Compositions and methods for treating pancreatic cancer

Aptamer-conjugated antisense oligonucleotides targeting KRAS-RAF-MEK-ERK pathways in pancreatic cancer cells provide a novel treatment for PDAC by effectively inhibiting KRAS and SOS1 expression, reducing cancer cell growth and inducing apoptosis.

JP2025521912APending Publication Date: 2025-07-10MOLECULAR AXIOM LLC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025500169
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-07-06
Filing Date
2023-07-06
Publication Date
2025-07-10

AI Technical Summary

Technical Problem

Pancreatic ductal adenocarcinoma (PDAC) has limited treatment options, with over 90% of patients relying on KRAS mutations, necessitating new therapies that target the RAS gene and its regulatory proteins effectively without off-target effects.

Method used

Compositions comprising aptamers that target pancreatic cancer cells and antisense oligonucleotides inhibiting KRAS-RAF-MEK-ERK signaling pathways, using RNA aptamers with specific nucleotide sequences to deliver antisense oligonucleotides that inhibit KRAS and SOS1 mRNA expression, potentially conjugated or encapsulated in nanoparticles.

Benefits of technology

The approach effectively inhibits KRAS and SOS1 expression, reducing pancreatic cancer cell growth and proliferation, demonstrating significant knockdown of mutant KRAS mRNA and protein levels, and inducing apoptosis in pancreatic cancer cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025521912000001_ABST
    Figure 2025521912000001_ABST
Patent Text Reader

Abstract

In various aspects and embodiments, the present disclosure provides compositions and methods for treating pancreatic cancer (e.g., pancreatic ductal adenocarcinoma, i.e., PDAC). According to aspects of the present disclosure, the composition comprises an aptamer that targets accumulation of the composition to pancreatic cancer cells, and an antisense oligonucleotide that inhibits the expression of mRNA associated with important signaling pathways that promote the growth or survival of pancreatic cancer cells, such as the KRAS-RAF-MEK-ERK signaling pathway or the RTK-RAS-ERK cascade. Exemplary antisense oligonucleotides described herein target KRAS, including mutant KRAS. Exemplary antisense oligonucleotides described herein target SOS1 and / or SOS2 transcripts.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Priority This application claims the benefit of, and priority to, U.S. Provisional Application No. 63 / 358,588, filed Jul. 6, 2022, which is hereby incorporated by reference in its entirety.

Summary of the Invention

[0002] Background Art Pancreatic ductal adenocarcinoma (PDAC) is a lethal malignancy with limited treatment options. More than 90% of PDAC patients primarily rely on activating mutations in the KRAS GTPase. There is a high priority need for new therapies that target the RAS gene, particularly KRAS, and the proteins that regulate Ras activity. In various aspects and embodiments of the present disclosure, compositions and methods for treating pancreatic cancer are provided.

Brief Description of the Drawings

[0003]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11A

Figure 11B

Figure 11C

Figure 12

Figure 13

Figure 14A-14B

Figure 15

Figure 16

Figure 17

Figure 18

Mode for Carrying Out the Invention

[0004] In various aspects and embodiments, the present disclosure provides compositions and methods for treating pancreatic cancer (e.g., pancreatic ductal adenocarcinoma, i.e., PDAC). According to aspects of the present disclosure, the composition comprises an aptamer that targets accumulation of the composition to pancreatic cancer cells, and an antisense oligonucleotide that inhibits the expression of mRNA associated with important signaling pathways that promote the growth or survival of pancreatic cancer cells, such as the KRAS-RAF-MEK-ERK signaling pathway or the RTK-RAS-ERK cascade.

[0005] Pancreatic ductal adenocarcinoma (PDAC) is one of the most lethal human cancers, with a 5-year survival rate of less than about 7%. The majority of patients die within 6 months after diagnosis. PDAC frequently harbors KRAS mutations. KRAS (Kirsten rat sarcoma virus) or K-Ras is part of the RAS / MAPK pathway. The K-Ras protein is a GTPase that is activated by binding of GTP. The K-Ras protein is inactivated when it converts GTP to GDP. When the protein binds to GDP, it does not relay signals to the cell nucleus. In normal quiescent cells, K-Ras is mainly bound to GDP and is inactive. When receptor tyrosine kinase (RTK) is activated, K-Ras-GTP is transiently formed, which regulates a number of intracellular signaling networks and controls the mitogenic process. K-Ras can also bind to proteins of the guanine nucleotide exchange factor (GEF) class (such as SOS1), which results in the forced release of the bound nucleotide (GDP) from K-Ras. Single amino acid substitutions in K-Ras cause activating mutations in various malignancies, including lung adenocarcinoma, mucinous adenoma, pancreatic ductal carcinoma, and colorectal cancer. Frequently occurring driver mutations include G12 substitutions, which cause K-Ras to bind persistently to GTP and become constitutively activated. K-Ras is a major component of the KRAS-RAF-MEK-ERK signaling pathway and an essential regulator of cell proliferation. See Waters AM and Der CJ, KRAS: The Critical Driver and Therapeutics Target for Pancreatic Cancer, Cold Spring Harb. Perspect. Med. 2018.

[0006] Furthermore, the RTK-Ras-ERK cascade is a central signaling module involved in the control of biological processes including cell proliferation and survival. The coupling of RTKs to Ras is mediated by the Ras-specific nucleotide exchange factor Son of SEVENLESS (Sos), which activates Ras by inducing the exchange of GDP for GTP. A positive feedback loop involving Ras-GTP and Sos leads to an increase in the amplitude and duration of Ras activation in response to EGF stimulation.

[0007] In various aspects and embodiments, the compositions of the present disclosure include RNA aptamers that associate with antisense oligonucleotides that inhibit the expression of mRNAs associated with major signaling pathways such as the KRAS-RAF-MEK-ERK signaling pathway or the RTK-RAS-ERK pathway in pancreatic cancer cells. Without wishing to be bound by theory, the aptamers can target cell surface molecules or endocytosis membrane-associated proteins (e.g., membrane receptors or glycoproteins) that are overexpressed or specifically expressed in pancreatic cancer cells. The associated antisense oligonucleotides inhibit the expression of endogenous nucleic acids (e.g., mRNAs) in pancreatic cancer cells that are required for the KRAS-RAF-MEK-ERK signaling pathway or the RTK-RAS-ERK signaling pathway. The present disclosure contemplates compositions involving conjugation between the aptamer and the antisense oligonucleotide, or encapsulation of the antisense oligonucleotide in aptamer-decorated particles. As used herein, the terms "conjugated to" or "conjugate" refer to the state of two or more entities that are linked by direct or indirect covalent or non-covalent interactions. In some embodiments, the conjugation is through covalent interactions.

[0008] According to the present disclosure, the aptamer comprises a nucleotide sequence that targets accumulation of the composition to pancreatic cancer cells, thereby overcoming the limitations of conventional approaches that target mutant K-Ras and / or related signaling cascades that lack sufficient efficacy or potency or exhibit off-target effects. In some embodiments, the aptamer comprises the nucleotide sequence GAAUGCCC (SEQ ID NO: 1003). Exemplary aptamers comprise the nucleotide sequence CUCAAUGGCGAAUGCCCGCCUAAUAGGG (SEQ ID NO: 1004) or derivatives thereof. In some embodiments, the aptamer comprises the nucleotide sequence: GGGAGACAAGAAUAAACGCUCAAUGGCGAAUGCCCGCCUAAUAGGGCGUUAUGACUUGUUGAGUUCGACAGGAGGCUCACAACAGGC (SEQ ID NO: 1005) or derivatives thereof. In some embodiments, the aptamer comprises from 1 to about 20, or 1 to about 15, or 1 to about 10, or 1 to 5 nucleic acid base substitutions with respect to SEQ ID NO: 1004 or 1005. In some embodiments, the substitutions are modified nucleic acid bases (e.g., modified U for U, modified A for A, modified G for G, or modified C for C) as known in the art. The aptamers and derivatives are described in U.S. Patent Nos. 10,550,394, 11,261,449, and 9,464,293, each of which is incorporated herein by reference in its entirety. In various embodiments, the aptamer has a nucleotide sequence (as described above) that is about 100 nucleotides or less in length, or about 88 nucleotides or less in length, or about 80 nucleotides or less in length, or about 70 nucleotides or less in length, or about 60 nucleotides or less in length, or about 50 nucleotides or less in length, or about 40 nucleotides or less in length, or about 30 nucleotides or less in length.In various embodiments, the aptamer is at least about 20 nucleotides in length, or at least about 25 nucleotides in length, or at least about 28 nucleotides in length. For example, in various embodiments, the aptamer has a length of from about 25 nucleotides to about 80 nucleotides, by way of example, from 25 nucleotides to about 60 nucleotides, or from about 25 nucleotides to about 40 nucleotides in length.

