaging N. eutropha, the method comprising combining N. eutropha as described herein (e.g., strain D23) into a package.
[0101] In a plurality of embodiments, the package is resistant to gas exchange or resistant to water. In a plurality of embodiments, the package is permeable to gas exchange, NH3, NH4 + , or NO2 - .
[0102] In certain embodiments, the present disclosure provides a method of inhibiting microbial growth on the skin of a subject, the method comprising topically administering to a subject in need thereof an effective dose of the N. eutropha bacteria described herein (e.g., strain D23).
[0103] In a plurality of embodiments, this effective dose is approximately 1×10 9 CFU, 2×10 9 CFU, 5×10 9 CFU, 1×10 10 CFU, 1.5×10 10 CFU, 2×10 10 CFU, 5×10 10 CFU, or 1×10 11 CFU. In a plurality of embodiments, this effective dose is at least about 1×10 9 CFU, 2×10 9 CFU, 5×10 9 CFU, 1×10 10 CFU, 1.5×10 10 CFU, 2×10 10 CFU, 5×10 10 CFU, or 1×10 11 CFU. In a plurality of embodiments, this effective dose is approximately 1×10 9 CFU to 2×10 9 CFU, 2×10 9 CFU to 5×10 9 CFU, 5×10 9 CFU to 1×10 10 CFU, 1×10 10 CFU to 1.5×10 10 CFU, 1×10 10 CFU to 2×10 10 CFU, 1.5×10 10 CFU to 2×10 10 CFU, 2×10 10 CFU to 5×10 10 CFU, or 5×10 10 CFU to 1×10 11 CFU. In a plurality of embodiments, the bacteria are about 1×10 8 , 2×10 8 , 5×10 8 , 1×10 9, 2×10 9 , 5×10 9 , or 1×10 10 CFU / ml and administered. In a plurality of embodiments, the bacterium is at least about 1×10 8 , 2×10 8 , 5×10 8 , 1×10 9 , 2×10 9 , 5×10 9 , or 1×10 10 CFU / ml and administered. In a plurality of embodiments, the bacterium is about 1×10 8 ~2×10 8 , 2×10 8 ~5×10 8 , 5×10 8 ~1×10 9 , 1×10 9 ~2×10 9 , 2×10 9 ~5×10 9 , or 5×10 9 ~1×10 10 CFU / ml and administered. In a plurality of embodiments, the administration is performed twice a day. In a plurality of embodiments, the subject is human. In a plurality of embodiments, the microbial growth to be inhibited is the growth of Pseudomonas aeruginosa or Staphylococcus aureus (S. aureus or SA), Streptococcus pyogenes (S. pyogenes or SP), or Acinetobacter baumannii (A. baumannii or AB).
[0104] In certain embodiments, the present disclosure provides a method of supplying nitric oxide to a subject, the method comprising positioning an effective dose of the N. eutropha bacteria described herein (e.g., strain D23) in close proximity to the subject.
[0105] In certain embodiments, the present disclosure provides a method of reducing body odor, the method comprising topically administering an effective dose of the N. eutropha bacteria described herein (e.g., strain D23) to a subject in need thereof.
[0106] In certain embodiments, the present disclosure provides a method of treating a disease associated with low nitrite levels, the method comprising topically administering a therapeutically effective dose of the N. eutropha bacteria (e.g., strain D23) described herein to a subject in need thereof.
[0107] In a plurality of embodiments, the disease is HIV dermatitis, an infection in a diabetic foot ulcer, atopic dermatitis, acne, such as acne vulgaris, eczema, contact dermatitis, an allergic reaction, psoriasis, a skin infection, a vascular disorder, a vaginal yeast infection, a sexually transmitted disease, a heart disease, atherosclerosis, alopecia, a leg ulcer following diabetes or bed confinement, angina, particularly chronic stable angina, an ischemic disorder, congestive heart failure, myocardial infarction, ischemia-reperfusion injury, laminitis, hypertension, hypertrophic organ degeneration, Raynaud's phenomenon, fibrosis, fibrotic organ degeneration, an allergy, an autoimmune sensitization, end-stage renal disease, obesity, erectile dysfunction, or cancer.
[0108] In certain embodiments, the present disclosure provides a method of treating a skin disorder, the method comprising topically administering a therapeutically effective dose of the N. eutropha bacteria (e.g., strain D23) described herein to a subject in need thereof. In related embodiments, the present disclosure provides the N. eutropha bacteria (e.g., strain D23) described herein for treating a disorder such as a skin disorder. In related embodiments, the present disclosure provides the N. eutropha bacteria (e.g., strain D23) described herein for manufacturing a medicament, e.g., a medicament for treating a skin disorder.
[0109] In multiple embodiments, the skin disorder is acne, such as acne vulgaris, rosacea, eczema, or psoriasis. In some embodiments, the skin disorder is an infection in an ulcer, such as a venous ulcer, such as a lower leg ulcer, such as a venous lower leg ulcer, such as a diabetic foot ulcer. In some embodiments, topical administration includes pre-treating the subject with N. eutropha, such as N. eutropha described herein. In some embodiments, topical administration includes topical administration before the onset of the skin disorder. In some embodiments, topical administration includes topical administration after the onset of the skin disorder.
[0110] In certain aspects, the present disclosure provides a method of promoting wound healing or closure, the method comprising administering to the wound an effective dose of an N. eutropha bacterium (e.g., strain D23) described herein. In related aspects, the present disclosure provides an N. eutropha bacterium (e.g., strain D23) described herein for promoting wound healing. In related aspects, the present disclosure provides an N. eutropha bacterium (e.g., strain D23) described herein for manufacturing a medicament, such as a medicament for promoting wound healing.
[0111] In multiple embodiments, the wound contains one or more undesirable bacteria, such as pathogenic bacteria. In multiple embodiments, the wound contains S. aureus, P. aeruginosa, P. aeroginosa, or A. baumannii.
[0112] In multiple embodiments, the N. eutropha is administered to the subject before the onset of the wound. In multiple embodiments, administering to the wound includes administering to the subject before the onset of the wound. In multiple embodiments, the method further comprises administering N. eutropha (e.g., N. eutropha described herein, e.g., strain D23) to the wound after the onset of the wound. In some aspects, the present disclosure provides a method of killing or inhibiting the growth of pathogenic bacteria, the method comprising contacting the skin with an N. eutropha bacterium (e.g., N. eutropha described herein, e.g., strain D23), such as by applying it thereto.
[0113] In multiple embodiments, this pathogenic bacterium contributes to one or more of the following conditions: HIV dermatitis, ulcers such as venous ulcers such as lower leg ulcers such as venous lower leg ulcers such as diabetic foot ulcers, atopic dermatitis, acne such as acne vulgaris, eczema, contact dermatitis, allergic reactions, psoriasis, urticaria, rosacea, skin infections, vascular diseases, vaginal yeast infections, sexually transmitted diseases, heart diseases, atherosclerosis, alopecia, diabetes or lower leg ulcers following bed restraint, angina, particularly chronic stable angina, ischemic diseases, congestive heart failure, myocardial infarction, ischemia-reperfusion injury, laminitis, hypertension, hypertrophic organ degeneration, Raynaud's phenomenon, fibrosis, fibrotic organ degeneration, allergies, autoimmunization, end-stage renal disease, obesity, erectile dysfunction, pneumonia, primary immunodeficiency, epidermolysis bullosa, or cancer.
[0114] In multiple embodiments, the condition is an ulcer such as a venous ulcer such as a lower leg ulcer such as a venous lower leg ulcer such as an infection in a diabetic foot ulcer. In multiple embodiments, the condition is a venous lower leg ulcer. In multiple embodiments, the condition is acne such as acne vulgaris. In multiple embodiments, the condition is acne vulgaris. In multiple embodiments, this pathogenic bacterium is one or more of Propionibacterium acnes, Pseudomonas aeruginosa, Staphylococcus aureus, Streptococcus pyogenes, or Acinetobacter baumannii. In multiple embodiments, the method further includes determining whether the subject requires killing or growth inhibition of the pathogenic bacterium, for example, determining that the subject requires killing or growth inhibition of the pathogenic bacterium. In multiple embodiments, the method further includes selecting a subject who requires killing or growth inhibition of the pathogenic bacterium.
[0115] In some embodiments, this N. eutropha catalyzes the following reactions.
[0116] At neutral pH, ammonia generated from ammonium under approximately neutral pH conditions is the initial reaction substrate. The conversion of ammonia to nitrite occurs in two steps, each catalyzed by ammonia monooxygenase (Amo) and hydroxylamine oxidoreductase (Hao), respectively, as follows.
Chemical formula
[0117] In some examples, reaction B is reported to exhibit nitrous acid (HNO2) formation at low pH, as follows.
Chemical formula
[0118] In certain embodiments, this N. eutropha has a doubling time of less than 4, 5, 6, 7, 8, 9, or 10 hours, such as about 8 hours, such as 7 - 9 hours or 6 - 10 hours when grown under batch culture conditions. In some embodiments, the doubling time is at least 3, 4, 5, or 6 hours under batch culture conditions. In some embodiments, this N. eutropha has a doubling time of less than 16, 18, 20, 22, 24, or 26 hours, such as about 20 hours, such as 19 - 21 hours or 18 - 22 hours when grown under chemostat (i.e., continuous culture) conditions. In some embodiments, the doubling time is at least 10, 12, 14, 16, or 18 hours under chemostat conditions.
[0119] In certain embodiments, a continuous culture of N. eutropha with an OD600 of about 0.15 - 0.18 can reach an OD600 of about 0.5 - 0.6 in about 1 - 2 days. For example, in some embodiments, a continuous culture of N. eutropha can grow from an OD600 of about 0.15 to at least 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 OD600 over about 1 day, and in multiple embodiments, the culture can reach an OD in the range of 0.4 - 0.6 or 0.3 - 0.7 over about 1 day. In multiple embodiments, a continuous culture of N. eutropha can grow from an OD600 of about 0.15 to at least 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 OD600 over about 2 days, and in multiple embodiments, the culture can reach an OD in the range of 0.4 - 0.6 or 0.3 - 0.7 over about 2 days. In some embodiments, the continuous culture conditions include growth in a bioreactor in N. europaea medium optionally containing about 200 mM NH4 + including growth in a bioreactor in N. europaea medium optionally containing about 200 mM NH4. In some embodiments, the continuous culture conditions are the conditions presented in Example 2.
[0120] In certain embodiments, the present N. eutropha can convert NH4 - (e.g., about 200 mM) to nitrite (e.g., reaching up to about 180 mM) at a rate of at least about 50, 75, 125, or 150 micromoles NO2 - / min, e.g., about 100 - 150, 75 - 175, 75 - 125, 100 - 125, 125 - 150, or 125 - 175 micromoles / min, e.g., about 125 micromoles NO2 + / min. In some embodiments, the reaction rate is measured in a about 1 L chemostat culture of about 10 9 CFU / ml over 24 hours.
[0121] In certain embodiments, the present N. eutropha can grow in a medium containing at least 50 mM, 75 mM, 100 mM, 125 mM, 150 mM, 175 mM, 200 mM, 225 mM, 250 mM, 275 mM, or 300 mM, for example, about 150 - 200, 175 - 225, 200 - 250, 225 - 275, 250 - 300 mM, for example, about 200 mM or about 250 mM of NH4 + (or NH3). In certain embodiments, the present N. eutropha grows in a bioreactor at these ammonium concentrations. In some embodiments, when the present N. eutropha grows at these ammonium concentrations, the concentration of nitrate or nitrite can reach at least 60, 80, 100, 120, 140, 160, or 180 mM, for example, about 140 - 180, 160 - 200, or 140 - 200 mM, for example, about 160 mM or 180 mM.
[0122] In certain aspects, the present disclosure provides a high - density culture of N. eutropha, such as N. eutropha strain D23. For example, the high - density culture composition may include a cell suspension of a vigorously dividing culture of N. eutropha bacteria having an OD600 of at least about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, or 0.7, for example, about 0.2 - 0.6, 0.3 - 0.6, 0.4 - 0.6, 0.5 - 0.6, or 0.4 - 0.7, and the composition is substantially free of other organisms.
[0123] In some embodiments, the present N. eutropha is stable for at least 2 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months when stored at 4°C. In some embodiments, the storage method includes resuspending the cells in a buffer containing one or more of Na2HPO4 and MgCl2, for example, 50 mM Na2HPO4 and 2 mM MgCl2, for example, the storage buffer described in Example 2. For example, the storage conditions can be the conditions specified in Example 2. In some embodiments, the present N. eutropha is treated with 200 mM NH4 before storage at 4°C +(pH 6 to 8, for example, 7) and cultured continuously. Stability may include one or more of 1) retention of viability, 2) retention of related properties such as the ability to produce a given level of nitrite.
[0124] In certain embodiments, NH4 + and NH3 may be used synonymously throughout this disclosure.
[0125] This disclosure provides, inter alia, a method of altering the composition of a subject's skin microbiome. The method includes administering, for example, applying a preparation comprising ammonia-oxidizing bacteria to the surface of the skin, and the amount and frequency of administration, for example, application, are sufficient to reduce the proportion of pathogenic bacteria on the surface of the skin.
[0126] In some embodiments, the ammonia-oxidizing bacteria are ubiquitous Gram-negative obligate chemolithoautotrophic bacteria that have the unique ability to generate energy solely from the conversion of ammonia to nitrite.
[0127] In some embodiments, the method may further include selecting a subject based on a subject in need of a reduction in the proportion of pathogenic bacteria on the surface of the skin.
[0128] In some embodiments, the preparation comprising ammonia-oxidizing bacteria comprises at least one of ammonia, ammonium salts, and urea.
[0129] In some embodiments, the preparation comprising ammonia-oxidizing bacteria comprises a release control material, for example, a sustained release material.
[0130] In some embodiments, the ammonia-oxidizing bacteria preparation comprises one of excipients, such as a pharmaceutically acceptable excipient or a cosmetically acceptable excipient. One of the excipients, such as a pharmaceutically acceptable excipient and a cosmetically acceptable excipient, may be suitable for one of topical administration, nasal administration, pulmonary administration, and gastrointestinal administration. One of the excipients, such as a pharmaceutically acceptable excipient and a cosmetically acceptable excipient, may be a surfactant. The surfactant may be selected from the group consisting of cocoamidopropyl betaine (ColaTeric COAB), polyethylene sorbitol ester (e.g., Tween 80), ethoxylated lauryl alcohol (RhodaSurf 6 NAT), sodium lauryl sulfate / sodium lauryl glucoside / cocoamidopropyl betaine (Plantapon 611 L UP), sodium lauryl sulfate (e.g., RhodaPex ESB 70 NAT), alkyl polyglucoside (e.g., Plantaren 2000 N UP), sodium lauryl sulfate (Plantaren 200), Dr. Bronner's Castile soap, lauramine oxide (ColaLux Lo), sodium dodecyl sulfate (SDS), alkyl polyglucoside polysulfonate (PolySufanate 160 P), sodium lauryl sulfate (Stepanol-WA Extra K), and any combination thereof. Dr. Bronner's Castile soap contains water, organic coconut oil, potassium hydroxide, organic olive oil, fair trade organic hemp oil, organic jojoba oil, citric acid, and tocopherol. In some embodiments, the excipient comprises one or more, for example, all, of water, organic coconut oil, potassium hydroxide, organic olive oil, fair trade organic hemp oil, organic jojoba oil, citric acid, and tocopherol.
[0131] In some embodiments, the preparation may be substantially free of other organisms.
[0132] In some embodiments, the preparation is disposed in a powder, a cosmetic, a cream, a stick, an aerosol, an ointment, a wipe, or a bandage. The preparation may be provided as a powder, a cosmetic, a cream, a stick, an aerosol, an ointment, a wipe, or a bandage.
[0133] In some embodiments, the preparation may contain a humectant, a deodorant, a fragrance, a coloring agent, an insect repellent, a cleansing agent, or a UV blocker.
[0134] In some embodiments, excipients, such as pharmaceutically acceptable excipients or cosmetically acceptable excipients, may include an anti-adhesive, a binder, a coating agent, a disintegrant, a filler, a flavoring agent, a color, a lubricant, a glidant, an adsorbent, a preservative, or a sweetening agent.
[0135] In some embodiments, the preparation containing ammonia-oxidizing bacteria is about 10 8 ~ about 10 14 CFU / L. In certain embodiments, the preparation may contain about 1×10 9 CFU / L to about 10×10 9 CFU / L.
[0136] In some embodiments, the preparation containing ammonia-oxidizing bacteria may contain about 50 milligrams (mg) to about 1000 mg of ammonia-oxidizing bacteria.
[0137] In some embodiments, the mass ratio of ammonia-oxidizing bacteria to an excipient, such as a pharmaceutically acceptable excipient or a cosmetically acceptable excipient, ranges from about 0.1 gram / L to about 1 gram / L.
[0138] In some embodiments, the ammonia-oxidizing bacteria preparation is useful for the treatment or prevention of diseases or conditions associated with low nitrite levels, the treatment or prevention of body odor, the treatment for supplying nitric oxide, or the treatment for inhibiting microbial growth, such as pathogenic bacteria growth.
[0139] In some embodiments, the ammonia-oxidizing bacteria are selected from the group consisting of Nitrosomonas, Nitrosococcus, Nitrosospira, Nitrosocystis, Nitrosolobus, Nitrosovibrio, and combinations thereof. The preparation may further comprise an organism selected from the group consisting of Lactobacillus, Streptococcus, Bifidobacter, and combinations thereof. In certain embodiments, the preparation consists essentially of organisms other than ammonia-oxidizing bacteria.
[0140] In some embodiments, the preparation comprising ammonia-oxidizing bacteria may comprise ammonia-oxidizing bacteria in a growth state. In some embodiments, the preparation comprising ammonia-oxidizing bacteria may comprise ammonia-oxidizing bacteria in a storage state.
[0141] In some embodiments, the methods of the present disclosure can be used to provide cosmetic products. In some embodiments, the methods of the present disclosure can be used to provide therapeutic products. The preparation can be useful for the treatment of at least one of HIV dermatitis, infections in diabetic foot ulcers, atopic dermatitis, acne, such as acne vulgaris, eczema, contact dermatitis, allergic reactions, psoriasis, urticaria, rosacea, skin infections, vascular diseases, vaginal yeast infections, sexually transmitted diseases, heart diseases, atherosclerosis, alopecia, diabetes or lower leg ulcers following bed confinement, angina, particularly chronic stable angina, ischemic diseases, congestive heart failure, myocardial infarction, ischemia-reperfusion injury, laminitis, hypertension, hypertrophic organ degeneration, Raynaud's phenomenon, fibrosis, fibrotic organ degeneration, allergies, autoimmune sensitization, end-stage renal disease, obesity, erectile dysfunction, pneumonia, primary immunodeficiency, epidermolysis bullosa, or cancer.
[0142] In certain embodiments, the preparation can be useful for the treatment of at least one of acne, such as acne vulgaris, eczema, psoriasis, urticaria, rosacea, and skin infections.
