genetically engineered cells

Abstract

Disclosed herein are compositions and methods relating to genetically engineered mammalian cells that include modulating the expression of selected genes. The genetically engineered mammalian cells described herein advantageously have improved viability. In some embodiments, the mammalian cells are genetically engineered to reduce or eliminate expression of a renalase gene compared to the expression level of the same cell type that is not genetically engineered, and the cells are further genetically engineered to reduce or eliminate expression of an ABO gene.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of pending U.S. Provisional Patent Application Nos. PCT / US2022 / 079017, filed November 1, 2022; U.S. Provisional Patent Application Nos. 63 / 491,032, filed March 17, 2023; 63 / 493,880, filed April 3, 2023; and 63 / 507,793, filed June 13, 2023, the contents of which are incorporated herein by reference in their entireties.

[0002] Reference to electronic sequence listing The contents of the electronic sequence listing (41822WO_SequenceListing.xml; size: 326 KB; created on October 27, 2023) are incorporated herein by reference in their entirety. [Background technology]

[0003] background Transplantation of tissues such as pancreas or pancreatic islets has been used to treat diseases such as diabetes, for example, type I diabetes.However, when transplanted into host subject, transplanted cells and tissues often encounter a stressful and harsh environment.Therefore, there is a need to engineer cells and tissues (for example, stem cells, or cells differentiated from stem cells) that have improved survival and / or reduced immunogenicity in host subject. Summary of the Invention [Means for solving the problem]

[0004] Abstract The present disclosure relates to genetically engineered mammalian cells that contain modulated expression of selected genes. The genetically engineered mammalian cells described herein are advantageous in that they have improved survival and / or reduced immunogenicity.

[0005] In a first aspect, the present disclosure relates to genetically engineered mammalian cells that have been engineered to reduce or eliminate expression of the renalase gene, which cells have also been genetically engineered to reduce or eliminate expression of the ABO gene, to reduce or eliminate expression of the CXCL10 gene, to reduce or eliminate expression of beta-2 microglobulin (B2M), to reduce or eliminate expression of the tissue factor 3 (F3) gene, and / or to increase expression of CD47 or expression of a mutant CD47, when compared to the expression levels of the corresponding genes in the same cell type when the cell is not genetically engineered.

[0006] In some embodiments, the mammalian cells are genetically engineered to reduce or eliminate expression of a renalase gene compared to the expression level of the same cell type that is not genetically engineered, and the cells are further genetically engineered to reduce or eliminate expression of an ABO gene.

[0007] In some embodiments, the mammalian cells have been genetically engineered to reduce or eliminate expression of the renalase gene compared to the expression level of the same cell type that has not been genetically engineered, and the cells have been further genetically engineered to reduce or eliminate expression of the ABO gene, and / or the cells have been genetically engineered to reduce or eliminate expression of the CXCL10 gene.

[0008] In some embodiments, the mammalian cells have been genetically engineered to reduce or eliminate expression of the renalase gene compared to the expression level of the same cell type that is not genetically engineered, and the cells have been further genetically engineered to reduce or eliminate expression of the ABO gene; the cells have been genetically engineered to reduce or eliminate expression of the CXCL10 gene; and / or the cells have been genetically engineered to reduce or eliminate expression of the B2M gene.

[0009] In some embodiments, the mammalian cells have been genetically engineered to reduce or eliminate expression of the renalase gene compared to the expression level of the same cell type that is not genetically engineered, and the cells have been further genetically engineered to reduce or eliminate expression of the ABO gene; the cells have been genetically engineered to reduce or eliminate expression of the CXCL10 gene; the cells have been genetically engineered to reduce or eliminate expression of the B2M gene; and / or the cells have been genetically engineered to reduce or eliminate expression of the F3 gene.

[0010] In some embodiments, mammalian cells have been genetically engineered to reduce or eliminate expression of the renalase gene compared to the expression level of the same cell type that is not genetically engineered, and the cells have been further genetically engineered to reduce or eliminate expression of the ABO gene; the cells have been genetically engineered to reduce or eliminate expression of the CXCL10 gene; the cells have been genetically engineered to reduce or eliminate expression of the B2M gene; the cells have been genetically engineered to reduce or eliminate expression of the F3 gene; and / or the cells have been genetically engineered to increase expression of CD47. In some embodiments, the engineered cells include the insertion of an exogenous CD47 gene.

[0011] In some embodiments, the mammalian cells have been genetically engineered to reduce or eliminate expression of the renalase gene, and the cells are further genetically engineered to reduce or eliminate expression of the ABO gene; the cells have been genetically engineered to reduce or eliminate expression of the CXCL10 gene; the cells have been genetically engineered to reduce or eliminate expression of the B2M gene; the cells have been genetically engineered to reduce or eliminate expression of the F3 gene; and / or the cells have been genetically engineered to express a mutant CD47. In some embodiments, the CD47 protein comprises at least three amino acids added to the N-terminus of the mature CD47 protein, the three added amino acids having the formula X3-X2-X1, where X3 is W, X2 is selected from Q, A and G, and X1 is selected from R, P, L, T, F, I and M. In some embodiments, the mutant CD47 protein comprises an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 145 or 146, except that Q at position 1 is replaced with at least three amino acids. In some embodiments, Q at position 1 is replaced with any one of WQR, WAP, WQL, WQP, WQPP, WQT, WQF, WQI, WGP, and WQM. In some embodiments, the cell comprises a gene encoding a mutant CD47 protein, wherein the gene encodes a CD47 protein in which at least three amino acids are added between the CD47 leader sequence (e.g., the amino acid sequence of SEQ ID NO: 244) and the beginning of the mature CD47 amino acid sequence (e.g., an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 145 or 146).In some embodiments, the cell comprises a gene encoding a mutant CD47 protein, wherein the gene encodes a CD47 protein in which a "Q" at position 19 of an amino acid sequence at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 14 or 243 is replaced with at least three amino acids. In some embodiments, the at least three amino acids are selected from any of WQR, WAP, WQL, WQP, WQPP, WQT, WQF, WQI, WGP, or WQM. In some embodiments, the at least three amino acids are WQPP. In some embodiments, the Q at position 1 is replaced with WQPP. In some embodiments, at least three amino acids have the formula X3-X2-X1, where X3 is W, X2 is selected from Q, A and G, and X1 is selected from R, P, L, T, F, I and M.

[0012] In some embodiments, the CD47 protein comprises an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 145 or 146, and the CD47 protein comprises at least three amino acids added to the N-terminus of the mature CD47 protein, wherein the three added amino acids have the formula X3-X2-X1, where X3 is W, X2 is selected from Q, A, and G, and X1 is selected from R, P, L, T, F, I, and M. In some embodiments, the three amino acids are selected from WQR, WAP, WQL, WQP, WQT, WQF, WQI, WGP, and WQM.

[0013] Some embodiments of the present disclosure provide mammalian cells that have been genetically engineered to reduce or eliminate expression of the CXCL10 gene, and that have also been genetically engineered to reduce or eliminate expression of the ABO gene and / or tissue factor (F3) gene.

[0014] In some embodiments, the mammalian cells are genetically engineered to reduce or eliminate expression of the CXCL10 gene compared to the expression level of the same cell type that is not genetically engineered, and the cells are further genetically engineered to reduce or eliminate expression of the ABO gene.

[0015] In some embodiments, the mammalian cells have been genetically engineered to reduce or eliminate expression of the CXCL10 gene; the cells have been further genetically engineered to reduce or eliminate expression of the ABO gene compared to the expression level of the same cell type that has not been genetically engineered; and / or the cells have been genetically engineered to reduce or eliminate expression of the tissue factor (TF3) gene.

[0016] In some embodiments, the mammalian cells have been genetically engineered to reduce or eliminate expression of the CXCL10 gene compared to the expression level of the same cell type that has not been genetically engineered; the cells have been further genetically engineered to reduce or eliminate expression of the ABO gene; the cells have been genetically engineered to reduce or eliminate expression of the tissue factor (TF3) gene; and / or the cells have been genetically engineered to reduce or eliminate expression of the beta-2 microglobulin (B2M) gene.

[0017] In some embodiments, the mammalian cells have been genetically engineered to reduce or eliminate expression of the CXCL10 gene compared to the expression level of the same cell type that is not genetically engineered; the cells have been further genetically engineered to reduce or eliminate expression of the ABO gene; the cells have been genetically engineered to reduce or eliminate expression of the tissue factor (TF3) gene; the cells have been genetically engineered to reduce or eliminate expression of the beta-2 microglobulin (B2M) gene; and / or the cells have been genetically engineered to reduce or eliminate expression of the renalase gene.

[0018] In some embodiments, the mammalian cells have been genetically engineered to reduce or eliminate expression of the CXCL10 gene compared to the expression level of the same cell type that is not genetically engineered; the cells have been further genetically engineered to reduce or eliminate expression of the ABO gene; the cells have been genetically engineered to reduce or eliminate expression of the tissue factor (TF3) gene; the cells have been genetically engineered to reduce or eliminate expression of the beta-2 microglobulin (B2M) gene; the cells have been genetically engineered to reduce or eliminate expression of the renalase gene; and / or the cells have been genetically engineered to increase expression of CD47. In some embodiments, the engineered cells comprise the insertion of an exogenous CD47 gene.

[0019] In some embodiments, the mammalian cells have been genetically engineered to reduce or eliminate expression of the CXCL10 gene; the cells have been further genetically engineered to reduce or eliminate expression of the ABO gene; the cells have been genetically engineered to reduce or eliminate expression of the tissue factor (TF3) gene; the cells have been genetically engineered to reduce or eliminate expression of the beta-2 microglobulin (B2M gene); the cells have been genetically engineered to reduce or eliminate expression of the renalase gene; and / or the cells have been genetically engineered to express a mutant CD47 protein. In some embodiments, the CD47 protein comprises at least three amino acids added to the N-terminus of the mature CD47 protein, wherein the three added amino acids have the formula X3-X2-X1, where X3 is W, X2 is selected from Q, A, and G, and X1 is selected from R, P, L, T, F, I, and M. In some embodiments, the CD47 protein comprises an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 145 or 146, and the CD47 protein comprises at least three amino acids added to the N-terminus of the mature CD47 protein, wherein the three added amino acids have the formula X3-X2-X1, where X3 is W, X2 is selected from Q, A, and G, and X1 is selected from R, P, L, T, F, I, and M. In some embodiments, the three amino acids are selected from WQR, WAP, WQL, WQP, WQT, WQF, WQI, WGP, and WQM.

[0020] In some embodiments, the cells express a membrane-bound CD47 protein, wherein the membrane-bound CD47 protein comprises an amino acid sequence at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 145 or 146, except that Q at position 1 is replaced with at least three amino acids. In some embodiments, Q at position 1 is replaced with any one of WQR, WAP, WQL, WQP, WQPP, WQT, WQF, WQI, WGP, and WQM. In some embodiments, the cells comprise a gene encoding a membrane-bound CD47 protein, wherein the gene encodes a CD47 protein in which at least three amino acids are added between the CD47 leader sequence (e.g., the amino acid sequence of SEQ ID NO: 244) and the beginning of a mature CD47 amino acid sequence (e.g., an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 145 or 146). In some embodiments, the cells comprise a gene encoding a membrane-bound CD47 protein, wherein the gene encodes a CD47 protein in which a "Q" at the position corresponding to position 19 of an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 14 or 243 is replaced with at least three amino acids. In some embodiments, at least three amino acids are selected from any of WQR, WAP, WQL, WQP, WQPP, WQT, WQF, WQI, WGP, or WQM. In some embodiments, at least three amino acids are WQPP. In some embodiments, Q at position 1 is replaced with WQPP. In some embodiments, at least three amino acids have the formula X3-X2-X1, where X3 is W, X2 is selected from Q, A, and G, and X1 is selected from R, P, L, T, F, I, and M.

[0021] In some embodiments of the present disclosure, the mammalian cells are genetically engineered to reduce or eliminate expression of B2M, CXCL10, renalase, ABO, and F3 genes, and to increase expression of CD47, compared to the expression levels of the same mammalian cell type that is not genetically engineered.

[0022] In some embodiments of the present disclosure, mammalian cells are genetically engineered to reduce or eliminate expression of B2M, CXCL10, renalase, ABO, and F3 genes, and to express a mutant CD47, compared to the expression levels of the same mammalian cell type that is not genetically engineered. In some embodiments, the CD47 protein comprises at least three amino acids added to the N-terminus of the mature CD47 protein, the three added amino acids having the formula X3-X2-X1, where X3 is W, X2 is selected from Q, A, and G, and X1 is selected from R, P, L, T, F, I, and M. In some embodiments, the CD47 protein comprises an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 145 or 146, and the CD47 protein comprises at least three amino acids added to the N-terminus of the mature CD47 protein, wherein the three added amino acids have the formula X3-X2-X1, where X3 is W, X2 is selected from Q, A, and G, and X1 is selected from R, P, L, T, F, I, and M. In some embodiments, the three amino acids are selected from WQR, WAP, WQL, WQP, WQT, WQF, WQI, WGP, and WQM.

[0023] Certain aspects of the present disclosure include mammalian cells of ABO blood type O that have been genetically engineered to reduce or eliminate expression of the renalase gene. In some embodiments, the cells have been genetically engineered to reduce or eliminate expression of the CXCL10 gene and / or to express a mutant CD47 protein.

[0024] In some embodiments, the mammalian cells are of ABO blood type O, and the cells have been genetically engineered to reduce or eliminate expression of the renalase gene compared to the expression level of the same cell type that is not genetically engineered; the cells have been genetically engineered to reduce or eliminate expression of the CXCL10 gene; the cells have been genetically engineered to reduce or eliminate expression of the B2M gene; the cells have been genetically engineered to reduce or eliminate expression of the F3 gene; and the cells have been genetically engineered to increase expression of the CD47 gene.

[0025] Certain aspects of the present disclosure include mammalian cells that express a membrane-bound CD47 protein, wherein the CD47 protein comprises at least three amino acids added to the N-terminus of the mature CD47 protein, the three added amino acids having the formula X3-X2-X1, where X3 is W, X2 is selected from Q, A and G, and X1 is selected from R, P, L, T, F, I and M.

[0026] In some embodiments, the cells express a membrane-bound CD47 protein, wherein the CD47 protein comprises an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 145 or 146, and wherein the CD47 protein comprises at least three amino acids added to the N-terminus of the mature CD47 protein, wherein the three added amino acids have the formula X3-X2-X1, where X3 is W, X2 is selected from Q, A, and G, and X1 is selected from R, P, L, T, F, I, and M. In some embodiments, the three amino acids are selected from WQR, WAP, WQL, WQP, WQT, WQF, WQI, WGP, and WQM.

[0027] In some embodiments, the mammalian cells express a membrane-bound CD47 protein, and the cells have also been genetically engineered to reduce or eliminate expression of the B2M gene.

[0028] In some embodiments, the mammalian cells express a membrane-bound CD47 protein, and the cells have also been genetically engineered to reduce or eliminate expression of the B2M gene and / or to reduce or eliminate expression of the B2M gene and / or the F3 gene.

[0029] In some embodiments, the mammalian cells express a membrane-bound CD47 protein, and the cells have also been genetically engineered to reduce or eliminate expression of the B2M gene; the cells have been genetically engineered to reduce or eliminate expression of the B2M gene F3 gene; and / or the cells have been genetically engineered to reduce or eliminate expression of the CXCL10 gene.

[0030] In some embodiments, the mammalian cells express a membrane-bound CD47 protein, and the cells have also been genetically engineered to reduce or eliminate expression of the B2M gene; the cells have been genetically engineered to reduce or eliminate expression of the B2M gene F3 gene; the cells have been genetically engineered to reduce or eliminate expression of the CXCL10 gene; and / or the cells have been genetically engineered to reduce or eliminate expression of the renalase gene.

[0031] In some embodiments, the mammalian cells express a membrane-bound CD47 protein, and the cells have also been genetically engineered to reduce or eliminate expression of the B2M gene; the cells have been genetically engineered to reduce or eliminate expression of the B2M gene F3 gene; the cells have been genetically engineered to reduce or eliminate expression of the CXCL10 gene; the cells have been genetically engineered to reduce or eliminate expression of the renalase gene; and / or the cells are ABO blood type O.

[0032] In some embodiments, the mammalian cells express a membrane-bound CD47 protein, and the cells have also been genetically engineered to reduce or eliminate expression of the B2M gene; the cells have been genetically engineered to reduce or eliminate expression of the B2M gene F3 gene; the cells have been genetically engineered to reduce or eliminate expression of the CXCL10 gene; the cells have been genetically engineered to reduce or eliminate expression of the renalase gene; the cells are ABO blood type O; and / or the cells have been genetically engineered to reduce or eliminate expression of ABO genes.

[0033] In some embodiments, the mammalian cells express a membrane-bound CD47 protein, and the cells have also been genetically engineered to reduce or eliminate expression of the B2M gene; the cells have been genetically engineered to reduce or eliminate expression of the B2M gene F3 gene; the cells have been genetically engineered to reduce or eliminate expression of the CXCL10 gene; the cells have been genetically engineered to reduce or eliminate expression of the renalase gene; the cells are ABO blood type O; the cells have been genetically engineered to reduce or eliminate expression of ABO genes; and / or the cells are naturally ABO blood type O.

[0034] In some embodiments, the mammalian cells express membrane-bound CD47 protein, and the cells are also genetically engineered to reduce or eliminate expression of the B2M gene; the cells are genetically engineered to reduce or eliminate expression of the B2M gene F3 gene; the cells are genetically engineered to reduce or eliminate expression of the CXCL10 gene; the cells are genetically engineered to reduce or eliminate expression of the renalase gene; the cells are ABO blood type O; the cells are genetically engineered to reduce or eliminate expression of ABO genes; and / or the cells are naturally ABO blood type O, and a transgene encoding a CD47 protein is inserted into the genome of the cells such that CD47 transgene expression is tied to the expression of an endogenous target gene in the cells. In some embodiments, the endogenous target gene is a housekeeping gene, such as ACTB, NANOG, or GAPDH. In some embodiments, the transgene is inserted such that the 3'UTR of the housekeeping gene (e.g., the 3'UTR of the GAPDH gene) is intact.

[0035] In some embodiments, the endogenous CD47 gene of the cell has been mutated such that the cell expresses a CD47 protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 145 or 146, wherein the CD47 protein comprises at least three amino acids added to the N-terminus of the mature CD47 protein, wherein the three added amino acids have the formula X3-X2-X1, where X3 is W, X2 is selected from Q, A and G, and Xi is selected from R, P, L, T, F, I and M.