[0009] In various embodiments, the aptamer nucleotide sequence can be chemically modified. In some embodiments, the aptamer comprises RNA nucleotides, i.e., nucleotides having a 2'-hydroxyl. In some embodiments, the aptamer can include non-RNA nucleotides modified at the 2' position. For example, the aptamer nucleotide sequence may include one or more (or all or substantially all) pyrimidines modified with 2'-fluoro (i.e., fU or fC), which in some embodiments can improve nuclease resistance and / or aptamer folding. In some embodiments, the aptamer comprises one or more additional chemical modifications described herein, which include 2' modifications known in the art (e.g., 2'-O-methyl, 2'-O-ethyl, 2'-O-methoxyethyl (MOE), and bridged nucleotides having a bridge from 2' to 4', by way of example, LNA or cEt), backbone modifications (e.g., phosphorothioate or phosphorodithioate), or nucleobase modifications (i.e., modified nucleotides). See U.S. Patent No. 10,064,959, which is incorporated herein by reference. In some embodiments, the aptamer is phosphorothioated without backbone modification.

[0010] In some embodiments, the aptamer has the structure of 5'[fC][fU][fC]AA[fU]GG[fC]GAA[fU]G[fC][fC][fC]G[fC][fC][fU]AA[fU]AGGG3' (SEQ ID NO: 1006), and is designated herein as P19. In this structure, "f" indicates a 2'-fluoro nucleotide.

[0011] In some embodiments, the aptamer comprises one or more hydrocarbon linkers (e.g., alkylene) or polyether linkers (e.g., PEG linker) inserted between one or more nucleotides. In some embodiments, the nucleotides of the aptamer may be replaced with a hydrocarbon linker or a polyether linker (e.g., replacing 2 to 10 nucleotides), provided that the binding or selectivity of the aptamer for pancreatic cancer cells is not substantially reduced by the replacement (e.g., not reduced by more than 20% or more than 10%). In some embodiments, the nucleotides are replaced with linkers that are not present in the core motif. Exemplary spacer moieties are described herein and can be oligoethylene glycol moieties that provide a spacer of 3 to 18 atoms. Aptamers having a spacer can be synthesized using phosphoramidite spacer moieties known in the art.

[0012] In various embodiments, the compositions of the present disclosure inhibit the expression of the KRAS gene, which is one of the four major driver genes (KRAS, TP53, CDKN2A, and SMAD4) in PDAC. As a member of the RAS gene family, the KRAS protein (21 kDa) has GTPase activity and thus binds to GTP in the activated state and GDP in the inactivated state. Ras regulates cell growth, differentiation, and apoptosis by activating several signaling pathways, including the RAF / MEK / ERK, PI3K / AKT / mTOR, PLC / PKC, and RAL pathways.

[0013] In some embodiments, the antisense oligonucleotide targets KRAS mRNA. Exemplary nucleobase sequences of antisense oligonucleotides targeting KRAS are shown in Table 1. In some embodiments, the antisense oligonucleotide comprises or consists of the nucleotide sequences listed in Table 1 or Table 2. In some embodiments, the antisense oligonucleotide targets WT and mutant KRAS isoform mRNAs, i.e., the oligonucleotide is not specific for the mRNA encoding the mutant form of KRAS. In these embodiments, the aptamer selectively delivers the antisense oligonucleotide to cancer cells, thereby avoiding any toxicity in normal cells due to loss of KRAS expression and obviating the need for genetic testing of the patient's KRAS mutations.

[0014] In some embodiments, the antisense oligonucleotide targets mutant KRAS mRNA (e.g., encoding the G12 variant), and such antisense oligonucleotides comprise or consist of the nucleotide sequences shown in Table 3. In still other embodiments, the oligonucleotide comprises or consists of the sequences listed in Table 4. For the sake of brevity, nucleotide sequences may be shown herein using DNA nucleotide sequences (i.e., containing the T nucleobase) or RNA nucleotide sequences (i.e., containing the U nucleobase). From the context (unless otherwise specified), it is understood that when a nucleotide or sequence is intended to be RNA, the T nucleotide is replaced by U (or a modified U such as pseudouridine or 1-methylpseudouridine), and vice versa for DNA.

[0015] In various embodiments, the antisense oligonucleotide comprises at least 8, or at least 10, or at least 12 consecutive nucleotides of the nucleotide sequences shown in Table 1, Table 2, Table 3, or Table 4. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence selected from Table 13. In some embodiments, the antisense oligonucleotide has 13 to 24 contiguous nucleotides (e.g., 13 to 18, or 13 to 16, or 14 to 16 consecutive nucleotides) of (or including) the sequences disclosed in Table 1, Table 2, Table 3, or Table 4.

[0016] Exemplary antisense oligonucleotides comprise or consist of a nucleotide sequence selected from Table 3. Antisense oligonucleotides (ASOs) phosphorothioate-linked from the sequences in Table 3 are constructed as gapmers. For example, unless otherwise indicated in Table 3, the nucleotide sequences are constructed as 3-X-3 gapmers having three locked nucleotides (LNAs) at each end. The antisense oligonucleotides are fully phosphorothioate-linked. Alternatively, the ASOs may be constructed according to other chemical profiles described herein.

[0017] Exemplary antisense oligonucleotides comprise or consist of a nucleotide sequence selected from Table 4. Antisense oligonucleotides constructed from the sequences in Table 4 may be constructed as gapmers. For example, the nucleotide sequences can be constructed as 3-X-3 gapmers having three locked nucleotides (LNAs) at each end. The antisense oligonucleotides can be fully phosphorothioate-linked. Alternatively, the ASOs may be constructed according to other chemical profiles described herein.

[0018] Exemplary nucleotide sequences and antisense oligonucleotides targeting KRAS (wild-type or mutant) are described in WO2023 / 034537 and U.S. Provisional Application No. 63 / 480,467, which are hereby incorporated by reference in their entirety. Such nucleotide sequences and antisense oligonucleotides may be used in connection with the present disclosure.

[0019] In some embodiments, the antisense oligonucleotide targets the KRAS mRNA encoding mutant KRAS. In various embodiments, the mutant KRAS is selected from a G12C mutation, a G12V mutation, a G12A mutation, and a G12D mutation. For example, the antisense oligonucleotide may comprise or consist of a nucleotide sequence selected from Table 3 or Table 4.

[0020] In some embodiments, the antisense oligonucleotide selectively targets and inhibits the expression of SOS1 and / or SOS2, thereby preventing the interaction between SOS1 and KRAS in the guanosine diphosphate (GDP)-bound "off" state, which is the inactivated state of KRAS.