[0143] In some embodiments, the preparation can be provided in a container, and the preparation and the container have a weight of less than about 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or 2000 grams.
[0144] In some embodiments, the preparation has a surfactant of from about 0.1% to less than about 10%. In certain embodiments, the preparation may be substantially free of surfactant.
[0145] In some embodiments, the preparation may contain a chelating agent. In some embodiments, the preparation may be substantially free of chelating agent.
[0146] In some embodiments, the method may include applying the preparation about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 times a day. In certain embodiments, the preparation may be applied once a day. In certain other embodiments, the preparation may be applied twice a day.
[0147] In some embodiments, the preparation may be applied for about 1 - 3, 3 - 5, 5 - 7, 7 - 9, 5 - 10, 10 - 14, 12 - 18, 12 - 21, 21 - 28, 28 - 35, 35 - 42, 42 - 49, 49 - 56, 46 - 63, 63 - 70, 70 - 77, 77 - 84, or 84 - 91 days. In certain embodiments, the preparation may be applied for about 16 days.
[0148] In some embodiments, the method may further include obtaining a sample from the surface of the skin. In certain embodiments, the method may further include isolating the DNA of bacteria in the sample. In certain embodiments, the method may further include sequencing the DNA of bacteria in the sample.
[0149] In some embodiments, administration of ammonia-oxidizing bacteria provides an increase in the proportion of non-pathogenic bacteria on the surface. In certain embodiments, the non-pathogenic bacteria can be commensal non-pathogenic bacteria. In certain embodiments, the non-pathogenic bacteria are commensal non-pathogenic bacteria of the genus Staphylococcus. In certain embodiments, the non-pathogenic bacteria can be the commensal non-pathogenic bacterium Staphylococcus epidermidis.
[0150] In some embodiments, the proportion of non-pathogenic Staphylococcus bacteria increases or is determined to increase after about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks. In certain embodiments, the proportion of the non-pathogenic bacterium Staphylococcus epidermidis increases or is determined to increase after about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks.
[0151] In some embodiments, potentially pathogenic Propionibacteria or Propionibacteria associated with disease decrease or are determined to decrease after about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks.
[0152] In some embodiments, potentially pathogenic Stenotrophomonas or Stenotrophomonas associated with disease decrease or are determined to decrease after about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks.
[0153] In some embodiments, the surface of the skin includes a wound.
[0154] In some embodiments, methods for treating acne, such as acne vulgaris, may be provided by one or more of the methods of the present disclosure. In some embodiments, methods for treating eczema may be provided by one or more of the methods of the present disclosure. In some embodiments, methods for treating psoriasis may be provided by one or more of the methods of the present disclosure. In some embodiments, methods for treating urticaria may be provided by one or more of the methods of the present disclosure. In some embodiments, methods for treating rosacea may be provided by one or more of the methods of the present disclosure. In some embodiments, methods for treating skin infections may be provided by one or more of the methods of the present disclosure. In some embodiments, a method for reducing the amount of undesirable bacteria on the surface of a subject is provided.
[0155] In some embodiments, the methods herein (e.g., methods of administering bacteria of N. eutropha, such as bacteria of strain D23, to a subject in need thereof) further comprise treating the subject with an antibiotic. In multiple embodiments, the antibiotic is tetracycline, a lincosamide (such as clindamycin), a macrolide (such as erythromycin), an aminoglycoside (such as gentamicin), a β-lactam (such as piperacillin), a β-lactamase inhibitor (such as tazobactam), or any combination thereof (such as a combination of a β-lactam (such as piperacillin) and a β-lactamase inhibitor (such as tazobactam)). In some embodiments, the antibiotic is an antibiotic to which the bacteria are sensitive. In multiple embodiments, the antibiotic is administered after the bacteria have achieved the desired therapeutic effect. In multiple embodiments, the antibiotic is an antibiotic to which the bacteria are resistant. In multiple embodiments, the antibiotic is administered before or while the bacteria are producing their therapeutic effect.
[0156] It is understood that the compositions and methods herein involving bacteria may also involve multiple bacteria. For example, a method of administering bacteria of N. eutropha may also involve administering multiple bacteria of N. eutropha.
[0157] In certain aspects, the present disclosure also provides a nucleic acid comprising a sequence of consecutive nucleotides (e.g., 15 to 100 nucleotides) from the D23 genome, such as the genes provided herein, e.g., the sequences of the genes set forth in Table 1, FIGS. 6-8, or Supplementary Table 1, or SEQ ID NO: 66, or the reverse complement of any of the foregoing. In related aspects, the present disclosure provides a nucleic acid comprising a sequence of consecutive nucleotides (e.g., 15 to 100 nucleotides) from SEQ ID NO: 1 or the reverse complement thereof. In related aspects, the present disclosure provides a nucleic acid comprising a sequence of consecutive nucleotides (e.g., 15 to 100 nucleotides) from the genes of Table 1 (e.g., the sequences of SEQ ID NOs: 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, or 33), or the reverse complement thereof.
[0158] In some embodiments, the present nucleic acid has a sequence that does not occur naturally, or another modification such as a label, or both. In some embodiments, the sequence of contiguous nucleotides is not the sequence found in N. eutropha strain C91. In some embodiments, the present nucleic acid comprises a heterologous sequence 5' to a sequence of 15 to 100 contiguous nucleotides, or a heterologous sequence 3' to a sequence of 15 to 100 contiguous nucleotides, or both. In some embodiments, the present nucleic acid has a nucleotide length of 10 - 15, 15 - 20, 20 - 25, 25 - 30, 30 - 24, 35 - 40. In some embodiments, the present nucleic acid is bound, for example covalently, to a detectable label, such as a fluorescent label. In some embodiments, the present nucleic acid comprises 10 - 15, 15 - 20, 20 - 25, 25 - 30, 30 - 24, 35 - 40, 40 - 50, 50 - 60, 60 - 70, 70 - 80, 80 - 90, or 90 - 100 contiguous nucleotides from the D23 genome. In some embodiments, the present nucleic acid comprises at least about 10, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, or 1000 contiguous nucleotides from the D23 genome. In some embodiments, the present nucleic acid is DNA.
[0159] In some embodiments, the present disclosure provides a composition or kit comprising a first nucleic acid and a second nucleic acid. In some embodiments, the first nucleic acid comprises contiguous nucleotides (e.g., 15 to 100 nucleotides) from SEQ ID NO: 1, SEQ ID NO: 66, the genes of FIGS. 6-8, or the genes of Table 1, or the reverse complement thereof. In some embodiments, the second nucleic acid comprises contiguous nucleotides (e.g., 15 to 100 nucleotides) from SEQ ID NO: 1, SEQ ID NO: 66, the genes of FIGS. 6-8, or the genes of Table 1, or the reverse complement thereof. In some embodiments, the present nucleic acid has a sequence that does not occur naturally, e.g., a sequence not found in N. eutropha strain C91. In some embodiments, the first nucleic acid and the second nucleic acid define an amplicon of a gene of Table 1, e.g., the sequence of SEQ ID NO: 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, or 33, or the reverse complement thereof.
[0160] In some embodiments, the first nucleic acid has a sequence corresponding to the first region of SEQ ID NO: 1, the reverse complement of the second nucleic acid has a sequence corresponding to the second region of SEQ ID NO: 1, and the first region and the second region are separated by a distance suitable for PCR. In some embodiments, the reverse complement of the first nucleic acid has a sequence corresponding to the first region of SEQ ID NO: 1, the second nucleic acid has a sequence corresponding to the second region of SEQ ID NO: 1, and the first region and the second region are separated by a distance suitable for PCR. In one embodiment, the distance suitable for PCR is 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, or 1000 nucleotides or less of SEQ ID NO: 1. In some embodiments, the first nucleic acid and the second nucleic acid depict an amplicon of SEQ ID NO: 1. In some embodiments, the first nucleic acid and the second nucleic acid each have a melting temperature (Tm) suitable for PCR, e.g., a Tm of about 55-65°C or about 60-65°C. In some embodiments, the Tm of the first nucleic acid is within 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1°C of the Tm of the second nucleic acid.
[0161] In some embodiments, each of the first nucleic acid, the second nucleic acid, or the first and second nucleic acids further comprises a heterologous sequence on the 5' side of a sequence of consecutive nucleotides. Alternatively, or in combination, in some embodiments, each of the first nucleic acid, the second nucleic acid, or the first and second nucleic acids further comprises a heterologous sequence on the 3' side of a sequence of consecutive nucleotides from SEQ ID NO: 1 or SEQ ID NO: 66. In some embodiments, each of the first nucleic acid, the second nucleic acid, or the first and second nucleic acids has a nucleotide length of 15-20, 20-25, 25-30, 30-24, or 35-40. In some embodiments, each of the first nucleic acid, the second nucleic acid, or the first and second nucleic acids is bound, e.g., covalently, to a detectable label, e.g., a fluorescent label. In some embodiments, the first nucleic acid comprises or consists of the sequence of SEQ ID NO: 64. In some embodiments, the second nucleic acid comprises or consists of the sequence of SEQ ID NO: 65. In some embodiments, the first nucleic acid, the second nucleic acid, or both thereof are DNA.
[0162] In some embodiments, the composition or kit includes at least 2 pairs (e.g., 3, 4, 5, 6, 7, 8, 9, or 10 pairs) of primers, each pair recognizing an amplicon of a gene in Table 1 (e.g., the sequences of SEQ ID NO: 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, or 33), or its reverse complement. In some embodiments, the first pair of primers recognizes an amplicon of an Amo gene (e.g., AmoA1, AmoA2, AmoB1, AmoB2, AmoC1, AmoC2, or AmoC3), and the second pair of primers recognizes an amplicon of an Amo gene (e.g., AmoA1, AmoA2, AmoB1, AmoB2, AmoC1, AmoC2, or AmoC3). In some embodiments, the first pair of primers recognizes an amplicon of an AmoA gene (e.g., AmoA1 or AmoA2). In some embodiments, the second pair of primers recognizes an amplicon of an AmoB gene (e.g., AmoB1 or AmoB2). In some embodiments, the third pair of primers recognizes an amplicon of an AmoC gene (e.g., AmoC1, AmoC2, or AmoC3).
[0163] In some embodiments, the kit includes a first container in which a first nucleic acid is disposed and a second container in which a second nucleic acid is disposed. The kit can include, for example, additional containers for a third, fourth, fifth, or sixth nucleic acid. In some embodiments, a pair of primers that recognize an amplicon are stored in a single container.
[0164] The present disclosure also provides, in some aspects, a nucleic acid comprising or consisting of the sequence of SEQ ID NO: 64. The present disclosure also provides, in some aspects, a nucleic acid comprising or consisting of the sequence of SEQ ID NO: 65. The present disclosure also provides, in some aspects, a molecule comprising the nucleic acid described herein and a detectable label, e.g., a fluorescent label. The nucleic acid can consist of, for example, the sequence of SEQ ID NO: 64 or SEQ ID NO: 65.
[0165] In some aspects, the present disclosure provides a composition comprising a first molecule and a second molecule. In some embodiments, the first molecule comprises a nucleic acid described herein, for example, a nucleic acid consisting of the sequence of SEQ ID NO: 64, and optionally comprises a detectable label, such as a fluorescent label. In some embodiments, the second molecule comprises a nucleic acid described herein, for example, a nucleic acid consisting of the sequence of SEQ ID NO: 65, and optionally comprises a detectable label, such as a fluorescent label.
[0166] In some embodiments, the kit comprises a first container in which the first molecule is disposed and a second container in which the second molecule is disposed.
[0167] In some embodiments, the kit described herein further comprises one or more of a buffer, an enzyme (e.g., a polymerase, such as a thermostable polymerase like Taq), nucleotides (e.g., dNTPs), and optionally dye-labeled chain-terminating nucleotides (e.g., dideoxynucleotides), and these components can be provided separately or as part of a single composition.
[0168] In certain aspects, the present disclosure provides a method for detecting whether D23 N.eutropha nucleic acid is present in a sample, comprising performing a polymerase chain reaction (PCR) on the sample using primers specific to D23 N.eutropha, and determining whether a PCR product is generated, wherein the presence of the PCR product indicates the presence of D23 N.eutropha nucleic acid in the sample. In multiple embodiments, at least two PCR reactions, such as 3, 4, 5, 6, 7, 8, 9, or 10 PCR reactions, are performed. In multiple embodiments, the PCR reactions are performed in separate reaction volumes. In multiple embodiments, two or more PCR reactions are performed multiplexed.
[0169] In some embodiments, the primers specific for D23 N. eutropha are the first nucleic acid and the second nucleic acid described herein, e.g., the first nucleic acid and the second nucleic acid from the compositions or kits described herein. In some embodiments, the first primer comprises or consists of the sequence of SEQ ID NO: 65, and the second primer comprises or consists of the sequence of SEQ ID NO: 66.
[0170] In some embodiments, the PCR reaction is a quantitative PCR reaction or a real-time PCR reaction. In some embodiments, the PCR reaction includes a TaqMan reaction. In some embodiments, the PCR reaction involves cycling the temperature of the reaction mixture between a denaturation temperature (e.g., about 95 °C), an annealing temperature (e.g., 45 - 68, 55 - 65, or 60 - 65 °C), and an extension temperature (e.g., about 68 °C) for a number of cycles sufficient to generate a detectable PCR product, e.g., about 10, 15, 20, 25, or 30 cycles. In some embodiments, detection of the PCR product includes detecting fluorescence from the PCR product. In some embodiments, a positive control is performed, e.g., using a known D23 N. eutropha nucleic acid as a template. In some embodiments, a negative control is used, e.g., without using a template or using another bacterial nucleic acid as a template.
[0171] In certain aspects, the disclosure provides a method for detecting whether a D23 N. eutropha nucleic acid is present in a sample, the method comprising detecting the binding of the nucleic acids described herein to the sample, wherein the presence of the binding indicates the presence of the D23 N. eutropha nucleic acid in the sample. In some embodiments, the binding is detected by primer extension or RNase protection.