[0036] In some embodiments, the CD47 protein comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 245, 162, or 163.

[0037] Some aspects of the present disclosure relate to genetically modified mammalian cells, wherein the mammalian cells are stem cells. In some embodiments, the modified mammalian cells are pluripotent stem cells (PSCs), embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), and / or embryonic germ stem cells (EGSCs). In some embodiments, the modified mammalian cells are differentiated from pluripotent stem cells. In some embodiments, the genetically engineered mammalian cells are somatic cells. In some embodiments, the modified mammalian cells are definitive endoderm cells. In some embodiments, the mammalian cells are primitive gut cells. In some embodiments, the cells are PDX1-positive pancreatic progenitor cells. In some embodiments, the cells are NKX6.1-positive pancreatic progenitor cells. In some embodiments, the cells are Ngn3-positive endocrine precursor cells. In some embodiments, the cells are insulin-positive endocrine cells. In some embodiments, the mammalian cells are pancreatic SC-β cells. In some embodiments, the cells are NKX6.1-positive. In some embodiments, the cells are ISL1 negative. In some embodiments, the mammalian cells are NKX6.1 positive and ISL1 positive. In some embodiments, the mammalian cells are NKX6.1 negative and ISL1 negative. In some embodiments, the mammalian cells are ISL1 positive. In some embodiments, the mammalian cells are NKX6.1 negative. In some embodiments, the cells express insulin.

[0038] Certain aspects of the present disclosure relate to the genetically modified mammalian cells described herein, wherein gene manipulation is performed using CRISPR / Cas, piggyBac transposon, TALEN, zinc finger technology, homing endonuclease, or meganuclease.In some embodiments, at least one genetic modification is performed in the intron region of a gene.In some embodiments, at least one genetic modification is performed in the exon of a gene.In some embodiments, at least one genetic modification is performed in the promoter of a gene.

[0039] Certain embodiments of the present disclosure relate to mammalian cells that have been genetically engineered to reduce or eliminate expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:3 and / or SEQ ID NO:5, or a protein that comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:4 and / or SEQ ID NO:6. and wherein the gene is engineered to encode a protein encoding a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:7, so as to reduce or eliminate expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:1, or a protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:2, compared to the expression level of the same cell type that is not genetically engineered. 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 9, so as to reduce or eliminate expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 8, or a protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 8. or 100% identical to SEQ ID NO:10, or a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:11, or a protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:12, so as to reduce or eliminate expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:13,The present invention also relates to mammalian cells that have been genetically engineered to reduce or eliminate expression of a protein comprising an amino acid sequence that is 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical, and / or to increase expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:13 and / or SEQ ID NO:15, or a protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:145, and / or SEQ ID NO:146.

[0040] In some embodiments, the mammalian cell has been genetically engineered to reduce or eliminate expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:7 or a protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:8, and the cell is genetically engineered to reduce or eliminate expression of the same cell that has not been genetically engineered. The vector may also be genetically engineered to reduce or eliminate expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the SEQ ID NO:1 gene and / or SEQ ID NO:11, or a protein that comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:2 or SEQ ID NO:12, compared to the expression level of the original vector.

[0041] In some embodiments, the mammalian cells are genetically engineered to reduce or eliminate expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:7 or a protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:8, and the cells are genetically engineered to reduce or eliminate expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:1 and / or SEQ ID NO:11, compared to the expression level of the same cell type that is not genetically engineered. The nucleic acid sequence may also be genetically engineered to reduce or eliminate expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 2 and / or SEQ ID NO: 12, and may further be genetically engineered to reduce or eliminate expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 9 or a protein that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 10.

[0042] In some embodiments, the mammalian cell is genetically engineered to express at least one gene encoding SEQ ID NO: 1, such that the expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 7 or a protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 8 is reduced or eliminated compared to the expression level of the same cell type that is not genetically engineered. or 100% identical to SEQ ID NO: 11, so as to reduce or eliminate expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 2, or a protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 2. or 100% identical to SEQ ID NO:9 or a protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:10, so as to reduce or eliminate expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:12. , 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:3 and / or SEQ ID NO:5, and further, a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:4 and / or SEQ ID NO:6,Genetically engineered to reduce or eliminate expression of a protein containing an amino acid sequence that is 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the target gene.

[0043] In some embodiments, the mammalian cell is modified with a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 1 to reduce or eliminate expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 7 or a protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 8. and / or a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 11, so as to reduce or eliminate expression of a protein encoded by a nucleic acid that is 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 2 or a protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 2. a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:9 or a protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:10, so as to reduce or eliminate expression of the protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:12; a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:3 and / or SEQ ID NO:5, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:4 and / or SEQ ID NO:6, so as to reduce or eliminate expression of a protein comprising an amino acid sequence that is 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:4 and / or SEQ ID NO:6;or 100% identical to SEQ ID NO:13 and / or SEQ ID NO:15, and the cells have been genetically engineered to increase expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:145 and / or SEQ ID NO:146, compared to the expression level of the same cell type that has not been genetically engineered.

[0044] In some embodiments, the mammalian cell is engineered to express a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:3 and / or SEQ ID NO:5, such that the expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:9, SEQ ID NO:7, SEQ ID NO:1 and SEQ ID NO:11, or a protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:10, SEQ ID NO:8, SEQ ID NO:2 and SEQ ID NO:12, compared to the expression level of the same cell type that is not genetically engineered, is reduced or eliminated. or 100% identical to SEQ ID NO:4 and / or SEQ ID NO:6, and to increase expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:13 and / or SEQ ID NO:15, or a protein that contains an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:145 and / or SEQ ID NO:146.

[0045] In some embodiments of the present disclosure, mammalian cells, wherein the cells are ABO blood type O, have been genetically engineered to reduce or eliminate expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:3, SEQ ID NO:5, and / or SEQ ID NO:7, or a protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:4, SEQ ID NO:6, and / or SEQ ID NO:8, relative to the expression level of the same cell type that is not genetically engineered.In some embodiments, the mammalian ABO blood group O cells are engineered to express a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:3 and / or SEQ ID NO:5, such that the expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:9, SEQ ID NO:7, and SEQ ID NO:11, or a protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:10, SEQ ID NO:8, and SEQ ID NO:12, compared to the expression level of the same cell type that is not engineered. The nucleic acid sequence of the present invention may be engineered to reduce or eliminate expression of a protein or a protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:4 and / or SEQ ID NO:6, and to increase expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:13 and / or SEQ ID NO:15 or a protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:145 and / or SEQ ID NO:146.

[0046] Some embodiments of the present disclosure describe mammalian cells that have been genetically engineered to reduce or eliminate expression of a protein encoded by the renalase gene, and that have also been genetically engineered to reduce or eliminate expression of a protein encoded by the ABO gene, to reduce or eliminate expression of a protein encoded by the CXCL10 gene, to reduce or eliminate expression of a protein encoded by the beta-2 microglobulin (B2M) gene, to reduce or eliminate expression of a protein encoded by the tissue factor (F3) gene, and / or to increase expression of a protein encoded by the CD47 gene, compared to the protein expression levels of the same cell type that has not been genetically engineered.

[0047] In some embodiments of the present disclosure, mammalian cells have been genetically engineered to increase expression of a protein encoded by the CD47 gene compared to the protein expression level of the same cell type that is not genetically engineered, and the CD47 protein comprises an amino acid sequence at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 145 or 146, and the CD47 protein comprises a substitution at one or more of the amino acids corresponding to amino acid positions Q1, L3, A53, and L54 of SEQ ID NO: 145 or 146. In some embodiments, the CD47 protein comprises a P or L at the amino acid position corresponding to position 1 of SEQ ID NO: 145 or 146. In some embodiments, the CD47 protein comprises an R, A, K, N, E, or V at the amino acid position corresponding to position 3 of SEQ ID NO: 145 or 146. In some embodiments, the CD47 protein comprises W, Y, D, Q, or V at the amino acid position corresponding to position 53 of SEQ ID NO: 145 or 146. In some embodiments, the CD47 protein comprises A, I, K, M, E, W, S, or V at the amino acid position corresponding to position 54 of SEQ ID NO: 145 or 146. In some embodiments, the CD47 protein comprises P at the amino acid position corresponding to position 1 of SEQ ID NO: 145 or 146. In some embodiments, the CD47 protein comprises an amino acid other than Q at the amino acid position corresponding to position 1 of SEQ ID NO: 145 or 146. In some embodiments, the CD47 protein comprises an amino acid other than L at the amino acid position corresponding to position 3 of SEQ ID NO: 145 or 146. In some embodiments, the CD47 protein comprises an amino acid other than A at the amino acid position corresponding to position 53 of SEQ ID NO: 145 or 146. In some embodiments, the CD47 protein comprises an amino acid other than L at the amino acid position corresponding to position 54 of SEQ ID NO: 145 or 146. In some embodiments, the CD47 protein is membrane-bound.

[0048] Some aspects of the present disclosure describe compositions comprising one or more of the engineered mammalian cells described herein. In some embodiments, the composition comprises a plurality of non-native cells, a) at least 30% of the cells in the composition are NKX6.1-positive, ISL1-positive cells; b) at least 25% of the cells in the composition are NKX6.1-negative, ISL1-positive cells; c) there are more NKX6.1-positive, ISL1-positive cells than NKX6.1-negative, ISL1-positive cells in the composition; d) i) less than 12% of the cells in the composition are NKX6.1-negative, ISL1-negative cells; and / or ii) between 9 and 25% of the cells in the composition are NKX6.1-positive, ISL1-negative cells; and e) Less than 40% of the cells in the composition are VMAT1 positive cells.

[0049] Some aspects of the present disclosure describe methods of administering the described compositions to a subject. In some embodiments, the subject has diabetes.

[0050] The patent or application file contains at least one drawing executed in color. Copies of this document or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. [Brief explanation of the drawings]

[0051] [Figure 1] Figures 1A-C show that removal of the A antigen protects SC islets from immune attack. Figure 1A is a bar graph showing the percent of type A-positive SC islets differentiated from either unedited wild-type hESCs or ABO knockout versions of hESCs. Figure 1B is a bar graph showing the percent cytotoxicity of SC islets differentiated from wild-type or ABO knockout hESCs in an antibody-dependent cellular cytotoxicity assay. Figure 1C is a bar graph showing the percent cytotoxicity of SC islets differentiated from wild-type or ABO knockout hESCs in a complement-dependent cytotoxicity assay. Graphs are representative of five independent experiments using ABO-KO SC islet clonal cell lines.

[0052] [Figure 2] Figure 2 shows that HLA class I removal prevents T cell activation by SC islets. T cell responses (percentage of IFNγ-positive CD8 T cells) to SC islets were measured for three different donors (donors 1-3) under three different conditions: 1) unstimulated (first bar in each donor graph); 2) wild-type SC islets (second bar in each donor graph); and 3) B2M knockout SC islets (third bar in each donor graph).

[0053] [Figure 3] Figures 3A-B are graphs comparing wild-type cells with B2M knockout cells. Figure 3A is a graph showing the percentage of ISL1-positive cells in wild-type or B2M knockout ("HLA-IKO") SC islets removed from the graft at the indicated time points. Figure 3B shows the frequency of hCD69 expression in hCD8-positive cells recovered from wild-type or B2M knockout ("HLA-IKO") SC islet grafts removed at the indicated time points. Asterisks indicate unpaired T-tests.

[0054] [Figure 4]Figures 4A-B show that CD142 knockout hESCs have significantly reduced tissue factor pathway activation in vitro. Figure 4A is a bar graph showing the percentage of tissue factor (CD142)-positive cells in wild-type hESCs or in two different CD142 knockout pools. Figure 4B is a bar graph showing the percentage of tissue factor in wild-type (WT) cells or in cells from one of two different CD142 knockout pools of cells. "WT + αTF mAb" corresponds to wild-type hESCs pretreated with saturating levels of anti-tissue factor antibody to block complement pathway activation. The assay in Figure 4B shows cells, recombinant FVII, and recombinant FX. FX activation was measured using a colorimetric substrate, which depends on CD142 activating FVII, which in turn activates FX. In the experiment shown, omitting FVII did not completely abolish the signal ("No FVII (assay baseline)").

[0055] [Figure 5A] Figures 5A-C illustrate gene editing strategies for generating high-affinity CD47 variants. Figure 5A shows an exemplary guide sequence near the editing site in CD47 to enable HDR-mediated repair. Figure 5B shows an example of a template sequence for templated repair. Figure 5C shows a simplified schematic diagram of a portion of the wild-type CD47 protein sequence and a portion of the high-affinity CD47 protein sequence. [Figure 5B] Same as above. [Figure 5C] Same as above.

[0056] [Figure 6]Figure 6 shows a series of flow plots for different CD47 variants based on the expression of NKX6.1 (x-axis) and ISL1 (y-axis). "WT" corresponds to SC islands generated from wild-type hESCs (top left panel). SB(CD47)51 corresponds to SC islands generated from hESCs heterozygous for CD47 high-affinity editing and for CD47 knockout (top right two panels). SB(CD47)53 corresponds to SC islands generated from hESCs homozygous for CD47 high-affinity editing (bottom left two panels). SB(CD47)54 corresponds to SC islands generated from hESCs homozygous for CD47 knockout (bottom right two panels).

[0057] [Figure 7] Figure 7 is a bar graph showing the percentage of CFSE-positive, CD11b-positive cells across different test conditions. "Positive CTRL" corresponds to FITC-dextran. "dKO HI TG1 TG2 #22," "dKO HI TG1 TG2 #23," "dKO HI TG1 TG2 #24," and "dKO HI TG1 TG2 #54" correspond to four different clones of endothelial cells differentiated from stem cells after knockout of the B2M and CIITA genes and knock-in of the PDL1 and CD47 genes.

[0058] [Figure 8A]Figures 8A-B show a series of flow cytometry plots for the expression of the indicated genes in wild-type hESCs or in three different clones of hESCs (clones A3, A5, and A11) in which B2M and ABO were knocked out and CD47 was knocked in. Figure 8A shows plots for the expression of A antigen (top row), HLA-A, HLA-B, HLA-C (middle row), and CD47 (bottom row). In the bottom row, the first inset box within each plot indicates the area for expected endogenous levels of CD47, while the second inset box within each plot indicates the area for expected overexpression of CD47. Figure 8B shows plots for the expression of the stem cell markers SOX2 and OCT4 in the indicated cell types. [Figure 8B] Same as above.

[0059] [Figure 9A]9A-B show flow cytometry plots. Figure 9A shows several flow cytometry plots for the expression of NKX6.1 (x-axis) and ISL1 (y-axis) in stage 5 SC islet cells differentiated from wild-type hESCs ("WT") or from hESCs engineered to knock out B2M and ABO and knock in CD47. The lower panel of Figure 9A shows a graph illustrating the percentage of different cell types in stage 5 SC islet cells differentiated from wild-type hESCs ("WT") or from hESCs engineered to knock out B2M and ABO and knock in CD47. Figure 9B shows several flow cytometry plots of NKX6.1 (x-axis) and ISL1 (y-axis) expression in stage 6, day 6 SC islet cells differentiated from wild-type hESCs ("WT") or from hESCs engineered to knock out B2M and ABO and knock in CD47. The lower panel of Figure 9B shows a graph illustrating the percentage of different cell types in stage 6, day 6 SC islet cells differentiated from wild-type hESCs ("WT") or from hESCs engineered to knock out B2M and ABO and knock in CD47. For each of the bars in the bar graphs in Figures 9A and 9B, the top quadrant of each bar corresponds to the percentage of cells that are double negative for NKX6.1 and ISL1, the second quadrant from the top of each bar corresponds to the percentage of cells that are NKX6.1 positive and ISL1 negative, the third quadrant from the top of each bar corresponds to the percentage of cells that are ISL1 positive and NKX6.1 negative, and the bottom quadrant of each bar corresponds to the percentage of cells that are ISL1 positive and NKX6.1 positive. [Figure 9B] Same as above.

[0060] [Figure 10]Figures 10A-B show flow cytometry plots. Figure 10A shows several flow plots for NKX6.1 (x-axis) and ISL1 (y-axis) expression in stage 5 or stage 6 day 6 SC islet cells differentiated from hESCs engineered to knock out B2M, ABO, and CD142 and knock in CD47. Figure 10B shows a flow plot for CD142 expression in stage 6 SC islet cells differentiated from hESCs engineered to knock out B2M, ABO, and CD142 and knock in CD47. INCORPORATION BY REFERENCE

[0061] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. To the extent that the publications and patents or patent applications incorporated by reference conflict with the present disclosure contained herein, the present specification is intended to supersede and / or supersede any such conflicting material. DETAILED DESCRIPTION OF THE INVENTION

[0062] Detailed Description The following description and examples will explain the embodiments of the present disclosure in detail. It should be understood that the present disclosure is not limited to the specific embodiments described herein and may therefore have breadth. Those skilled in the art will recognize that there are numerous variations and modifications of the present disclosure, which are encompassed within the scope of the present disclosure.

[0063] All terms are intended to be understood as they are understood by one of ordinary skill in the art. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains.

[0064] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0065] While various features of the present disclosure may be described in the context of a single embodiment, those features may also be provided separately or in any suitable combination. Conversely, while the present disclosure may be described herein for clarity in the context of separate embodiments, the present disclosure may also be implemented in a single embodiment.

[0066] The following definitions supplement those in the art and relate to the present application and are not to be construed as being related or unrelated to, for example, any co-owned patent or application. Although any methods and materials similar or equivalent to those described herein can be used in carrying out the tests of the present disclosure, the preferred materials and methods are described herein. Therefore, the terminology used herein is for the purpose of describing specific embodiments only and is not intended to be limiting.

[0067] In this application, the use of the singular includes the plural unless specifically stated otherwise. It must be noted that as used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0068] In this application, the use of "or" means "and / or" unless stated otherwise. The terms "and / or" and "any combination thereof" and their grammatical equivalents may be used interchangeably when used herein. These terms may convey that any combination is specifically contemplated. Solely for purposes of explanation, the following phrase "A, B, and / or C," or "A, B, C, or any combination thereof" may mean "A individually; B individually; C individually; A and B; B and C; A and C; and A, B, and C." The term "or" may be used conjunctively or disjunctively, unless the context specifically dictates disjunctive use.