[0021] In some embodiments, the antisense oligonucleotides target (e.g., hybridize to) SOS1 and / or SOS2 mRNA. Son of Sevenless 1 and 2 (SOS1 and SOS2) promote the activation of RAS. In some embodiments, the oligonucleotide targets SOS1, transcript variant 2 (NM_001382394.1), transcript variant 3 (NM_001382395.1), or transcript variant 1 (NM_005633.4). In some embodiments, the antisense oligonucleotide targets SOS2 mRNA (NM_006939.4). In some embodiments, the antisense oligonucleotide is complementary to SOS1 or SOS2 but also has significant activity against other mRNAs. Nucleotide sequences and antisense oligonucleotides that target (e.g., hybridize to) SOS1 or SOS2 mRNA are described in WO2022 / 226377, US Provisional Application No. 63 / 358,588, US Provisional Application No. 63 / 476,895, and US Provisional Application No. 63 / 479,103, the contents of which are hereby incorporated by reference in their entirety, and such nucleotide sequences and antisense oligonucleotides can be used in connection with the present disclosure. Exemplary nucleotide sequences for constructing antisense oligonucleotides are shown in Table 13 herein.

[0022] In various embodiments, the antisense oligonucleotide comprises at least 8, or at least 10, or at least 12 consecutive nucleotides of the nucleotide sequences from Table 13. In various embodiments, the antisense oligonucleotide has 13 to 24 linked nucleotides, 13 to 18 linked nucleotides, or 13 to 16 linked nucleotides. In some embodiments, the antisense oligonucleotide is 14 to 16 nucleotides in length. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence selected from Table 13. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence selected from Table 13. In some embodiments, the nucleotide sequence targeting SOS1 and / or SOS2 mRNA is constructed as a gapmer as described herein. Unless otherwise indicated, the ASO compounds of Table 13 are constructed as gapmers having two or three LNAs at each end (and are fully phosphorothioate linked). In some embodiments, the wing segment may contain 5-methylcytosine nucleobases replacing RNA nucleotides. In an exemplary embodiment, the antisense oligonucleotide consists of the nucleotide sequence of SEQ ID NO: 582, SEQ ID NO: 835, or SEQ ID NO: 1000.

[0023] In some embodiments, binding (e.g., hybridization) of the antisense oligonucleotide to the target mRNA causes degradation of the target mRNA or blocks translation of the target mRNA. In some embodiments, when the antisense oligonucleotide binds to the target mRNA, a double-stranded nucleic acid molecule is created, and then endogenous nucleases for degrading the mRNA are recruited. In some embodiments, the antisense oligonucleotide recruits RNaseH and has an extension of DNA nucleotides sufficient to thereby cause degradation of the target mRNA. For example, the antisense oligonucleotide may have an extension (e.g., a central extension) of at least 6 or at least 8 DNA nucleotides, and this extension of at least 8 DNA nucleotides is optionally an extension of 9 or 10 DNA nucleotides. In some embodiments, one or more DNA nucleotides include a 2'-chemical modification independently selected from 2'-fluoro, 2'-methyl, and 2'-ethyl. For example, the antisense oligonucleotide can be a gapmer having a 5' segment and a 3' segment, each of the 5' segment and the 3' segment being 2 to 6 nucleotides or 2 to 4 nucleotides, and the 5' segment and the 3' segment containing no DNA nucleotides. In some embodiments, the gapmer is a 3-X-3 gapmer having 3 RNA nucleotides (e.g., LNA, etc.) at each end. In some embodiments, the gapmer is a 3-8-3 gapmer having a central block of DNA nucleotides and 5' and 3' segments of 3 RNA nucleotides each. In other embodiments, the gapmer is a 2-X-2 gapmer, such as, by way of example, a 2-10-2 gapmer or a 2-9-2 gapmer, having a central block of 8 to 10 DNA nucleotides and 5' and 3' segments of 2 RNA nucleotides each. In some embodiments, the gapmer is a 3-X-2 gapmer or a 2-X-3 gapmer. In some embodiments, the gapmer is a 3-10-3 gapmer.In some embodiments, one or more nucleotides of the 5’ segment and the 3’ segment include a 2’-O substituent, and optionally, all of the nucleotides of the 5’ segment and the 3’ segment include a 2’-O substituent. Exemplary 2’-O substituents are independently selected from 2’-O-methyl, 2’-O-ethyl, 2’-O-methoxyethyl (MOE), and bridged nucleotides having a bridge from the 2’ to the 4’ position (e.g., locked nucleotides or bicyclic nucleotides). In some embodiments, the bridged nucleotide has a methylene bridge (LNA) or a constrained ethyl bridge (cEt). In still other embodiments, one or more cytosine nucleotides within the 5’ segment and the 3’ segment are 5-methylcytosine (“5Me”) nucleobases (instead of 2’-modified RNA) and can be 5-methyldC ((5Me)dC). Such constructs are still considered gapmers, with RNA nucleotides adjacent to at least one side of the (5Me)dC nucleotide.

[0024] The term “gapmer” refers to an oligonucleotide having a central block of deoxynucleotides (also referred to herein as “DNA nucleotides”) having 5’ and 3’ segments of RNA nucleotides. As used herein, the term “DNA nucleotide” refers to a nucleotide that is not an RNA nucleotide. DNA nucleotides typically have 2’H, but may alternatively have various 2’ chemical modifications including 2’-halo and 2’-lower alkyl (e.g., C1-C4). In some embodiments, the 2’ chemical modification of the DNA nucleotide is independently selected from 2’-fluoro, 2’-methyl, and 2’-ethyl.

[0025] Locked nucleic acids (LNAs) or “locked nucleotides” are described, for example, in U.S. Patent Nos. 6,268,490; 6,316,198; 6,403,566; 6,770,748; 6,998,484; 6,670,461; and 7,034,133, all of which are hereby incorporated by reference in their entirety. An LNA is a modified nucleotide containing a bridge between the 2′ and 4′ carbons of the sugar moiety, which results in a “locked” conformation and / or bicyclic structure. Other suitable locked nucleotides that can be incorporated into the oligonucleotides of the present disclosure include those described in U.S. Patent Nos. 6,403,566 and 6,833,361, both of which are hereby incorporated by reference in their entirety. In an exemplary embodiment, the locked nucleotide is selected independently from 2′ to 4′ methylene bridges (referred to as LNAs) and constrained ethyl (cEt) bridges (see U.S. Patent Nos. 7,399,845 and 7,569,686, both of which are hereby incorporated by reference in their entirety).

[0026] In some embodiments, the antisense oligonucleotide has a modified backbone or modified internucleotide linkage. The term "internucleotide linkage" refers to the linkage between two adjacent nucleotides in a polynucleotide molecule. Of course, the internucleotide linkage is a phosphodiester bond formed between two oxygen atoms of a phosphate group and an oxygen atom of a sugar (either the 3'- or 5'-position), forming two ester bonds that bridge between two adjacent nucleosides. Modification of the internucleotide linkage may result in various properties, including but not limited to improved stability. For example, phosphorothioate or phosphorodithioate linkages increase the resistance of the internucleotide linkage to nucleases. Another example is the phosphonoacetate (PACE) linkage that improves transfection properties and enhances nuclease resistance. Internucleotide linkages and oligonucleotide backbone modifications that can be used in the oligonucleotides herein include, but are not limited to, phosphodiester, phosphorothioate, phosphorodithioate, methylphosphonate, alkylphosphonate, alkylphosphonothioate, phosphotriester, phosphoramidate, phosphoramidite, phosphorodiamidate, siloxane, carbonate, carbalkoxy, acetamidate, carbamate, morpholino, peptide nucleic acid, borano, thioether, bridged phosphoramidate, bridged methylene phosphonate, bridged phosphorothioate, and sulfone internucleoside linkages. In some embodiments, the antisense oligonucleotide comprises one or more phosphorothioate or phosphorodithioate nucleotides.

[0027] In some embodiments, the antisense oligonucleotide comprises one or more phosphorothioate or phosphorodithioate internucleotide linkages. In some embodiments, a phosphorothioate or phosphorodithioate linkage can be introduced between the last 3-5 nucleotides at the 5' end and / or 3' end of the oligonucleotide to reduce exonuclease degradation. In some embodiments, the antisense oligonucleotide has a combination of phosphodiester and phosphorothioate / phosphorodithioate linkages. In some embodiments, the antisense oligonucleotide contains at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 phosphorothioate or phosphorodithioate internucleotide linkages. In some embodiments, the antisense oligonucleotide comprises substantially alternating phosphodiester and phosphorothioate internucleotide linkages. In some embodiments, the antisense oligonucleotide is fully phosphorothioate / phosphorodithioate linked (i.e., all linkages are either phosphorothioate or phosphorodithioate). In some embodiments, the antisense oligonucleotide and the aptamer are fully phosphorothioate or phosphorodithioate linked.