[0172] In some embodiments of the methods herein, the sample comprises at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 bacterial strains. In some embodiments, the sample is derived from the skin of a subject, e.g., a human subject. In some embodiments, the methods herein comprise detecting one or more additional types of bacteria in the sample, e.g., Pseudomonas aeruginosa, Staphylococcus aureus, Streptococcus pyogenes, or Acinetobacter baumannii. The present invention provides, for example, the following items. (Item 1) Optimal growth rate, Optimal NH4+ oxidation rate, and A purified optimized Nitrosomonas eutropha (N. eutropha) bacterial preparation having at least one characteristic selected from optimal resistance to NH4+. (Item 2) The N. eutropha bacterial preparation according to item 1, wherein the optimal growth rate is a rate that enables continuous culture of N. eutropha at an OD600 (optical density at 600 nm) of about 0.15 to 0.18 and reaching an OD600 of about 0.5 to 0.6 in about 1 to 2 days. (Item 3) The N. eutropha bacterial preparation according to item 1 or 2, wherein the optimal growth rate is a doubling time of about 8 hours when cultured under batch culture conditions. (Item 4) The N. eutropha bacterial preparation according to any one of items 1 to 3, wherein the optimal NH4+ oxidation rate is a rate of at least about 125 micromoles / minute for oxidizing NH4+ to NO2-. (Item 5) The N. eutropha bacterial preparation according to any one of items 1 to 4, wherein the optimal resistance to NH4+ is the ability to grow in a medium containing about 200 mM NH4+ for at least about 48 hours. (Item 6) The N. eutropha bacterial preparation according to any one of items 1 to 5, having at least two characteristics selected from the group consisting of an optimized growth rate, an optimized NH4+ oxidation rate, and an optimized resistance to NH4+. (Item 7) The N. eutropha bacterial preparation according to any one of items 1 to 6, having an optimized growth rate, an optimized NH4+ oxidation rate, and an optimized resistance to NH4+. (Item 8) The N. eutropha bacterial preparation according to any one of items 1 to 7, comprising a chromosome that hybridizes to SEQ ID NO: 1 with very high stringency. (Item 9) An AmoA protein having identity with SEQ ID NO: 6 or 12, selected from at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identity; an AmoB protein having identity with SEQ ID NO: 8 or 14, selected from at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identity; an amoC gene having identity with SEQ ID NO: 4, 10, or 16, selected from at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identity; a hydroxylamine oxidoreductase protein having identity with SEQ ID NO: 18, 20, or 22, selected from at least 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identity; a cytochrome c554 protein having identity with SEQ ID NO: 24, 26, or 28, selected from at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identity; or a cytochrome cM552 protein having identity with SEQ ID NO: 30 or 32, selected from at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identity, the N. eutropha bacterial preparation according to any one of items 1 to 8. (Item 10) The N. eutropha bacterial preparation according to any one of items 1 to 9, comprising 1 to 5, 5 to 10, 10 to 15, 15 to 20, 20 to 25, 25 to 30, or all of the sequence characteristics in Table 2. (Item 11) The N. eutropha bacterial preparation according to item 10, comprising an AmoA1 or AmoA2 protein (or a gene encoding the same) having a mutation at position 1 of N. eutropha strain C91, for example, a mutation at position 1 of V. (Item 12) The N. eutropha bacterial preparation according to any one of items 10 to 11, comprising an AmoA1 or AmoA2 protein (or a gene encoding the same) having a mutation at position 160 of N. eutropha strain C91, for example, a mutation at position 160 of L. (Item 13) The N. eutropha bacterial preparation according to any one of items 10 to 12, comprising an AmoA1 or AmoA2 protein (or a gene encoding the same) having a mutation at position 167 of N. eutropha strain C91, for example, a mutation at position 167 of A. (Item 14) The N. eutropha bacterial preparation according to any one of items 10 to 13, comprising an AmoB1 or AmoB2 protein (or a gene encoding the same) having a mutation at position 33 of N. eutropha strain C91, for example, a mutation at position 33 of V. (Item 15) The N. eutropha bacterial preparation according to any one of items 10 to 14, comprising an AmoB1 or AmoB2 protein (or a gene encoding the same) having a mutation at position 165 of N. eutropha strain C91, for example, a mutation at position 165 of I. (Item 16) The N. eutropha bacterial preparation according to any one of items 10 to 15, comprising an AmoC3 protein (or a gene encoding the same) having a mutation at position 79 of N. eutropha strain C91, for example, a mutation at position 79 of A. (Item 17) The N. eutropha bacterial preparation according to any one of items 10 to 16, comprising an AmoC3 protein (or a gene encoding the same) having a mutation at position 271 of N. eutropha strain C91, for example, a mutation at position 271 of V. (Item 18) The N. eutropha bacterial preparation according to any one of items 10 to 17, comprising the Hao1, Hao2, or Hao3 protein (or the gene encoding the same) having a mutation at position 85 of N. eutropha strain C91, for example, the S at position 85. (Item 19) The N. eutropha bacterial preparation according to any one of items 10 to 18, comprising the Hao1, Hao2, or Hao3 protein (or the gene encoding the same) having a mutation at position 312 of N. eutropha strain C91, for example, the E at position 312. (Item 20) The N. eutropha bacterial preparation according to any one of items 10 to 19, comprising the Hao1 protein (or the gene encoding the same) having a mutation at position 163 of N. eutropha strain C91, for example, the A at position 163. (Item 21) The N. eutropha bacterial preparation according to any one of items 10 to 20, comprising the c554 CycA1, c554 CycA2, or c554 CycA3 protein (or the gene encoding the same) having a mutation at position 65 of N. eutropha strain C91, for example, the T at position 65. (Item 22) The N. eutropha bacterial preparation according to any one of items 10 to 21, comprising the c554 CycA1 protein (or the gene encoding the same) having a mutation at position 186 of N. eutropha strain C91, for example, the T at position 186. (Item 23) The N. eutropha bacterial preparation according to any one of items 10 to 22, comprising the cM552 CycB1 or cM552 CycB2 protein (or the gene encoding the same) having a mutation at position 63 of N. eutropha strain C91, for example, the V at position 63. (Item 24) An N. eutropha bacterial preparation according to any one of items 10 to 23, comprising a cM552 CycB1 or cM552 CycB2 protein (or a gene encoding the same) having a mutation at position 189 of N. eutropha strain C91, for example, a mutation at position 189 of P. (Item 25) An N. eutropha bacterial preparation according to any one of items 10 to 24, comprising a cM552 CycB1 or cM552 CycB2 protein (or a gene encoding the same) having a mutation at position 206 of N. eutropha strain C91, for example, a mutation at position 206 of insE. (Item 26) An N. eutropha bacterial preparation according to any one of items 10 to 25, comprising a cM552 CycB1 or cM552 CycB2 protein (or a gene encoding the same) having a mutation at position 207 of N. eutropha strain C91, for example, a mutation at position 207 of insE. (Item 27) An N. eutropha bacterial preparation according to any one of items 10 to 26, comprising a cM552 CycB1 protein (or a gene encoding the same) having a mutation at position 195 of N. eutropha strain C91, for example, a mutation at position 195 of insD. (Item 28) An N. eutropha bacterial preparation according to any one of items 10 to 27, comprising a cM552 CycB1 protein (or a gene encoding the same) having a mutation at position 196 of N. eutropha strain C91, for example, a mutation at position 196 of insD. (Item 29) An N. eutropha bacterial preparation according to any one of items 10 to 28, comprising a cM552 CycB1 protein (or a gene encoding the same) having a mutation at position 197 of N. eutropha strain C91, for example, a mutation at position 197 of insD. (Item 30) An N. eutropha bacterial preparation according to any one of the preceding items, comprising at least one structural difference, for example, at least one mutation, with respect to a wild-type bacterium such as N. eutropha strain C91. (Item 31) An N. eutropha bacterial preparation according to any of the preceding items, comprising a nucleic acid that can be amplified using a pair of primers described in this specification, for example, a primer containing the sequence of SEQ ID NO: 64 and a primer containing the sequence of SEQ ID NO: 65. (Item 32) An N. eutropha bacterial preparation according to any of the preceding items, comprising a nucleic acid or protein that is at least 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, or 100% identical to the gene of FIG. 6 or the protein encoded by the gene of FIG. 6. (Item 33) An N. eutropha bacterial preparation according to any of the preceding items, comprising a nucleic acid or protein that is at least 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, or 100% identical to any of the sequences of SEQ ID NOs: 64 to 66 or the protein encoded by any of the sequences of SEQ ID NOs: 64 to 66. (Item 34) An N. eutropha bacterium, or a purified preparation thereof, comprising a mutation in the ammonia monooxygenase gene, hydroxylamine oxidoreductase gene, cytochrome c554 gene, or cytochrome cm552 gene with respect to wild-type bacteria such as N. eutropha strain C91. (Item 35) The N. eutropha bacterium according to item 34, or a purified preparation thereof, wherein the mutation is in the amoA1 gene. (Item 36) The N. eutropha bacterium according to item 34, or a purified preparation thereof, wherein the mutation is in the amoA2 gene. (Item 37) The N. eutropha bacterium according to item 34, or a purified preparation thereof, wherein the mutation is in the amoB1 gene. (Item 38) The N. eutropha bacterium according to item 34, or a purified preparation thereof, wherein the mutation is in the amoB2 gene. (Item 39) The N. eutropha bacterium according to item 34, or a purified preparation thereof, wherein the mutation is in the amoC3 gene. (Item 40) The N. eutropha bacterium according to any one of items 34 to 39, or a purified preparation thereof, wherein the mutation is at the position described in this specification, for example, the position described in Table 2. (Item 41) The N. eutropha bacterium according to any one of items 34 to 39, or a purified preparation thereof, wherein the mutation is the mutation described in this specification, for example, the mutation described in Table 2. (Item 42) The N. eutropha bacterium according to item 34, or a purified preparation thereof, wherein the mutation is in the hao1 gene. (Item 43) The N. eutropha bacterium according to item 34, or a purified preparation thereof, wherein the mutation is in the hao2 gene. (Item 44) The N. eutropha bacterium according to item 34, or a purified preparation thereof, wherein the mutation is in the hao3 gene. (Item 45) The N. eutropha bacterium according to any one of items 42 to 44, or a purified preparation thereof, wherein the mutation is at the position described in this specification, for example, the position described in Table 2. (Item 46) The N. eutropha bacterium according to any one of items 42 to 44, or a purified preparation thereof, wherein the mutation is the mutation described in this specification, for example, the mutation described in Table 2. (Item 47) The N. eutropha bacterium according to item 34, or a purified preparation thereof, wherein the mutation is in the c554 cycA1 gene. (Item 48) The N. eutropha bacterium according to item 34, or a purified preparation thereof, wherein the mutation is in the c554 cycA2 gene. (Item 49) The N. eutropha bacterium according to item 34, or a purified preparation thereof, wherein the mutation is in the c554 cycA3 gene. (Item 50) The N. eutropha bacterium according to any one of items 47 to 49, or a purified preparation thereof, wherein the mutation is at the position described herein, for example, the position described in Table 2. (Item 51) The N. eutropha bacterium according to any one of items 47 to 49, or a purified preparation thereof, wherein the mutation is the mutation described herein, for example, the mutation described in Table 2. (Item 52) The N. eutropha bacterium according to item 34, or a purified preparation thereof, wherein the mutation is in the cM552 cycB1 gene. (Item 53) The N. eutropha bacterium according to item 34, or a purified preparation thereof, wherein the mutation is in the c554 cycB2 gene. (Item 54) The N. eutropha bacterium according to any one of items 52 to 53, or a purified preparation thereof, wherein the mutation is at the position described herein, for example, the position described in Table 2. (Item 55) The N. eutropha bacterium according to any one of items 52 to 53, or a purified preparation thereof, wherein the mutation is the mutation described herein, for example, the mutation described in Table 2. (Item 56) The purified optimized N. eutropha bacterium preparation according to item 1, which contains a mutation in the ammonia monooxygenase gene, hydroxylamine oxidoreductase gene, cytochrome c554 gene, or cytochrome cm552 gene. (Item 57) The purified optimized N. eutropha bacterium preparation according to item 56, wherein the mutation is in the amoA1 gene. (Item 58) The purified optimized N. eutropha bacterial preparation according to item 56, wherein the mutation is in the amoA2 gene. (Item 59) The purified optimized N. eutropha bacterial preparation according to item 56, wherein the mutation is in the amoB1 gene. (Item 60) The purified optimized N. eutropha bacterial preparation according to item 56, wherein the mutation is in the amoB2 gene. (Item 61) The purified optimized N. eutropha bacterial preparation according to item 56, wherein the mutation is in the amoC3 gene. (Item 62) The purified optimized N. eutropha bacterial preparation according to any one of items 57 - 61, wherein the mutation is at the position described herein, for example, the position described in Table 2. (Item 63) The purified optimized N. eutropha bacterial preparation according to any one of items 57 - 61, wherein the mutation is the mutation described herein, for example, the mutation described in Table 2. (Item 64) The purified optimized N. eutropha bacterial preparation according to item 56, wherein the mutation is in the hao1 gene. (Item 65) The purified optimized N. eutropha bacterial preparation according to item 56, wherein the mutation is in the hao2 gene. (Item 66) The purified optimized N. eutropha bacterial preparation according to item 56, wherein the mutation is in the hao3 gene. (Item 67) The purified optimized N. eutropha bacterial preparation according to any one of items 64 - 66, wherein the mutation is at the position described herein, for example, the position described in Table 2. (Item 68) The purified optimized N. eutropha bacterial preparation according to any one of items 64 - 66, wherein the mutation is the mutation described herein, for example, the mutation described in Table 2. (Item 69) The purified optimized N. eutropha bacterial preparation according to item 56, wherein the mutation is in the c554 cycA1 gene. (Item 70) The purified optimized N. eutropha bacterial preparation according to item 56, wherein the mutation is in the c554 cycA2 gene. (Item 71) The purified optimized N. eutropha bacterial preparation according to item 56, wherein the mutation is in the c554 cycA3 gene. (Item 72) The purified optimized N. eutropha bacterial preparation according to any one of items 69 to 71, wherein the mutation is at the position described herein, for example, the position described in Table 2. (Item 73) The purified optimized N. eutropha bacterial preparation according to any one of items 69 to 71, wherein the mutation is the mutation described herein, for example, the mutation described in Table 2. (Item 74) The purified optimized N. eutropha bacterial preparation according to item 56, wherein the mutation is in the cM552 cycB1 gene. (Item 75) The purified optimized N. eutropha bacterial preparation according to item 56, wherein the mutation is in the cM552 cycB2 gene. (Item 76) The purified optimized N. eutropha bacterial preparation according to any one of items 56, 74, and 75, wherein the mutation is at the position described herein, for example, the position described in Table 2. (Item 77) The purified optimized N. eutropha bacterial preparation according to any one of items 56, 74, and 75, wherein the mutation is the mutation described herein, for example, the mutation described in Table 2. (Item 78) The N. eutropha bacterium according to item 34, or a purified preparation thereof, having mutations at at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 positions in one or more of the amoA1 gene, amoA2 gene, amoB1 gene, amoB2 gene, amoC3 gene, hao1 gene, hao2 gene, hao3 gene, c554 cycA1 gene, c554 cycA2 gene, c554 cycA3 gene, cM552 cycB1 gene, and c554 cycB2 gene. (Item 79) The purified optimized N. eutropha bacterium preparation according to item 56, having mutations at at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 positions in one or more of the amoA1 gene, amoA2 gene, amoB1 gene, amoB2 gene, amoC3 gene, hao1 gene, hao2 gene, hao3 gene, c554 cycA1 gene, c554 cycA2 gene, c554 cycA3 gene, cM552 cycB1 gene, and c554 cycB2 gene. (Item 80) An N. eutropha bacterium containing a chromosome that hybridizes to SEQ ID NO: 1 under high stringency. (Item 81) The N. eutropha bacterium according to item 80, wherein the chromosome hybridizes to SEQ ID NO: 1 under very high stringency. (Item 82) The N. eutropha bacterium according to item 80 or 81, containing at least one of the genes in FIGS. 6-8, or a gene having at least 80% identity thereto. (Item 83) The N. eutropha bacterium according to item 80 or 81, containing at least one of the genes in FIGS. 6-8. (Item 84) An N. eutropha bacterium according to any one of Items 80 to 82, lacking any plasmid that is at least about 80% identical to Plasmid No. 2 or Plasmid No. 3. (Item 85) An N. eutropha bacterium according to any one of Items 80 to 84, lacking any plasmid. (Item 86) An N. eutropha bacterium comprising one or more of an AmoA1 gene that is at least about 98.9% identical to SEQ ID NO: 7 and an amoA2 gene that is at least about 98.8% identical to SEQ ID NO: 13. (Item 87) An N. eutropha bacterium comprising one or more of an AmoA1 protein that is at least about 99.0% identical to SEQ ID NO: 6 and an AmoA2 protein that is at least about 99.0% identical to SEQ ID NO: 12. (Item 88) An N. eutropha bacterium comprising one or more of an amoB1 gene that is at least about 99.2% identical to SEQ ID NO: 9 and an amoB2 gene that is at least about 99.2% identical to SEQ ID NO: 15. (Item 89) An N. eutropha bacterium according to Item 88, further comprising one or more of an AmoA1 gene or an amoA2 gene that is at least about 98.9% identical to SEQ ID NO: 7 or 13. (Item 90) An N. eutropha bacterium comprising one or more of an AmoB1 protein that is at least about 99.6% identical to SEQ ID NO: 8 or an AmoB1 protein that is at least about 99.6% identical to SEQ ID NO: 14. (Item 91) An N. eutropha bacterium according to Item 90, further comprising one or more of an AmoA1 protein that is at least about 99.0% identical to SEQ ID NO: 6 and an AmoA2 protein that is at least about 99.0% identical to SEQ ID NO: 12. (Item 92) An N. eutropha bacterium comprising one or more of an amoC1 gene that is at least about 99.9% identical to SEQ ID NO: 5, an amoC2 gene that is at least about 99.9% identical to SEQ ID NO: 11, and an amoC3 gene that is at least about 99.0% identical to SEQ ID NO: 17. (Item 93) The N. eutropha bacterium according to Item 92, further comprising one or more of an amoA1 gene that is at least about 98.9% identical to SEQ ID NO: 7, an amo2 gene that is at least about 98.9% identical to SEQ ID NO: 13, an amoB1 gene that is at least about 99.2% identical to SEQ ID NO: 9, and an amoB2 gene that is at least about 99.2% identical to SEQ ID NO: 15. (Item 94) An N. eutropha bacterium comprising an AmoC3 protein that is at least about 99.4% identical to SEQ ID NO: 16. (Item 95) The N. eutropha bacterium according to Item 94, further comprising one or more of an AmoA1 protein that is at least about 99.0% identical to SEQ ID NO: 6, an AmoA2 protein that is at least about 99.0% identical to SEQ ID NO: 12, an AmoB1 protein that is at least about 99.6% identical to SEQ ID NO: 8, and an AmoB1 protein that is at least about 99.6% identical to SEQ ID NO: 14. (Item 96) An N. eutropha bacterium comprising one or more of a hao1 gene that is at least about 99.1% identical to SEQ ID NO: 19, a hao2 gene that is at least about 99.5% identical to SEQ ID NO: 21, and a hao3 gene that is at least about 99.3% identical to SEQ ID NO: 23. (Item 97) The N. eutropha bacterium according to Item 96, further comprising one or more of an amoA1 gene that is at least about 98.9% identical to SEQ ID NO: 7, an amo2 gene that is at least about 98.9% identical to SEQ ID NO: 13, an amoB1 gene that is at least about 99.2% identical to SEQ ID NO: 9, an amoB2 gene that is at least about 99.2% identical to SEQ ID NO: 15, an amoC1 gene that is at least about 99.9% identical to SEQ ID NO: 5, an amoC2 gene that is at least about 99.9% identical to SEQ ID NO: 11, and an amoC3 gene that is at least about 99.0% identical to SEQ ID NO: 17. (Item 98) A N. eutropha bacterium comprising one or more of a Hao1 protein that is at least about 99.6% identical to SEQ ID NO: 18, a Hao2 protein that is at least about 99.7% identical to SEQ ID NO: 20, and a Hao3 protein that is at least about 99.7% identical to SEQ ID NO: 22. (Item 99) The N. eutropha bacterium according to Item 98, further comprising an AmoA1 protein that is at least about 99.0% identical to SEQ ID NO: 6, an AmoA2 protein that is at least about 99.0% identical to SEQ ID NO: 12, an AmoB1 protein that is at least about 99.6% identical to SEQ ID NO: 8, an AmoB1 protein that is at least about 99.6% identical to SEQ ID NO: 14, or an AmoC3 protein that is at least about 99.4% identical to SEQ ID NO: 16. (Item 100) A N. eutropha bacterium comprising one or more of a cycA1 gene that is at least about 98.1% identical to SEQ ID NO: 25, a cycA2 gene that is at least about 98.8% identical to SEQ ID NO: 27, and a cycA3 gene that is at