[0069] Furthermore, use of the term "including" as well as other forms such as "include," "includes," and "included" is not limiting.

[0070] References herein to "some embodiments," "an embodiment," "one embodiment," or "other embodiments" mean that a particular feature, structure, or characteristic described in connection with an embodiment is included in at least some embodiments of the present disclosure, but not necessarily in all embodiments.

[0071] As used in the specification and claim(s), the words "comprising" (and any form of comprising, e.g., "comprise" and "comprises"), "having" (and any form of having, e.g., "have" and "has"), "including" (and any form of including, e.g., "includes" and "include"), or "containing (and any form of containing, e.g., "contains" and "contain") are inclusive or open-ended and do not exclude additional, unstated elements or method steps. It is contemplated that any embodiment discussed herein can be implemented with respect to any method or composition of the disclosure, and conversely, any method or composition of the disclosure can also be implemented with respect to any embodiment discussed herein. Furthermore, the compositions of the disclosure can be used to achieve the methods of the disclosure.

[0072] The terms "about" or "approximately" refer to within an acceptable error range for a particular value, as determined by one of ordinary skill in the art, which will depend in part on the limitations of how the value is measured or determined, e.g., the measurement system. For example, "about" can mean within 1 standard deviation or more than 1 standard deviation, in accordance with practice in the art. Alternatively, "about" can mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value. In another example, the quantity "about 10" includes 10 and any amount between 9 and 11. In yet another example, the term "about" with respect to a reference numerical value can also include a range of values, plus or minus 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% from that value. Alternatively, particularly with respect to biological systems or processes, the term "about" can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value. Where particular values ​​are described in this application and claims, unless otherwise stated, the term "about" should be construed to mean within an acceptable range of error for the particular value.

[0073] The term "diabetes" and its grammatical equivalents, as used herein, can refer to / are a disease characterized by prolonged high blood glucose levels. For example, the term "diabetes" and its grammatical equivalents, as used herein, can refer to all or any type of diabetes, including, but not limited to, type 1, type 2, cystic fibrosis-related, surgical, gestational, and mitochondrial diabetes. In some embodiments, diabetes can be a type of genetic diabetes. In some embodiments, diabetes can be an autoimmune type of diabetes.

[0074] The term "endocrine cell(s)," unless otherwise specified, can refer to hormone-producing cells present in the pancreas of an organism, such as "islets," "islet cells," "islet equivalents," "islet-like cells," "pancreatic islets," and grammatical equivalents thereof. In certain embodiments, endocrine cells can be differentiated from pancreatic progenitor cells or precursors. Islet cells can include different types of cells, including, but not limited to, pancreatic alpha cells, pancreatic beta cells, pancreatic delta cells, pancreatic F cells, and / or pancreatic epsilon cells. Islet cells can also refer to cell groups, cell clusters, and the like.

[0075] The terms "guide RNA" and simply "guide" are used interchangeably herein to refer to either a crRNA (also known as CRISPR RNA) nucleic acid or a combination of a crRNA nucleic acid and a trRNA (also known as tracrRNA) nucleic acid. The crRNA and trRNA may be associated as a single RNA molecule (single guide RNA, sgRNA) or as two separate RNA molecules (dual guide RNA, dgRNA). "Guide RNA" refers to each type unless otherwise specified. The trRNA may be a naturally occurring sequence or a trRNA sequence that has modifications or differences compared to a naturally occurring sequence. For clarity, the terms "guide RNA" or "guide," as used herein, may refer to an RNA molecule (containing A, C, G, and U nucleotides) or a DNA molecule (containing A, C, G, and T nucleotides) encoding such an RNA molecule or its complementary sequence, unless specifically stated otherwise. Generally, for DNA nucleic acid constructs encoding guide RNAs, U residues in any of the RNA sequences described herein may be replaced with T residues, and for guide RNA constructs encoded by any of the DNA sequences described herein, T residues may be replaced with U residues. In some embodiments, any of the guide RNA sequences comprises a scaffold sequence. In some embodiments, the scaffold sequence comprises a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 143 (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT). In some embodiments, the guide RNA comprises one or more modified nucleotides. A discussion of modified guide RNAs can be found, for example, in WO2022 / 056000, which is incorporated herein in its entirety. In some embodiments, the guide RNA is unmodified.

[0076] The terms "polynucleotide," "nucleic acid," and "nucleic acid molecule" are used herein to refer to polymeric compounds containing nucleosides or nucleoside analogs with nitrogen-containing heterocyclic bases or base analogs linked together along the backbone, including polymers of conventional RNA, DNA, mixed RNA-DNA, and analogs thereof. The nucleic acid "backbone" can be composed of various linkages, including one or more of sugar-phosphodiester linkages, peptide-nucleic acid linkages ("peptide nucleic acids," or PNA; PCT No. WO 95 / 32305), phosphorothioate linkages, methylphosphonate linkages, or combinations thereof. The sugar moiety of the nucleic acid can be ribose, deoxyribose, or analogs with substitutions, such as 2' methoxy or 2' halide substitutions. The nitrogenous base can be a conventional base (A, G, C, T, U), an analog thereof (e.g., a modified uridine, such as 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine, etc.); inosine; a purine or pyrimidine derivative (e.g., N4-methyldeoxyguanosine, deaza- or aza-purines, deaza- or aza-pyrimidines, pyrimidine bases having a substituent at the 5- or 6-position (e.g., 5-methylcytosine), purine bases having a substituent at the 2-, 6-, or 8-position, 2-amino-6-methylaminopurine, O6-methylguanine, 4-thio-pyrimidine, 4-amino-pyrimidine, 4-dimethylhydrazine-pyrimidine, and O4-alkyl-pyrimidine; U.S. Pat. No. 5,378,825 and PCT No. WO 93 / 13121). For a general discussion, see The Biochemistry of the Nucleic Acids 5-36, Adams et al., ed., 11 thed., 1992). Nucleic acids may contain one or more "abasic" residues, in which case the backbone does not contain nitrogenous bases at any position in the polymer (U.S. Pat. No. 5,585,481). Nucleic acids may contain only conventional RNA or DNA sugars, bases, and linkages, or may contain both conventional components and substitutions (e.g., conventional bases with 2' methoxy linkages; or polymers containing both conventional bases and one or more base analogs). Nucleic acids include "locked nucleic acids" (LNAs); analogs containing one or more LNA nucleotide monomers with a bicyclic furanose unit locked in a sugar conformation that mimics RNA, enhancing hybridization affinity for complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry 43(42):13233-41). RNA and DNA may differ in having different sugar moieties, with uracil or its analogs present in RNA and thymine or its analogs present in DNA. The present disclosure provides numerous exemplary nucleotide sequences herein and contemplates the reverse complements of these nucleotide sequences, as well as RNA and / or DNA equivalents of any of these sequences. For example, an RNA equivalent of any of the DNA sequences disclosed herein will include uracil in place of thymine in the sequence, while a DNA equivalent of any of the RNA sequences disclosed herein will include thymine in place of uracil.

[0077] As used herein, "CRISPR" systems and "RNA-targeting endonuclease" or "Cas nuclease" include type II CRISPR systems from S. pyogenes, S. aureus, and other prokaryotes, as well as modified (e.g., engineered or mutant) versions thereof. See, e.g., U.S. Patent Application Publication No. 2016 / 0312198A1 and U.S. Patent Application Publication No. 2016 / 0312199A1. In certain embodiments, the RNA-targeting endonuclease is a type II CRISPR Cas enzyme. Other examples of Cas nucleases include the Csm or Cmr complex of a type III CRISPR system, or the Cas10, Csm1, or Cmr2 subunit thereof; and the Cascade complex of a type I CRISPR system, or the Cas3 subunit thereof. In some embodiments, the Cas nuclease may be from a type IIA, type IIB, or type IIC system. For a discussion of various CRISPR systems and Cas nucleases, see, e.g., Makarova et al., Nat. Rev. Microbiol., 9:467-477 (2011); Makarova et al., Nat. Rev. Microbiol., 13: 722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015). Non-limiting exemplary species from which Cas nucleases can be derived include Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Listeria innocua, Lactobacillus gasseri, Francisella novicida, Wolinella succinogenes, Sutterella wadsworthensis, Gammaproteobacterium, Neisseria meningitidis, Campylobacter jejuni, Pasteurella multocida, Fibrobacter succinogene, Rhodospirillum rubrum, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Lactobacillus buchneri, Treponema denticola, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohlobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Streptococcus pasteurianus, Neisseria cinerea, Campylobacter lari, Parvibaculum lavamentivorans, Corynebacterium diphtheria, Acidaminococcus sp., Lachnospiraceae bacterium ND2006, and Acaryochloris marina. In some embodiments, the Cas protein is a Cpf1 or Cas12 (e.g., Cas12i2) protein. In some embodiments, the present disclosure provides cells (e.g., stem cells, or stem cell-derived beta cells) containing one or more gene disruptions using a CRISPR system and one or more guide RNAs comprising any of the sequences disclosed herein. In some embodiments, the CRISPR system disrupts the target gene by introducing one or more insertions / deletions (e.g., indels) into the target gene.

[0078]

[0079] The terms "progenitor" and "precursor" cells are used interchangeably herein and refer to cells that have a cellular phenotype that is more primitive than a cell that can result from differentiation (e.g., is earlier in the developmental pathway or progression than a fully differentiated cell). In many cases, progenitor cells can also have significant or very high proliferative potential. Depending on the developmental pathway and the environment in which the cell develops and differentiates, progenitor cells can give rise to multiple distinct differentiated cell types, or they can give rise to a single differentiated cell type.

[0080] The term "precursor thereof" in reference to an insulin-positive endocrine cell can refer to any cell, including, for example, a pluripotent stem cell, a definitive endoderm cell, a primitive gut cell, a pancreatic progenitor cell, or an endocrine precursor cell, that can differentiate into an insulin-positive endocrine cell when cultured under suitable conditions that allow the precursor cell to differentiate into an insulin-positive endocrine cell.

[0081] The terms "stem cell-derived β cells," "SC-β cells," "functional β cells," "functional pancreatic β cells," "mature SC-β cells," "β-like cells," and their grammatical equivalents can refer to cells (e.g., non-native pancreatic β cells) that display at least one marker indicative of pancreatic β cells (e.g., PDX-1 or NKX6.1), express insulin, and display a glucose-dependent insulin secretion (GSIS) response similar to or superior to that of endogenous mature β cells (e.g., mature β cells from a healthy, functioning pancreas from a healthy, adult, non-diabetic patient). For brevity, SC-β cells may be referred to simply as "β cells" in this disclosure. In some embodiments, the terms "SC-β cells" and "non-native β cells" are interchangeable when used herein. In some embodiments, "SC-β cells" express lower levels of MAFA than pancreatic β cells from a healthy adult human patient. In some embodiments, "SC-β cells" express higher levels of MAFB than pancreatic β cells from a healthy adult human patient. In some embodiments, "SC-β cells" express higher levels of SIX2, HOPX, IAPP, and / or UCN3 than pancreatic β cells from healthy adult human patients. In some embodiments, "SC-β cells" include mature pancreatic cells. It should be understood that the SC-β cells need not be derived (e.g., directly) from stem cells, as the methods of the present disclosure can derive SC-β cells from any insulin-positive endocrine cell or its precursor using any cell as a starting point (e.g., embryonic stem cells, induced pluripotent stem cells, progenitor cells, e.g., definitive endoderm cells, partially reprogrammed somatic cells (e.g., somatic cells partially reprogrammed to an intermediate state between induced pluripotent stem cells and the somatic cells derived therefrom), multipotent cells, totipotent cells, transdifferentiated versions of any of the foregoing cells, etc., can be used, as the invention is not intended to be so limited). In some embodiments, the SC-β cells exhibit a response to multiple glucose challenges (e.g., a series of at least one, at least two, or at least three or more glucose challenges). In some embodiments, the response resembles the response of endogenous islets (eg, human islets) to multiple glucose challenges.In some embodiments, the morphology of SC-β cells resembles that of endogenous β cells. In some embodiments, SC-β cells exhibit an in vitro GSIS response that resembles that of endogenous β cells. In some embodiments, SC-β cells exhibit an in vivo GSIS response that resembles that of endogenous β cells. In some embodiments, SC-β cells exhibit both in vitro and in vivo GSIS responses that resemble that of endogenous β cells. In some embodiments, the GSIS response of SC-β cells can be observed within two weeks of transplantation of SC-β cells into a host (e.g., a human or animal). In some embodiments, the GSIS response of SC-β cells can be observed within three weeks of transplantation of SC-β cells into a host (e.g., a human or animal). In some embodiments, the GSIS response of SC-β cells can be observed within four weeks of transplantation of SC-β cells into a host (e.g., a human or animal). In some embodiments, the GSIS response of SC-β cells can be observed between one and three months after transplantation of SC-β cells into a host (e.g., a human or animal). In some embodiments, SC-β cells package insulin into secretory granules. In some embodiments, SC-β cells exhibit encapsulated crystalline insulin granules when examined using electron microscopy. In some embodiments, SC-β cells exhibit a stimulation index greater than 1. In some embodiments, SC-β cells exhibit a stimulation index greater than 1.1. In some embodiments, SC-β cells exhibit a stimulation index greater than 2. In some embodiments, the stimulation index of a cell is characterized by the ratio of insulin secreted in response to a high glucose concentration (e.g., 15 mM) compared to a low glucose concentration (e.g., 2.5 mM).

[0082] In some embodiments, SC-β cells exhibit cytokine-induced apoptosis in response to cytokines. In some embodiments, insulin secretion from SC-β cells is enhanced in response to known antidiabetic drugs (e.g., secretagogues). In some embodiments, SC-β cells are monohormonal. In some embodiments, SC-β cells do not abnormally co-express other hormones, such as glucagon, somatostatin, or pancreatic polypeptide. In some embodiments, SC-β cells exhibit a low replication rate. In some embodiments, SC-β cells increase intracellular Ca2+ in response to glucose.

[0083] The terms "stem cell-derived α-cell," "SC-α-cell," "functional α-cell," "functional pancreatic α-cell," "mature SC-α-cell," "α-like cell," and their grammatical equivalents can refer to cells (e.g., non-native pancreatic α-cells) that display at least one marker indicative of a pancreatic α-cell (e.g., expressing ISL1 but not NKX6.1, glucagon), express glucagon, and are capable of secreting functional glucagon in response to a stimulus that induces endogenous pancreatic α-cells to secrete functional glucagon. In some embodiments, "SC-α-cells" do not express somatostatin. In some embodiments, "SC-α-cells" do not express insulin. In some embodiments, the terms "SC-α-cells" and "non-native α-cells" are interchangeable when used herein. In some embodiments, "SC-α-cells" include mature pancreatic cells. For brevity, these cells may be referred to simply as "α-cells" in this disclosure.

[0084] The terms "stem cell-derived δ cells," "SC-δ cells," "functional δ cells," "functional pancreatic δ cells," "mature SC-δ cells," "δ-like cells," and their grammatical equivalents can refer to cells (e.g., non-native pancreatic δ cells) that display at least one marker indicative of pancreatic δ cells (e.g., somatostatin) and that express and can secrete somatostatin in response to a stimulus that induces endogenous pancreatic δ cells to secrete functional glucagon. For brevity, SC-δ cells may be referred to simply as "δ cells" in the present disclosure. In some embodiments, "SC-δ cells" do not express glucagon. In some embodiments, "SC-δ cells" do not express insulin. In some embodiments, the terms "SC-δ cells" and "non-native δ cells" are interchangeable when used herein. In some embodiments, "SC-δ cells" include mature pancreatic cells.

[0085] The terms "stem cell-derived enterochromaffin (EC) cells," "SC-EC cells," and their grammatical equivalents can refer to cells (e.g., non-native pancreatic EC cells) that display at least one marker indicative of pancreatic EC cells (e.g., expressing NKX6.1 but not ISL1, VMAT1 (vesicular monoamine transporter 1)). In some embodiments, the terms "SC-EC cells" and "non-native EC cells" are interchangeable when used herein.

[0086] The terms "stem cell-derived islet cells," "SC islet cells," and their grammatical equivalents refer to islet cells or islet-like cells differentiated in vitro from stem cells. Examples of SC islet cells include SC-β cells, SC-α cells, and SC-δ cells.

[0087] It should be understood that the SC islet cells need not be derived (e.g., directly) from stem cells, as the methods of the present disclosure can derive SC islet cells from other precursor cells generated during in vitro differentiation of SC islet cells as a starting point (e.g., embryonic stem cells, induced pluripotent stem cells, progenitor cells, partially reprogrammed somatic cells (e.g., somatic cells partially reprogrammed to an intermediate state between an induced pluripotent stem cell and the somatic cell derived therefrom), multipotent cells, totipotent cells, transdifferentiated versions of any of the foregoing cells, etc., can be used, as the invention is not intended to be so limited).

[0088] As used herein, the term "insulin-producing cells" and its grammatical equivalents refer to cells differentiated from pancreatic progenitor cells, or precursors thereof, that secrete insulin. Insulin-producing cells can include pancreatic β cells, as that term is explained herein, as well as pancreatic β-like cells (e.g., insulin-positive, endocrine cells) that constitutively or inducibly synthesize (e.g., transcribe the insulin gene, translate proinsulin mRNA, and modify proinsulin mRNA into insulin protein), express (e.g., manifest the phenotypic traits of the insulin gene), or secrete (e.g., release insulin into the extracellular space) insulin. For example, a population of insulin-producing cells produced by differentiating insulin-positive endocrine cells or their precursors into SC-β cells according to the methods of the present disclosure can be pancreatic β cells or β-like cells (e.g., cells that have at least one or at least two characteristics of endogenous β cells and exhibit a glucose-dependent insulin secretory (GSIS) response similar to that of endogenous adult β cells). For example, the population of insulin-producing cells produced by the methods described herein can include mature pancreatic beta cells or SC-beta cells, and can also include non-insulin-producing cells (e.g., cells with a cell-like phenotype except that they do not produce or secrete insulin).

[0089] The terms "insulin-positive β-like cells," "insulin-positive endocrine cells," and their grammatical equivalents can refer to cells (e.g., pancreatic endocrine cells) that exhibit at least one marker indicative of pancreatic β cells and also express insulin, but, unless otherwise specified, lack the glucose-dependent insulin secretion (GSIS) response characteristic of endogenous β cells. Exemplary markers of "insulin-positive endocrine cells" include, but are not limited to, NKX6.1 (NK6 homeobox 1), ISL1 (Islet1), and insulin.