[0028] In some embodiments, particularly when recruitment of RNaseH is undesirable, the antisense oligonucleotide has a morpholino backbone. Morpholino oligonucleotides generally do not induce degradation of their target RNA molecules and can be effective in sterically blocking target RNA sequences. Morpholino oligonucleotides and their synthesis are generally disclosed in U.S. Patent No. 11,028,386, U.S. Patent No. 10,947,533, and U.S. Patent No. 10,927,378, each of which is incorporated herein by reference in its entirety. In some embodiments, the antisense oligonucleotide includes thiomorpholino nucleotides and / or other substituted or modified nucleotides, such as those described in WO / 2019 / 060522 and WO / 2018 / 057430, each of which is incorporated herein by reference in its entirety. For example, Langner et al. describe a method for synthesizing an oligonucleotide analog called a thiophosphoramidate morpholino oligonucleotide (TMO) incorporating morpholino nucleosides and phosphorothioate linkages (“Synthesis and characterization of thiophosphoramidate morpholino oligonucleotides and chimeras.” JACS 142.38 (2020): 16240-16253; also see Dumbovic, Gabrijela, et al. “Nuclear compartmentalization of TERT mRNA and TUG1 lncRNA is driven by intron retention.” Nature Communications 12.1 (2021): 1-19; both are incorporated herein by reference in their entirety). Thus, the antisense oligonucleotides described herein can include fully or partially TMO-modified nucleotides, or chimeras of TMO-modified nucleotides and unmodified nucleotides and / or other nucleotides (e.g., LNA) containing different modifications.

[0029] In some embodiments, the antisense oligonucleotide may contain one or more modified bases. In some embodiments, cytosine is replaced with 5-methylcytosine, which may improve base pairing. Optionally, other modified bases (especially cytosine or guanine) can be used to reduce immunogenicity. Other modified bases are described in U.S. Patent No. 10,064,959, which is incorporated herein by reference.

[0030] In embodiments, the melting temperature of the antisense oligonucleotide hybridized to its target sequence is at least about 35°C. The Tm of an oligonucleotide is the temperature at which 50% of the oligonucleotide forms a duplex with its perfect complement and 50% is free in solution. Tm can be determined experimentally by measuring the change in absorbance of the oligonucleotide and its complement as a function of temperature. Tm can also be estimated using published known Tm calculators. In some embodiments, the Tm of the oligonucleotide hybridized to its target sequence is at least about 40°C, or at least about 45°C, or at least about 50°C. In some embodiments, the Tm of the oligonucleotide hybridized to its target sequence is from about 35°C to about 60°C. In some embodiments, the Tm of the oligonucleotide hybridized to its target sequence is from about 40°C to about 60°C, or from about 50°C to about 60°C.

[0031] In various embodiments, the aptamer and the antisense oligonucleotide are directly or indirectly linked via a linker. In some embodiments, the antisense oligonucleotide is directly or indirectly conjugated to the 3’ or 5’ end of the aptamer. In embodiments, the linker is directly or indirectly linked to the 3’ end of the aptamer. When conjugated indirectly via a linker, the linker may or may not be biologically cleavable (e.g., by a nuclease or other enzyme, or by disulfide reduction). Exemplary linkers may include amine, ester, and / or disulfide functional groups. A disulfide-containing linker may be reduced, for example, by glutathione within an endocytic vesicle, to decouple, for example, the aptamer and the antisense oligonucleotide. In some embodiments, the linker includes an alkylene (e.g., C2-C12, or C2-C8, or C2-C6) or oligoethylene glycol spacer, providing, for example, a spacer of 3 to 60 atoms, such as a spacer of 3, 6, 9, 12, 15, or 18 atoms. An exemplary spacer 18 (also referred to herein as a HEG spacer (hexaethylene glycol)) is an 18-atom spacer that can be placed at the 5’, 3’, or internally. Spacer 18 can be added and incorporated continuously when a longer spacer is needed (e.g., Sp18-Sp18). [Chemical formula]

[0032] In some embodiments, the linker is a C3 propyl spacer. Similar to spacer 18, multiple C3 spacers can be added to introduce a longer spacer arm (e.g., {SpC3}{SpC3}). [Chemical formula]

[0033] In some embodiments, the aptamer and the antisense oligonucleotide are directly linked via an oligonucleotide linker of, for example, 1 to 30 nucleotides, 1 to 20 nucleotides, or 2 to 15 nucleotides, or 6 to 15 nucleotides, or 8 to 14 nucleotides. In some embodiments, the linker is 3 nucleotides. In some embodiments, the linker is 4 nucleotides. In some embodiments, the linker is 5 nucleotides. In some embodiments, the linker is 6 nucleotides. In some embodiments, the linker is 7 nucleotides. In some embodiments, the linker is 8 nucleotides. In some embodiments, the linker is 9 nucleotides. In some embodiments, the linker is 10 nucleotides. In some embodiments, the linker is 11 nucleotides. In some embodiments, the linker is 12 nucleotides. The nucleotide composition or the sequence of the linker can be selected to avoid the formation of secondary structures. For example, the linker can substantially avoid combinations of nucleotides that form base pairs, such as Watson-Crick base pairs, and G and U nucleotides. In some embodiments, the nucleotide linker is an extension of a single nucleobase such as oligo A (e.g., an A8 - A14 linker such as an A12 linker). In various embodiments, the linker contains DNA or RNA nucleotides. For example, in some embodiments, the linker contains DNA nucleotides and does not contain a modified backbone. In some embodiments, the linker contains one or more RNA nucleotides that enable RNase cleavage.

[0034] In some embodiments, the composition includes a sterol conjugate (e.g., a cholesterol conjugate), or a fatty acid conjugate, such as a palmitoyl or stearyl lipid conjugate, which are optionally conjugated to the 3’ end of the aptamer-antisense oligonucleotide conjugate. These moieties can improve cell permeability. See US9,012,225, which is hereby incorporated by reference in its entirety.

[0035] In some embodiments, the antisense oligonucleotide is encapsulated within the particle and the aptamer is presented on the surface of the particle. In various embodiments, the particle is a liposome, a polymeric nanoparticle, or a lipid nanoparticle (LNP). Exemplary polymeric nanoparticles can be formed from PLA, PLGA, or their PEG copolymers. In some embodiments, the particle comprises a poly(β-amino ester) polymer. In various embodiments, the LNP comprises a cationic or ionizable lipid, a neutral lipid, cholesterol or a cholesterol moiety, and a PEGylated lipid. In an exemplary embodiment, the aptamer is conjugated to the end of a portion of the PEG groups that form a hydrophilic outer sheath.

[0036] In some embodiments, the lipid nanoparticle (or LNP) comprises a structural lipid. Exemplary structural lipids can be selected from one or more of cholesterol, fucosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, and tocopherol (e.g., alpha-tocopherol). In some embodiments, the structural lipid is cholesterol.

[0037] In some embodiments, the LNP comprises one or more phospholipids. Exemplary phospholipids are selected from the group consisting of cardiolipin, sterol-modified lipids (lipids modified by a cholesterol moiety attached to the sn-2 carbon of the glycerol backbone), mixed acyl glycerophospholipids, and symmetric acyl glycerophospholipids. Examples of the head group of the acyl glycerophospholipid include phosphatidic acid, lysophosphatidic acid, phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphoinositide, and phosphatidylserine.Exemplary phospholipids are selected from 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-doundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleoyl-2-cholesteryl hemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 LysoPC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), and sphingomyelin.