least about 99.4% identical to SEQ ID NO: 28. (Item 101) The N. eutropha bacterium according to Item 100, further comprising one or more of an amoA1 gene that is at least about 98.9% identical to SEQ ID NO: 7, an amo2 gene that is at least about 98.9% identical to SEQ ID NO: 13, an amoB1 gene that is at least about 99.2% identical to SEQ ID NO: 9, an amoB2 gene that is at least about 99.2% identical to SEQ ID NO: 15, an amoC1 gene that is at least about 99.9% identical to SEQ ID NO: 5, an amoC2 gene that is at least about 99.9% identical to SEQ ID NO: 11, an amoC3 gene that is at least about 99.0% identical to SEQ ID NO: 17, a hao1 gene that is at least about 99.1% identical to SEQ ID NO: 19, a hao2 gene that is at least about 99.5% identical to SEQ ID NO: 21, and a hao3 gene that is at least about 99.3% identical to SEQ ID NO: 23. (Item 102) An N. eutropha bacterium comprising one or more of a CycA1 protein that is at least about 99.2% identical to SEQ ID NO: 24, a CycA2 protein that is at least about 99.7% identical to SEQ ID NO: 26, and a CycA3 protein that is at least about 99.7% identical to SEQ ID NO: 28. (Item 103) The N. eutropha bacterium according to Item 102, further comprising one or more of an AmoA1 protein that is at least about 99.0% identical to SEQ ID NO: 6, an AmoA2 protein that is at least about 99.0% identical to SEQ ID NO: 12, an AmoB1 protein that is at least about 99.6% identical to SEQ ID NO: 8, an AmoB1 protein that is at least about 99.6% identical to SEQ ID NO: 14, an AmoC3 protein that is at least about 99.4% identical to SEQ ID NO: 16, a Hao1 protein that is at least about 99.6% identical to SEQ ID NO: 18, a Hao2 protein that is at least about 99.7% identical to SEQ ID NO: 20, and a Hao3 protein that is at least about 99.7% identical to SEQ ID NO: 22. (Item 104) An N. eutropha bacterium comprising one or more of a cycB1 gene that is at least about 96.8% identical to SEQ ID NO: 31 and a cycB2 gene that is at least about 97.2% identical to SEQ ID NO: 33. (Item 105) The N. eutropha bacterium according to item 104, further comprising one or more of an amoA1 gene that is at least about 98.9% identical to SEQ ID NO: 7, an amo2 gene that is at least about 98.9% identical to SEQ ID NO: 13, an amoB1 gene that is at least about 99.2% identical to SEQ ID NO: 9, an amoB2 gene that is at least about 99.2% identical to SEQ ID NO: 15, an amoC1 gene that is at least about 99.9% identical to SEQ ID NO: 5, an amoC2 gene that is at least about 99.9% identical to SEQ ID NO: 11, an amoC3 gene that is at least about 99.0% identical to SEQ ID NO: 17, a hao1 gene that is at least about 99.1% identical to SEQ ID NO: 19, a hao2 gene that is at least about 99.5% identical to SEQ ID NO: 21, a hao3 gene that is at least about 99.3% identical to SEQ ID NO: 23, a cycA1 gene that is at least about 98.1% identical to SEQ ID NO: 25, a cycA2 gene that is at least about 98.8% identical to SEQ ID NO: 27, and a cycA3 gene that is at least about 99.4% identical to SEQ ID NO: 28. (Item 106) The N. eutropha bacterium comprising one or more of a CycB1 protein that is at least about 97.2% identical to SEQ ID NO: 30 or a CycB2 protein that is at least about 98.8% identical to SEQ ID NO: 32. (Item 107) The N. eutropha bacterium according to item 106, further comprising one or more of an AmoA1 protein that is at least about 99.0% identical to SEQ ID NO: 6, an AmoA2 protein that is at least about 99.0% identical to SEQ ID NO: 12, an AmoB1 protein that is at least about 99.6% identical to SEQ ID NO: 8, an AmoB1 protein that is at least about 99.6% identical to SEQ ID NO: 14, an AmoC3 protein that is at least about 99.4% identical to SEQ ID NO: 16, a Hao1 protein that is at least about 99.6% identical to SEQ ID NO: 18, a Hao2 protein that is at least about 99.7% identical to SEQ ID NO: 20, a Hao3 protein that is at least about 99.7% identical to SEQ ID NO: 22, a CycA1 protein that is at least about 99.2% identical to SEQ ID NO: 24, a CycA2 protein that is at least about 99.7% identical to SEQ ID NO: 26, and a CycA3 protein that is at least about 99.7% identical to SEQ ID NO: 28. (Item 108) An N. eutropha bacterium comprising one or more genes according to SEQ ID NOs: 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, and 33. (Item 109) An N. eutropha bacterium comprising one or more proteins according to SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, and 32. (Item 110) An N. eutropha bacterium comprising a protein that is a mutant with respect to at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30 positions, or all of the amino acid positions listed in Table 2 of N. eutropha strain C91. (Item 111) An N. eutropha bacterium comprising a protein that is a mutant with respect to all of the amino acid positions listed in Table 2 of N. eutropha strain C91. (Item 112) A transgenic N. eutropha bacterium according to any one of Items 1 to 111. (Item 113) An N. eutropha bacterium according to any one of Items 80 to 112, having at least one property selected from an optimized growth rate, an optimized NH4+ oxidation rate, and an optimized resistance to NH4+. (Item 114) An N. eutropha bacterium according to Item 113, having at least two properties selected from an optimized growth rate, an optimized NH4+ oxidation rate, and an optimized resistance to NH4+. (Item 115) An N. eutropha bacterium according to Item 113, having an optimized growth rate, an optimized NH4+ oxidation rate, and an optimized resistance to NH4+. (Item 116) A composition comprising an N. eutropha bacterium according to any one of Items 1 to 115, substantially free of other organisms. (Item 117) A composition comprising the N.eutropha bacterium according to any one of items 1 to 115 and further comprising a second organism, wherein the composition is substantially free of other organisms. (Item 118) The composition according to item 117, wherein the second organism is an ammonia-oxidizing bacterium. (Item 119) The composition according to item 117, wherein the second organism is selected from the group consisting of Nitrosomonas, Nitrosococcus, Nitrosospria, Nitrosocystis, Nitrosolobus, Nitrosovibrio, Lactobacillus, Streptococcus, and Bifidobacter, and combinations thereof. (Item 120) A composition comprising a cell suspension of an actively dividing culture of N.eutropha bacteria having an OD600 of at least about 0.2, wherein the composition is substantially free of other organisms. (Item 121) A composition for topical administration comprising the N.eutropha bacterium according to any one of items 1 to 115 and a pharmaceutically or cosmetically acceptable excipient suitable for topical administration. (Item 122) The composition according to item 121, which is substantially free of other organisms. (Item 123) The composition according to item 121, further comprising a second organism. (Item 124) The composition according to item 123, wherein the second organism is an ammonia-oxidizing bacterium. (Item 125) The composition according to item 123, wherein the second organism is selected from the group consisting of Nitrosomonas, Nitrosococcus, Nitrosospria, Nitrosocystis, Nitrosolobus, Nitrosovibrio, Lactobacillus, Streptococcus, and Bifidobacter, and combinations thereof. (Item 126) The composition according to any one of items 121 to 125, provided as or disposed in a powder, cosmetic, cream, stick, aerosol, ointment, wipe, or dressing. (Item 127) The composition according to any one of items 121 to 126, further comprising a humectant, deodorant, fragrance, colorant, insect repellent, cleansing agent, or ultraviolet blocker. (Item 128) The composition according to any one of items 121 to 127, wherein the excipient comprises an anti-adhesive, binder, coating agent, disintegrant, filler, flavor, color, lubricant, slip agent, adsorbent, preservative, or sweetener. (Item 129) The composition according to any one of items 121 to 128, wherein the concentration of N. eutropha in the composition is about 1011 to 1012 CFU / L. (Item 130) The composition according to any one of items 121 to 129, wherein the concentration of N. eutropha in the composition is about 109 CFU / ml. (Item 131) The composition according to any one of items 121 to 130, wherein the mass ratio of N. eutropha to the pharmaceutical excipient is in the range of about 0.1 gram / L to about 1 gram / L. (Item 132) A composition comprising at least about 1,000 L of N. eutropha bacteria according to any one of items 1 to 115 at about 1012 CFU / L. (Item 133) For example, as a dry preparation such as a powder, a composition comprising at least about 1, 2, 5, 10, 20, 50, 100, 200, or 500 g of N. eutropha bacteria according to any one of items 1 to 115. (Item 134) For example, at a concentration providing one or more of treatment or prevention of skin disorders, treatment or prevention of diseases or conditions related to low nitrite levels, treatment or prevention of body odor, treatment for supplying nitric oxide, or treatment for inhibiting microbial growth, a clothing item comprising N. eutropha according to any one of items 1 to 115. (Item 135) The clothing item according to item 134, which is packaged. (Item 136) The clothing item according to items 134 to 135, which is packaged in a material resistant to gas exchange or a material resistant to water. (Item 137) A cloth containing N. eutropha according to any one of items 1 to 115. (Item 138) A knitting yarn containing N. eutropha according to any one of items 1 to 115. (Item 139) A sewing thread containing N. eutropha according to any one of items 1 to 115. (Item 140) A method for obtaining, for example, manufacturing N. eutropha bacteria having an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized resistance to NH4+, (a) culturing the bacteria under conditions of selecting one or more of an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized resistance to NH4+ to thereby produce a culture; (b) testing a sample derived from the culture for an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized resistance to NH4+; (c) repeating the culturing step and the testing step until bacteria having an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized resistance to NH4+ are obtained. (Item 141) The method according to item 140, further comprising the step of obtaining N. eutropha bacteria from a source. (Item 142) The method according to item 141, wherein the source is soil or the skin of an individual. (Item 143) Culturing the bacterium under conditions of selecting one or more of an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized tolerance to NH4+ comprises culturing the bacterium in N. europae medium containing about 200 mM NH4+, the method according to item 142. (Item 144) The method according to item 143, comprising the step of producing a pure culture. (Item 145) The method according to item 143 or 144, comprising the step of co-culturing the N. eutropha with at least one other type of ammonia-oxidizing bacterium. (Item 146) The method according to any one of items 140 - 145, wherein the N. eutropha in step (a) lacks an optimized growth rate, an optimized NH4+ oxidation rate, and an optimized tolerance to NH4+. (Item 147) The method according to any one of items 140 - 146, wherein step (c) comprises repeating the culturing step and the testing step until a bacterium having at least two of an optimized growth rate, an optimized NH4+ oxidation rate, and an optimized tolerance to NH4+ is obtained. (Item 148) N. eutropha bacteria produced by the method according to any one of items 140 - 147. (Item 149) A method for testing an N. eutropha preparation, comprising assaying the N. eutropha for one or more of an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized tolerance to NH4+; and classifying the N. eutropha as acceptable if the N. eutropha has one or more of an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized tolerance to NH4+. (Item 150) The method according to item 149, further comprising testing the preparation for contaminating organisms. (Item 151) The method according to any one of items 149 to 150, further comprising the step of taking out a sample from the preparation and the step of performing a test on the sample. (Item 152) The method according to any one of items 149 to 151, further comprising testing the medium in which the N. eutropha is cultured. (Item 153) The method according to any one of items 149 to 152, further comprising packaging N. eutropha from the preparation into a package. (Item 154) The method according to any one of items 149 to 153, further comprising commercializing N. eutropha from the preparation. (Item 155) A method for generating, for example, manufacturing N. eutropha, comprising contacting N. eutropha with a culture medium and culturing the N. eutropha until an OD600 of at least about 0.5 is reached. (Item 156) The method according to item 155, further comprising assaying the N. eutropha and the culture medium for contaminating organisms. (Item 157) The method according to any one of items 155 to 156, further comprising assaying the N. eutropha for one or more of an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized resistance to NH4+. (Item 158) The method according to any one of items 155 to 157, comprising generating N. eutropha at at least about 1,000 L / day at about 1012 CFU / L. (Item 159) A method for generating, for example, manufacturing N. eutropha, comprising contacting N. eutropha with a culture medium and culturing the N. eutropha until about 1012 CFU / L of N. eutropha is generated at at least about 1,000 L. (Item 160) The method according to item 159, further comprising the step of assaying said N. eutropha for one or more of an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized tolerance to NH4+. (Item 161) The method according to any one of items 159 to 160, further comprising the step of testing said N. eutropha or said culture medium for contaminating organisms. (Item 162) The method according to any one of items 159 to 161, wherein said N. eutropha in contact with said culture medium is N. eutropha having one or more of an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized tolerance to NH4+. (Item 163) A method for producing, for example, manufacturing N. eutropha, comprising: (a) contacting N. eutropha with a culture medium; (b) culturing said N. eutropha for 1 to 2 days until the culture reaches an OD600 of about 0.5 to 0.6, thereby producing said culture. (Item 164) The method according to item 163, further comprising the step of assaying said N. eutropha for one or more of an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized tolerance to NH4+. (Item 165) The method according to any one of items 163 to 164, further comprising the step of testing said culture for contaminating organisms. (Item 166) The method according to any one of items 163 to 165, wherein said N. eutropha in step (a) is N. eutropha having one or more of an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized tolerance to NH4+. (Item 167) The method according to any one of items 163 to 166, comprising producing at least about 1,000 L / day of N. eutropha at about 1012 CFU / L. (Item 168) N. eutropha bacteria produced by the method according to any one of items 155 to 167. (Item 169) N. eutropha preparation produced by the method according to any one of items 155 to 167. (Item 170) The preparation according to item 169, wherein the preparation contains at least about 0.1 to about 100 milligrams (mg) of N. eutropha. (Item 171) A reaction mixture containing N. eutropha with an optical density of about 0.5 to about 0.6. (Item 172) A method for producing clothing having N. eutropha, the method comprising contacting a clothing item with N. eutropha according to any one of items 1 to 115. (Item 173) The method according to item 172, comprising producing at least 10, 100, or 1000 clothing items. (Item 174) The method according to item 172, comprising contacting the clothing item with at least 10^10 CFU of N. eutropha. (Item 175) The method according to item 172, further comprising packaging the clothing. (Item 176) A method for obtaining a formulation of N. eutropha, the method comprising combining contacting N. eutropha according to any one of items 1 to 115 with a pharmaceutically or cosmetically acceptable excipient. (Item 177) The method according to item 176, further comprising mixing the N. eutropha and the excipient. (Item 178) The method according to item 176, performed under conditions substantially free of contaminating organisms. (Item 179) A method for packaging N. eutropha, the method comprising combining N. eutropha according to any one of items 1 to 115 with a package. (Item 180) The method according to item 179, wherein the package is resistant to gas exchange or resistant to water. (Item 181) The method according to item 179, wherein the package is permeable to gas exchange, NH3, NH4+, or NO2-. (Item 182) A method of inhibiting microbial growth on the skin of a subject, the method comprising topically administering to the subject in need thereof an effective dose of the N. eutropha bacterium according to any one of items 1 to 115. (Item 183) The method according to item 182, wherein the effective dose is approximately 1.5×1010 CFU. (Item 184) The method according to any one of items 182 to 183, wherein the administration is performed twice a day. (Item 185) The method according to any one of items 182 to 184, wherein the subject is a human. (Item 186) The method according to any one of items 182 to 185, wherein the microbial growth to be inhibited is the growth of Pseudomonas aeruginosa, Staphylococcus aureus, Streptococcus pyogenes, or Acinetobacter baumannii. (Item 187) A method of supplying nitric oxide to a subject, the method comprising positioning an effective dose of the N. eutropha bacterium according to any one of items 1 to 115 in close proximity to the subject. (Item 188) A method of reducing body odor, the method comprising topically administering to the subject in need thereof an effective dose of the N. eutropha bacterium according to any one of items 1 to 115. (Item 189) A method for treating a disease associated with low nitrite levels, the method comprising topically administering to a subject in need thereof a therapeutically effective dose of N. eutropha bacteria according to any one of items 1 to 115. (Item 190) The method according to item 189, wherein the disease is HIV dermatitis, an infection in diabetic foot ulcers, atopic dermatitis, acne, such as acne vulgaris, eczema, contact dermatitis, allergic reaction, psoriasis, skin infection, vascular disease, vaginal yeast infection, sexually transmitted disease, heart disease, atherosclerosis, alopecia, diabetes or a lower leg ulcer following bed restraint, angina pectoris, particularly chronic stable angina pectoris, ischemic disease, congestive heart failure, myocardial infarction, ischemia-reperfusion injury, laminitis, hypertension, hypertrophic organ degeneration, Raynaud's phenomenon, fibrosis, fibrotic organ degeneration, allergy, autoimmunization, end-stage renal disease, obesity, impotence, or cancer. (Item 191) A method for treating a skin disorder, the method comprising topically administering to a subject in need thereof a therapeutically effective dose of N. eutropha bacteria according to any one of items 1 to 115. (Item 192) The method according to item 191, wherein the skin disorder is acne, such as acne vulgaris, rosacea, eczema, or psoriasis. (Item 193) The method according to item 191, wherein the skin disorder is an ulcer, such as a venous ulcer, such as a lower leg ulcer, such as a venous lower leg ulcer, such as an infection in a diabetic foot ulcer. (Item 194) The method according to any one of items 191 to 193, wherein the topical administration comprises pre-treating the subject with N. eutropha, such as N. eutropha according to any one of items 1 to 115. (Item 195) The method according to any one of items 191 to 194, wherein the topical administration comprises topical administration before the onset of the skin disorder. (Item 196) The method according to any one of items 191 to 195, wherein the topical administration comprises topical administration after the onset of the skin disorder. (Item 197) A method for promoting wound healing or closure, the method comprising administering to the wound an effective dose of N. eutropha bacteria as described in any one of items 1 to 115. (Item 198) The method according to item 197, wherein the wound contains one or more undesirable bacteria, such as pathogenic bacteria. (Item 199) The method according to item 197, wherein the wound contains Staphylococcus aureus, Pseudomonas aeruginosa, or Acinetobacter baumannii. (Item 200) The method according to item 197, wherein the N. eutropha is administered to the subject before the onset of the wound. (Item 201) The method according to item 197, wherein administering to the wound includes administering to the subject before the onset of the wound. (Item 202) The method according to any one of items 197 to 201, further comprising administering N. eutropha to the wound after the onset of the wound. (Item 203) A method for killing pathogenic bacteria or inhibiting their growth, the method comprising contacting, for example, applying to the skin N. eutropha bacteria, such as N. eutropha bacteria as described in any one of items 1 to 115. (Item 204) The method according to item 203, wherein the pathogenic bacterium contributes to one or more of the following conditions: HIV dermatitis, ulcers, such as venous ulcers, such as leg ulcers, such as venous leg ulcers, such as infectious diseases in diabetic foot ulcers, atopic dermatitis, acne, such as acne vulgaris, eczema, contact dermatitis, allergic reactions, psoriasis, urticaria, rosacea, skin infections, vascular diseases, vaginal Candida infections, sexually transmitted diseases, heart diseases, atherosclerosis, alopecia, diabetes or leg ulcers following bed restraint, angina pectoris, particularly chronic stable angina pectoris, ischemic diseases, congestive heart failure, myocardial infarction, ischemia-reperfusion injury, laminitis, hypertension, hypertrophic organ degeneration, Raynaud's phenomenon, fibrosis, fibrotic organ degeneration, allergies, autoimmunity sensitization, end-stage renal disease, obesity, impotence, pneumonia, primary immunodeficiency, epidermolysis bullosa, or cancer. (Item 205) The method according to item 204, wherein the condition is an ulcer, such as a venous ulcer, such as a leg ulcer, such as a venous leg ulcer, such as an infectious disease in a diabetic foot ulcer. (Item 206) The method according to item 204, wherein the condition is a venous leg ulcer. (Item 207) The method according to item 