[0090] The term "β cell marker" refers to, but is not limited to, proteins, peptides, nucleic acids, protein and nucleic acid polymorphisms, splice variants, protein or nucleic acid fragments, elements, and other analytes expressed or present in pancreatic β cells. Exemplary β cell markers include, but are not limited to, pancreatic and duodenal homeobox 1 (PDX1) polypeptide, insulin, c-peptide, amylin, E-cadherin, Hnf3β, PCI / 3, B2, Nkx2.2, GLUT2, PC2, ZnT-8, ISL1, Pax6, Pax4, NeuroD, 1 Inf1b, Hnf-6, Hnf-3 beta, VMAT2, NKX6.1, and MafA, as well as those described in Zhang et al., Diabetes. 50(10):2231-6 (2001). In some embodiments, the β cell marker is a nuclear β cell marker. In some embodiments, the beta cell marker is PDX1 or PH3.

[0091] The term "pancreatic endocrine marker" can refer to, but is not limited to, proteins; peptides; nucleic acids; protein and nucleic acid polymorphisms; splice variants; protein or nucleic acid fragments; elements; and other analytes that are expressed or present in pancreatic endocrine cells. Exemplary pancreatic endocrine cell markers include, but are not limited to, Ngn-3, NeuroD, and Islet-1.

[0092] The terms "pancreatic progenitor cells," "pancreatic endocrine precursor cells," "pancreatic precursors," "pancreatic endocrine precursors," and their grammatical equivalents are used interchangeably herein to refer to stem cells capable of becoming pancreatic hormone-expressing cells that can form pancreatic endocrine cells, pancreatic exocrine cells, or pancreatic ductal cells. These cells are committed to differentiation into at least one type of pancreatic cell, e.g., insulin-producing beta cells, glucagon-producing alpha cells, somatostatin-producing delta cells (or D cells), and / or pancreatic polypeptide-producing F cells. Such cells can express at least one of the following markers: NGN3, NKX2.2, NeuroD, ISL-1, Pax4, Pax6, or ARX.

[0093] The term "PDX1-positive pancreatic progenitor cells," as used herein, can refer to cells that are pancreatic endoderm (PE) cells capable of differentiating into SC-β cells, such as pancreatic β cells. PDX1-positive pancreatic progenitor cells express the marker PDX1. Other markers include, but are not limited to, Cdcp1, Ptf1a, HNF6, or NRx2.2. PDX1 expression can be assessed by any method known to those skilled in the art, such as immunohistochemistry using an anti-PDX1 antibody or quantitative RT-PCR. In some embodiments, PDX1-positive pancreatic progenitor cells lack NKX6.1 expression. In some embodiments, PDX1-positive pancreatic progenitor cells may also be referred to as PDX1-positive, NKX6.1-negative pancreatic progenitor cells due to the lack of NKX6.1 expression. In some embodiments, PDX1-positive pancreatic progenitor cells may also be referred to as "pancreatic foregut endoderm cells."

[0094] The terms "PDX1-positive, NKX6.1-positive pancreatic progenitor cells" and "NKX6.1-positive pancreatic progenitor cells" are used interchangeably herein and can refer to cells that are pancreatic endoderm (PE) cells capable of differentiating into insulin-producing cells, such as pancreatic β cells. PDX1-positive, NKX6.1-positive pancreatic progenitor cells express the markers PDX1 and NKX6-1. Other markers can include, but are not limited to, Cdcp1, Ptf1a, HNF6, or NRx2.2. NKX6-1 expression can be assessed by any method known to those skilled in the art, for example, immunochemical testing using anti-NKX6-1 antibodies or quantitative RT-PCR. As used herein, the terms "NKX6.1" and "NKX6-1" are equivalent and interchangeable. In some embodiments, PDX1-positive, NKX6.1-positive pancreatic progenitor cells may also be referred to as "pancreatic foregut precursor cells."

[0095] The terms "NeuroD" and "NeuroD1" are used interchangeably to identify proteins and their encoding genes expressed in pancreatic endocrine precursor cells.

[0096] The term "differentiated cell" or its grammatical equivalents, in its native form, refers to any primary cell that is not pluripotent as the term is defined herein. In other words, the term "differentiated cell" can refer to a more specialized cell type derived from a less specialized cell type (e.g., stem cells, e.g., induced pluripotent stem cells) during the cell differentiation process. Without wishing to be limited by theory, during normal ontogeny, pluripotent stem cells can first differentiate into endodermal cells that can form pancreatic cells and other endodermal cell types. Further differentiation of endodermal cells can lead to the pancreatic pathway, where approximately 98% of the cells become exocrine cells, ductular cells, or matrix cells, and approximately 2% become endocrine cells. Early endocrine cells are islet progenitor cells, which can then further differentiate into insulin-producing cells (e.g., functional endocrine cells) that secrete insulin, glucagon, somatostatin, or pancreatic polypeptide. Endodermal cells can also differentiate into other cells of endodermal origin, such as lung, liver, intestine, thymus, etc.

[0097] As used herein, the term "somatic cell" can refer to any cell that forms the body of an organism, as opposed to a germline cell. In mammals, germline cells (also known as "gametes") are sperm and eggs, which fuse during fertilization to produce a cell called a zygote, from which all mammalian embryos develop. All other cell types in a mammal's body—aside from sperm and eggs, the cells from which they are made (gametocytes), and undifferentiated stem cells—are somatic cells: internal organs, skin, bone, blood, and connective tissue are all composed of somatic cells. In some embodiments, a somatic cell is a "non-embryonic somatic cell," which refers to a somatic cell that is not present in or obtained from an embryo and that is not obtained as a result of propagation of such a cell in vitro. In some embodiments, a somatic cell is an "adult somatic cell," which refers to a cell that is present in or obtained from an organism other than an embryo or fetus, or that is obtained as a result of propagation of such a cell in vitro. Unless otherwise indicated, the methods for converting at least one insulin-positive endocrine cell or precursor thereof into an insulin-producing, glucose-responsive cell can be performed in vivo or in vitro (in vivo, when performed when at least one insulin-positive endocrine cell or precursor thereof is present in a subject; in vitro, when performed using isolated at least one insulin-positive endocrine cell or precursor thereof maintained in culture).

[0098] As used herein, the term "adult cell" can refer to a cell found throughout the body after embryonic development.

[0099] The term "endodermal cells," as used herein, can refer to cells derived from one of the three primary germ cell layers in a very early embryo (the other two germ cell layers are mesoderm and ectoderm). The endoderm is the innermost of the three layers. Endoderm cells differentiate first into the embryonic gut, and then into the lining of the respiratory and digestive tracts (e.g., intestine), the liver, and the pancreas.

[0100] The term "cells of endodermal origin," as used herein, can refer to any cells that develop or differentiate from endodermal cells. For example, cells of endodermal origin include cells of the liver, lung, pancreas, thymus, intestine, stomach, and thyroid gland. Without wishing to be bound by theory, liver and pancreatic progenitor cells (also called pancreatic precursor cells) develop from endodermal cells in the embryonic foregut. Shortly after their specialization, liver and pancreatic progenitor cells rapidly acquire distinct cellular functions and regenerative capabilities. These changes are initiated by inductive signals and gene regulatory factors that are highly conserved among vertebrates. The strong need for hepatocytes and pancreatic beta cells in the therapeutic treatment of liver failure and type 1 diabetes has sparked interest in organ development and regeneration. Studies in various model organisms and humans have revealed evolutionarily conserved inductive signals and transcription factor networks that initiate the differentiation of liver and pancreatic cells, providing guidance on how to promote hepatocyte and beta cell differentiation from various stem and progenitor cell types.

[0101] The term "definitive endoderm," as used herein, can refer to cells differentiated from endoderm cells and capable of differentiating into SC-β cells (e.g., pancreatic β cells). Definitive endoderm cells express the marker Sox17. Other markers characteristic of definitive endoderm cells can include, but are not limited to, MIXL2, GATA4, HNF3b, GSC, FGF17, VWF, CALCR, FOXQ1, CXCR4, Cerberus, OTX2, Goosecoid, C-Kit, CD99, CMKOR1, and CRIP1. In particular, definitive endoderm cells herein express Sox17, and in some embodiments, Sox17 and HNF3B, but do not express significant levels of GATA4, SPARC, APF, or DAB. Definitive endoderm cells are not positive for the marker PDX1 (e.g., they are PDX1 negative). Definitive endoderm cells have the ability to differentiate into cells including liver, embryonic, pancreatic, thymic, intestinal, stomach, and thyroid cells. Expression of Sox17 and other markers of definitive endoderm can be assessed by any method known to those skilled in the art, such as immunochemical testing using anti-Sox17 antibodies, or quantitative RT-PCR.

[0102] The term "pancreatic endoderm" can refer to cells of endodermal origin that can differentiate into multiple pancreatic lineages, including pancreatic beta cells, but no longer have the capacity to differentiate into non-pancreatic lineages.

[0103] The term "pancreatic islet cells" refers to a population of cells that includes different types of pancreatic endocrine cells (beta cells, alpha cells, delta cells, epsilon cells) and enterochromaffin (EC) cells, as described, for example, in Xavier et al. (J Clin Med. 2018 Mar; 7(3): 54), which is incorporated herein by reference.

[0104] The term "primitive gut cells" or "gut cells," as used herein, can refer to cells differentiated from endoderm cells and capable of differentiating into SC-β cells (e.g., pancreatic β cells). Primitive gut cells express at least one of the following markers: HNF1-β, HNF3-β, or HNF4-α. In some embodiments, primitive gut cells are FOXA2-positive and SOX2-positive, i.e., express both FOXA2 (also known as HNF3-β) and SOX2. In some embodiments, primitive gut cells are FOXA2-positive and PDX1-negative, i.e., express FOXA2 but not PDX1. Primitive gut cells have the potential to differentiate into cells including lung, liver, pancreatic, stomach, and intestinal cells. Expression of HNF1-β and other markers of the primitive gut can be assessed by any method known to those skilled in the art, for example, by immunochemical testing using anti-HNF1-β antibodies.

[0105] The term "phenotype" can refer to one or several total biological characteristics that define a cell or organism according to a particular set of environmental conditions and factors, regardless of the actual genotype.

[0106] The terms "patient," "subject," and "individual" are used interchangeably and can refer to either a human or a non-human animal. "Non-human animal" and "non-human mammal," used interchangeably herein, include mammals, such as rats, mice, rabbits, sheep, cats, dogs, cows, pigs, and non-human primates. The term "subject" also encompasses any vertebrate, including, but not limited to, mammals, reptiles, amphibians, and fish. Advantageously, however, the subject is a mammal, such as a human, or another mammal, for example, a domesticated mammal, such as a dog, cat, horse, or a productive mammal, such as a cow, sheep, pig, or the like. A "patient in need thereof" or a "subject in need thereof" is referred to herein as a patient diagnosed with or suspected of having a disease or disorder, such as, but not limited to, diabetes.

[0107] "Administering," as used herein, can refer to providing one or more compositions described herein to a patient or subject. By way of example, and not limitation, composition administration, e.g., injection, can be via intravenous (iv), subcutaneous (sc), intradermal (id), intraperitoneal (ip), or intramuscular (im) injection. One or more such routes can be utilized. Parenteral administration can be, for example, via bolus injection or gradual perfusion over time. Alternatively, or in conjunction, administration can be via oral route. Furthermore, administration can also be via surgical deposition of a bolus or pellet of cells or placement of a medical device. In certain embodiments, compositions of the present disclosure can include engineered or host cells expressing a nucleic acid sequence described herein, or a vector comprising at least one nucleic acid sequence described herein, in an amount effective to treat or prevent a proliferative disorder. Pharmaceutical compositions can include a cell population described herein in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients. Such compositions may contain buffers, such as neutral buffered saline, phosphate buffered saline, etc.; carbohydrates, such as glucose, mannose, sucrose, or dextran, mannitol; proteins; polypeptides or amino acids, such as glycine; antioxidants; chelating agents, such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives.

[0108] The terms "genetically engineered," "genetically modified," or "genetically modified," and their grammatical equivalents, as used herein, refer to genetic modifications that do not occur in nature. Examples of genetic manipulation include the use of gene editing systems, such as CRISPR / Cas, piggyBac, TALEN, and / or zinc finger systems, to disrupt the expression of one or more gene targets in a cell (e.g., to reduce or eliminate expression) or to increase expression in the cell (e.g., by inserting a gene of interest). "Genetically engineered," "genetically modified," or "genetically modified" cells, as used herein, refer to genetically engineered cells or cells derived and / or derived from genetically engineered cells. For example, genetically engineered stem cell-derived SC islet cells are considered genetically engineered SC islets.

[0109] In some embodiments, "ABO," as used herein, is a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1. In some embodiments, "ABO" is a protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:2.

[0110] In some embodiments, "renalase," as used herein, is a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 3 or 5. In some embodiments, "renalase" is a protein that comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 4 and / or 6.

[0111] In some embodiments, "CXCL10," as used herein, is a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 7. In some embodiments, "CXCL10" is a protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 8.

[0112] In some embodiments, "beta-2 microglobulin" or "B2M," as used herein, is a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 9. In some embodiments, "B2M" is a protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 10.

[0113] In some embodiments, "tissue factor," as used herein, is a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 11. In some embodiments, "tissue factor" is a protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 12.

[0114] In some embodiments, "CD47," as used herein, is a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 13 or 15. In some embodiments, "CD47" is a protein that comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 145, and / or SEQ ID NO: 146. stem cells

[0115] The term "stem cell" is used herein to refer to a mammalian cell that has both the capacity for self-renewal and the ability to generate differentiated cell types (Morrison et al. (1997) Cell 88:287-298). In the context of cellular ontogeny, the adjectives "differentiated" or "differentiating" are relative terms. A "differentiated cell" is a cell that has progressed further down the developmental pathway than the cell to which it is being compared. Thus, pluripotent stem cells can differentiate into lineage-restricted progenitor cells (e.g., mesodermal stem cells), and lineage-restricted progenitor cells can also differentiate into further restricted cells (e.g., neuronal progenitor cells), which can differentiate into end-stage cells (i.e., terminally differentiated cells, e.g., neurons, cardiomyocytes, etc.), which may or may not retain the ability to fulfill roles characteristic of a particular tissue type and further proliferate. Stem cells can be characterized by both the presence and absence of certain markers (e.g., proteins, RNA, etc.). Stem cells can also be identified by both in vitro and in vivo functional assays, particularly assays relating to the ability of stem cells to give rise to multiple differentiated progeny. In certain embodiments, the host cells are adult stem cells, somatic stem cells, non-embryonic stem cells, embryonic stem cells, hematopoietic stem cells, induced pluripotent stem cells, and trophoblast stem cells. In some embodiments, the stem cell line is naturally an O blood type cell line (i.e., the cell line is not genetically engineered to be an O blood type cell line). In some embodiments, the stem cell line is naturally an Rh blood type cell line. - (rhesus factor negative) cell line. In some embodiments, the cells comprise a gene disruption in the RHD gene. In some embodiments, the cells do not comprise a gene disruption in the RHD gene. In some embodiments, the cells comprise a gene disruption in the RHCE gene. In some embodiments, the cells do not comprise a gene disruption in the RHCE gene.

[0116] The stem cells of interest include pluripotent stem cells (PSCs). The term "pluripotent stem cells" or "PSCs" is used herein to mean stem cells that can produce all cell types of an organism. Thus, PSCs can become cells of all germ layers of an organism (e.g., endoderm, mesoderm, and ectoderm of vertebrates). Pluripotent cells can form teratomas and contribute to ectoderm, mesoderm, and endoderm tissues in living organisms. Plant pluripotent stem cells can become all cell types of a plant (e.g., cells of roots, stems, leaves, etc.).

[0117] Animal PSCs can be derived in a number of different ways. For example, embryonic stem cells (ESCs) are derived from the inner cell mass of an embryo (Thomson et al., Science. 1998 Nov. 6; 282(5391):1145-7), while induced pluripotent stem cells (iPSCs) are derived from somatic cells (Takahashi et al., Cell. 2007 Nov. 30; 131(5):861-72; Takahashi et al., Nat Protoc. 2007; 2(12):3081-9; Yu et al., Science. 2007 Dec. 21; 318(5858):1917-20. Epub 2007 Nov. 20). The term PSC refers to pluripotent stem cells regardless of their derivation, and therefore encompasses the terms ESC and iPSC, as well as the term embryonic germ stem cells (EGSC), which is another example of a PSC. PSCs can be in the form of established cell lines, PSCs can be obtained directly from primary embryonic tissue, or PSCs can be derived from somatic cells.

[0118] "Embryonic stem cells" (ESCs) refer to PSCs isolated from embryos, typically from the inner cell mass of blastocysts. ESC lines are listed in the NIH Human Embryonic Stem Cell Registry, e.g., hESBGN-01, hESBGN-02, hESBGN-03, and hESBGN-04 (BresaGen, Inc.); HES-1, HES-2, HES-3, HES-4, HES-5, and HES-6 (ES Cell International); Miz-hESI (MizMedi Hospital-Seoul National University); HSF-1 and HSF-6 (University of California at San Francisco); and H1, H7, H9, H13, and H14 (Wisconsin Alumni Research Foundation (WiCell Research Institute)). In some embodiments, the ESCs are the Cyt49 (CVCL_B850) cell line. The stem cells of interest also include embryonic stem cells from other primates, such as rhesus monkey stem cells and marmoset stem cells.Stem cells can be obtained from any mammalian species, such as humans, equines, bovines, pigs, canines, felines, rodents, such as mice, rats, hamsters, primates, etc. (Thomson et al. (1998) Science 282:1145; Thomson et al. (1995) Proc. Natl. Acad. Sci USA 92:7844; Thomson et al. (1996) Biol. Reprod. 55:254; Shamblott et al., Proc. Natl. Acad. Sci. USA 95:13726, 1998).In a preferred embodiment, stem cells are human stem cells. In culture, ESCs typically grow as flat colonies with large nucleo-cytoplasmic ratios, distinct borders, and prominent nucleoli. In addition, ESCs express SSEA-3, SSEA-4, TRA-1-60, TRA-1-81, and alkaline phosphatase, but not SSEA-1.Examples of methods for generating and characterizing ESCs can be found, for example, in U.S. Patent Nos. 7,029,913, 5,843,780, and 6,200,806, each of which is incorporated herein in its entirety. Methods for propagating undifferentiated hESCs are described in WO99 / 20741, WO01 / 51616, and WO03 / 020920, each of which is incorporated herein in its entirety. In some embodiments, the ESC cell line is naturally an O blood type cell line (i.e., the cell line is not genetically engineered to be an O blood type cell line). In some embodiments, the ESC cell line is naturally an Rh. - (rhesus factor negative) cell line. In some embodiments, the cells comprise a gene disruption in the RHD gene. In some embodiments, the cells do not comprise a gene disruption in the RHD gene. In some embodiments, the cells comprise a gene disruption in the RHCE gene. In some embodiments, the cells do not comprise a gene disruption in the RHCE gene.