[0038] In some embodiments, the lipid nanoparticle composition further comprises one or more PEG lipids. A PEG lipid is a lipid modified with polyethylene glycol. Exemplary PEG lipids are selected from one or more of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, and PEG-modified dialkylglycerol. The PEG lipid can be selected from PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, PEG-cholesterol, PEG-tocopherol, or PEG-DSPE lipid.

[0039] Lipid particle formulations used in embodiments of the present disclosure include those described in US9,738,593; US10,221,127; US10,166,298, which are hereby incorporated by reference in their entirety. In some embodiments, the liposomes or nanoparticles further comprise a targeting moiety as described.

[0040] In another aspect, the present disclosure provides a method for treating a subject having pancreatic cancer. In various embodiments, the cancer is adenocarcinoma (e.g., pancreatic ductal adenocarcinoma), squamous cell carcinoma, adenosquamous carcinoma, and colloid carcinoma. In some embodiments, the pancreatic cancer is stage 1 cancer, stage 2 cancer, stage 3 cancer, or stage 4 cancer. In some embodiments, the cancer is non-metastatic. In other embodiments, the cancer is metastatic. The method comprises administering to the subject an effective amount of the composition described herein. In some embodiments, the subject is identified as having pancreatic cancer with a KRAS mutation, such as a KRAS mutation selected from G12C mutation, G12V mutation, G12A mutation, and G12D mutation. In such embodiments, the composition can be selected by its specificity for mutant KRAS mRNA as already described (see, for example, Tables 3 and 4).

[0041] In various embodiments, the compositions of the present disclosure are administered parenterally, such as by intravenous or intraarterial injection. In some embodiments, the compositions are administered by intramuscular, subcutaneous, or direct injection into the target tissue (e.g., pancreatic tissue).

[0042] The dosage and dosing schedule can vary depending on the patient's condition and the chemical nature of the compound. In various embodiments, the compositions are administered approximately weekly, approximately bi-monthly (i.e., approximately every other week), approximately monthly, or approximately quarterly. The dosage and dosing schedule can further include varying the dosage and frequency based on the patient's response.

[0043] As used herein, the term "about" means ±10% of the relevant value, unless otherwise specified in the context.

[0044] Other aspects and embodiments of the present disclosure will become apparent from the following examples. TIFF2025521912000004.tif222170TIFF2025521912000005.tif234170TIFF2025521912000006.tif234170TIFF2025521912000007.tif233170TIFF2025521912000008.tif234170TIFF2025521912000009.tif247170TIFF2025521912000010.tif240170TIFF2025521912000011.tif231170TIFF2025521912000012.tif229170TIFF2025521912000013.tif227170TIFF2025521912000014.tif230170TIFF2025521912000015.tif229170TIFF2025521912000016.tif226170TIFF2025521912000017.tif229170TIFF2025521912000018.tif235170TIFF2025521912000019.tif115170TIFF2025521912000020.tif236170TIFF2025521912000021.tif223170TIFF2025521912000022.tif228170TIFF2025521912000023.tif192170TIFF2025521912000024.tif206170TIFF2025521912000025.tif106170TIFF2025521912000026.tif221170TIFF2025521912000027.tif169170

Example

[0045] Example 1. Knockdown of KRAS mRNA Cell culture conditions and in vitro transfection Various tumor cell lines having different KRAS mutations were plated in 96-well plates at a density of 20,000 cells per well and treated with both 5 nM and 20 nM antisense oligonucleotides by transfection using Lipofectamine (Life Technology, USA). Transfection was performed according to the vendor's recommendations and incubated for 3 hours using 0.3 μL of Lipofectamine per well. After 2 days, the cells were harvested and subjected to the Quantigene assay (Life Technology, USA) for relative quantitative analysis of mRNA. The catalog numbers of the KRAS probe and the PPIB (reference gene for normalizing the expression level) probe are SA-50338 and SA-50155, respectively. The percent decrease in mRNA relative to the non-targeted control oligonucleotide was calculated and summarized in Table 5. The results indicate that the KRAS-targeted oligonucleotide can inhibit KRAS mRNA in NCI-H358 cells (a non-small cell lung cancer cell line carrying the KRAS mutation). TIFF2025521912000028.tif127170

[0046] Example 2. Inhibition of pERK The NCI-H358 tumor cell line having the KRAS mutation was plated in 96-well plates at a density of 20,000 cells per well and treated with both 5 nM and 20 nM antisense oligonucleotides by transfection using Lipofectamine (Life Technology, USA). Transfection was performed according to the vendor's recommendations and incubated for 3 hours using 0.3 μL of Lipofectamine per well. After 4 days, the cells were harvested and subjected to the pERK AlphaLISA assay (Cat.ALSU-PERK-A10K, Perkin Elmer, USA). The pERK inhibition in each treatment was calculated by normalizing with a non-targeted control oligo and summarized in Table 6 below. The results show that the oligonucleotide targeting KRAS inhibits pERK in NCI-H358 cells. TIFF2025521912000029.tif223170

[0047] Example 3. Antisense Oligonucleotide-Mediated Growth Inhibition of Various Cancer Cells Various tumor cell lines carrying various KRAS mutations were plated in 384-well plates at a density of 800 cells per well and treated with both 5 μM and 1 μM antisense oligonucleotides by co-incubation. After 7 days, cell viability was measured using the CellTiter-Glo® 2.0 assay (Promega, USA) according to the vendor's protocol, and the growth inhibition relative to a non-targeted control oligo was calculated. The results are summarized in Tables 7-10. The results demonstrate that the mutant-targeted antisense oligonucleotides are effective in targeting mutant KRAS. TIFF2025521912000030.tif178170TIFF2025521912000031.tif176170TIFF2025521912000032.tif99170TIFF2025521912000033.tif176170TIFF2025521912000034.tif220170TIFF2025521912000035.tif169170TIFF2025521912000036.tif167170TIFF2025521912000037.tif136170TIFF2025521912000038.tif178170TIFF2025521912000039.tif125170

[0048] Example 4: Mutant KRAS (G12C Mutation) Knockdown For transfection with the oligonucleotides described herein, cells were treated with Lipofectamine and harvested at 48 hours post-transfection for mRNA expression analysis. Data were individually normalized to the PPIB mRNA level and knockdown percentages were calculated relative to non-targeting ASO. B2M indicates cell transfection by transfection control. Figure 1 exemplifies mRNA knockdown of mutant KRAS (NCI-H358 cells) with the G12C mutation by ASO28, ASO37, ASO67, or ASO80 (Table 3). The mRNA knockdown of mutant KRAS with the G12C mutation was prominent when mediated by ASO28 and ASO67.

[0049] For protein level analysis, cells were seeded at 10,000 cells / well in 12-well plates and transfected with ASO / Lipofectamine (3 μl Lipofectamine). Cells were harvested on day 3 post-transfection and protein expression was analyzed. The ASO used in the study was ASO28 (G12C ASO, 16-mer), and the cell lines used were NCI-H358 (G12C, KRAS mutant heterozygous) and A375 (KRAS wild-type). Figure 2 exemplifies protein expression knockdown of both KRAS and downstream proteins of the KRAS-RAF-MEK-ERK signaling pathway (pERK, a MAPK marker; and pS6, a marker downstream of ERK). Also, Figure 2 exemplifies the increase in apoptosis marker (cPARP) expression mediated by an increase in the amount of ASO (ASO28) used for transfection.