204, wherein the condition is acne, such as acne vulgaris. (Item 208) The method according to item 204, wherein the condition is acne vulgaris. (Item 209) The method according to any one of items 203 to 208, wherein the pathogenic bacterium is one or more of Propionibacterium acnes, Pseudomonas aeruginosa, Staphylococcus aureus, Streptococcus pyogenes, or Acinetobacter baumannii. (Item 210) The method according to any one of items 203 to 209, further comprising determining whether the subject requires killing of the pathogenic bacterium or inhibition of its growth, for example, determining that the subject requires killing of the pathogenic bacterium or inhibition of its growth. (Item 211) The method according to any one of items 203 to 210, further comprising selecting the subject that requires killing of the pathogenic bacterium or inhibition of its growth. (Item 212) A method for changing the composition of the skin microbiome of a subject, comprising: administering, for example, applying, a preparation containing ammonia-oxidizing bacteria to the surface of the skin, wherein the amount and frequency of the administration, for example, application, are sufficient to reduce the proportion of pathogenic bacteria on the surface of the skin. (Item 213) The method according to item 212, further comprising selecting the subject based on the subject that requires a reduction in the proportion of pathogenic bacteria on the surface of the skin. (Item 214) The method according to any one of items 212 to 213, wherein the preparation contains at least one of ammonia, ammonium salts, and urea. (Item 215) The method according to any one of items 212 to 214, wherein the preparation contains a release control material, for example, a sustained release material. (Item 216) The method according to any one of items 212 to 215, wherein the ammonia-oxidizing bacteria preparation further contains an excipient, for example, one of a pharmaceutically acceptable excipient or a cosmetically acceptable excipient. (Item 217) The method according to item 216, wherein one of the excipients, for example, the pharmaceutically acceptable excipient and the cosmetically acceptable excipient, is suitable for one of topical administration, nasal administration, pulmonary administration, and gastrointestinal administration. (Item 218) The method according to any one of items 216 to 217, wherein one of the excipients, for example, the pharmaceutically acceptable excipient and the cosmetically acceptable excipient, is a surfactant. (Item 219) The method according to item 218, wherein the surfactant is selected from the group consisting of cocamidopropyl betaine (ColaTeric COAB), polyethylene sorbitol ester (e.g., Tween 80), ethoxylated lauryl alcohol (RhodaSurf 6 NAT), sodium lauryl sulfate / sodium lauryl glucoside / cocamidopropyl betaine (Plantapon 611 L UP), sodium lauryl sulfate (e.g., RhodaPex ESB 70 NAT), alkyl polyglucoside (e.g., Plantaren 2000 N UP), sodium lauryl sulfate (Plantaren 200), Dr. Bronner's Castile soap, lauramine oxide (ColaLux Lo), sodium dodecyl sulfate (SDS), alkyl polyglucoside polysulfonate (PolySufanate 160 P), sodium lauryl sulfate (Stepanol-WA Extra K), and any combination thereof. (Item 220) The method according to any one of items 212 to 219, wherein the preparation substantially does not contain other organisms. (Item 221) The method according to any one of items 212 to 220, wherein the preparation is disposed in a powder, cosmetic, cream, stick, aerosol, ointment, wipe, or dressing. (Item 222) The method according to any one of items 212 to 221, wherein the preparation is provided as a powder, cosmetic, cream, stick, aerosol, ointment, wipe, or dressing. (Item 223) The method according to any one of items 212 to 222, wherein the preparation contains a humectant, deodorant, fragrance, coloring agent, insect repellent, cleansing agent, or sunscreen. (Item 224) The method according to any one of items 216 to 217, wherein the excipient, for example, the pharmaceutically acceptable excipient or the cosmetically acceptable excipient, contains an anti-adhesive, binder, coating agent, disintegrant, filler, flavor, color, lubricant, lubricant, adsorbent, preservative, or sweetener. (Item 225) The method according to any one of items 212 to 224, wherein the preparation containing the ammonia-oxidizing bacteria contains from about 10^8 to about 10^14 CFU / L. (Item 226) The method according to item 225, wherein the preparation contains from about 1×10^9 CFU / L to about 10×10^9 CFU / L. (Item 227) The method according to any one of items 212 to 226, wherein the preparation containing the ammonia-oxidizing bacteria contains from about 50 milligrams (mg) to about 1000 mg of ammonia-oxidizing bacteria. (Item 228) The method according to any one of items 216 to 227, wherein the mass ratio of the ammonia-oxidizing bacteria to the excipient, for example, the pharmaceutically acceptable excipient or the cosmetically acceptable excipient, is in the range of about 0.1 gram / L to about 1 gram / L. (Item 229) The method according to any one of items 212 to 228, wherein the ammonia-oxidizing bacteria preparation is useful for the treatment or prevention of skin disorders, the treatment or prevention of diseases or conditions related to low nitrite levels, the treatment or prevention of body odor, the treatment for supplying nitric oxide, or the treatment for inhibiting microbial growth, for example, pathogenic bacteria growth. (Item 230) The method according to any one of items 212 to 229, wherein the ammonia-oxidizing bacteria are selected from the group consisting of Nitrosomonas, Nitrosococcus, Nitrosospira, Nitrosocystis, Nitrosolobus, Nitrosovibrio, and combinations thereof. (Item 231) The method according to any one of items 212 to 230, wherein the preparation contains an organism selected from the group consisting of Lactobacillus, Streptococcus, Bifidobacter, and combinations thereof. (Item 232) The method according to any one of items 212 to 230, wherein the preparation substantially does not contain organisms other than ammonia-oxidizing bacteria. (Item 233) The method according to any one of items 212 to 232, wherein the ammonia-oxidizing bacterium preparation contains ammonia-oxidizing bacteria in a growing state. (Item 234) The method according to any one of items 212 to 232, wherein the ammonia-oxidizing bacterium preparation contains ammonia-oxidizing bacteria in a storage state. (Item 235) The method according to any one of items 212 to 234 for providing a cosmetic product. (Item 236) The method according to any one of items 212 to 234 for providing a therapeutic product. (Item 237) The method according to any one of items 212 to 236, wherein the preparation is useful for the treatment of at least one of HIV dermatitis, infections in diabetic foot ulcers, atopic dermatitis, acne, such as acne vulgaris, eczema, contact dermatitis, allergic reactions, psoriasis, urticaria, rosacea, skin infections, vascular diseases, vaginal yeast infections, sexually transmitted diseases, heart diseases, atherosclerosis, alopecia, diabetes or leg ulcers following bed restraint, angina pectoris, particularly chronic stable angina pectoris, ischemic diseases, congestive heart failure, myocardial infarction, ischemia-reperfusion injury, laminitis, hypertension, hypertrophic organ degeneration, Raynaud's phenomenon, fibrosis, fibrotic organ degeneration, allergies, autoimmunization, end-stage renal disease, obesity, erectile dysfunction, pneumonia, primary immunodeficiency, epidermolysis bullosa, or cancer. (Item 238) The method according to item 237, wherein the preparation is useful for the treatment of at least one of acne, such as acne vulgaris, eczema, psoriasis, urticaria, rosacea, and skin infections. (Item 239) The method according to any one of items 212 to 238, wherein the preparation is provided in a container, and the preparation and the container have a weight of less than about 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or 2000 grams. (Item 240) The method according to any one of items 212 to 239, wherein the preparation has a surfactant of about 0.1% to less than about 10%. (Item 241) The method according to any one of Items 212 to 240, wherein the preparation substantially does not contain a surfactant. (Item 242) The method according to any one of Items 212 to 241, wherein the preparation contains a chelating agent. (Item 243) The method according to any one of Items 212 to 242, wherein the preparation is applied about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 times a day. (Item 244) The method according to any one of Items 212 to 243, wherein the preparation is applied once a day. (Item 245) The method according to any one of Items 212 to 243, wherein the preparation is applied twice a day. (Item 246) The method according to any one of Items 212 to 245, wherein the preparation is applied for about 1 to 3, 3 to 5, 5 to 7, 7 to 9, 5 to 10, 10 to 14, 12 to 18, 12 to 21, 21 to 28, 28 to 35, 35 to 42, 42 to 49, 49 to 56, 46 to 63, 63 to 70, 70 to 77, 77 to 84, or 84 to 91 days. (Item 247) The method according to any one of Items 212 to 246, wherein the preparation is applied for about 16 days. (Item 248) The method according to any one of Items 212 to 247, further comprising obtaining a sample from the surface of the skin. (Item 249) The method according to Item 248, further comprising isolating the DNA of bacteria in the sample. (Item 250) The method according to any one of Items 248 to 249, further comprising sequencing the DNA of bacteria in the sample. (Item 251) The method according to any one of Items 212 to 250, wherein the administration of the ammonia-oxidizing bacteria provides an increase in the proportion of non-pathogenic bacteria on the surface. (Item 252) The method according to item 251, wherein the non-pathogenic bacterium is a symbiotic non-pathogenic bacterium. (Item 253) The method according to item 252, wherein the non-pathogenic bacterium is a symbiotic non-pathogenic bacterium of the genus Staphylococcus. (Item 254) The method according to item 253, wherein the non-pathogenic bacterium is the symbiotic non-pathogenic bacterium Staphylococcus epidermidis. (Item 255) The method according to any one of items 252 to 254, wherein the non-pathogenic bacterium of the genus Staphylococcus increases after about two weeks or is identified as increasing after about two weeks. (Item 256) The method according to item 255, wherein the non-pathogenic bacterium Staphylococcus epidermidis increases after about two weeks or is identified as increasing after about two weeks. (Item 257) The method according to any one of items 212 to 256, wherein the potentially pathogenic Propionibacteria or Propionibacteria associated with a disease decreases after about two weeks or is identified as decreasing after about two weeks. (Item 258) The method according to any one of items 212 to 257, wherein the potentially pathogenic Stenotrophomonas or Stenotrophomonas associated with a disease decreases after about two weeks or is identified as decreasing after about two weeks. (Item 259) The method according to any one of items 212 to 258, wherein the surface of the skin includes a wound. (Item 260) A method for treating acne, such as acne vulgaris, by the method according to any one of items 212 to 259. (Item 261) A method for treating eczema by the method according to any one of items 212 to 259. (Item 262) A method for treating psoriasis by the method according to any one of items 212 to 259. (Item 263) A method for treating urticaria by the method according to any one of items 212 to 259. (Item 264) A method for treating eczema by the method according to any one of items 212 to 259. (Item 265) A method for treating skin infections by the method according to any one of items 212 to 259. (Item 266) A method for reducing the amount of undesirable bacteria on the surface of a subject by the method according to any one of items 212 to 258. (Item 267) A nucleic acid comprising a sequence of 15 to 100 consecutive nucleotides from SEQ ID NO: 66 or its reverse complement, provided that the sequence does not occur naturally, or has another modification, for example, a label, or both. (Item 268) The nucleic acid according to item 267, wherein the sequence of 15 to 100 consecutive nucleotides is not found in N. Eutropha strain C91. (Item 269) The nucleic acid according to item 267 or 268, further comprising a heterologous sequence on the 5' side with respect to the sequence of 15 to 100 consecutive nucleotides from SEQ ID NO: 66. (Item 270) The nucleic acid according to item 267 or 268, further comprising a heterologous sequence on the 3' side with respect to the sequence of 15 to 100 consecutive nucleotides from SEQ ID NO: 66. (Item 271) The nucleic acid according to item 267 or 268, further comprising a first heterologous sequence on the 5' side with respect to the sequence of 15 to 100 consecutive nucleotides from SEQ ID NO: 66 and a second heterologous sequence on the 3' side with respect to the sequence of 15 to 100 consecutive nucleotides from SEQ ID NO: 66. (Item 272) The nucleic acid according to any one of items 267 to 271, having a nucleotide length of 15 to 20, 20 to 25, 25 to 30, 30 to 24, or 25 to 40. (Item 273) A detectable label, for example, a nucleic acid according to any one of items 267 to 272, which is bound, for example, covalently, to a fluorescent label. (Item 274) A first nucleic acid comprising 15 to 100 consecutive nucleotides from SEQ ID NO: 66, A second nucleic acid comprising 15 to 100 consecutive nucleotides from the reverse complement of SEQ ID NO: 66, The composition comprising the same, provided that the first nucleic acid or the second nucleic acid or both thereof have a sequence that does not naturally exist or a modification such as a label or both thereof. (Item 275) The composition according to item 274, wherein each of the first nucleic acid, the second nucleic acid, or the first nucleic acid and the second nucleic acid does not contain a sequence found in N. Eutropha strain C91. (Item 276) The composition according to item 274 or 275, wherein each of the first nucleic acid, the second nucleic acid, or the first nucleic acid and the second nucleic acid further comprises a heterologous sequence on the 5' side with respect to the sequence of 15 to 100 consecutive nucleotides from SEQ ID NO: 66. (Item 277) The composition according to any one of items 274 to 276, wherein each of the first nucleic acid, the second nucleic acid, or the first nucleic acid and the second nucleic acid further comprises a heterologous sequence on the 3' side with respect to the sequence of 15 to 100 consecutive nucleotides from SEQ ID NO: 66. (Item 278) The composition according to any one of items 274 to 277, wherein each of the first nucleic acid, the second nucleic acid, or the first nucleic acid and the second nucleic acid has a nucleotide length of 15 to 20, 20 to 25, 25 to 30, 30 to 24, or 25 to 40. (Item 279) The composition according to any one of items 274 to 278, wherein each of the first nucleic acid, the second nucleic acid, or the first nucleic acid and the second nucleic acid is bound to a detectable label, for example, a fluorescent label, for example, covalently. (Item 280) A nucleic acid consisting of the sequence AATCTGTCTCCACAGGCAGC (SEQ ID NO: 64). (Item 281) A nucleic acid consisting of the sequence TATACCCACCACCCACGCTA (SEQ ID NO: 65). (Item 282) A molecule comprising the nucleic acid according to Item 280 or 281 and a detectable label, for example, a fluorescent label. (Item 283) A composition comprising a first nucleic acid consisting of the sequence AATCTGTCTCCACAGGCAGC (SEQ ID NO: 64) and a second nucleic acid consisting of the sequence TATACCCACCACCCACGCTA (SEQ ID NO: 65). (Item 284) (i) A first molecule comprising a first nucleic acid consisting of the sequence AATCTGTCTCCACAGGCAGC (SEQ ID NO: 64) and optionally (ii) a detectable label, for example, a fluorescent label, A composition comprising (i) a second molecule comprising a second nucleic acid consisting of the sequence TATACCCACCACCCACGCTA (SEQ ID NO: 65) and optionally (ii) a detectable label, for example, a fluorescent label. (Item 285) A method for detecting whether D23 N. eutropha nucleic acid is present in a sample, Performing a polymerase chain reaction (PCR) on the sample using primers specific to N. eutropha D23, Determining whether a PCR product is generated, the method wherein the presence of the PCR product indicates that the D23 N. eutropha nucleic acid is present in the sample.
[0173] The present disclosure contemplates any combination of one or more of the foregoing aspects and / or embodiments, as well as any combination with one or more of the embodiments described in the modes for carrying out the invention and the examples. BRIEF DESCRIPTION OF THE DRAWINGS
[0174]
Figure 1
Figure 2-1
Figure 2-2
Figure 2-3
Figure 2-4
Figure 3-1
Figure 3-2
Figure 3-3
Figure 4-1
Figure 4-2
Figure 4-3
Figure 4-4
Figure 4-5
Figure 5-1
Figure 5-2
Figure 5-3
Figure 5-4
Figure 5-5
Figure 5-6
Figure 5-7
Figure 5-8
Figure 5-9
Figure 5-10
Figure 5-11
Figure 5-12
Figure 5-13
Figure 5-14
Figure 6-1
Figure 6-2
Figure 6-3
Figure 6-4
Figure 6-5
Figure 6-6
Figure 6-7
Figure 6-8
Figure 6-9
Figure 6-10
Figure 6-11
Figure 6-12
Figure 6-13
Figure 6-14
Figure 6-15
Figure 6-16
Figure 7-1
Figure 7-2
Figure 7-3
Figure 7-4
Figure 7-5
Figure 7-6
Figure 7-7
Figure 7-8
Figure 7-9
Figure 7-10
Figure 7-11
Figure 7-12
Figure 7-13
Figure 8-1
Figure 8-2
Figure 8-3
Figure 8-4
Figure 8-5
Figure 8-6
Figure 8-7
Figure 8-8
Figure 8-9
Figure 8-10
Figure 8-11
Figure 8-12
Figure 8-13
Figure 8-14
Figure 8-15
Figure 8-16
Figure 9
Figure 10
Figure 11
Figure 12
Figure 13
Figure 14-1
Figure 14-2
Figure 15
Figure 16
Figure 17
Figure 18
BEST MODE FOR CARRYING OUT THE INVENTION
[0175] Supplementary Table 1 shows the genomic annotation of 2,777 genes identified in strain D23 using array analysis. The column headings are as described in Figure 6. "C91 alias" refers to the homolog in strain C91. Supplementary Table 1 is attached at the end of the "Modes for Carrying Out the Invention" and "Examples".
[0176] Supplementary Table 2 shows the sequences of selected protein genes identified in strain D23. Supplementary Table 2 is attached at the end of the "Modes for Carrying Out the Invention" and "Examples".
[0177] Ammonia-oxidizing bacteria (AOB) of the genus Nitrosomonas are Gram-negative obligate autotrophic bacteria that have the unique ability to generate nitrite and nitric oxide solely from ammonia as an energy source. They are widely present in both soil and water environments and are essential components of the environmental nitrification process. Due to the role of nitrite and nitric oxide on human skin as important components of several physiological functions such as vasodilation, skin inflammation, and wound healing, these bacteria may have beneficial properties for both healthy skin conditions and immunopathological skin conditions. These bacteria may be safe for use in humans because they grow slowly, cannot grow on organic carbon sources, may be sensitive to soaps and antibiotics, and are not associated with any diseases or infections in animals or humans.
[0178] 1. Definitions Ammonia-oxidizing bacteria are bacteria that can oxidize ammonia or ammonium to nitrite at a rate, for example, at a substantial rate, for example, at a predetermined rate, for example, at least at a rate shown in any one of Figures 2A, 2B, 2C, 4A, 4B, or 5, or at least 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, or 10% of that rate. In some embodiments, this substantial rate is at least 50, 75, 125, or 150 micromoles NO2 - / min, e.g., about 100 - 150, 75 - 175, 75 - 125, 100 - 125, 125 - 150, or 125 - 175 micromoles / min, e.g., about 125 micromoles NO2 - / min rate of ammonium ion (NH4 + )(e.g., about 200 mM) to nitrite (NO2 - ). Examples of ammonia - oxidizing bacteria include N. eutropha strains D23 and C91, and other bacteria of the genera Nitrosomonas, Nitrosococcus, Nitrosospira, Nitrosocystis, Nitrosolobus, and Nitrosovibrio. Nitrosomonas eutropha strain D23 is designated AOB D23 - 100 and refers to the strain deposited with the American Tissue Culture Collection (ATCC) on April 8, 2014, and having accession number PTA - 121157. Nitrosomonas eutropha with accession number PTA - 121157 has the genomic sequence presented in SEQ ID NO:1 herein. The nucleic acid sequence(s), e.g., genomic sequence, of accession number PTA - 121157 are hereby incorporated by reference in their entirety.
[0179] When the term optimized Nitrosomonas eutropha (N. eutropha) is used herein, it refers to N. eutropha having an optimized growth rate, optimized NH4 + oxidation rate, or optimized resistance to NH4 + . In one embodiment, this is at least one nucleotide, e.g., ammonia monooxygenase, hydroxylamine oxidoreductase, cytochrome c554, and cytochrome c MOnly the nucleotides in the gene selected from 552 are different from those of naturally occurring N. eutropha. This difference can occur, for example, by natural mutations in N. eutropha, induced mutations, or selection of directed genetic manipulations. In one embodiment, this is different from naturally occurring N. eutropha in that it has a set of alleles that do not occur together in nature. These differences can provide one or more of the treatment or prevention of skin disorders, the treatment or prevention of diseases or conditions associated with low nitrite levels, the treatment or prevention of body odor, the treatment for supplying nitric oxide to a subject, and the treatment for inhibiting microbial growth.
[0180] As used herein, "pure" refers to a composition that includes a certain organism but substantially does not include other organisms. For example, a pure culture of ammonia-oxidizing bacteria is a culture that substantially does not include organisms other than ammonia-oxidizing bacteria. For example, a pure culture of N. eutropha is a culture that substantially does not include organisms other than N. eutropha. In some embodiments, "substantially does not include" means that it cannot be detected even by methods used to detect other organisms (for example, plating the culture and examining colony morphology, or PCR of conserved genes such as 16S RNA). A pure composition may include elements that are not organisms, for example, nutrients or excipients. Any embodiment, preparation, composition, or formulation of ammonia-oxidizing bacteria discussed herein may optionally include, consist essentially of, or consist of pure ammonia-oxidizing bacteria.
[0181] Throughout the present disclosure, a formulation may refer to a composition or a preparation.