[0119] "Embryonic germ stem cells" (EGSCs) or "embryonic germ cells" or "EG cells" refer to PSCs derived from germ cells and / or germ cell precursor cells, e.g., primordial germ cells, i.e., those capable of giving rise to sperm and eggs. Embryonic germ cells (EG cells) are believed to have similar properties to the embryonic stem cells described above. Examples of methods for generating and characterizing EG cells can be found, for example, in U.S. Patent No. 7,153,684; Matsui, Y., et al., (1992) Cell 70:841; Shamblott, M., et al. (2001) Proc. Natl. Acad. Sci. USA 98: 113; Shamblott, M., et al. (1998) Proc. Natl. Acad. Sci. USA, 95:13726; and Koshimizu, U., et al. (1996) Development, 122:1235, each of which references is incorporated herein in its entirety.

[0120] "Induced pluripotent stem cells" or "iPSCs" refer to PSCs derived from cells that are not PSCs (i.e., cells that are more differentiated than PSCs). iPSCs can be derived from multiple different cell types, including terminally differentiated cells. iPSCs have an ES cell-like morphology, growing as flat colonies with a large nucleo-cytoplasmic ratio, distinct borders, and prominent nucleoli. In addition, iPSCs express one or more essential pluripotency markers known to those skilled in the art, including, but not limited to, alkaline phosphatase, SSEA3, SSEA4, Sox2, Oct3 / 4, Nanog, TRA160, TRA181, TDGF 1, Dnmt3b, FoxD3, GDF3, Cyp26a1, TERT, and zfp42. Examples of methods for generating and characterizing iPSCs can be found, for example, in U.S. Patent Application Publication Nos. 20090047263, 20090068742, 20090191159, 20090227032, 20090246875, and 20090304646, each of which is incorporated herein in its entirety. Generally, to generate iPSCs, somatic cells are provided with reprogramming factors known in the art for reprogramming somatic cells to become pluripotent stem cells (e.g., Oct4, SOX2, KLF4, MYC, Nanog, Lin28, etc.).

[0121] "Somatic cells" refer to any cell in an organism that does not normally give rise to all cell types in the organism in the absence of experimental manipulation. In other words, somatic cells are fully differentiated cells that do not naturally give rise to cells of all three germ layers of the body, i.e., endoderm, mesoderm, and ectoderm. For example, somatic cells can include both neurons and neural progenitor cells, the latter of which can naturally give rise to all or some cell types of the central nervous system but cannot give rise to cells of the mesodermal or endodermal lineages.

[0122] In certain instances, stem cells may be undifferentiated (e.g., cells not committed to a particular lineage) before exposure to at least one beta cell maturation factor according to the methods disclosed herein, while in other instances, it may be desirable to differentiate stem cells into one or more intermediate cell types before exposure to at least one cell maturation factor described herein. For example, stem cells may exhibit morphological, biological, or physical characteristics of undifferentiated cells, and these characteristics can be used to distinguish undifferentiated cells from differentiated cells of embryonic or adult origin. In some instances, undifferentiated cells may appear in two-dimensional micrographs as colonies of cells with a high nuclear-to-cytoplasmic ratio and prominent nucleoli. Stem cells may be on their own (e.g., substantially absent any undifferentiated cells) or may be used in the presence of differentiated cells. In certain instances, stem cells may be cultured in the presence of suitable nutrients and, if necessary, other cells, so that the stem cells can grow and, if necessary, differentiate. For example, embryonic fibroblasts or fibroblast-like cells may be present in the culture to support stem cell growth. Fibroblasts may be present during one stage of stem cell development, but not necessarily during all stages. For example, fibroblasts may be added to a stem cell culture at an initial culture stage and not be added to the stem cell culture at one or more subsequent culture stages.

[0123] The stem cells used in all aspects of the present disclosure can be any cells derived from any type of tissue (e.g., embryonic tissue, e.g., fetal or prefetal tissue, or adult tissue), and these stem cells have the characteristic that, under appropriate conditions, they can produce progeny of different cell types, e.g., derivatives of at least one of all three germ layers (endoderm, mesoderm, and ectoderm). These cell types can be provided in the form of established cell lines, or they can be obtained directly from primary embryonic tissue and immediately used for differentiation. Included are cells listed in the NIH Human Embryonic Stem Cell Registry, e.g., hESBGN-01, hESBGN-02, hESBGN-03, hESBGN-04 (BresaGen, Inc.); HES-1, HES-2, HES-3, HES-4, HES-5, HES-6 (ES Cell International); Miz-hESI (MizMedi Hospital-Seoul National University); HSF-1, FISF-6 (University of California at San Francisco); and H1, H7, H9, H13, H14 (Wisconsin Alumni Research Foundation (WiCell Research Institute)). In some embodiments, the source of human stem cells or pluripotent stem cells used for chemically induced differentiation into mature, insulin-positive cells did not involve the destruction of a human embryo.

[0124] In another embodiment, stem cells can be isolated from tissues, including solid tissues. In some embodiments, the tissue is skin, fat tissue (e.g., adipose tissue), muscle tissue, heart or cardiac tissue. In other embodiments, the tissue is, for example, but not limited to, umbilical cord blood, placenta, bone marrow, or cartilage.

[0125] Stem cells of interest also include various types of embryonic cells, exemplified by human embryonic stem (hES) cells described by Thomson et al. (1998) Science 282:1145; embryonic stem cells from other primates, e.g., rhesus stem cells (Thomson et al. (1995) Proc. Natl. Acad. Sci. USA 92:7844); marmoset stem cells (Thomson et al. (1996) Biol. Reprod. 55:254); and human embryonic germ (hEG) cells (Shambloft et al., Proc. Natl. Acad. Sci. USA 95:13726, 1998). Lineage-committed stem cells, such as mesodermal stem cells and other early cardiac progenitor cells (see, e.g., Reyes et al., (2001) Blood 98:2615-2625; Eisenberg & Bader (1996) Circ Res. 78(2):205-16), are also stem cells of interest. Stem cells can be obtained from any mammalian species, e.g., humans, equines, bovines, porcines, canines, felines, rodents, e.g., mice, rats, hamsters, primates, etc. In some embodiments, human embryos were not destroyed for the source of pluripotent cells used in the methods and compositions disclosed herein.

[0126] A mixture of cells from suitable endothelial, muscle and / or neural stem cell sources can be collected from mammalian donors by methods known in the art. A suitable source is the hematopoietic microenvironment. For example, circulating peripheral blood, preferably mobilized (i.e., supplemented) circulating peripheral blood, can be removed from a subject. In some embodiments, stem cells can be reprogrammed stem cells, such as stem cells derived from somatic cells or differentiated cells. In such embodiments, dedifferentiated stem cells can be, for example, neoplastic cells, tumor cells and cancer cells, or alternatively, induced reprogrammed cells, such as, but not limited to, induced pluripotent stem cells or iPS cells.

[0127] In some embodiments, SC-beta cells are selected from the group consisting of trichocytes, keratinocytes, gonadotrophs, corticotrophs, thyrotrophs, somatotrophs, mammotrophs, chromaffin cells, parafollicular cells, glomus cells, melanocytes, nevus cells, Merkel cells, odontoblasts, cementoblasts, keratocytes, retinal Müller cells, retinal pigment epithelial cells, neurons, glial cells (e.g., oligodendrocytes), and the like. cells, astrocytes), ependymal cells, pineal cells, lung cells (e.g., type I pneumocytes and type II pneumocytes), Clara cells, goblet cells, G cells, beta cells, ECL cells, gastric chief cells, parietal cells, pit cells, K cells, beta cells, I cells, goblet cells, Paneth cells, enterocytes, fold cells, hepatocytes, hepatic stellate cells (e.g., Kupffer cells from the mesoderm), gallbladder cells, acinar center cells, pancreatic stellate cells, pancreatic alpha cells, pancreatic beta cells, pancreatic delta cells, pancreatic F cells (e.g., PP cells), pancreatic epsilon cells, turbinates, Cells include follicular glands (e.g., follicular cells), parathyroid glands (e.g., parathyroid chief cells), eosinophilic cells, urothelium, osteoblasts, osteocytes, chondroblasts, chondrocytes, fibroblasts, fibrocytes, myoblasts, myocytes, muscle satellite cells, tenocytes, cardiomyocytes, lipoblasts, adipocytes, interstitial cells of Cajal, angioblasts, endothelial cells, mesangial cells (e.g., intraglomerular mesangial cells and extraglomerular mesangial cells), juxtaglomerular cells, macula densa cells, stromal cells, interstitial cells, telocellular carcinomas, and thyroid carcinomas. The cells can be derived from one or more of: blasts, simple epithelial cells, podocytes, renal proximal tubule brush border cells, Sertoli cells, Leydig cells, granulosa cells, PEG cells, germ cells, sperm, ovums, lymphocytes, myeloid cells, endothelial progenitor cells, endothelial stem cells, hemangioblasts, mesoangioblasts, pericytes, mural cells, splenocytes (e.g., T lymphocytes, B lymphocytes, dendritic cells, microphages, leukocytes), trophoblast stem cells, or any combination thereof. SC Island

[0128] In some embodiments, any of the genetically engineered cells disclosed herein are SC islet cells. In some embodiments, the SC islet cells are NKX6.1 + / ISL1 + In some embodiments, the SC islet cells are NKX6.1 - / ISL1 + In some embodiments, the SC islet cells are NKX6.1 + / ISL1 - In some embodiments, the SC islet cells are naturally Rh blood group cells. In some embodiments, the SC islet cells express insulin. In some embodiments, the SC islet cells express glucagon. In some embodiments, the SC islet cells express somatostatin. In some embodiments, the SC islet cells are naturally Rh blood group cells (i.e., the SC islet cells or their precursor cells were not genetically engineered to be an O blood group cell line). In some embodiments, the SC islet cells are naturally Rh blood group cells. - (rhesus factor negative) cells. In some embodiments, the cells comprise a gene disruption in the RHD gene. In some embodiments, the cells do not comprise a gene disruption in the RHD gene. In some embodiments, the cells comprise a gene disruption in the RHCE gene. In some embodiments, the cells do not comprise a gene disruption in the RHCE gene.

[0129] In some embodiments, the present disclosure provides compositions comprising a population of genetically engineered SC islet cells, in some embodiments, the compositions comprise 50%, 40%, 30%, or 20% or more NKX6.1 + / ISL1 + In some embodiments, the composition comprises NKX6.1-positive, ISL1-positive cells (e.g., as determined by flow cytometry). In some embodiments, 30% or more of the cells in the composition are NKX6.1-positive, ISL1-positive cells; 25% or more of the cells in the composition are NKX6.1-negative, ISL1-positive cells; less than 12% of the cells in the composition are NKX6.1-negative, ISL1-negative cells; or between 9-25% of the cells in the composition are NKX6.1-positive, ISL1-negative cells (e.g., as determined by flow cytometry). In some embodiments, 40%, 35%, 30%, 26%, 25%, or 20% or more of the cells in the composition are NKX6.1-positive, ISL1-negative cells. - / ISL1 + In some embodiments, 26% or more of the cells in the composition are NKX6.1 cells (e.g., as determined by flow cytometry). - / ISL1 +In some embodiments, between 5-25%, between 5-40%, between 5-35%, or between 8-20% of the cells in the composition are NKX6.1 cells (e.g., as determined by flow cytometry). - / ISL1 + In some embodiments, no more than 50%, 45%, 40%, 35%, 30%, or 25% of the cells in the composition are NKX6.1 cells (e.g., as determined by flow cytometry). + / ISL1 - In some embodiments, 50% or less of the cells in the composition are NKX6.1 cells (e.g., as determined by flow cytometry). + / ISL1 - cells (e.g., as determined by flow cytometry).

[0130] In some embodiments, less than 12% (e.g., about 11%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, about 1%, or less) of the cells in the population are NKX6.1-negative, ISL1-negative cells. In some embodiments, less than 10%, less than 8%, less than 6%, less than 4%, or between 1% and 11%, 2% and 10%, 2% and 12%, 4% and 12%, 6% and 12%, 8% and 12%, 2% and 8%, 4% and 8%, 3% and 6%, or 3% and 5% of the cells in the population are NKX6.1-negative, ISL1-negative cells. In some embodiments, 2% to 12%, 4% to 12%, 6% to 12%, 8% to 12%, 2% to 8%, 4% to 8%, 3% to 6%, or 3% to 5% of the cells in the population are NKX6.1-negative, ISL1-negative cells.

[0131] In some embodiments, at least 15% (e.g., about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, or more) of the cells in the population are NKX6.1-negative, ISL1-positive cells. In some embodiments, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, or 15%-60%, 15%-45%, 15%-30%, 30%-60%, 30%-45%, or 45%-60% of the cells in the population are NKX6.1-negative, ISL1-positive cells. In some embodiments, 20% to 60%, 20% to 50%, 20% to 40%, 20% to 30%, 30% to 60%, 30% to 50%, 30% to 40%, 40% to 60%, 40% to 50%, or 50% to 60% of the cells in the population are NKX6.1-negative, ISL1-positive cells.

[0132] In some embodiments, at least 15% of the cells in the population (e.g., 20% to 60%, 20% to 50%, 20% to 40%, 20% to 30%, 30% to 60%, 30% to 50%, 30% to 40%, 40% to 60%, 40% to 50%, or 50% to 60%) are NKX6.1-negative, ISL1-positive cells, and less than 12% of the cells in the population (e.g., 2% to 12%, 4% to 12%, 6% to 12%, 8% to 12%, 2% to 8%, 4% to 8%, 3% to 6%, or 3% to 5%) are NKX6.1-negative, ISL1-negative cells.

[0133] In some embodiments, at least 60%, at least 65%, at least 70%, at least 73%, at least 74%, at least 75%, at least 80%, at least 85%, at least 90%, about 85-95%, or about 90-95% of the cells in the population are ISL1-positive cells. In some embodiments, 50-90%, 50-85%, 50-80%, 50-75%, 50-70%, 50-60%, 60-90%, 60-85%, 60-80%, 60-75%, 60-70%, 65-90%, 65-85%, 65-80%, 65-75%, 65-70%, 70-90%, 70-85%, 70-80%, 70-75%, 75-90%, 75-85%, 75-80%, 80-90%, 80-85%, or 85-90% of the cells in the population are ISL1-positive cells. In some embodiments, at least 74%, at least 75%, at least 80%, at least 85%, at least 90%, about 85-95%, or about 90-95% of the cells in the population are ISL1-positive cells, or about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or about 99% of the cells in the population are ISL1-positive cells.

[0134] In some embodiments, a population of in vitro differentiated cells described herein comprises more NKX6.1-negative, ISL1-positive cells than NKX6.1-positive, ISL1-positive cells. In some embodiments, at least 40% of the cells in the population are NKX6.1-negative, ISL1-positive cells. In some embodiments, at least 45%, at least 50%, about 40-50%, about 45-55%, or about 50-55% of the cells in the population are NKX6.1-negative, ISL1-positive cells. In some embodiments, about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or about 55% of the cells in the population are NKX6.1-negative, ISL1-positive cells.

[0135] In some embodiments, at least 20% (e.g., at least 20%, at least 30%, at least 40%, at least 50%, at least 50%, at least 60%, or more) of the ISL1-positive cells are NKX6.1-negative. In some embodiments, about 20%-60%, 20%-50%, 20%-40%, 20%-30%, 30%-60%, 30%-50%, 30%-40%, 40%-60%, 40%-50%, or 50%-60% of the ISL1-positive cells are NKX6.1-negative. In some embodiments, about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or more of the ISL1-positive cells are NKX6.1-negative.

[0136] In some embodiments, at least 20% (e.g., at least 20%, at least 30%, at least 40%, at least 50%, at least 50%, at least 60%, or more) of the cells in the composition are ISL1-positive and NKX6.1-positive. In some embodiments, about 20%-60%, 20%-50%, 20%-40%, 20%-30%, 30%-60%, 30%-50%, 30%-40%, 40%-60%, 40%-50%, or 50%-60% of the cells in the composition are ISL1-positive and NKX6.1-positive. In some embodiments, about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or more of the cells in the composition are ISL1-positive and NKX6.1-positive.

[0137] In some embodiments, at least 20% (e.g., at least 20%, at least 30%, at least 40%, at least 50%, at least 50%, at least 60%, or more) of the cells in the composition are ISL1-positive and NKX6.1-negative. In some embodiments, about 20%-60%, 20%-50%, 20%-40%, 20%-30%, 30%-60%, 30%-50%, 30%-40%, 40%-60%, 40%-50%, or 50%-60% of the cells in the composition are ISL1-positive and NKX6.1-negative. In some embodiments, about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or more of the cells in the composition are ISL1-positive and NKX6.1-negative.

[0138] In some embodiments, a population of in vitro differentiated cells described herein comprises up to 20% (e.g., up to 20%, up to 30%, up to 40%, or up to 50%) NXK6.1-positive, ISL1-positive cells. In some embodiments, a population of in vitro differentiated cells described herein comprises about 20%-50%, 20%-40%, 20%-30%, 30%-50%, 30%-40%, or 40%-50% NXK6.1-positive, ISL1-positive cells. In some embodiments, a population of in vitro differentiated cells described herein comprises about 20%-50%, 20%-40%, 20%-30%, 30%-50%, 30%-40%, or 40%-50% NXK6.1-positive, ISL1-positive cells.

[0139] In some embodiments, the NKX6.1-positive, ISL1-positive cells also express PDX1. In some embodiments, the NKX6.1-positive, ISL1-positive cells also express insulin. In some embodiments, the NKX6.1-positive, ISL1-positive cells also express C-peptide. In some embodiments, the NKX6.1-positive, ISL1-positive cells also express chromogranin A.