[0050] Figure 3 illustrates another experiment regarding protein expression knockdown of both KRAS and downstream proteins of the KRAS-RAF-MEK-ERK signaling pathway (pERK, a MAPK marker, and pS6, an ERK downstream marker). Cells were seeded in 6-well plates at 100,000 cells / well, and the cells were transfected with ASO / Lipofectamine (3 μl Lipofectamine). Cells were harvested on the third day after transfection, and protein expression was analyzed. The ASOs used in the study were ASO28 (G12C ASO, 16-mer) and ASO67 (Gl2C ASO, 14-mer). The cell line used was NCI-H358 (Gl2C, KRAS mutation heterozygous). Protein expression of both KRAS and downstream proteins of the KRAS-RAF-MEK-ERK signaling pathway (pERK, a MAPK marker, and pS6, an ERK downstream marker) decreased in a dose-dependent manner in cells transfected with ASO28 or ASO67. Also, Figure 3 illustrates an increase in apoptosis marker (cPARP) expression mediated by an increase in the amount of ASO (ASO28 and ASO67) used for transfection.

[0051] Figure 4 illustrates 3D cell growth inhibition resulting from inhibition of mutant KRAS expression by contacting cells carrying a KRAS mutation (NCI-H358 cells with a KRAS G12C mutation) with the oligonucleotides described herein (e.g., ASO28 or ASO67). 3D growth of NCI-H358 (with a G12C KRAS mutation) was measured on the 7th day (left) and 13th day (right) after ASO treatment.

[0052] Example 5: Mutant KRAS (G12V mutation) knockdown Cells were seeded in a 12-well plate at 10,000 cells / well, and the cells were transfected with ASO / Lipofectamine (3 μl Lipofectamine). Cells were harvested on the third day after transfection, and protein expression was analyzed. The ASO used in the study was ASO80 (Gl2VASO, 14-mer), and the cell lines used were LCLC97TM1 (Gl2V, KRAS mutant homozygous) and A375 (KRAS wild type).

[0053] Figure 5 illustrates mRNA knockdown of mutant KRAS (NCIH441 cells) with Gl2V mutation by ASO77, ASO80, or ASO81. Figure 6 illustrates knockdown (mediated by ASO80) of protein expression of both Gl2V mutant KRAS and downstream proteins of the KRAS-RAF-MEK-ERK signaling pathway (both pERK and pAKT, which are MAPK markers; and pS6, which is an ERK downstream marker). Figure 7 illustrates knockdown (mediated by ASO81) of protein expression of both Gl2V mutant KRAS and downstream proteins of the KRAS-RAF-MEK-ERK signaling pathway (both pERK and pAKT, which are MAPK markers; and pS6, which is an ERK downstream marker). Cells were seeded in a 12-well plate at 10,000 cells / well, and the cells were transfected with ASO / Lipofectamine (3 μl Lipofectamine). Cells were harvested on the third day after transfection, and protein expression was analyzed. The ASO used in the study was ASO80 (Gl2VASO, 14-mer), and the cell lines used were LCLC97TM1 (Gl2V, KRAS mutant homozygous) and A375 (KRAS wild type).

[0054] Figure 8 illustrates 3D cell growth inhibition resulting from inhibition of mutant KRAS expression by contacting cells carrying the KRAS mutation (LCLC97TM1 cells, NCI-H441 cells, or CFPAC-1 cells) with the oligonucleotides described herein (e.g., ASO77 - 81). 3D growth was measured on the seventh day after ASO treatment.

[0055] Example 6: Mutant KRAS (G12A mutation) knockdown Figure 9 illustrates the 3D cell growth inhibition resulting from the inhibition of mutant KRAS expression by contacting cells carrying a KRAS mutation (NCI-H2009 cells or SW1116 cells) with the oligonucleotides described herein (see, for example, Table 3). 3D growth was measured on day 7 or day 13 after ASO treatment.

[0056] Example 7: Mutant KRAS (G12D mutation) knockdown Figure 10 illustrates the mRNA knockdown of mutant KRAS (Panc04.03 cells) having a G12D mutation by ASO37.

[0057] Example 8: Binding specificity of P19 aptamer to PDAC cells Cell culture and aptamer folding conditions ATTC cells were grown in RPMI-1640 medium supplemented with 10% fetal bovine serum, 100 U / ml penicillin, and 100 U / ml streptomycin (Pen-Strep) and incubated at 37 °C in a humidified incubator containing 5% CO2.

[0058] Under aptamer folding conditions, the P19-labeled aptamer was resuspended in RNAse-free water to the desired concentration. The resuspended aptamer was heated at 80 °C for 5 minutes on a heat block. The P19-labeled aptamer tube was removed from the heat block and stored at room temperature until it reached 25 °C. The aptamer was stored on ice until use.

[0059] Evaluation of P19 aptamer activity conjugated with a fluorescent dye / binding assay The P19 aptamer was conjugated to Cy7 or Cy5, and in vitro binding was evaluated in multiple cell lines. For the binding assay, cells were plated in 12-well plates at a culture density of 70% the day before. On the day of treatment, the cells were washed twice with binding buffer (DPBS + 5 mM MgCl) and incubated for 30 minutes with 500 nM of the folded aptamer. After 30 minutes of incubation, the medium was removed and the cells were fixed with 4% formalin at 37 °C for 10 minutes to prepare for staining. The cells were washed twice with DPBS and stained with 1 μg / ml of Hoescht 33342 according to the manufacturer's instructions (stored on ice in the dark at room temperature for 15 minutes until visualization). The cells were imaged via a Keyence BZX microscope using DAPI, Cy7, and Cy5 filters to detect nuclear staining and aptamer binding. The imaging results regarding the binding specificity of the P19 aptamer are summarized in Table 11, and the microscopic images are shown in FIGS. 11A-11C. The results indicate that the P19 aptamer shows specificity for PDAC cells (MIA PaCa-2-GFP[++], PANC-1[+], CFPAC-1[+]) compared to non-PDAC cells (hepatocytes [-], non-small cell lung cancer cells [-]). TIFF2025521912000040.tif64170

[0060] Example 9: Regulation of KRAS Expression Cell Culture Conditions and In Vitro Transfection ATCC cells were grown in RPMI-1640 medium supplemented with 10% fetal bovine serum, 100 U / ml penicillin and 100 U / ml streptomycin (Pen-strep, or PS), and incubated at 37 °C in a humidified incubator containing 5% CO2. For antisense treatment, cells were plated onto 96-well plates at a 70% confluence density the day before. On the day of transfection, cells were washed once with OptiMEM medium and incubated in 90 μL of OptiMEM. In OptiMEM, an antisense and Lipofectamine RNAiMax transfection reagent were mixed at the desired concentration to prepare a transfection mixture, and 10 μL of this transfection mixture was added to each well and incubated for 2 hours. After 2 hours, 10 μL of serum was added to the wells and the volume was brought to 200 μL with the culture medium for each cell line. Alternatively, the medium was changed 2 hours after transfection or the next day. ASO treatment can also be performed without using a transfection reagent. In this case, the ASO was diluted in OptiMEM and added to the cell culture medium at a volume of less than 5% of the total volume.

[0061] Detection of mRNA knockdown Cells were lysed and harvested 48 hours after transfection. Lysis and subsequent mRNA detection were performed according to the Quantigen assay specified by the manufacturer (ThermoFisher). The ability of the ASO to knockdown the desired mRNA was evaluated as follows. MIA PaCa-2 (CRL-1420, ATCC) cells were plated overnight at 15,000 cells per well in RPMI1640 containing 10% FBS in clear flat-bottom 96-well plates. Cells were transfected with 30 nM, 10 nM, 3 nM, 1 nM ASO combined with RNAiMAX according to the manufacturer's instructions (Thermo Fisher). At 3 hours after transfection, the transfection mixture was removed, supplemented with RPMI1640 + 10% FBS, and incubated for 48 hours. Quantification of mRNA was performed using Thermo Fisher's QuantiGene according to its instructions. The results of KRAS mRNA knockdown by ASO are shown in Table 12.

[0062] Inhibition of cell proliferation The ability of the ASO to inhibit cell proliferation was evaluated as follows. MIA PaCa-2 cells were plated overnight at 600 cells per well in RPMI1640 containing 10% FBS in clear 384-well plates (S-Bio, #MS-9384UZ). Cells were treated with different concentrations of ASO. After 7 days, cell viability was determined by measuring the total ATP content using the Cell Titer Glo reagent (Promega, G7570) according to the manufacturer's instructions. The results of cell proliferation inhibition are shown in Table 12.