[0182] As used herein, an "autotroph", e.g., an autotrophic bacterium, is any organism that can self-nourish by using inorganic materials as a nutrient source and using photosynthesis or chemosynthesis as an energy source. Autotrophic bacteria can synthesize organic compounds from carbon dioxide, and ATP is derived from other sources, the oxidation of ammonia to nitrite, the oxidation of hydrogen sulfide, and the oxidation of Fe 2+ of Fe 3+ to Fe. The autotrophic bacteria of the present disclosure cannot cause an infectious disease.
[0183] As used herein, "co-administered" means that two (or more) different therapeutic agents are delivered to a subject while the subject is suffering from a disorder, e.g., these two or more therapeutic agents are delivered after the subject has been diagnosed with the disorder and before the disorder has been cured or eliminated. In some embodiments, the delivery of one therapeutic agent continues overlappingly when the delivery of the other therapeutic agent begins. This is sometimes referred to herein as "simultaneous delivery" or "co-occurring delivery" or "parallel delivery". In other embodiments, the delivery of one therapeutic agent has ended before the delivery of the other therapeutic agent begins. This is sometimes referred to herein as "sequential delivery" or "serial delivery". In embodiments of either case, the therapeutic agents are co-administered and thus more effective. For example, the second therapeutic agent is more effective, e.g., a second therapeutic agent with fewer equivalent effects is seen, or the second therapeutic agent reduces symptoms to a greater extent than would be seen if the second therapeutic agent were administered in the absence of the first therapeutic agent, or a similar situation is seen with the first therapeutic agent. In some embodiments, the delivery is such that the reduction of symptoms, or the decrease of other parameters associated with the disorder, exceeds the reduction or decrease that would be observed when one therapeutic agent is delivered in the absence of the other therapeutic agent. The effects of these two therapeutic agents can be partially additive, fully additive, or supra-additive (i.e., synergistic). The delivery can be such that the effect of the first therapeutic agent delivered is still detectable when the second therapeutic agent is delivered.
[0184] The complete N. europaea medium refers to the N. europaea growth medium described in Ensign et al., “In vitro activation of ammonia monooxygenase from Nitrosomonas europaea by copper.” J Bacteriol. 1993 Apr;175(7):1971-80.
[0185] "Culturing" refers to the process of placing a quantity of a desired bacterium under conditions that promote its growth, i.e., that promote cell division. Those conditions can involve a specified culture medium, a set temperature range, and / or a stirring rate. The bacterium can be cultured in liquid culture or on a plate, e.g., an agar plate.
[0186] As used herein, the term "isolated" refers to a substance that has been removed from its original environment or natural environment (e.g., the natural environment if it occurs naturally). For example, a naturally occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide separated from some or all of the coexisting materials in the natural system by human intervention is isolated. Such polynucleotides can be part of a vector and / or such polynucleotides or polypeptides can be part of a composition, and such vector or composition can still be isolated because it is not part of the environment in which it is found in nature.
[0187] "Nucleic acid", "nucleic acid sequence", "nucleotide sequence", or "polynucleotide sequence", and "polynucleotide" are used interchangeably. They refer to a polymeric form of nucleotides of any length, for example, deoxyribonucleotides or ribonucleotides, or analogs thereof. This polynucleotide can be either single-stranded or double-stranded, and in the case of single-stranded, it can be a coding strand or a non-coding (antisense) strand. The polynucleotide can include modified nucleotides such as methylated nucleotides and nucleotide analogs. This nucleotide sequence can be interrupted by non-nucleotide components. The polynucleotide can be further modified after polymerization, such as by conjugation with a labeling component. The nucleic acid can be a recombinant polynucleotide, or a polynucleotide of genomic origin, cDNA origin, semi-synthetic origin, or synthetic origin, all of which do not exist naturally or are bound to another polynucleotide in a non-natural arrangement.
[0188] As used herein, the term "optimal growth rate" refers to a doubling time of less than about 4, 5, 6, 7, 8, 9, or 10 hours when cultured under batch conditions as described in Example 2 herein, a doubling time of less than about 16, 18, 20, 22, 24, or 26 hours when grown under chemostat conditions as described in Example 2 herein, or one or more of the growth from an OD600 of about 0.15 to at least about 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 OD600 over about 1 or 2 days. In one embodiment, the optimal growth rate is a rate having a doubling time that is at least 10, 20, 30, 40, or 50% shorter than the doubling time of naturally occurring N. eutropha.
[0189] As used herein, "optimized NH4 + oxidation rate" refers to a rate of converting NH3 or NH4 + to NO2 - at a rate of at least about 50, 75, 125, or 150 micromoles per minute. For example, this rate is the rate of converting NH4 + (e.g., about 200 mM) to NO2 -It can be at least about 50, 75, 125, or 150 micromoles per minute to convert to. In one embodiment, optimized NH4 + The oxidation rate is for NH3 or NH4 + is at least 10, 20, 30, 40, or 50% faster than the rate seen in naturally occurring N. eutropha to convert to NO2 - at the rate of conversion.
[0190] The percent amino acid sequence identity (%) to the amino acid sequences herein (e.g., the proteins expressed by N. eutropha D23) is defined as the percentage of amino acid residues in a candidate sequence that are identical to the amino acid residues in a reference sequence, which can be a naturally occurring N. eutropha sequence or an N. eutropha D23 sequence, after aligning the sequences and introducing gaps as necessary to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. The alignment for determining the percent amino acid sequence identity can be achieved in a variety of ways within the means of those skilled in the art using publicly available computer software such as, for example, BLAST, ALIGN, or Megalign (DNASTAR) software. One skilled in the art can determine the appropriate parameters for measuring the alignment, including any algorithm necessary to achieve the maximum alignment over the entire length of the sequences being compared. For example, the WU-BLAST-2 software can be used to determine amino acid sequence identity (Altschul et al, Methods in Enzymology 266, 460-480 (1996), http: / / blast.wustl / edu / blast / README.html). WU-BLAST-2 uses several search parameters, many of which are set to default values. These adjustable parameters are set to the following values: overlap span = 1, overlap fraction = 0.125, overall threshold (T) = I1. The HSP score (S) and HSP S2 parameters are dynamic values established by the program itself depending on the composition of the particular sequences, but the minimum values can be adjusted as needed.
[0191] An amino acid substitution can be the result of replacing one amino acid with another having similar structural and / or chemical properties (e.g., substitution of leucine with serine, i.e., a conservative amino acid substitution). Although typical, non-limiting conservative substitutions include the substitution of one another among the aliphatic amino acids Ala, Val, Leu, and Ile, the exchange of Ser and Thr containing hydroxy residues, the exchange of the acidic residues Asp and Glu, the exchange between the amide-containing residues Asn and Gln, the exchange of the basic residues Lys and Arg, the exchange of the aromatic residues Phe and Tyr, and the exchange of the small amino acids Ala, Ser, Thr, Met, and Gly. Further conservative substitutions include substitution with another amino acid having a similar spatial or steric arrangement of a certain amino acid, for example, the exchange of Asn and Asp, or the exchange of Gln and Glu. An amino acid substitution can also be the result of replacing one amino acid with another having different structural and / or chemical properties (i.e., a non-conservative amino acid substitution). Insertions or deletions can optionally be amino acids in the range of 1 to 5. Permissible modifications can be determined by systematically making amino acid insertions, deletions, or substitutions in the sequence and testing the resulting mutants for activity in in vivo or in vitro assays, for example, for the metabolism of urea or ammonia.
[0192] The percent sequence identity (%) to the nucleic acid sequences of this specification (e.g., the N. eutropha D23 genome and parts thereof) is defined as the percentage of nucleotides in a candidate sequence that are identical to the nucleotides in a reference sequence, which can be a naturally occurring N. eutropha sequence or an N. eutropha D23 sequence, after aligning the sequences and introducing gaps as necessary to achieve the maximum percent sequence identity. Alignment for determining nucleotide sequence identity can be achieved in various ways within the means of one of ordinary skill in the art, using publicly available computer software such as BLAST, for example. One of ordinary skill in the art can determine appropriate parameters for measuring alignment, including any algorithm necessary to achieve a maximum alignment over the full length of the sequences being compared.
[0193] The terms “polypeptide,” “peptide,” and “protein” (in the case of a single chain) are used interchangeably herein to refer to an amino acid polymer. This polymer can be linear or branched, can contain modified amino acids, and can be interrupted by non-amino acids. These terms also encompass amino acid polymers that have been modified (e.g., by any other manipulation such as disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or conjugation to a labeling component). This polypeptide can be isolated from a natural source, produced from a eukaryotic or prokaryotic host by recombinant techniques, or be a product of synthetic methods.
[0194] As used herein, “NH4 + optimized tolerance to” refers to the ability to grow for at least about 24 or 48 hours under conditions of NH3 or NH4 + above 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, or 300 mM. In one embodiment, the optimized tolerance to NH4 + is at the selected concentration of NH3 or NH4 +Refers to the ability to grow more rapidly by at least 10, 20, 30, 40, or 50% or longer by at least 10, 20, 30, 40, or 50% than is possible with naturally occurring N. eutropha in the presence of
[0195] As used herein with respect to comparisons between nucleic acid or protein sequences, "similar" means having homology. Similar genes or proteins can include, for example, substitutions (such as conservative or non-conservative substitutions, etc.), insertions (such as insertions of at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30 amino acids, and for example, insertions of up to 2, 3, 4, 5, 10, 15, 20, 25, 30, or 50 amino acids, or any positive combination thereof, or insertions of the number of nucleotides necessary to encode said amino acids), deletions (such as deletions of at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30 amino acids, and for example, deletions of up to 2, 3, 4, 5, 10, 15, 20, 25, 30, or 50 amino acids, or any positive combination thereof, or deletions of the number of nucleotides necessary to encode said amino acids), or any combination thereof. Each of the substitutions, insertions, and deletions can be located in the N-terminal, C-terminal, or central region of the protein or gene. In multiple embodiments, a conservative substitution is a substitution that does not change the charge and / or polarity and / or approximate size and / or geometry of the position being substituted.
[0196] As used herein, "transgenic" means containing one or more exogenous DNA moieties. The exogenous DNA is derived from another organism, such as another bacterium, bacteriophage, animal, or plant.
[0197] As used herein, treatment of a disease or condition refers to a reduction in the severity or frequency of at least one symptom of that disease or condition, compared to an untreated patient who is otherwise similar. Treatment can also refer to the arrest, delay, or reversal of the progression of a disease or condition, compared to an untreated patient who is otherwise similar. Treatment can include addressing the underlying cause of the disease and / or one or more symptoms.
[0198] As used herein, a therapeutically effective amount refers to an amount sufficient to prevent the progression of, or cause regression of, a disease or condition, or to alleviate the symptoms of a disease or condition, or to achieve a desired result. A therapeutically effective dose can be measured, for example, as the number of bacteria or viable bacteria (e.g., in CFU units), or the mass of bacteria (e.g., in milligrams, grams, or kilograms), or the volume of bacteria (e.g., in mm 3 units).
[0199] As used herein, the term "viability" refers to the ability of autotrophic bacteria, such as ammonia-oxidizing bacteria, to oxidize ammonia, ammonium, or urea to nitrite at a predetermined rate. In some embodiments, this rate is at least 50, 75, 125, or 150 micromoles NO2 - / min, e.g., about 100 - 150, 75 - 175, 75 - 125, 100 - 125, 125 - 150, or 125 - 175 micromoles / min, e.g., about 125 micromoles NO2 - / min of the conversion of ammonium ions (NH4 + )(e.g., about 200 mM) to nitrite (NO2 - ).
[0200] As referred to herein, "growth medium" or "AOB medium" contains the components of Table 3 or Table 4 below in this specification.
[0201] In some embodiments, the optimal state for the present disclosure is a growth state, e.g., a maximum growth state, characterized by at least a pH of about 7.6, ammonia, trace minerals, oxygen, and carbon dioxide. Another state may be characterized by a pH of about 7.4 or less and may be characterized by the absence of carbon dioxide. Under low carbon dioxide conditions, ammonia-oxidizing bacteria, e.g., Nitrosomonas, continue to oxidize ammonia to nitrite to generate ATP but lack sufficient carbon dioxide, e.g., to fix and generate proteins, and instead generate polyphosphate, which is used as an energy storage medium. This allows ammonia-oxidizing bacteria to remain in a "storage state" for a period of time, e.g., a predetermined period of time, e.g., at least 1, 2, 3, 4, 5, 6, 7 days, 1, 2, 3, 4 weeks, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months, 1, 2, 3, 4, or 5 years. In some embodiments, the ammonia-oxidizing bacteria can remain in the storage state for at least about 6 months to about 1 year.
[0202] As used herein, "growth state" refers to a state or environment that can have a pH of at least about 7.6, e.g., in a medium, e.g., a culture medium, e.g., a growth medium, of autotrophic bacteria, e.g., ammonia-oxidizing bacteria. The level of at least one of ammonia, ammonium ions, and urea can be from about 1 micromolar to 1000 millimolar. The level of trace substances is from about 0.01 micromolar iron to 200 micromolar iron. The level of oxygen is from about 5% to 100% oxygen saturation (e.g., of the medium). The level of carbon dioxide is from about 20 ppm to 10% saturation (e.g., of the medium). In certain embodiments, the level of at least one of ammonia, ammonium ions, and urea can be from about 10 micromolar to 100 millimolar. The level of trace substances is from about 0.1 micromolar iron to 20 micromolar iron. The level of oxygen is from about 5% to 100% oxygen saturation. The level of carbon dioxide is from about 200 ppm to 5% saturation (e.g., of the medium).
[0203] As used herein, "polyphosphate-loaded state" refers to a state or environment that may have a pH of about 7.4 or less, e.g., in a medium, e.g., a culture medium, e.g., a growth medium, of autotrophic bacteria, e.g., ammonia-oxidizing bacteria. The level of at least one of ammonia, ammonium ions, and urea is from about 1 micromole to 2000 millimoles. The level of trace substances is from 0.01 micromole iron to 200 micromole iron. The level of oxygen is about 0% to 100% O2 saturation (e.g., of the medium). The level of carbon dioxide is less than 0 to 400 ppm, and the level of phosphate exceeds about 1 micromole. In certain embodiments, the level of at least one of ammonia, ammonium ions, and urea is from about 10 micromoles to 200 millimoles. The level of trace substances is from 0.1 micromole iron to 20 micromole iron. The level of oxygen is about 5% to 100% O2 saturation. The level of carbon dioxide is less than about 0 to 200 ppm, and the level of phosphate exceeds about 10 micromoles.
[0204] The polyphosphate-loaded state can be induced for a period, e.g., a predetermined period. This predetermined period can be a period that allows sufficient polyphosphate accumulation in ammonia-oxidizing bacteria. This predetermined period is a period suitable for providing a sufficient polyphosphate load to allow long-term storage of ammonia-oxidizing bacteria. This predetermined period can be at least partially based on a period of about 0.2 to 10 times, 0.3 to 5 times, 0.5 to 3 times, 0.5 to 1.5 times, or 0.5 to 1 times the doubling time of ammonia-oxidizing bacteria. This predetermined period can be at least partially based on a period of about 1 doubling time of ammonia-oxidizing bacteria. In some embodiments, this predetermined period is from about 8 hours to 12 hours. In some embodiments, this predetermined period is about 10 hours. In some embodiments, this predetermined period is about 24 hours.
[0205] The purpose of the polyphosphate loading state is to provide sufficient ammonia, ammonium ions, and / or urea, as well as O2 to the AOB so that ATP can be generated, but they cannot use that ATP to fix CO2. Instead, by not providing them with CO2 and carbonate, they use that ATP to generate polyphosphate that can be stored by the bacteria.
[0206] As used herein, the term "storage state" refers to a state or environment having a pH of about 7.4 or less (in some embodiments, the pH can be 7.6 or less), such as in a medium, such as a culture medium, such as a growth medium, of autotrophic bacteria, such as ammonia-oxidizing bacteria. The level of at least one of ammonia, ammonium ions, and urea is about 1 to 1000 micromoles. The level of trace substances is about 0.1 to 100 micromoles. The level of oxygen is about 0 to 100% saturation (e.g., of the medium). The level of carbon dioxide is about 0 to 800 ppm. In certain embodiments, the level of at least one of ammonia, ammonium ions, and urea is about 10 to 100 micromoles. The level of trace substances is about 1 to 10 micromoles. The level of oxygen is about 0 to 100% saturation (e.g., of the medium). The level of carbon dioxide is about 0 to 400 ppm.
[0207] AOB is generated (i.e., in the storage state) by, according to some embodiments of the present disclosure, generating AOB biomass during the growth state, then exposing the AOB to the polyphosphate loading state, then removing the medium, and resuspending the AOB in a buffer, such as a storage buffer.
[0208] This ammonia-oxidizing bacterium can remain in a "storage state" for a period of time, for example, a predetermined period, such as at least 1, 2, 3, 4, 5, 6, 7 days, 1, 2, 3, 4 weeks, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months, 1, 2, 3, 4, or 5 years. In some embodiments, the ammonia-oxidizing bacterium can remain in the storage state for at least about 6 months to about 1 year. Upon regeneration, the viability of the ammonia-oxidizing bacterium is at least about 50%, 60%, 70%, 80%, 90%, or 100% of the viability of the ammonia-oxidizing bacterium before storage (e.g., in a growing state). In some embodiments, this ammonia-oxidizing bacterium preparation loses no more than 10%, 20%, 30%, 40%, 50%, 60%, or 70% of its ability to oxidize NH4 + when stored under selected conditions.
[0209] The time required to regenerate ammonia-oxidizing bacteria from a stored state (or polyphosphate-loaded state) can be a predetermined period. For example, this predetermined period can be less than about 75 hours, or less than about 72 hours. This predetermined period can be at least partially based on a period of about 0.2 to 10 times, 0.3 to 5 times, 0.5 to 3 times, 0.5 to 1.5 times, or 0.5 to 1 times the doubling time of the ammonia-oxidizing bacteria. This predetermined period can be at least partially based on a period of about 1 doubling time of the ammonia-oxidizing bacteria. This predetermined period can be about 8 hours to 12 hours. This predetermined period can be about 10 hours. This predetermined time can be less than about 75 hours, 72 hours, 70 hours, 68 hours, 65 hours, 60 hours, 55 hours, 50 hours, 45 hours, 40 hours, 35 hours, 30 hours, 25 hours, 20 hours, 15 hours, 10 hours, 5 hours, 4 hours, 3 hours, 2 hours, or 1 hour. This predetermined period can be about 5 minutes to 5 hours. This predetermined period can be about 5 to 10 minutes, 10 to 15 minutes, 15 to 20 minutes, 20 to 25 minutes, 25 to 30 minutes, 30 to 45 minutes, 45 to 60 minutes, 60 minutes to 1.5 hours, 1.5 hours to 2 hours, 2 hours to 2.5 hours, 2.5 hours to 3 hours, 3 hours to 3.5 hours, 3.5 hours to 4 hours, 4 hours to 4.5 hours, 4.5 hours to 5 hours. In some embodiments, this predetermined period can be about 2 hours. This predetermined period is, for example, the time required to achieve regeneration of the ammonia-oxidizing bacteria, for example, the viability of the ammonia-oxidizing bacteria compared to the viability of the bacteria before storage (e.g., in a growing state), for example, the time required to achieve a viability of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99%, or 100%.