[0140] In some embodiments, the disclosure provides a composition comprising a plurality of genetically engineered cells (e.g., a composition comprising a cluster of cells or a plurality of clusters of cells), wherein 30-60%, 30-55%, 30-50%, 30-45%, 30-40%, 30-35%, 35-60%, 35-55%, 35-50%, 35-45%, 35-40%, 40-60%, 40-55%, 40-50%, 40-45%, 45-60%, 45-55%, 45-50%, 50-60%, or 50-55% of the cells in the composition are NKX6.1-positive, ISL1-positive cells, and 20-50%, 20-45%, 20-40%, 20-35%, 20-30%, 20-25% of the cells in the composition are NKX6.1-positive, ISL1-positive cells. , 25-50%, 25-45%, 25-40%, 25-35%, 25-30%, 30-50%, 30-45%, 30-40%, 30-35%, 35-50%, 35-35%, 35-40%, 40-50%, 40-45%, or 45-50% of the cells in the composition are NKX6.1-negative, ISL1-positive cells, and 1-12%, 1- In some embodiments, the present disclosure provides compositions comprising 10%, 1-8%, 1-6%, 1-4%, 3-5%, 1-2%, 2-12%, 2-10%, 2-8%, 2-6%, 2-4%, 4-12%, 4-10%, 4-8%, 4-6%, 6-12%, 6-10%, 6-8%, 8-12%, 8-10%, or 10-12% NKX6.1-negative, ISL1-negative cells. In some embodiments, the present disclosure provides compositions comprising a plurality of genetically engineered cells (e.g., a cluster of cells or a composition comprising multiple clusters of cells), wherein 35-50% of the cells in the composition are NKX6.1-positive, ISL1-positive cells, 30-45% of the cells in the composition are NKX6.1-negative, ISL1-positive cells, or 2-12% of the cells in the composition are NKX6.1-negative, ISL1-negative cells. In some embodiments, between 3-25%, between 3-20%, between 3-15%, between 3-10%, between 3-5%, between 5-25%, between 5-20%, between 5-15%, between 5-10%, between 10-25%, between 10-20%, between 10-15%, between 15-25%, between 15-20%, or between 20-25% of the cells in the composition are NKX6.1-positive, ISL1-negative cells.

[0141] In some embodiments, the present disclosure provides a composition comprising a plurality of genetically engineered cells (e.g., a composition comprising a cluster of cells or a plurality of clusters of cells), wherein at least 30% of the cells in the composition are NKX6.1-positive, ISL1-positive cells, at least 25% of the cells in the composition are NKX6.1-negative, ISL1-positive cells, and between 9-25% of the cells in the composition are NKX6.1-positive, ISL1-negative cells. In some embodiments, the disclosure provides a composition comprising a plurality of genetically engineered cells (e.g., a composition comprising a cluster of cells or a plurality of clusters of cells), wherein 30-60%, 30-55%, 30-50%, 30-45%, 30-40%, 30-35%, 35-60%, 35-55%, 35-50%, 35-45%, 35-40%, 40-60%, 40-55%, 40-50%, 40-45%, 45-60%, 45-55%, 45-50%, 50-60%, or 50-55% of the cells in the composition are NKX6.1-positive, ISL1-positive cells; and 20-50%, 20-45%, 20-40%, 20-35%, 20-30%, 20-25%, 25-50%, 25-45%, 25-40%, 25-35%, 25-30%, 30-50%, 30-45%, 30-40%, 30-35%, 35-50%, 35-35%, 35-40%, 40-50%, 40-45%, or 45-50% are NKX6.1-negative, ISL1-positive cells The present invention provides a composition wherein 9-30%, 9-25%, 9-20%, 9-15%, 9-12%, 12-30%, 12-25%, 12-20%, 12-15%, 15-30%, 15-25%, 15-20%, 20-30%, 20-25%, or 25-30% of the cells in the composition are NKX6.1-positive, ISL-negative cells. In some embodiments, 1-12%, 1-10%, 1-8%, 1-6%, 1-4%, 3-5%, 1-2%, 2-12%, 2-10%, 2-8%, 2-6%, 2-4%, 4-12%, 4-10%, 4-8%, 4-6%, 6-12%, 6-10%, 6-8%, 8-12%, 8-10%, or 10-12% of the cells in the composition are NKX6.1-negative, ISL1-negative cells.In some embodiments, the present disclosure provides a composition comprising a plurality of genetically engineered cells (e.g., a composition comprising a cluster of cells or a plurality of clusters of cells), wherein 35-50% of the cells in the composition are NKX6.1-positive, ISL1-positive cells, 30-45% of the cells in the composition are NKX6.1-negative, ISL1-positive cells, and 9-25% of the cells in the composition are NKX6.1-positive, ISL1-negative cells.

[0142] In some embodiments, less than 12% (e.g., about 11%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, about 1%, or less) of the cells in the composition are NKX6.1-negative, ISL1-negative cells. In some embodiments, less than 10%, less than 8%, less than 6%, less than 4%, or between 1% and 11%, 2% and 10%, 2% and 12%, 4% and 12%, 6% and 12%, 8% and 12%, 2% and 8%, 4% and 8%, 3% and 6%, or 3% and 5% of the cells in the composition are NKX6.1-negative, ISL1-negative cells. In some embodiments, 2% to 12%, 4% to 12%, 6% to 12%, 8% to 12%, 2% to 8%, 4% to 8%, 3% to 6%, or 3% to 5% of the cells in the population are NKX6.1-negative, ISL1-negative cells.

[0143] In some embodiments, at least 15% (e.g., about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, or more) of the cells in the composition are NKX6.1-negative, ISL1-positive cells. In some embodiments, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, 15%-60%, 15%-45%, 15%-30%, 30%-60%, 30%-45%, or 45%-60% of the cells in the composition are NKX6.1-negative, ISL1-positive cells. In some embodiments, 20% to 60%, 20% to 50%, 20% to 40%, 20% to 30%, 30% to 60%, 30% to 50%, 30% to 40%, 40% to 60%, 40% to 50%, or 50% to 60% of the cells in the composition are NKX6.1-negative, ISL1-positive cells.

[0144] In some embodiments, at least 15% (e.g., 20% to 60%, 20% to 50%, 20% to 40%, 20% to 30%, 30% to 60%, 30% to 50%, 30% to 40%, 40% to 60%, 40% to 50%, or 50% to 60%) of the cells in the composition are NKX6.1-negative, ISL1-positive cells, and less than 12% (e.g., 2% to 12%, 4% to 12%, 6% to 12%, 8% to 12%, 2% to 8%, 4% to 8%, 3% to 6%, or 3% to 5%) of the cells in the composition are NKX6.1-negative, ISL1-negative cells.

[0145] In some embodiments, at least 60%, at least 65%, at least 70%, at least 73%, at least 74%, at least 75%, at least 80%, at least 85%, at least 90%, about 85-95%, or about 90-95% of the cells in the composition are ISL1-positive cells. In some embodiments, 50-90%, 50-85%, 50-80%, 50-75%, 50-70%, 50-60%, 60-90%, 60-85%, 60-80%, 60-75%, 60-70%, 65-90%, 65-85%, 65-80%, 65-75%, 65-70%, 70-90%, 70-85%, 70-80%, 70-75%, 75-90%, 75-85%, 75-80%, 80-90%, 80-85%, or 85-90% of the cells in the composition are ISL1-positive cells. In some embodiments, at least 74%, at least 75%, at least 80%, at least 85%, at least 90%, about 85-95%, or about 90-95% of the cells in the composition are ISL1-positive cells. In some embodiments, about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or about 99% of the cells in the composition are ISL1-positive cells.

[0146] In some embodiments, the composition comprises that more NKX6.1-positive, ISL1-positive cells than NKX6.1-negative, ISL1-positive cells. In some embodiments, at least 40% of the cells in the composition are NKX6.1-negative, ISL1-positive cells. In some embodiments, at least 45%, at least 50%, about 40-50%, about 45-55%, or about 50-55% of the cells in the composition are NKX6.1-negative, ISL1-positive cells. In some embodiments, about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or about 55% of the cells in the composition are NKX6.1-negative, ISL1-positive cells.

[0147] In some embodiments, at least 20% (e.g., at least 20%, at least 30%, at least 40%, at least 50%, at least 50%, at least 60%, or more) of the ISL1-positive cells are NKX6.1-negative. In some embodiments, about 20%-60%, 20%-50%, 20%-40%, 20%-30%, 30%-60%, 30%-50%, 30%-40%, 40%-60%, 40%-50%, or 50%-60% of the ISL1-positive cells are NKX6.1-negative. In some embodiments, about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or more of the ISL1-positive cells are NKX6.1-negative.

[0148] In some embodiments, the composition comprises at least 20% (e.g., at least 20%, 30%, 40%, 50%, or 60%) NXK6.1-positive, ISL1-positive cells. In some embodiments, the composition comprises about 20% to 50%, 20% to 40%, 20% to 30%, 30% to 50%, 30% to 40%, 40% to 50%, 40% to 60%, or 50% to 60% NXK6.1-positive, ISL1-positive cells. In some embodiments, the composition comprises about 20% to 50%, 20% to 40%, 20% to 30%, 30% to 50%, 30% to 40%, or 40% to 50% NXK6.1-positive, ISL1-positive cells.

[0149] In some embodiments, the composition comprises less than 25% (e.g., less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, or less) NKX6.1-positive, ISL1-negative cells. In some embodiments, the composition comprises about 2%-25%, 2%-20%, 2%-15%, 2%-10%, 2%-5%, 5%-25%, 5%-20%, 5%-15%, 5%-10%, 10%-25%, 10%-20%, 10%-15%, 15%-25%, 15%-20%, or 20%-25% NKX6.1-positive, ISL1-negative cells. In some embodiments, the composition comprises about 2%-10%, 2%-8%, 2%-6%, 2%-4%, 4%-10%, 4%-8%, 4%-6%, 6%-10%, 6%-8%, or 8%-10% NKX6.1-positive, ISL1-negative cells. In some embodiments, the composition comprises about 2%, 4%, 6%, 8%, or 10% NKX6.1-positive, ISL1-negative cells.

[0150] In some embodiments, the composition comprises less than 10% SOX9-positive cells. In some embodiments, the composition comprises less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% SOX9-positive cells. In some embodiments, the composition comprises 0.1-10%, 0.1-7%, 0.1-3%, 0.1-1%, 0.5-10%, 0.5-7%, 0.5-3%, 0.5-1%, 1-10%, 1-5%, 1-3%, 3-10%, 3-5%, or 5-10% SOX9-positive cells.

[0151] In some embodiments, the composition comprises less than 5% Ki67-positive cells. In some embodiments, the composition comprises less than 5%, 4%, 3%, 2%, or 1% Ki67-positive cells. In some embodiments, the composition comprises 0.01-0.1%, 0.1-5%, 0.1-3%, 0.1-1%, 0.5-5%, 0.5-3%, 0.5-1%, 1-5%, 1-3%, or 1-2% Ki67-positive cells.

[0152] In some embodiments, at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the cells in the composition are CHGA-positive cells, or 80-100%, 85-100%, 90-100%, 90-99%, 90-98%, 95-99%, or 95-99% of the cells in the composition are CHGA-positive cells.

[0153] In some embodiments, the percentage of cells expressing the markers provided herein is measured by flow cytometry.Those skilled in the art are familiar with typical methods for testing whether a cell or a collection of cells is positive or negative for the expression of specific gene markers (e.g., NKX6.1, ISL1, INS, GCG, somatostatin, chromogranin A, SOX9, C-peptide, Ki67) by flow cytometry.In some embodiments, cells are considered positive for the expression of specific genes (e.g., NKX6.1, ISL1, INS, GCG, somatostatin, chromogranin A, SOX9, C-peptide, Ki67) based on median fluorescence intensity (rMFI). As used herein, the term "rMFI" or relative median fluorescence intensity is the ratio of the fluorescence intensity measured using an antibody against a specific target (e.g., NKX6.1, ISL1, INS, GCG, somatostatin, chromogranin A, SOX9, C-peptide, Ki67) to the intensity obtained from a control antibody (isotype control). In some embodiments, an anti-(human) NKX6.1, ISL1, INS, GCG, somatostatin, chromogranin A, or SOX9 antibody is used. Examples of antibodies suitable for use in flow cytometry are any of the antibodies disclosed in Table 1. An example of a suitable flow cytometer is the Accuri 6 flow cytometer. In some embodiments, target-expressing cells (e.g., cells expressing NKX6.1 and / or ISL1), when tested, exhibit a target relative medium fluorescence intensity (rMFI) of at least 6, 6.5, 7, 8, 9, or 10 as measured by flow cytometry. In another embodiment, the rMFI is between 6.5 and 15, between 6.5 and 14, between 6.5 and 13, between 6.5 and 13, between 6.5 and 12, or between 6.5 and 10.

[0154] In some embodiments, the percentage of cells that express the markers provided herein is measured by qRT-PCR.In some embodiments, the percentage of cells that express the markers provided herein is measured by single-cell RNA sequencing analysis.Those skilled in the art know how to test whether cell or cell collection is positive for the expression of specific gene markers (for example, NKX6.1, ISL1, INS, GCG, ARX or ghrelin) by single-cell RNA sequencing analysis.

[0155] In some embodiments, a population of genetically engineered cells described herein comprises less than 25% (e.g., less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, or less) NKX6.1-positive, ISL1-negative cells. In some embodiments, a population of genetically engineered cells described herein comprises about 2%-25%, 2%-20%, 2%-15%, 2%-10%, 2%-5%, 5%-25%, 5%-20%, 5%-15%, 5%-10%, 10%-25%, 10%-20%, 10%-15%, 15%-25%, 15%-20%, or 20%-25% NKX6.1-positive, ISL1-negative cells. In some embodiments, a population of genetically engineered cells described herein comprises about 2%-10%, 2%-8%, 2%-6%, 2%-4%, 4%-10%, 4%-8%, 4%-6%, 6%-10%, 6%-8%, or 8%-10% NKX6.1-positive, ISL1-negative cells. In some embodiments, a population of genetically engineered cells described herein comprises about 2%, 4%, 6%, 8%, or 10% NKX6.1-positive, ISL1-negative cells. [Table 1]

[0156] In some embodiments, a population of genetically engineered cells described herein comprises more NKX6.1-negative, ISL1-positive cells than NKX6.1-positive, ISL1-positive cells. In some embodiments, the population comprises more NKX6.1-positive, ISL1-positive cells than NKX6.1-negative, ISL1-positive cells. In some embodiments, at least 30% or 40% of the cells in the population are NKX6.1-negative, ISL1-positive cells. In some embodiments, at least 45%, at least 50%, about 25-50%, 20-50%, 20-40%, 20-55%, 25-40%, 30-45%, 30-40%, about 40-50%, about 45-55%, or about 50-55% of the cells in the population are NKX6.1-negative, ISL1-positive cells. In some embodiments, about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or about 55% of the cells in the population are NKX6.1-negative, ISL1-positive cells.

[0157] In some embodiments, at least 20% (e.g., at least 20%, at least 30%, at least 40%, at least 50%, at least 50%, at least 60%, or more) of the ISL1-positive cells are NKX6.1-negative. In some embodiments, about 20%-60%, 20%-50%, 20%-40%, 20%-30%, 30%-60%, 30%-50%, 30%-40%, 40%-60%, 40%-50%, or 50%-60% of the ISL1-positive cells are NKX6.1-negative. In some embodiments, about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or more of the ISL1-positive cells are NKX6.1-negative.

[0158] In some embodiments, the population of genetically engineered cells described herein comprises at least 20% (e.g., at least 20%, 30%, 40%, 50%, or 60%) NXK6.1-positive, ISL1-positive cells. In some embodiments, the population of genetically engineered cells described herein comprises about 20%-50%, 20%-40%, 20%-30%, 30%-50%, 30%-40%, 40%-50%, 40%-60%, or 50%-60% NXK6.1-positive, ISL1-positive cells. In some embodiments, the population of genetically engineered cells described herein comprises about 20%-50%, 20%-40%, 20%-30%, 30%-50%, 30%-40%, or 40%-50% NXK6.1-positive, ISL1-positive cells.

[0159] In some embodiments, a population of genetically engineered cells described herein comprises less than 25% (e.g., less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, or less) NKX6.1-positive, ISL1-negative cells. In some embodiments, a population of genetically engineered cells described herein comprises about 2%-25%, 2%-20%, 2%-15%, 2%-10%, 2%-5%, 5%-25%, 5%-20%, 5%-15%, 5%-10%, 10%-25%, 10%-20%, 10%-15%, 15%-25%, 15%-20%, or 20%-25% NKX6.1-positive, ISL1-negative cells. In some embodiments, a population of genetically engineered cells described herein comprises about 2%-10%, 2%-8%, 2%-6%, 2%-4%, 4%-10%, 4%-8%, 4%-6%, 6%-10%, 6%-8%, or 8%-10% NKX6.1-positive, ISL1-negative cells. In some embodiments, a population of genetically engineered cells described herein comprises about 2%, 4%, 6%, 8%, or 10% NKX6.1-positive, ISL1-negative cells.

[0160] In some embodiments, the population of genetically engineered cells described herein comprises ghrelin-positive cells. In some embodiments, the population of genetically engineered cells described herein comprises less than 5% (e.g., less than 5%, less than 3%, less than 2%, less than 1%, or less than 0.5%) ghrelin-positive cells. In some embodiments, the population of genetically engineered cells described herein comprises at least 0.05% (e.g., at least 0.05%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.8%, 1%, 1.2%, 1.5%, 1.8%, 2%, 3%, 4%, or 5%) ghrelin-positive cells. In some embodiments, the population of genetically engineered cells described herein comprises 1-5%, 2-5%, 3-5%, 0.1-5%, 0.1-3%, 0.1-2%, 0.1-1%, 0.5-5%, 0.5-3%, 0.5-2%, 0.5-1%, 0.5-0.8%, 0.05-1%, 0.05-0.7%, or 0.05-2% ghrelin-positive cells.