[0063] P19 aptamer activity with short incubation time The ability of the ASO to inhibit the proliferation of PDAC cells was investigated using a short incubation time. It has previously been shown that the P19 aptamer can bind to the surface of PDAC cells within 10 minutes of incubation. Three different linkers (HEG spacer, C3 propyl spacer, and oligo A 12The P19 aptamer-conjugates (e.g., ASO840) described herein using ) were tested on MIA PaCa-2 (PDAC) using gymnosis for a 6-day incubation or shorter treatment (e.g., 30 minutes or 1 hour), the ASO solution was removed and the medium was replenished. ASO840 is based on SEQ ID NO: 526 as a fully phosphorothioate-linked 3-8-3 LNA gapmer. After 6 days, cell viability was determined by measuring the total ATP content using the Cell Titer Glo reagent (Promega, G7570) according to the manufacturer's instructions. TIFF2025521912000041.tif106170

[0064] Evaluation of P19 aptamer activity conjugated with ASO840 and different linkers Three different linkers (HEG spacer, C6 propyl spacer, and oligo A 12 ) were used to conjugate the P19 aptamer with ASO840. Each of the conjugates was transfected into MIA PaCa-2 (ATCC) (KRAS G12C mutant) cells at increasing nanomolar concentrations. The mRNA knockdown data were recorded as the percentage of mRNA knockdown. Figure 12 shows that the P19 aptamer-conjugate ASO840 maintains specific target activity at all P19 conjugate concentrations tested using three different linkers (HEG spacer, C3 propyl spacer, and oligo A 12 ). Knockdown by ASO840 is shown as a control. Figure 13 further compares the knockdown of KRAS mRNA in MIA PaCa-2 cells mediated by antisense oligonucleotides (ASO 840) with and without linkage to the P19 aptamer. Figures 14A-14B show MIA PaCa-2 cells carrying the KRAS mutation (G12C mutation) with three different linkers (HEG spacer, C3 propyl spacer, and oligo A 12Exemplification of 3D cell growth inhibition due to inhibition of mutant KRAS expression by contacting with P19 aptamer-conjugate (ASO840) using [[ID=]]. In Figure 14A, MIA PaCa-2 cells were contacted with the P19 aptamer-conjugate for 6 days. In Figure 14B, MIA PaCa-2 cells were contacted with the P19 aptamer-conjugate for 1 hour, then washed out, and the medium was replenished for 6 days. The washout experiment demonstrated that the P19 aptamer-conjugate (ASO840) with the C6 propyl spacer showed an increase in 3D cell growth inhibition compared to the P19 aptamer alone, ASO840 alone, and other P19 aptamer-ASO840 conjugates.

[0065] Example 10: Regulation of SOS Expression Cell Culture Conditions and In Vitro Transfection ATCC cells were grown in RPMI-1640. The medium was supplemented with 10% fetal bovine serum, 100 U / ml penicillin, and 100 U / ml streptomycin (Pen-strep, or PS), and the cells were incubated at 37 °C in a humidified incubator containing 5% CO2. For antisense treatment, cells were plated at a 70% culture density in 96-well plates the day before. On the day of transfection, the cells were washed once with OptiMEM medium and incubated in 90 μL of OptiMEM. In OptiMEM, an antisense and Lipofectamine RNAiMax transfection reagent were mixed at the desired concentration to prepare a transfection mixture, and 10 μL of this transfection mixture was added to each well and incubated for 2 hours. After 2 hours, 10 μL of serum was added to the wells, and the volume was made up to 200 μL with the culture medium for each cell line. Alternatively, the medium was changed 2 hours after transfection or the next day. The ASO treatment may also be performed without using a transfection reagent. In this case, the ASO was diluted in OptiMEM and then added to the cell culture medium at a volume of less than 5% of the total volume.

[0066] Detection of mRNA knockdown Cells were lysed and harvested 48 hours after transfection. Lysis and subsequent mRNA detection were performed according to the Quantigen assay specified by the manufacturer (ThermoFisher).

[0067] The ability of ASO to knockdown the desired mRNA was evaluated as follows. MIA PaCa-2 (CRL-1420, ATCC) cells were plated overnight at 15,000 cells per well in RPMI 1640 containing 10% FBS in clear flat-bottom 96-well plates. 5 nM and 20 nM ASO combined with RNAiMAX were transfected into the cells according to the manufacturer's instructions (Thermo Fisher). At 3 hours after transfection, the transfection mixture was removed, supplemented with RPMI 1640 + 10% FBS, and incubated for 48 hours. Quantification of mRNA was performed using QuantiGene from Thermo Fisher according to the instructions. The results of SOS1 and SOS2 mRNA knockdown by ASO are shown in Table 13.

[0068] Inhibition of cell proliferation The ability of ASO to inhibit cell proliferation was evaluated as follows. MIA PaCa-2 cells were plated overnight at 600 cells per well in RPMI 1640 containing 10% FBS in clear 384-well plates (S-Bio, #MS-9384UZ). The cells were treated with different concentrations of ASO. After 7 days, cell viability was determined by measuring the total ATP content using the Cell Titer Glo reagent (Promega, G7570) according to the manufacturer's instructions. The results of cell proliferation inhibition are shown in Table 13. TIFF2025521912000042.tif217170TIFF2025521912000043.tif215170TIFF2025521912000044.tif218170TIFF2025521912000045.tif210170TIFF2025521912000046.tif209170TIFF2025521912000047.tif209170TIFF2025521912000048.tif209170TIFF2025521912000049.tif215170TIFF2025521912000050.tif210170TIFF2025521912000051.tif210170TIFF2025521912000052.tif214170TIFF2025521912000053.tif209170TIFF2025521912000054.tif216170TIFF2025521912000055.tif215170TIFF2025521912000056.tif216170TIFF2025521912000057.tif170170

[0069] Three different linkers (HEG spacer, C6 propyl spacer, and oligo A 12) was used to conjugate the P19 aptamer with ASO674. ASO674 is a fully phosphorothioate-linked 3-8-3 gapmer. Each of the conjugates was transfected into MIA PaCa-2 (ATCC) cells at increasing nanomolar concentrations. SOS1 and SOS2 mRNA knockdown data were recorded as the percentage of mRNA knockdown. Figure 15 shows that the P19 aptamer-conjugated ASO674 maintains the SOS1-specific on-target activity of all P19-conjugates using three different linkers (HEG spacer, C3 propyl spacer, and oligo A12). Similarly, Figure 16 shows that the P19 aptamer-conjugated ASO232 (a fully phosphorothioate-linked 3-8-3 gapmer) maintains the SOS1-specific on-target activity of the P19-conjugate using a 2× C3 propyl spacer as compared to the antisense oligonucleotide alone.

[0070] Figure 17 illustrates the 3D cell growth inhibition resulting from the inhibition of SOS1 mRNA expression by contacting MIA PaCa-2 cells with a P19 aptamer-conjugate (e.g., ASO232) using a C6 linker. In Figure 17, MIA PaCa-2 cells were contacted with the P19 aptamer-conjugate for 7 days or 1 hour and then washed out and the medium replenished. In the washout experiment, the P19 aptamer-conjugate (ASO232) using a C6 propyl spacer showed an increase in 3D cell growth inhibition as compared to ASO232 alone.

[0071] Figure 18 illustrates the 3D cell growth inhibition due to the inhibition of SOS1 mRNA expression in MIA PaCa-2 (PDAC) and NCI-H1975 (NSCLC, ATCC CRL-5908) cells by the P19 aptamer ASO232 conjugate (C6 linker) in the state of washout at 7 days and 30 minutes later. In Figure 18, the results show the 3D cell growth inhibition by ASO232 against both MIA PaCa-2 (PDAC) and NCI-H1975 (NSCLC, ATCC CRL-5908) cells. The P19 aptamer-conjugate (ASO232) using the C6 propyl spacer showed an increase in 3D cell growth inhibition only in MIA PaCa-2 (PDAC) cells, but not in NCI-H1975 (NSCLC, ATCC CRL-5908) cells. These results support the P19 aptamer specificity for MIA PaCa-2 (PDAC) cells.