[0210] 2. Ammonia-oxidizing bacteria (AOB), N. eutropha strain D23, and similar bacteria Autotrophic ammonia-oxidizing bacteria (which may be referred to herein as multiple AOBs (AOBs) or AOB) are obligate autotrophic bacteria referred to by Alan B. Hooper and A. Krummel et al. Alan B. Hooper, Biochemical Basis of Obligate Autotrophy in Nitrosomonas europaea, Journal of Bacteriology, Feb 1969, p.776-779. Antje Krummel et al., Effect of Organic Matter on Growth and Cell Yield of Ammonia-Oxidizing Bacteria, Arch Microbiol (1982) 133:50-54. These bacteria obtain all their metabolic energy solely from the oxidation of ammonia to nitrite in their respiratory chain with nitric oxide (NO) as an intermediate product, and obtain virtually all of their carbon by fixing carbon dioxide. They cannot utilize carbon sources other than a few simple molecules.
[0211] Ammonia-oxidizing bacteria (AOB) are widely found in the environment and, in the presence of ammonia, oxygen and trace metals fix carbon dioxide and grow. The growth of AOB can be slow, and toxic levels of ammonia can kill fish and other organisms before the AOB can grow and reduce the ammonia to non-toxic levels. The slow growth of AOB can also delay the health benefits of NO and nitrite produced by AOB when applied to the skin.
[0212] It is desired to supplement the aquarium, skin, or process with sufficient viable AOB grown and stored for that purpose. Since AOB do not form spores, storage in a dry state with high viability is difficult, and storage in a moist state keeps them metabolically active.
[0213] For example, the decay of nitrification ability during storage of AOB for wastewater treatment has been studied (Munz G, Lubello C, Oleszkiewicz JA. Modeling the decay of ammonium oxidizing bacteria. Water Res. 2011 Jan;45(2):557-64. Oi:10.1016 / j.watres.2010.09.022).
[0214] The growth, long-term storage, and restoration of activity of Nitrosomonas have been discussed by Cassidy et al. (U.S. Patent No. 5,314,542), who disclosed growing Nitrosomonas, removing toxic waste, storing it in a sterile water with appropriate salinity for up to one year, and then regenerating it by adding a buffer (CaCO3) and 200 ppm of ammonium (this regeneration takes 72 hours).
[0215] As obligate autotrophs, AOB use this energy to fix CO2 and synthesize proteins by reducing the equivalents generated by the oxidation of ammonia to nitrite. Growth requires ammonia, oxygen, minerals, and carbon dioxide.
[0216] Nitrosomonas can exist in several metabolic states according to "Polyphosphate and Orthophosphate Content of Nitrosomonas europaea as a Function of Growth" (K.R. Terry and A.B. Hooper, Journal of Bacteriology, July 1970, p. 199-206, Vol. 103, No. I).
[0217] In certain embodiments of the present disclosure, the ammonia-oxidizing bacteria can be pure. The ammonia-oxidizing bacteria preparation (formulation or composition) contains, consists essentially of, or consists of pure ammonia-oxidizing bacteria. The ammonia-oxidizing bacteria can be from a genus selected from the group consisting of Nitrosomonas, Nitrosococcus, Nitrosospira, Nitrosocystis, Nitrosolobus, Nitrosovibrio, and combinations thereof.
[0218] The present disclosure provides, among other things, a unique strain of ammonia-oxidizing bacteria, such as an optimized strain, strain D23 of N. eutropha, which can increase the production of nitric oxide and nitric oxide precursors on the surface of a subject, such as a human subject. The present disclosure also provides methods of using this bacterium and articles containing this bacterium.
[0219] In a plurality of embodiments, this N. eutropha does not occur naturally. For example, it may have accumulated desirable mutations during a selection period. In other embodiments, desirable mutations can be introduced by an experimenter. In some embodiments, this N. eutropha can be a purified preparation and can be an optimized N. eutropha.
[0220] In a preferred embodiment, this N. eutropha strain is autotrophic and thus cannot cause an infectious disease. The preferred strain utilizes urea, as well as ammonia, obviating the hydrolysis of urea in sweat prior to absorption and utilization by the bacterium. Also, in order to grow at low pH, this bacterium can absorb either NH4 + ions or urea. This selected strain must also have the ability to live on the outer epidermis of a subject, such as a human, and withstand the conditions there.
[0221] Although the present disclosure refers specifically to strain D23 of N. eutropha, preparations, methods, compositions, therapeutics, wearable articles, and clothing items having one or more other strains of N. eutropha, one or more other species of Nitrosomonas, and one or more of one or more other ammonia-oxidizing bacteria can be used. Autotrophic AOBs are obligate autotrophic bacteria referred to by Alan B. Hooper and A. Krummel et al. Alan B. Hooper, Biochemical Basis of Obligate Autotrophy in Nitrosomonas europaea, Journal Journal of Bacteriology, Feb 1969, p.776-779. Antje Krummel et al., Effect of Organic Matter on Growth and Cell Yield of Ammonia-Oxidizing Bacteria, Arch Microbiol (1982) 133:50-54. These bacteria obtain all their metabolic energy solely from the oxidation of ammonia to nitrite in their respiratory chain with nitric oxide (NO) as an intermediate product, and obtain virtually all carbon by fixing carbon dioxide. They cannot utilize carbon sources other than a few simple molecules.
[0222] In certain embodiments, this N. eutropha was deposited with the American Tissue Culture Collection (ATCC) on April 8, 2014, and is the strain with accession number PTA-121157 designated as AOB D23-100 (25 vials).
[0223] In certain embodiments, this N. eutropha contains a chromosome having a sequence that is at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to SEQ ID NO: 1 (the complete genome sequence of strain D23).
[0224] In certain embodiments, the bacteria having the above-described sequence characteristics have one or more of (1) the optimized growth rate measured by the doubling time, (2) the optimized growth rate measured by OD600, (3) the optimized NH4 + oxidation rate, (4) the optimized tolerance to NH4 + and (4) the optimized tolerance to NO2 - One or more of these characteristics. Specific sub-combinations of these characteristics are identified in the following paragraphs.
[0225] In some embodiments, the N. eutropha described herein has (1) the optimized growth rate measured by the doubling time, (2) the optimized growth rate measured by OD600, (3) the optimized NH4 + oxidation rate, (4) NH4+ Optimization tolerance to, and (4) NO2 - Has one or more of the optimization tolerances to. For example, the bacterium may have the characteristics (1) and (2); (2) and (3); (3) and (4); or (4) and (5) of the first list in this paragraph. As another example, the bacterium may have the characteristics (1), (2), and (3); (1), (2), and (4); (1), (2), and (5); (1), (3), and (4); (1), (3), and (5); (1), (4), and (5); (2), (3), and (4); (2), (3), and (5); or (3), (4), and (5) of the first list in this paragraph. As a further example, the bacterium may have the characteristics (1), (2), (3), and (4); (1), (2), (3), and (5); (1), (2), (4), and (5); (1), (3), (4), and (5); or (2), (3), (4), and (5) of the first list in this paragraph. In some embodiments, the bacterium has the characteristics (1), (2), (3), (4), and (5) of the first list in this paragraph.
[0226] The present disclosure relates to (1) the optimized growth rate measured by the doubling time, (2) the optimized growth rate measured by OD600, (3) the optimized NH4 + oxidation rate, (4) the optimization tolerance to NH4 + and (4) NO2 -Also provided is a pure composition of N. eutropha having one or more of the optimization resistances to. For example, this pure N. eutropha composition may have the characteristics (1) and (2); (2) and (3); (3) and (4); or (4) and (5) of the first list in this paragraph. As another example, this pure N. eutropha composition may have the characteristics (1), (2), and (3); (1), (2), and (4); (1), (2), and (5); (1), (3), and (4); (1), (3), and (5); (1), (4), and (5); (2), (3), and (4); (2), (3), and (5); or (3), (4), and (5) of the first list in this paragraph. As a further example, this pure N. eutropha composition may have the characteristics (1), (2), (3), and (4); (1), (2), (3), and (5); (1), (2), (4), and (5); (1), (3), (4), and (5); or (2), (3), (4), and (5) of the first list in this paragraph. In some embodiments, this pure N. eutropha composition of the first list in this paragraph has the characteristics (1), (2), (3), (4), and (5).
[0227] The N. eutropha strain D23, deposited with the ATCC Patent Depositary on April 8, 2014, under accession number PTA - 121157 in the form of 25 vials and designated as AOB D23 - 100, contains a circular genome having SEQ ID NO: 1 or its complement. Thus, in some embodiments, the N. eutropha strains described herein contain a nucleic acid sequence having a nucleic acid sequence similar to SEQ ID NO: 1 or its complement, for example, a genome.
[0228] For example, this N. eutropha may contain a nucleic acid sequence having a 1,000 - base - pair portion having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identity to the 1,000 - base - pair portion of SEQ ID NO: 1 or its complement. This 1,000 - base - pair portion may extend, for example, from nucleotide (n×1,000)+1 to (n + 1)×1,000, where n = 0, 1, 2, 3···2538, for example, nucleotides 1 - 1,000, 1,001 - 2,000, etc. up to the end of SEQ ID NO: 1.
[0229] In multiple embodiments, the present N. eutropha comprises a nucleic acid sequence having a 2,000-base pair portion with at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identity to the 2,000-base pair portion of SEQ ID NO: 1 or its complement. This 2,000-base pair portion can extend, for example, from nucleotide (n×2,000)+1 to (n + 1)×2,000, where n = 0, 1, 2, 3···1269, for example, nucleotides 1 to 2,000, 2,001 to 4,000, etc. up to the end of SEQ ID NO: 1.
[0230] In multiple embodiments, the present N. eutropha comprises a nucleic acid sequence having a 5,000-base pair portion with at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identity to the 5,000-base pair portion of SEQ ID NO: 1 or its complement. This 5,000-base pair portion can extend, for example, from nucleotide (n×5,000)+1 to (n + 1)×5,000, where n = 0, 1, 2, 3···508, for example, nucleotides 1 to 5,000, 5,001 to 10,000, etc. up to the end of SEQ ID NO: 1.
[0231] In multiple embodiments, the present N. eutropha comprises a nucleic acid sequence having a 10,000-base pair portion with at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identity to the 10,000-base pair portion of SEQ ID NO: 1 or its complement. This 10,000-base pair portion can extend, for example, from nucleotide (n×10,000)+1 to (n + 1)×10,000, where n = 0, 1, 2, 3···254, for example, nucleotides 1 to 10,000, 10,001 to 20,000, etc. up to the end of SEQ ID NO: 1.
[0232] In multiple embodiments, this N. eutropha comprises a nucleic acid sequence having a 20,000 base pair portion with at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identity to the 20,000 base pair portion of SEQ ID NO: 1 or its complement. This 20,000 base pair portion can extend, for example, from nucleotide (n×20,000)+1 to (n + 1)×20,000, where n = 0, 1, 2, 3 ··· 127. For example, it can be nucleotides 1 to 20,000, 20,001 to 40,000, etc. up to the end of SEQ ID NO: 1.
[0233] In multiple embodiments, this N. eutropha comprises a nucleic acid sequence having a 50,000 base pair portion with at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identity to the 50,000 base pair portion of SEQ ID NO: 1 or its complement. This 50,000 base pair portion can extend, for example, from nucleotide (n×50,000)+1 to (n + 1)×50,000, where n = 0, 1, 2, 3 ··· 51. For example, it can be nucleotides 1 to 50,000, 50,001 to 100,000, etc. up to the end of SEQ ID NO: 1.
[0234] In multiple embodiments, this N. eutropha comprises a nucleic acid sequence having a 100,000 base pair portion with at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identity to the 100,000 base pair portion of SEQ ID NO: 1 or its complement. This 100,000 base pair portion can extend, for example, from nucleotide (n×100,000)+1 to (n + 1)×100,000, where n = 0, 1, 2, 3 ··· 26. For example, it can be nucleotides 1 to 100,000, 100,001 to 20,000, etc. up to the end of SEQ ID NO: 1.
[0235] In some embodiments, the disclosure provides compositions of N. eutropha comprising a chromosome that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to SEQ ID NO:1. In some embodiments, the disclosure provides pure compositions of N. eutropha comprising a chromosome that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to SEQ ID NO:1.
[0236] In certain embodiments, the N. eutropha strain hybridizes to SEQ ID NO:1, or to the genome of strain D23 deposited in the form of 25 vials with the ATCC Patent Depository under accession number PTA-121157 on April 8, 2014 and designated as AOB D23-100, or to their complements, under low stringency, moderate stringency, high stringency, or very high stringency conditions, or under other hybridization conditions described herein. As used herein, the term "hybridizes under low stringency, moderate stringency, high stringency, or very high stringency conditions" describes the hybridization and washing conditions. Guidance for performing hybridization reactions is provided in Current Protocols in Molecular Biology, John Wiley & It can be found in Sons, N.Y. (1989), 6.3.1 - 6.3.6. Both aqueous and non-aqueous methods are described in this reference, and either can be used. The specific hybridization conditions referred to in this specification are as follows: 1) Low stringency hybridization conditions in 6x sodium chloride / sodium citrate (SSC) at about 45°C, followed by at least two washes in 0.2x SSC, 0.1% SDS at 50°C or higher (the temperature of these washes can be increased to 55°C in the case of low stringency conditions), 2) Moderate stringency hybridization conditions in 6x SSC at about 45°C, followed by one or more washes in 0.2x SSC, 0.1% SDS at 60°C, 3) High stringency hybridization conditions in 6x SSC at about 45°C, followed by one or more washes in 0.2x SSC, 0.1% SDS at 65°C, 4) Very high stringency hybridization conditions are 0.5M sodium phosphate, 7% SDS at 65°C, followed by one or more washes in 0.2x SSC, 1% SDS at 65°C. The very high stringency conditions (4) are the preferred conditions and are the conditions to be used unless otherwise specified.
[0237] The genome of strain D23 (SEQ ID NO: 1) was compared with the genome of N. eutropha C91. The annotation of the D23 genome is shown in Supplementary Table 1, which lists the positions of 2,777 genes in SEQ ID NO: 1 identified by sequence analysis. In certain embodiments, N. eutropha as described herein comprises one or more genes or proteins listed in Supplementary Table 1, or genes or proteins similar to one of said genes or said proteins.
[0238] Thus, in some embodiments, the present N. eutropha comprises the genes of Supplementary Table 1, or the proteins encoded by said genes. In certain embodiments, the present N. eutropha comprises genes that are similar to (e.g., at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identical to) the genes of Supplementary Table 1, or the proteins encoded by said genes. In multiple embodiments, the present N. eutropha comprises at least 2, 3, 4, 5, 10, 20, 30, 40, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 1000, 1500, 2000, 2500 of the genes of Supplementary Table 1, or all of them, or genes or proteins that are identical or similar to the proteins encoded by said genes.
[0239] In some embodiments, the N. eutropha described herein (e.g., strain D23) comprises one or more genes or proteins that are absent in strain C91, or genes or proteins that are similar to one of said genes or said proteins. Examples of these genes are presented in FIGS. 6-8 and are described in more detail in Example 4 of this specification.
[0240] Thus, with respect to FIG. 6, in some embodiments, the present N. eutropha comprises 1, 2, 3, 4, 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, or all of the genes of FIG. 6 that are identical or similar (e.g., at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identical). In some embodiments, the present N. eutropha comprises 1, 2, 3, 4, 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, or all of the proteins encoded by the genes listed in FIG. 6 that are identical or similar (e.g., at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identical).
[0241] With respect to Figure 7, in some embodiments, this N. eutropha comprises 1, 2, 3, 4, 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, or all of the genes in Figure 7 that are identical or similar (e.g., at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identical). In some embodiments, this N. eutropha comprises 1, 2, 3, 4, 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, or all of the proteins encoded by the genes listed in Figure 7 that are identical or similar (e.g., at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identical).
[0242] With respect to Figure 8, in some embodiments, this N. eutropha comprises 1, 2, 3, 4, 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 200, or all of the genes in Figure 8 that are identical or similar (e.g., at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identical). In some embodiments, this N. eutropha comprises 1, 2, 3, 4, 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 200, or all of the proteins encoded by the genes listed in Figure 8 that are identical or similar (e.g., at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identical).
[0243] Collectively with respect to FIGS. 6-8, in some embodiments, this N. eutropha contains 1, 2, 3, 4, 5, 10, 20, 40, 60, 80, 100, 150, 200, 250, 300, 350, 400, 450, 500, or all of the genes shown in FIGS. 6-8 that are identical or similar (e.g., at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identical). In some embodiments, this N. eutropha contains 1, 2, 3, 4, 5, 10, 20, 40, 60, 80, 100, 150, 200, 250, 300, 350, 400, 450, 500, or all of the proteins encoded by the genes listed in FIGS. 6-8 that are identical or similar (e.g., at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identical).
[0244] In some embodiments, the N. eutropha described herein (e.g., strain D23) lacks one or more genes or proteins specific to strain C91, or genes or proteins similar to one of said genes or said proteins. Examples of these genes are presented in FIG. 9 and are described in more detail in Example 4 herein. Thus, in some embodiments, the N. eutropha described herein lacks at least 1, 2, 3, 4, 5, 10, 20, 50, 100, 150, 200, 250, or all of the genes shown in FIG. 9. In some embodiments, the N. eutropha described herein lacks at most 2, 3, 4, 5, 10, 20, 50, 100, 150, 200, 250, or all of the genes shown in FIG. 9. In multiple embodiments, the N. eutropha described herein lacks about 1-5, 5-10, 10-20, 20-50, 50-100, 100-150, 150-200, 200-250, or 250 to all of the genes shown in FIG. 9.
[0245] Sequencing of the D23 genome revealed genes involved in ammonia metabolism (e.g., ammonia monooxygenase, hydroxylamine oxidoreductase, cytochrome c554, and cytochrome cM Several potentially interesting genes were identified, including those containing <552>. All of these genes are present in multiple copies, and generally, these copies are not identical to each other. An interesting set of genes is the ammonia monooxygenase synthesis operon amoCAB, which is present in two copies in addition to a third copy of amoC. These operons have homologs in C91, namely Neut_2078 / 7 / 6 and Neut_2319 / 8 / 7. Another set of interesting genes is the hydroxylamine oxidoreductase (hao), which is present in three copies. This hao homolog in C91 is designated Neut_1672, 1793, and 2335. A third set of interesting genes is the cytochrome c554 gene encoded by cycA, which is present in three copies. The corresponding C91 genes are designated Neut_1670, 1791, and 2333. A fourth set of interesting genes is the cytochrome c M 552 gene, which is present in two copies. These homologous C91 genes are designated Neut_1790 and 2332. Each gene group is summarized in Table 1 and will be discussed in more detail below.