[0161] In some embodiments, the present disclosure provides compositions comprising genetically engineered NKX6.1-positive, ISL1-positive cells that express lower levels of MAFA than NKX6.1-positive, ISL1-positive cells from the pancreas of a healthy control adult subject or from a cadaver pancreas. In some embodiments, the pharmaceutical composition comprises genetically engineered NKX6.1-positive, ISL1-positive cells that express higher levels of MAFB than NKX6.1-positive, ISL1-positive cells from the pancreas of a healthy control adult subject or from a cadaver pancreas. In some embodiments, the pharmaceutical composition comprises genetically engineered NKX6.1-positive, ISL1-positive cells that express higher levels of SIX2, HOPX, IAPP, and / or UCN3 than NKX6.1-positive, ISL1-positive cells from the pancreas of a healthy control adult subject or from a cadaver pancreas. In some embodiments, the pharmaceutical composition comprises genetically engineered NKX6.1-positive, ISL1-positive cells that do not express MAFA. In some embodiments, the pharmaceutical composition comprises genetically engineered NKX6.1-positive, ISL1-positive cells that express MAFB. In some embodiments, the pharmaceutical composition comprises cells that have been genetically modified (e.g., using gene editing techniques such as CRISPR). In some embodiments, the pharmaceutical composition comprises genetically engineered NKX6.1-positive, ISL1-positive cells that express lower levels of beta-2 microglobulin, CIITA, HLA-A, HLA-B, HLA-C, HLA-DP, HLA-DQ, and HLADR than NKX6.1-positive, ISL1-positive cells from the pancreas of a healthy control adult subject or from a cadaveric pancreas. In some embodiments, the pharmaceutical composition comprises genetically engineered NKX6.1-positive, ISL1-positive cells that express increased levels of CD47, PDL1, HLA-G, CD46, CD55, CD59, and CTLA than NKX6.1-positive, ISL1-positive cells from the pancreas of a healthy control adult subject or from a cadaveric pancreas. In some embodiments, any of the cell markers disclosed herein (e.g., NKX6.1, PDX1, MAFA, MAFB, SIX2, HOPX, IAPP, and / or UCN3) are detected by flow cytometry.

[0162] In some embodiments, any of the cells disclosed herein have not been genetically modified to reduce PDL1 expression. In some embodiments, any of the cells disclosed herein have not been genetically modified to reduce MHC class II protein expression. In some embodiments, any of the cells disclosed herein have not been genetically modified to reduce CIITA protein expression. In some embodiments, any of the genetically modified cells disclosed herein do not have reduced MHC class II protein expression compared to cells of the same type that have not been genetically modified. In some embodiments, any of the genetically modified cells disclosed herein do not have reduced CIITA protein expression compared to cells of the same type that have not been genetically modified. In some embodiments, any of the cells disclosed herein do not contain a genetic alteration in any of the HLA-DR, HLA-DP, or HLA-DQ genes. In some embodiments, any of the cells disclosed herein do not contain a genetic alteration in the CIITA gene.

[0163] In some embodiments, any of the genetically modified cells disclosed herein does not comprise reduced expression of Rh protein antigen expression selected from the group consisting of Rh C antigen, Rh E antigen, Kell K antigen (KEL), Duffy (FY) Fya antigen, Duffy Fy3 antigen, Kidd (JK) Jkb antigen, MNS antigen U, and MNS antigen S, compared to a cell of the same type that has not been genetically modified. In some embodiments, any of the cells disclosed herein does not have a genetic alteration in the RHD and / or RHCE genes.

[0164] In some cases, the cell populations or cell clusters disclosed herein are unsorted, e.g., isolated, cell populations or cell clusters that have not undergone a cell sorting process. In some embodiments, the cell clusters disclosed herein can refer to cell clusters formed by the self-aggregation of cultured cells in a given environment, e.g., in a 3D suspension culture. Cell sorting as described herein can refer to the process of isolating a group of cells from a plurality of cells by relying on differences in cell size, shape (morphology), surface protein expression, endogenous signal protein expression, or any combination thereof. In some cases, cell sorting involves subjecting cells to flow cytometry. Flow cytometry can be a laser-based or impedance-based biophysical technique. During flow cytometry, cells can be suspended in a fluid stream and passed through an electronic detection device. Fluorescence-activated cell sorting (FACS), a type of flow cytometry based on one or more parameters of the optical properties of cells (e.g., emission wavelength upon laser excitation), can be used to physically separate and thereby purify cells of interest. As described herein, an unsorted cell cluster may be a cell cluster formed by a plurality of cells that have not been subjected to an active cell sorting process, such as flow cytometry. In some cases, the flow cytometry discussed herein may be based on one or more signal peptides expressed in the cells. For example, the cell cluster may include cells that express a signal peptide (e.g., a fluorescent protein, such as green fluorescent protein (GFP) or tdTomato). In some cases, the signal peptide is expressed as an indicator of insulin expression in the cells. For example, the cell cluster may include cells that carry an exogenous nucleic acid sequence encoding GFP under the control of an insulin promoter. The insulin promoter may be an endogenous or exogenous promoter. In some cases, the expression of GFP in these cells may indicate insulin expression in the cells. Thus, the GFP signal may be a marker for pancreatic beta cells.In some cases, the cell sorting described herein may involve subjecting cells to a magnetically activated sorting process in which magnetic antibodies or other ligands are used to label different types of cells, and differences in magnetic properties can be used to sort the cells.

[0165] The percentage of cells expressing one or more specific markers, such as PDX1, NKX6.1, insulin, NGN3 or CHGA, as described herein can be a percentage value detected using techniques such as flow cytometry assay.In some cases, during flow cytometry assay, the cell populations or cell clusters described herein are dispersed into a single cell suspension by incubation in a digestive enzyme such as trypsin or TrypLE™ Express.The dispersed cells can be washed with a suitable buffer, such as PBS, centrifuged, and then resuspended in a fixation buffer, such as 4% PFA.The cells can then be incubated with a primary antibody against the cell marker of interest, followed by incubation with a secondary antibody.After antibody incubation, the cells can be washed and subjected to flow cytometry separation.Techniques other than flow cytometry can also be used to characterize the cells described herein, for example, to determine the cell percentage. Non-limiting examples of cell characterization methods include gene sequencing, microscopy techniques (fluorescence microscopy, atomic force microscopy), karyotyping, isoenzyme analysis, DNA characterization, and viral susceptibility.

[0166] In some embodiments, in any of the compositions disclosed herein, at least a portion of the genetically engineered cells in the population of genetically engineered cells are present in multiple cell clusters. In some cases, the cell clusters are about 50 μm to about 500 μm, about 50 μm to about 400 μm, about 50 μm to about 300 μm, about 60 μm to about 400 μm, about 60 μm to about 300 μm, about 60 μm to about 250 μm, about 75 μm to about 400 μm, about 75 μm to about 300 μm, about 75 μm to about 250 μm, about 125 μm to about 225 μm, about 130 μm to about 160 μm, about 170 μm to about 225 μm, about 140 μm to about 200 μm, about 140 μm to about 170 μm, about 160 μm to about 220 μm, about 170 μm to about 215 μm, or about 170 μm to about 200 μm in diameter. In some cases, in the pharmaceutical compositions disclosed herein, the cell population exists as single cell suspension.In some embodiments, in the pharmaceutical compositions disclosed herein, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 98%, or at least 99% of the cells are present in cell clusters.In some embodiments, in the pharmaceutical compositions disclosed herein, substantially all of the cells are present in cell clusters, for example, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, at least 99.9%, at least 99.99%, at least 99.999%, or at least 99.9999% of the cells.

[0167] In some embodiments, the cell clusters are between about 80 and 270 microns in diameter. In some embodiments, the cell clusters are between about 100 and about 250 microns in diameter (e.g., about 125, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 200, about 210, about 215, about 220, or about 225 microns in diameter). For example, in some embodiments, the cell clusters are between about 125 and about 225 microns, between about 130 and about 160 microns, between about 170 and about 225 microns, between about 140 and about 200 microns, between about 140 and about 170 microns, between about 160 and about 220 microns, between about 170 and about 215 microns, or between about 170 and about 200 microns in diameter.

[0168] In some embodiments, the present disclosure provides a composition comprising one or more cell clusters. In some embodiments, the composition comprises 500-20,000, 500-15,000, 500-10,000, 500-5,000, 500-2,000, 500-1,000, 1,000-20,000, 1,000-15,000, 1,000-10,000, 1,000-5,000, 1,000-2,000, 2,000-20,000, 2,000-15,000, 2,000-10,000, 2,000-5,000, 5,000-20,000, 5,000-15,000, 5,000-10,000, 10,000-20,000, 10,000-15,000, 15,000-20,000, or 3,000-9,000 cell clusters. Method for producing pancreatic islet cells

[0169] In certain aspects, the present disclosure relates to compositions and methods for generating endocrine cells from genetically engineered pancreatic progenitor cells or genetically engineered precursors. Certain exemplary detailed protocols for generating endocrine cells to provide at least one SC-β cell are described in U.S. Patent Application Publication Nos. 20150240212, 20150218522, 20210238553, and 2022-0090020, each of which is incorporated herein by reference in its entirety.

[0170] In some embodiments, the methods for generating a population of endocrine cells result in an increased percentage of pancreatic alpha and / or delta cells and a decreased percentage of pancreatic EC cells when generating pancreatic beta cells. In some embodiments, the methods described herein can be used to obtain a population enriched in alpha cells. In some embodiments, the methods described herein can be used to obtain a population enriched in beta cells. In some embodiments, the methods described herein can be used to obtain a population enriched in alpha cells and beta cells. In some embodiments, the methods described herein can be used to obtain an increased yield of pancreatic endocrine cells.

[0171] Successful differentiation of pancreatic β cells requires that the differentiated cells synthesize and secrete physiologically relevant amounts of insulin. Differentiation of hPSCs into hormone-expressing pancreatic endocrine cells is achieved by transitioning hPSCs through key embryonic developmental stages: differentiation into mesendoderm and definitive endoderm, establishment of the gastrula endoderm, patterning of the posterior foregut, and specification and maturation of pancreatic endoderm and endocrine precursors. Through these stages, hPSCs can acquire a pancreatic endocrine phenotype and the ability to secrete glucose-responsive insulin in vitro.

[0172] Generally, at least one pancreatic alpha, beta and / or delta cell or precursor thereof, e.g., pancreatic progenitor cells produced according to the methods disclosed herein, may comprise a mixture or combination of different cells, e.g., a mixture of cells, such as, for example, PDX1-positive pancreatic progenitor cells, pancreatic progenitor cells co-expressing PDX1 and NKX6-1, Ngn3-positive endocrine progenitor cells, insulin-positive endocrine cells (e.g., NKX6.1-positive, ISL1-positive cells, or beta-like cells), and / or other pluripotent or stem cells.

[0173] At least one pancreatic α, β, and / or δ cell or precursor thereof can be produced according to any suitable culture protocol for differentiating stem cells or pluripotent cells to a desired differentiation stage. In some embodiments, at least one pancreatic α, β, and / or δ cell or precursor thereof is produced by culturing at least one pluripotent cell under suitable conditions for a suitable period of time to differentiate the at least one pluripotent cell into at least one pancreatic α, β, and / or δ cell or precursor thereof.

[0174] In some embodiments, at least one pancreatic alpha, beta, and / or delta cell or precursor thereof is a substantially pure population of pancreatic alpha, beta, and / or delta cells or precursors thereof. In some embodiments, the population of pancreatic alpha, beta, and / or delta cells or precursors thereof comprises a mixture of pluripotent cells or differentiated cells. In some embodiments, the population of pancreatic alpha, beta, and / or delta cells or precursors thereof is substantially free of or devoid of embryonic stem cells, pluripotent cells, or iPS cells. In some embodiments, the methods described herein produce a population of cells comprising pancreatic alpha, beta, and / or delta cells in a ratio resembling that of a natural pancreatic islet.

[0175] In some embodiments, the methods described herein include (i) culturing a first population of cells comprising pancreatic progenitor cells (e.g., PDX1-positive, NKX6.1-negative cells; or a mixture of PDX1-positive, NKX6.1-negative cells and PDX1-positive, NKX6.1-positive cells) in a first culture medium containing a forkhead box O1 (FoxO1) inhibitor and a Notch signaling pathway inhibitor for a period of time to obtain a second population of cells (e.g., a population of cells comprising more PDX1-positive, NKX6.1-positive cells than the first population); and (ii) culturing the second population of cells in a second culture medium containing a PKC activator and a Wnt signaling pathway inhibitor. In some embodiments, the methods generate a population of cells comprising PDX1-positive, NKX6.1-positive, and insulin-positive cells.

[0176] In some embodiments, the method described herein includes culturing a first population of cells in a first culture medium, wherein the first population of cells includes PDX1-positive and NKX6.1-negative pancreatic progenitor cells and PDX1-positive and NKX6.1-positive pancreatic progenitor cells, and the first culture medium includes a Forkhead Box O1 (FoxO1) inhibitor (e.g., AS1842856 or a derivative thereof). In some embodiments, the first culture medium further includes a Notch signaling pathway inhibitor. In some embodiments, the Notch signaling pathway inhibitor is a γ-secretase inhibitor (e.g., XXI, DAPT, or a derivative thereof). In some embodiments, the γ-secretase inhibitor is XXI. In some embodiments, the first culture medium does not include a Wnt signaling pathway inhibitor.

[0177] In some embodiments, the first population of cells comprises PDX1-positive and NKX6.1-positive pancreatic progenitor cells. In some embodiments, the first population of cells comprises more PDX1-positive and NKX6.1-negative pancreatic progenitor cells than PDX1-positive and NKX6.1-positive pancreatic progenitor cells. In some embodiments, the first population of cells comprises more PDX1-positive and NKX6.1-positive pancreatic progenitor cells than PDX1-positive and NKX6.1-negative pancreatic progenitor cells.

[0178] In some embodiments, the first culture medium further comprises a PKC activator (e.g., PdBU, TPB, phorbol 12-myristate 13-acetate, bryostatin 1, or a derivative thereof). In some embodiments, the PKC activator is PdBU. In some embodiments, the first culture medium further comprises one or more (e.g., one, two, three, four, five) agents selected from a fibroblast growth factor (e.g., KGF), a sonic hedgehog (SHH) signaling pathway inhibitor (e.g., SANT-1), retinoic acid, a Rho-associated, coiled-coil-containing protein kinase (ROCK) inhibitor (e.g., triazovivin), and a TGF-β ligand (e.g., activin A). In some embodiments, the first culture medium further comprises a water-soluble synthetic polymer (e.g., PVA, e.g., PVA 80%). In some embodiments, the first culture medium comprises a FoxO1 inhibitor (e.g., AS1842856 or a derivative thereof), a Notch signaling pathway inhibitor (e.g., a γ-secretase inhibitor, e.g., XXI), a PKC activator (e.g., PdBU), a fibroblast growth factor (e.g., KGF), a sonic hedgehog (SHH) signaling pathway inhibitor (e.g., SANT-1), retinoic acid, a Rho-associated, coiled-coil-containing protein kinase (ROCK) inhibitor (e.g., thiazovivin), and a TGF-β ligand (e.g., activin A), and a water-soluble synthetic polymer (e.g., PVA, e.g., PVA 80%).

[0179] In some embodiments, the first population of cells is cultured in the first medium for about 12 to 72 hours (e.g., about 12 to 72 hours, 12 to 66 hours, 12 to 60 hours, 12 to 54 hours, 12 to 48 hours, 12 to 42 hours, 12 to 36 hours, 12 to 30 hours, 12 to 24 hours, 12 to 18 hours, 18 to 72 hours, 18 to 66 hours, 18 to 60 hours, 18 to 54 hours, 18 to 48 hours, 18 to 42 hours, 18 to 36 hours, 18 to 30 hours, 18 to 24 hours, 24 to 72 hours, 24 to 66 hours, 24 to 60 hours, 24 to 54 hours, 24 to 48 hours, 24 to 42 hours, 24 to 36 hours, The cells are cultured for a period of 24-30 hours, 30-72 hours, 30-66 hours, 30-60 hours, 30-54 hours, 30-48 hours, 30-42 hours, 30-36 hours, 36-72 hours, 36-66 hours, 36-60 hours, 36-54 hours, 36-48 hours, 36-42 hours, 42-72 hours, 42-66 hours, 42-60 hours, 42-54 hours, 42-48 hours, 48-72 hours, 48-66 hours, 48-60 hours, 48-54 hours, 54-72 hours, 54-66 hours, 54-60 hours, 60-72 hours, 60-66 hours, or 66-72 hours. In some embodiments, the first population of cells is cultured in the first medium for a period of about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, or 72 hours. In some embodiments, the first population of cells is cultured in the first medium for a period of about 24 hours. In some embodiments, the first population of cells is cultured in the first medium for a period of about 48 hours.

[0180] In some embodiments, culturing the first population of cells in the first medium for the contact period described herein (e.g., 24 or 48 hours) results in a second population of cells. In some embodiments, the second population of cells comprises PDX1-positive and NKX6.1-positive pancreatic progenitor cells and PDX1-positive and NKX6.1-negative pancreatic progenitor cells. In some embodiments, the second population of cells comprises more PDX1-positive and NKX6.1-positive pancreatic progenitor cells than the first population of cells. In some embodiments, the second population of cells comprises more PDX1-positive and NKX6.1-positive pancreatic progenitor cells than PDX1-positive and NKX6.1-negative pancreatic progenitor cells. In some embodiments, the second population of cells comprises a minor amount of PDX1-positive and NKX6.1-negative pancreatic progenitor cells (e.g., less than 5%, less than 4%, less than 3%, less than 2%, less than 1% of the second population of cells).