Claims

**Claim 1** A composition comprising an aptamer (a nucleotide sequence that targets accumulation of the composition to pancreatic cancer cells) comprising a nucleotide sequence that targets accumulation of the composition to pancreatic cancer cells, and an antisense oligonucleotide that inhibits the expression of mRNA related to the KRAS-RAF-MEK-ERK signaling pathway or the RTK-RAS-ERK signaling pathway in pancreatic cancer cells. **Claim 2** The composition according to claim 1, wherein the aptamer comprises the nucleotide sequence GAAUGCCC (SEQ ID NO: 1003). **Claim 3** The composition according to claim 2, wherein the aptamer comprises the nucleotide sequence CUCAAUGGCGAAUGCCCCGCCUAAUAGG (SEQ ID NO: 1004) or a derivative thereof. **Claim 4** The composition according to claim 3, wherein the aptamer comprises the nucleotide sequence: GGGGAGACAAGAAUAAAACGCUCAAUGGCGAAUGCCCCGCCUAAUAGGGCGUUAAUGACUUGUUGAGUUCGACAGGAGGGUCACAAACAGGCC (SEQ ID NO: 1005) or a derivative thereof. **Claim 5** The composition according to any one of claims 1 to 4, wherein the aptamer nucleotide sequence is chemically modified. **Claim 6** The composition according to claim 5, wherein the aptamer nucleotide sequence comprises 2′F-Py. **Claim 7** The composition according to any one of claims 1 to 6, wherein the antisense oligonucleotide targets KRAS mRNA. **Claim 8** The composition according to claim 7, wherein the antisense oligonucleotide comprises at least 8, or at least 10, or at least 12 consecutive nucleotides of an oligonucleotide from any one of Tables 1 to 4. **Claim 9** The composition according to claim 8, wherein the antisense oligonucleotide has 13 to 24 linked nucleotides. **Claim 10** The composition according to claim 8, wherein the antisense oligonucleotide has 13 to 16 linked nucleotides. **Claim 11** The composition according to any one of claims 7 to 10, wherein the antisense oligonucleotide targets KRAS mRNA encoding mutant KRAS.

12. The composition according to claim 11, wherein the mutant KRAS is selected from a G12C mutation, a G12V mutation, a G12A mutation, and a G12D mutation.

13. The composition according to claim 12, wherein the antisense oligonucleotide consists of a nucleotide sequence selected from Table 3 or 4.

14. The composition according to any one of claims 1 to 6, wherein the antisense oligonucleotide targets SOS1 and / or SOS2 mRNA.

15. The composition according to claim 14, wherein the antisense oligonucleotide comprises at least 8, or at least 10, or at least 12 consecutive nucleotides of a sequence from Table 13.

16. The composition according to claim 15, wherein the antisense oligonucleotide has 13 to 24 linked nucleotides.

17. The composition according to claim 15, wherein the antisense oligonucleotide has 13 to 16 linked nucleotides.

18. The composition according to claim 15, wherein the antisense oligonucleotide consists of a nucleotide sequence selected from Table 13.

19. The composition according to any one of claims 1 to 18, wherein the antisense oligonucleotide has an extension of at least 6 DNA nucleotides sufficient to recruit RNaseH.

20. The composition according to claim 19, wherein the antisense oligonucleotide has an extension of at least 8 DNA nucleotides, and this extension of at least 8 DNA nucleotides is optionally an extension of 9 or 10 DNA nucleotides.

21. The composition according to claim 19 or 20, wherein one or more DNA nucleotides comprise a 2'-chemical modification independently selected from 2'-fluoro, 2'-methyl, and 2'-ethyl.

22. The composition according to any one of claims 19 to 21, wherein the antisense oligonucleotide is a gapmer having a 5' segment and a 3' segment, each of the 5' segment and the 3' segment being 2 to 6 nucleotides or 2 to 4 nucleotides, and the 5' segment and the 3' segment not containing DNA nucleotides.

23. The composition according to claim 22, wherein the antisense oligonucleotide is a 3-X-3 gapmer, 2-X-2 gapmer, 2-X-3 gapmer, or 3-X-2 gapmer.

24. The composition according to claim 22 or 23, wherein one or more nucleotides of the 5' segment and the 3' segment comprise a 2'-O substituent, and optionally, all of the nucleotides of the 5' segment and the 3' segment comprise a 2'-O substituent.

25. The composition according to claim 24, wherein the 2'-O substituent is independently selected from 2'-O-methyl, 2'-O-ethyl, 2'-O-methoxyethyl (MOE), and a bridged nucleotide having a bridge from 2' to 4'.

26. The composition according to claim 25, wherein the bridged nucleotide has a methylene bridge (LNA) or a constrained ethyl bridge (cEt).

27. The composition according to any one of claims 1 to 26, wherein the antisense oligonucleotide has a modified backbone.

28. The composition according to claim 27, wherein the antisense oligonucleotide and / or the aptamer comprises one or more phosphorothioate or phosphorodithioate nucleotides.

29. The composition according to claim 28, wherein the oligonucleotide and / or the aptamer is completely phosphorothioate or phosphorodithioate linked.

30. The composition according to any one of claims 1 to 29, wherein the cytidine nucleobase in the antisense oligonucleotide and / or the aptamer is 5-methylcytidine.

31. The composition according to any one of claims 1 to 30, wherein the antisense oligonucleotide hybridizes to the target sequence of the antisense oligonucleotide at a Tm of at least about 35°C, or at least about 40°C, or at least about 45°C, or at least about 50°C.

32. The composition according to claim 31, wherein the Tm of the oligonucleotide hybridized to the target sequence of the antisense oligonucleotide is from about 35°C to about 60°C, or from about 40°C to about 60°C, or from about 50°C to about 60°C.

33. The composition according to any one of claims 1 to 32, wherein the aptamer and the antisense oligonucleotide are directly or indirectly linked via a linker.

34. The composition according to claim 33, wherein the linker is an oligoethylene glycol spacer, optionally a hexaethylene glycol spacer.

35. The composition according to claim 33, wherein the linker is a C3 spacer.

36. The composition according to claim 33, wherein the linker is a nucleotide linker.

37. The composition according to claim 36, wherein the nucleotide linker has a length of 1 to 20 nucleotides, or a length of 2 to 15 nucleotides.

38. The composition according to claim 37, wherein the linker is an extension of a single nucleobase.

39. The composition according to claim 38, wherein the linker is oligo A.

40. The composition according to claim 39, wherein the oligo A linker is 12 nucleobases in length.

41. The composition according to any one of claims 37 to 40, wherein the linker contains DNA nucleotides.

42. The composition according to any one of claims 37 to 40, wherein the linker contains RNA nucleotides.

43. The composition according to claim 33, wherein the linker is a non-nucleotide linker and is optionally cleavable.

44. The composition according to any one of claims 1 to 32, wherein the antisense oligonucleotide is encapsulated within a particle and the aptamer is presented on the surface of the particle.

45. The composition according to claim 44, wherein the particle is a liposome, a polymeric nanoparticle, or a lipid nanoparticle.

46. A method for treating a subject having pancreatic cancer, the method comprising administering to the subject an effective amount of the composition according to any one of claims 1 to 45.

47. The method according to claim 46, wherein the pancreatic cancer is non-metastatic.

48. The method according to claim 46, wherein the pancreatic cancer is metastatic.

49. The method according to any one of claims 46 to 48, wherein the subject is identified as having pancreatic cancer associated with a KRAS mutation.

50. The method according to claim 49, wherein the KRAS mutation is selected from a G12C mutation, a G12V mutation, a G12A mutation, and a G12D mutation.