Table 1
[0246] In some embodiments, the N. eutropha described herein contains genes that are the same as or similar to the genes and proteins in Table 1.
[0247] More specifically, in certain embodiments, the present disclosure provides a composition of N. eutropha comprising a nucleic acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to the ammonia monooxygenase sequence of Table 1, e.g., a purified N. eutropha preparation. In certain embodiments, the present disclosure provides a composition of N. eutropha comprising a nucleic acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to the hydroxylamine oxidoreductase sequence of Table 1. In certain embodiments, the present disclosure provides a composition of N. eutropha comprising a nucleic acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to the cytochrome c554 sequence of Table 1. In certain embodiments, the present disclosure provides a composition of N. eutropha comprising a nucleic acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to the cytochrome c M 552 sequence, e.g., a purified N. eutropha preparation. In certain embodiments, the present disclosure provides a composition of N. eutropha comprising a nucleic acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.3%, 99.4%, 99.5%, or 99.6% identical to the ammonia monooxygenase sequence of Table 1. In certain embodiments, the present disclosure provides a composition of N. eutropha comprising an amino acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.4%, 99.5%, 99.6%, or 99.7% identical to the hydroxylamine oxidoreductase sequence of Table 1. In certain embodiments, the present disclosure provides a composition of N. eutropha comprising an amino acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.5%, 99.6%, or 99.7% identical to the cytochrome c554 sequence of Table 1. In certain embodiments, the present disclosure provides a composition of N. eutropha comprising an amino acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.5%, 99.6%, or 99.7% identical to the cytochrome c
[0248] 552 sequence. In certain embodiments, the present disclosure provides a composition of N. eutropha comprising an amino acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.3%, 99.4%, 99.5%, or 99.6% identical to the ammonia monooxygenase sequence of Table 1. In certain embodiments, the present disclosure provides a composition of N. eutropha comprising an amino acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.4%, 99.5%, 99.6%, or 99.7% identical to the hydroxylamine oxidoreductase sequence of Table 1. In certain embodiments, the present disclosure provides a composition of N. eutropha comprising an amino acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.5%, 99.6%, or 99.7% identical to the cytochrome c554 sequence of Table 1. In certain embodiments, the present disclosure provides a composition of N. eutropha comprising an amino acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.5%, 99.6%, or 99.7% identical to the cytochrome c MProvided are compositions of N. eutropha comprising an amino acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 97.1%, 97.2%, 97.5%, 98%, 98.5%, 98.6%, 98.7%, 98.8%, 99%, or 99.5% identical to the 552 sequence.
[0249] In some embodiments, the N. eutropha is present in a pure composition, e.g., in the form of a purified optimized N. eutropha preparation.
[0250] More specifically, in certain aspects, the present disclosure provides a pure composition of N. eutropha comprising a nucleic acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 98.5%, 98.8%, 98.9%, 99%, 99.2%, 99.3%, 99.4%, 99.5%, or 99.6% identical to the ammonia monooxygenase sequence of Table 1. In certain aspects, the present disclosure provides a pure composition of N. eutropha comprising a nucleic acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to the hydroxylamine oxidoreductase sequence of Table 1. In certain aspects, the present disclosure provides a pure composition of N. eutropha comprising a nucleic acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to the cytochrome c554 sequence of Table 1. In certain aspects, the present disclosure provides a pure composition of N. eutropha comprising a nucleic acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to the cytochrome c M Provided are pure compositions of N. eutropha comprising a nucleic acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to the 552 sequence.
[0251] In certain embodiments, the present disclosure provides a pure composition of N. eutropha comprising an amino acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 98.5%, 98.8%, 98.9%, 99%, 99.2%, 99.3%, 99.4%, 99.5%, or 99.6% identical to the ammonia monooxygenase sequence of Table 1. In certain embodiments, the present disclosure provides a pure composition of N. eutropha comprising an amino acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.4%, 99.5%, 99.6%, or 99.7% identical to the hydroxylamine oxidoreductase sequence of Table 1. In certain embodiments, the present disclosure provides a pure composition of N. eutropha comprising an amino acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.5%, 99.6%, or 99.7% identical to the cytochrome c554 sequence of Table 1. In certain embodiments, the present disclosure provides a pure composition of N. eutropha comprising an amino acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 97.1%, 97.2%, 97.5%, 98%, 98.5%, 98.6%, 98.7%, 98.8%, 99%, or 99.5% identical to the cytochrome c M 552 sequence of Table 1.
[0252] In some embodiments, the present N. eutropha comprises a gene or protein comprising a sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to any of the sequences of strain D23 of Table 1, e.g., any of SEQ ID NOs: 4-33. Substitutions can be conservative or non-conservative and insertions and deletions are also contemplated. In some embodiments, the present N. eutropha comprises a gene or protein comprising any of the sequences of Table 1, e.g., any of SEQ ID NOs: 4-33. In some embodiments, this protein has an N-terminal and / or C-terminal extension or deletion of up to about 1, 2, 3, 4, 5, 6, 8, 10, 15, 20, 25, 50, or 100 amino acids.
[0253] The nucleic acid sequence alignment of Table 1 shows the percentage identity between the homolog of C91 and the homolog of D23. The following paragraphs discuss this percentage identity and describe various genes having homology with the D23 gene of Table 1.
[0254] More specifically, these amoA1 genes are approximately 98.8% identical (i.e., at positions 821 / 831). Thus, in some embodiments, the N. eutropha described herein contains D23 nucleotides at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or all of the positions where this gene differs between strain C91 and strain D23. In multiple embodiments, the N. eutropha described herein contains D23 nucleotides at a maximum of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or all of the positions where this gene differs between strain C91 and strain D23. In multiple embodiments, the N. eutropha described herein contains a gene that is at least about 98.8%, 98.9%, 99.0%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 amoA1 gene.
[0255] These amoA2 genes are approximately 98.8% identical (i.e., at positions 821 / 831). Thus, in some embodiments, the N. eutropha described herein contains D23 nucleotides at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or all of the positions where this gene differs between strain C91 and strain D23. In multiple embodiments, the N. eutropha described herein contains D23 nucleotides at a maximum of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or all of the positions where this gene differs between strain C91 and strain D23. In multiple embodiments, the N. eutropha described herein contains a gene that is at least about 98.8%, 98.9%, 99.0%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 amoA2 gene.
[0256] These amoB1 genes are approximately 99.1% identical (i.e., at positions 1255 / 1266). Thus, in some embodiments, the N. eutropha described herein contains D23 nucleotides at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or all of the positions where this gene differs between strain C91 and strain D23. In multiple embodiments, the N. eutropha described herein contains D23 nucleotides at a maximum of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or all of the positions where this gene differs between strain C91 and strain D23. In multiple embodiments, the N. eutropha described herein contains a gene that is at least about 99.1%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 amoB1 gene.
[0257] These amoB2 genes are approximately 99.1% identical (i.e., at positions 1254 / 1266). Thus, in some embodiments, the N. eutropha described herein contains D23 nucleotides at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or all of the positions where this gene differs between strain C91 and strain D23. In multiple embodiments, the N. eutropha described herein contains D23 nucleotides at a maximum of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or all of the positions where this gene differs between strain C91 and strain D23. In multiple embodiments, the N. eutropha described herein contains a gene that is at least about 99.1%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 amoB2 gene.
[0258] These amoC1 genes are approximately 99.8% identical (i.e., at positions 814 / 816). Thus, in some embodiments, N. eutropha as described herein contains D23 nucleotides at at least 1, 2, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, N. eutropha as described herein contains D23 nucleotides at a maximum of 1, 2, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, N. eutropha as described herein contains a gene that is at least about 99.8%, 99.9%, or 100% identical to the D23 amoC1 gene.
[0259] These amoC2 genes are approximately 99.8% identical (i.e., at positions 814 / 816). Thus, in some embodiments, N. eutropha as described herein contains D23 nucleotides at at least 1, 2, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, N. eutropha as described herein contains D23 nucleotides at a maximum of 1, 2, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, N. eutropha as described herein contains a gene that is at least about 99.8%, 99.9%, or 100% identical to the D23 amoC2 gene.
[0260] These amoC3 genes are approximately 98.9% identical (i.e., at positions 816 / 825). Thus, in some embodiments, the N. eutropha described herein contains D23 nucleotides at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or all of the positions where this gene differs between strain C91 and strain D23. In multiple embodiments, the N. eutropha described herein contains D23 nucleotides at a maximum of 1, 2, 3, 4, 5, 6, 7, 8, 9, or all of the positions where this gene differs between strain C91 and strain D23. In multiple embodiments, the N. eutropha described herein contains a gene that is at least about 98.9%, 99.0%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 amoC3 gene.
[0261] These hao1 genes are approximately 99.0% identical (i.e., at positions 1696 / 1713). Thus, in some embodiments, the N. eutropha described herein contains D23 nucleotides at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or all of the positions where this gene differs between strain C91 and strain D23. In multiple embodiments, the N. eutropha described herein contains D23 nucleotides at a maximum of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or all of the positions where this gene differs between strain C91 and strain D23. In multiple embodiments, the N. eutropha described herein contains a gene that is at least about 99.0%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 hao1 gene.
[0262] These hao2 genes are approximately 99.4% identical (i.e., at positions 1702 / 1713). Thus, in some embodiments, N. eutropha as described herein contains D23 nucleotides at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, N. eutropha as described herein contains D23 nucleotides at at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, N. eutropha as described herein contains a gene that is at least about 99.4%, 99.6%, 99.8%, or 100% identical to the D23 hao2 gene.
[0263] These hao3 genes are approximately 99.2% identical (i.e., at positions 1700 / 1713). Thus, in some embodiments, N. eutropha as described herein contains D23 nucleotides at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, N. eutropha as described herein contains D23 nucleotides at at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, N. eutropha as described herein contains a gene that is at least about 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 hao3 gene.
[0264] These cycA1 genes are approximately 98.0% identical (i.e., at positions 694 / 708). Thus, in some embodiments, the N. eutropha described herein contains D23 nucleotides at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or all of the positions where this gene differs between strain C91 and strain D23. In multiple embodiments, the N. eutropha described herein contains D23 nucleotides at a maximum of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or all of the positions where this gene differs between strain C91 and strain D23. In multiple embodiments, the N. eutropha described herein contains a gene that is at least about 98.0%, 98.2%, 98.4%, 98.6%, 98.8%, 99.0%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 cycA1 gene.
[0265] These cycA2 genes are approximately 98.7% identical (i.e., at positions 699 / 708). Thus, in some embodiments, the N. eutropha described herein contains D23 nucleotides at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or all of the positions where this gene differs between strain C91 and strain D23. In multiple embodiments, the N. eutropha described herein contains D23 nucleotides at a maximum of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or all of the positions where this gene differs between strain C91 and strain D23. In multiple embodiments, the N. eutropha described herein contains a gene that is at least about 98.7%, 98.8%, 99.0%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 cycA2 gene.
[0266] These cycA3 genes are approximately 99.3% identical (i.e., at positions 703 / 708). Thus, in some embodiments, the N. eutropha described herein contains D23 nucleotides at at least 1, 2, 3, 4, 5, or all of the positions where this gene differs between strain C91 and strain D23. In multiple embodiments, the N. eutropha described herein contains D23 nucleotides at a maximum of 1, 2, 3, 4, 5, or all of the positions where this gene differs between strain C91 and strain D23. In multiple embodiments, the N. eutropha described herein contains a gene that is at least about 99.3%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 cycA3 gene.
[0267] These cycB1 genes are approximately 96.7% identical (i.e., at positions 696 / 720). Thus, in some embodiments, the N. eutropha described herein contains D23 nucleotides at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or all of the positions where this gene differs between strain C91 and strain D23. In multiple embodiments, the N. eutropha described herein contains D23 nucleotides at a maximum of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or all of the positions where this gene differs between strain C91 and strain D23. In multiple embodiments, the N. eutropha described herein contains a gene that is at least about 96.7%, 96.8%, 97.0%, 97.2%, 97.4%, 97.6%, 97.8%, 98.0%, 98.2%, 98.4%, 98.4%, 98.6%, 98.8%, 99.0%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 cycB1 gene.
[0268] These cycB2 genes are approximately 97.1% identical (i.e., at positions 702 / 723). Thus, in some embodiments, the N. eutropha described herein contains D23 nucleotides at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, the N. eutropha described herein contains D23 nucleotides at a maximum of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or all of the positions where this gene differs between strain C91 and strain D23. In some embodiments, the N. eutropha described herein contains a gene that is at least about 97.1%, 97.2%, 97.4%, 97.6%, 97.8%, 98.0%, 98.2%, 98.4%, 98.4%, 98.6%, 98.8%, 99.0%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 cycB2 gene.
[0269] The following four paragraphs describe the genes and proteins in Table 1 in more detail.
[0270] Ammonia monooxygenase catalyzes the reaction
Chemical formula
Chemical formula
[0271] The ability of D23 to aerobically dissimilate ammonia as the sole energy source and reductant is due to two specialized protein complexes, Amo and Hao, and cytochromes c554 and c that send electrons to the quinone pool. mRequires 552. During ammonia oxidation at low oxygen concentrations, the NO reductase activity of c554 is important. N. eutropha strain D23 contains three cytochrome c554 genes designated cycA1, cycA2, and cycA3. These genes and the corresponding proteins are listed in Table 1 above. In some embodiments, the N. eutropha described herein contains 1, 2, or 3 cytochrome c554 genes and / or proteins (e.g., the D23 sequence of Table 1), or genes and / or proteins similar thereto. For example, the present N. eutropha may contain all of the cytochrome c554 genes and / or proteins (e.g., the D23 sequence of Table 1), or genes and / or proteins similar thereto. Even more specifically, in some embodiments, the present N. eutropha contains all of the D23 cytochrome c554 genes of Table 1. In some embodiments, the present N. eutropha contains all of the D23 cytochrome c554 proteins of Table 1.
[0272] The ability of D23 to aerobically dissimilate ammonia as the sole energy source and reductant depends on two specialized protein complexes, Amo and Hao, and cytochromes c554 and c that send electrons to the quinone pool. m Requires 552. Cytochrome c m 552 reduces quinone with electrons from Hao. N. eutropha strain D23 contains two cytochrome c M 552 genes designated cycB1 and cycB2. These genes and the corresponding proteins are listed in Table 1 above. In some embodiments, the N. eutropha described herein contains 1 or 2 cytochrome c M 552 genes and / or proteins (e.g., the D23 sequence of Table 1), or genes and / or proteins similar thereto. For example, the present N. eutropha contains the cytochrome c MIt may contain both the 552 gene and / or protein (e.g., the D23 sequence in Table 1), or a similar gene and / or protein. More specifically, in some embodiments, this N. eutropha is the D23 cytochrome c in Table 1 M It contains both of the 552 genes. In some embodiments, this N. eutropha is the D23 cytochrome c in Table 1 M It contains both of the 552 proteins.
[0273] In some embodiments, the N. eutropha described herein contains a combination of genes and / or proteins selected from Table 1. This combination may include, for example, the genes and / or proteins listed in the previous four paragraphs. For example, this combination may include two classes of genes and / or proteins in Table 1. Thus, in some embodiments, this N. eutropha contains one or more ammonia monooxygenase genes and / or proteins and one or more hydroxylamine oxidoreductase genes and / or proteins as described in Table 1 or in the previous four paragraphs. In multiple embodiments, this N. eutropha contains one or more ammonia monooxygenase genes and / or proteins and one or more cytochrome c554 genes and / or proteins as described in Table 1 or in the previous four paragraphs. In multiple embodiments, this N. eutropha contains one or more ammonia monooxygenase genes and / or proteins and one or more cytochrome c M 552 genes and / or proteins. In multiple embodiments, this N. eutropha contains one or more hydroxylamine oxidoreductase genes and / or proteins and one or more cytochrome c554 genes and / or proteins as described in Table 1 or in the previous four paragraphs. In multiple embodiments, this N. eutropha contains one or more hydroxylamine oxidoreductase genes and / or proteins and one or more cytochrome c M 552 genes and / or proteins.
[0274] This combination may also include the genes and / or proteins of the three classes in Table 1. Thus, in some embodiments, this N. eutropha comprises one or more ammonia monooxygenase genes and / or proteins as described in Table 1 or in the foregoing four paragraphs, and one or more hydroxylamine oxidoreductase genes and / or proteins, and one or more cytochrome c554 genes and / or proteins. In a plurality of embodiments, this N. eutropha comprises one or more ammonia monooxygenase genes and / or proteins as described in Table 1 or in the foregoing four paragraphs, and one or more hydroxylamine oxidoreductase genes and / or proteins, and one or more cytochrome c M 552 genes and / or proteins. In a plurality of embodiments, this N. eutropha comprises one or more one or more ammonia monooxygenase genes and / or proteins as described in Table 1 or in the foregoing four paragraphs, and one or more cytochrome c554 genes and / or proteins, and / or one or more cytochrome c M 552 genes and / or proteins. In a plurality of embodiments, this N. eutropha comprises one or more one or more hydroxylamine oxidoreductase genes and / or proteins as described in Table 1 or in the foregoing four paragraphs, and one or more cytochrome c554 genes and / or proteins, and / or one or more cytochrome c M 552 genes and / or proteins.
[0275] This combination may include genes and / or proteins of all four classes in Table 1. Thus, in some embodiments, this N. eutropha has one or more ammonia monooxygenase genes and / or proteins, and one or more hydroxylamine oxidoreductase genes and / or proteins, and one or more cytochrome c554 genes and / or proteins, and / or one or more cytochrome c M 552 genes as described in Table 1 or in the foregoing four paragraphs.
[0276] Table 2 (below) lists the sequence differences between the D23 protein and the C91 protein in Table 1. For example, AmoA1 has an M at position 1 of C91 but a V at position 1 of D23, and this difference is abbreviated as M1V in Table 2. As another example, D23 CycB1 has an insertion of DDD between residues 194 and 195 of the C91 protein, and the added residues become residues 195, 196, and 197 of the D23 protein, and these differences are abbreviated as 195insD, 196insD, and 197insD in Table 2, respectively. The sequence alignments that form the basis of Table 2 are shown in Figures 10 - 16.
Table 2
[0277] Thus, the N. eutropha described herein may include one or more of the sequence characteristics listed in Table 2. For example, this N. eutropha may include at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, or all of the sequence characteristics in Table 2. In some embodiments, this N. eutropha includes 2, 3, 4, 5, 10, 15, 20, 25, 30 or fewer, or all of the sequence characteristics in Table 2. In multiple embodiments, this N...
Claims
[Claim 1] The invention as depicted in the drawings.
Citation Information
Patent Citations
Compound containing ammonia-oxidizing bacteria that enhances productivity of nitric oxide and nitric oxide precursors, and method of using the same
JP2004506028A
Composition containing ammonia-oxidizing bacteria and method of use thereof
JP2005515218A