[0181] In some embodiments, the methods described herein further include culturing the second population of cells in a second medium comprising a Wnt signaling pathway inhibitor (e.g., a tankyrase inhibitor, e.g., NVP-TNKS656). In some embodiments, the second medium comprises a PKC activator (e.g., PdBu). In some embodiments, the second culture medium further comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10) agents selected from epidermal growth factor (e.g., betacellulin), thyroid hormone (e.g., GC-1), TGFβ-R1 kinase inhibitor (e.g., ALK5i), Notch signaling pathway inhibitor (e.g., γ-secretase inhibitor, e.g., XXI), sonic hedgehog (SHH) signaling pathway inhibitor (e.g., SANT-1), retinoic acid, Rho-associated, coiled-coil-containing protein kinase (ROCK) inhibitor (e.g., thiazovivin), protein kinase inhibitor (e.g., staurosporine), bone morphogenetic (BMP) signaling pathway inhibitor (e.g., LDN193189), and histone methyltransferase EZH2 inhibitor (e.g., DZNep). In some embodiments, the second medium further comprises one or more (e.g., one, two, three, or four) agents selected from an acetyl-CoA-related metabolite (e.g., acetate), an HDAC inhibitor (e.g., β-hydroxybutyrate), a redox homeostasis regulator (e.g., taurine), and a one-carbon metabolic pathway intermediate (e.g., formate). In some embodiments, the second medium further comprises a vitamin (e.g., biotin). In some embodiments, the second medium further comprises glutamine. In some embodiments, the second medium further comprises a water-soluble synthetic polymer (e.g., PVA, e.g., PVA 87-89%). In some embodiments, the second medium does not comprise a FOXO1 inhibitor.In some embodiments, the second medium contains an inhibitor of a Wnt signaling pathway (e.g., a tankyrase inhibitor, e.g., NVP-TNKS656), a PKC activator (e.g., PdBu), an epidermal growth factor (e.g., betacellulin), a thyroid hormone (e.g., GC-1), a TGFβ-R1 kinase inhibitor (e.g., ALK5i), a Notch signaling pathway inhibitor (e.g., a γ-secretase inhibitor, e.g., XXI), a sonic hedgehog (SHH) signaling pathway inhibitor (e.g., SANT-1), retinoic acid, a Rho-associated, coiled-coil-containing protein kinase ( These include: ROCK inhibitors (e.g., thiazovivin), protein kinase inhibitors (e.g., staurosporine), bone morphogenetic (BMP) signaling pathway inhibitors (e.g., LDN193189), histone methyltransferase EZH2 inhibitors (e.g., DZNep), acetyl-CoA-related metabolites (e.g., acetate), HDAC inhibitors (e.g., β-hydroxybutyrate), redox homeostasis regulators (e.g., taurine), one-carbon metabolic pathway intermediates (e.g., formate), vitamins (e.g., biotin), glutamine, and water-soluble synthetic polymers (e.g., PVA, e.g., PVA 87-89%), but do not contain FOXO1 inhibitors.

[0182] In some embodiments, the second population of cells is cultured in the second medium for about 12 to 72 hours (e.g., about 12 to 72 hours, 12 to 66 hours, 12 to 60 hours, 12 to 54 hours, 12 to 48 hours, 12 to 42 hours, 12 to 36 hours, 12 to 30 hours, 12 to 24 hours, 12 to 18 hours, 18 to 72 hours, 18 to 66 hours, 18 to 60 hours, 18 to 54 hours, 18 to 48 hours, 18 to 42 hours, 18 to 36 hours, 18 to 30 hours, 18 to 24 hours, 24 to 72 hours, 24 to 66 hours, 24 to 60 hours, 24 to 54 hours, 24 to 48 hours, 24 to 42 hours, 24 to 36 hours, The cells are cultured for a period of 24-30 hours, 30-72 hours, 30-66 hours, 30-60 hours, 30-54 hours, 30-48 hours, 30-42 hours, 30-36 hours, 36-72 hours, 36-66 hours, 36-60 hours, 36-54 hours, 36-48 hours, 36-42 hours, 42-72 hours, 42-66 hours, 42-60 hours, 42-54 hours, 42-48 hours, 48-72 hours, 48-66 hours, 48-60 hours, 48-54 hours, 54-72 hours, 54-66 hours, 54-60 hours, 60-72 hours, 60-66 hours, or 66-72 hours. In some embodiments, the second population of cells is cultured in the second medium for a period of about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, or 72 hours. In some embodiments, the second population of cells is cultured in the second medium for a period of about 48 hours.

[0183] In some embodiments, culturing the second population of cells in the second medium for a contact period described herein (e.g., 48 hours) results in a third population of cells. In some embodiments, the third population of cells comprises pancreatic progenitor cells that are PDX1-positive and NKX6.1-positive. In some embodiments, the third population of cells comprises cells that are ISL1-positive. In some embodiments, the third population of cells comprises cells that are ISL1-negative. In some embodiments, the third population of cells comprises cells that are ISL1-positive. In some embodiments, the third population of cells comprises more ISL1-positive cells than the first and second populations of cells. In some embodiments, the third population of cells comprises more ISL1-negative cells than ISL1-positive cells. In some embodiments, the third population of cells comprises cells that are insulin-negative. In some embodiments, the third population of cells comprises cells that are insulin-positive. In some embodiments, the third population of cells comprises more insulin-negative cells than insulin-positive cells. In some embodiments, the third population of cells comprises more cells that are insulin positive than the first and second populations of cells.

[0184] In some embodiments, the method further comprises culturing a third population of cells in a third medium comprising one or more agents selected from a Notch signaling pathway inhibitor (e.g., a γ-secretase inhibitor, e.g., XXI), a TGFβ-R1 kinase inhibitor (e.g., ALK5i), a thyroid hormone (e.g., GC-1), a bone morphogenetic (BMP) signaling pathway inhibitor (e.g., LDN193189), a Rho-associated, coiled-coil-containing protein kinase (ROCK) inhibitor (e.g., thiazovivin), a protein kinase inhibitor (e.g., staurosporine), and a histone methyltransferase EZH2 inhibitor (e.g., DZNep). In some embodiments, the third medium further comprises one or more agents selected from an acetyl-CoA-related metabolite (e.g., acetate), an HDAC inhibitor (e.g., β-hydroxybutyrate), a redox homeostasis regulator (e.g., taurine), and a one-carbon metabolic pathway intermediate (e.g., formate). In some embodiments, the third medium further comprises a vitamin (e.g., biotin). In some embodiments, the third medium further comprises glutamine. In some embodiments, the third medium further comprises a water-soluble synthetic polymer (e.g., PVA, e.g., PVA 87-89%).

[0185] In some embodiments, the third culture medium does not contain a Wnt signaling pathway inhibitor or a PKC activator. In some embodiments, the third medium contains a Notch signaling pathway inhibitor (e.g., γ-secretase inhibitor, e.g., XXI), a TGFβ-R1 kinase inhibitor (e.g., ALK5i), a thyroid hormone (e.g., GC-1), a bone morphogenetic (BMP) signaling pathway inhibitor (e.g., LDN193189), a Rho-associated, coiled-coil-containing protein kinase (ROCK) inhibitor (e.g., thiazovivin), a protein kinase inhibitor (e.g., staurosporine), and a histone methyltransferase EZH2 inhibitor (e.g., DZNep), an acetyl-CoA-related metabolite (e.g., acetate), an HDAC inhibitor (e.g., β-hydroxybutyrate), a redox homeostasis regulator (e.g., taurine), a one-carbon metabolic pathway intermediate (e.g., formate), a vitamin (e.g., biotin), glutamine, and a water-soluble synthetic polymer (e.g., PVA, e.g., PVA 87-89%), but does not contain a Wnt signaling pathway inhibitor and a PKC activator. In some embodiments, the third population of cells is cultured in a third medium (e.g., a third medium that does not contain a Wnt signaling pathway inhibitor or a PKC activator) for a period of about 24 to 96 hours (e.g., about 24 to 96 hours, 24 to 84 hours, 24 to 72 hours, 24 to 60 hours, 24 to 48 hours, 24 to 36 hours, 36 to 96 hours, 36 to 84 hours, 36 to 72 hours, 36 to 60 hours, 36 to 48 hours, 48 ​​to 96 hours, 48 ​​to 84 hours, 48 ​​to 72 hours, 48 ​​to 60 hours, 60 to 96 hours, 60 to 84 hours, 60 to 72 hours, 72 to 96 hours, 72 to 84 hours, or 84 to 96 hours). In some embodiments, the third population of cells is cultured in the third medium for a period of about 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, or 96 hours.In some embodiments, the third population of cells is cultured in the third medium for about 96 hours.

[0186] In some embodiments, the third culture medium further comprises a Wnt signaling pathway inhibitor but does not comprise a PKC activator. In some embodiments, the third culture medium contains an inhibitor of a Wnt signaling pathway (e.g., a tankyrase inhibitor, e.g., NVP-TNKS656), a Notch signaling pathway inhibitor (e.g., a γ-secretase inhibitor, e.g., XXI), a TGFβ-R1 kinase inhibitor (e.g., ALK5i), a thyroid hormone (e.g., GC-1), a bone morphogenetic (BMP) signaling pathway inhibitor (e.g., LDN193189), a Rho-associated, coiled-coil-containing protein kinase (ROCK) inhibitor (e.g., thiazovivin), a protein kinase inhibitor (e.g., staurosporine), and a histone methyltransferase EZH2 inhibitor (e.g., DZNep), an acetyl-CoA-related metabolite (e.g., acetate), an HDAC inhibitor (e.g., β-hydroxybutyrate), a redox homeostasis regulator (e.g., taurine), a one-carbon metabolic pathway intermediate (e.g., formate), a vitamin (e.g., biotin), glutamine, and a water-soluble synthetic polymer (e.g., PVA, e.g., PVA In some embodiments, the third population of cells is cultured in a third medium (e.g., a third medium comprising a Wnt signaling pathway inhibitor but not a PKC activator) for a period of about 24 to 48 hours (e.g., about 24 to 48 hours, 24 to 36 hours, or 36 to 48 hours), after which the Wnt signaling pathway inhibitor is removed from the third medium and the cells are further cultured for about 24 to 48 hours (e.g., about 24 to 48 hours, 24 to 36 hours, or 36 to 48 hours). In some embodiments, the third population of cells is cultured in a third medium (e.g., a third medium comprising a Wnt signaling pathway inhibitor but not a PKC activator) for a period of about 48 hours, after which the Wnt signaling pathway inhibitor is removed from the third medium and the cells are further cultured for about 48 hours.

[0187] In some embodiments, culturing the third population of cells in the third medium for a contact period described herein (e.g., 96 hours) results in a fourth population of cells. In some embodiments, the fourth population of cells comprises cells that are PDX1-positive and NKX6.1-positive. In some embodiments, the fourth population of cells comprises cells that are insulin-positive. In some embodiments, the fourth population of cells comprises cells that are PDX1-positive, NKX6.1-positive, and insulin-positive. In some embodiments, the fourth population of cells comprises cells that are ISL1-positive. In some embodiments, the fourth population of cells comprises cells that are ISL-1-negative. In some embodiments, at least 30% (e.g., at least 30%, at least 40%, at least 50%, or at least 60%) of the fourth population of cells are insulin-positive. In some embodiments, 30%-50%, 30%-40%, or 40%-50% of the fourth population of cells are insulin-positive.

[0188] In some embodiments, the method further comprises culturing the fourth population of cells in a fourth medium comprising one or more agents selected from a TGFβ-R1 kinase inhibitor (e.g., ALK5i), a thyroid hormone (e.g., GC-1), an osteogenic (BMP) signaling pathway inhibitor (e.g., LDN193189), a Rho-associated, coiled-coil-containing protein kinase (ROCK) inhibitor (e.g., thiazovivin), a protein kinase inhibitor (e.g., staurosporine), and a histone methyltransferase EZH2 inhibitor (e.g., DZNep). In some embodiments, the fourth medium further comprises one or more agents selected from an acetyl-CoA-related metabolite (e.g., acetate), an HDAC inhibitor (e.g., β-hydroxybutyrate), a redox homeostasis regulator (e.g., taurine), and a one-carbon metabolic pathway intermediate (e.g., formate). In some embodiments, the fourth medium further comprises a vitamin (e.g., biotin). In some embodiments, the fourth culture medium further comprises one or more of glutamine (e.g., L-glutamine), glutamate (e.g., L-glutamate), and carnitine (e.g., L-carnitine). In some embodiments, the fourth culture medium further comprises albumin (e.g., human serum albumin or HSA). In some embodiments, the fourth culture medium further comprises ZnSO. In some embodiments, the fourth culture medium does not comprise a Wnt signaling pathway inhibitor or a PKC activator.In some embodiments, the fourth culture medium comprises a TGFβ-R1 kinase inhibitor (e.g., ALK5i), a thyroid hormone (e.g., GC-1), an osteogenic (BMP) signaling pathway inhibitor (e.g., LDN193189), a Rho-associated, coiled-coil-containing protein kinase (ROCK) inhibitor (e.g., thiazovivin), a protein kinase inhibitor (e.g., staurosporine), and a histone methyltransferase EZH2 inhibitor (e.g., DZNep), an acetyl-CoA-related metabolite (e.g., acetate), an HDAC inhibitor (e.g., beta-hydroxybutyrate), a redox homeostasis regulator (e.g., taurine), a one-carbon metabolic pathway intermediate (e.g., formate), a vitamin (e.g., biotin), glutamine, glutamate, carnitine, albumin (e.g., human serum albumin or HSA), and ZnSO4, but does not contain a Wnt signaling pathway inhibitor or a PKC activator.

[0189] In some embodiments, the fourth population of cells is cultured in the fourth medium for a period of about 24 to 96 hours (e.g., about 24 to 96 hours, 24 to 84 hours, 24 to 72 hours, 24 to 60 hours, 24 to 48 hours, 24 to 36 hours, 36 to 96 hours, 36 to 84 hours, 36 to 72 hours, 36 to 60 hours, 36 to 48 hours, 48 ​​to 96 hours, 48 ​​to 84 hours, 48 ​​to 72 hours, 48 ​​to 60 hours, 60 to 96 hours, 60 to 84 hours, 60 to 72 hours, 72 to 96 hours, 72 to 84 hours, or 84 to 96 hours). In some embodiments, the fourth population of cells is cultured in the fourth medium for a period of about 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, or 96 hours. In some embodiments, the fourth population of cells is cultured in the fourth medium for a period of about 72 hours.

[0190] In some embodiments, a fifth population of cells is produced by culturing the fourth population of cells in a fourth culture medium for the contact period described herein (e.g., 96 hours). In some embodiments, the methods described herein further include culturing the fifth population of cells in a fifth culture medium containing glutamine, albumin (e.g., human serum albumin or HSA), and ZnSO. In some embodiments, the fifth culture medium contains glutamine, albumin (e.g., human serum albumin or HSA), and ZnSO, and does not contain any one of agents selected from a TGFβ-R1 kinase inhibitor (e.g., ALK5i), a thyroid hormone (e.g., GC-1), an osteogenic (BMP) signaling pathway inhibitor (e.g., LDN193189), a Rho-associated, coiled-coil-containing protein kinase (ROCK) inhibitor (e.g., thiazovivin), a protein kinase inhibitor (e.g., staurosporine), and a histone methyltransferase EZH2 inhibitor (e.g., DZNep). In some embodiments, the fifth medium further comprises a histone methyltransferase EZH2 inhibitor (e.g., DZNep), an acetyl-CoA-related metabolite (e.g., acetate), an HDAC inhibitor (e.g., beta-hydroxybutyrate), a redox homeostasis regulator (e.g., taurine), a one-carbon metabolic pathway intermediate (e.g., formate), a vitamin (e.g., biotin), glutamine, glutamate, and carnitine.In some embodiments, the fifth culture medium comprises a histone methyltransferase EZH2 inhibitor (e.g., DZNep), an acetyl-CoA-related metabolite (e.g., acetate), an HDAC inhibitor (e.g., beta-hydroxybutyrate), a redox homeostasis regulator (e.g., taurine), a one-carbon metabolic pathway intermediate (e.g., formate), a vitamin (e.g., biotin), glutamate, glutamine, carnitine, albumin (e.g., human serum albumin or HSA), and ZnSO4, and does not contain any one of agents selected from a TGFβ-R1 kinase inhibitor (e.g., ALK5i), a thyroid hormone (e.g., GC-1), a bone morphogenetic (BMP) signaling pathway inhibitor (e.g., LDN193189), a Rho-associated, coiled-coil-containing protein kinase (ROCK) inhibitor (e.g., thiazovivin), a protein kinase inhibitor (e.g., staurosporine), and a histone methyltransferase EZH2 inhibitor (e.g., DZNep). In some embodiments, the fifth culture medium comprises albumin (e.g., human serum albumin or HSA) and ZnSO4, and does not comprise any one of agents selected from a TGFβ-R1 kinase inhibitor (e.g., ALK5i), a thyroid hormone (e.g., GC-1), an osteogenic (BMP) signaling pathway inhibitor (e.g., LDN193189), a Rho-associated, coiled-coil-containing protein kinase (ROCK) inhibitor (e.g., thiazovivin), a protein kinase inhibitor (e.g., staurosporine), and a histone methyltransferase EZH2 inhibitor (e.g., DZNep), an acetyl-CoA-related metabolite (e.g., acetate), an HDAC inhibitor (e.g., beta-hydroxybutyrate), a redox homeostasis regulator (e.g., taurine), a one-carbon metabolic pathway intermediate (e.g., formate), a vitamin (e.g., biotin), carnitine, glutamate, and glutamine.

[0191] In some embodiments, the fifth population of cells is cultured in the fifth medium for a period of about 96 to 240 hours (e.g., about 96 to 240 hours, 96 to 216 hours, 96 to 192 hours, 96 to 168 hours, 96 to 144 hours, 96 to 120 hours, 120 to 240 hours, 120 to 216 hours, 120 to 192 hours, 120 to 168 hours, 120 to 144 hours, 144 to 240 hours, 144 to 216 hours, 144 to 192 hours, 144 to 168 hours, 168 to 240 hours, 168 to 216 hours, 168 to 192 hours, 192 to 240 hours, 192 to 216 hours, or 192 to 240 hours). In some embodiments, the fifth population of cells is cultured in the fifth medium for a period of about 24, 48, 72, 96, 120, 144, 168, 192, 216, or 240 hours. In some embodiments, the fifth population of cells is cultured in the fifth medium for a period of about 192 hours.

[0192] In some embodiments, culturing the fifth population of cells in the fifth medium for a contact period described herein (e.g., 192 hours) results in a sixth population of cells. In some embodiments, at least 15% (e.g., at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40% or more) of the sixth population of cells are NKX6.1-negative, ISL-positive, and less than 12% (e.g., less than 12%, less than 10%, less than 8%, less than 6%, less than 4%, less than 2%, or less) of the sixth population of cells are NKX6.1-negative, ISL-negative.

[0193] In some embodiments, the methods described herein include: (i) culturing a first population of cells in a first culture medium to obtain a second population of cells, wherein the first population of cells comprises PDX1-positive and NKX6.1-negative pancreatic progenitor cells and PDX1-positive and NKX6.1-positive pancreatic progenitor cells, and the first culture medium comprises a FoxO1 inhibitor, a Notch signaling pathway inhibitor, a PKC activator, a fibroblast growth factor, a sonic hedgehog (SHH) signaling pathway inhibitor, retinoic acid, a Rho-associated, coiled-coil-containing protein kinase (ROCK) inhibitor, a TGF-β ligand, and a water-soluble synthetic polymer; (ii) culturing the second population of cells obtained in (i) using a second culture medium to obtain a third population of cells, wherein the second culture medium comprises a Wnt signaling pathway inhibitor, a PKC activator, an epidermal growth factor, a thyroid hormone, a TGFβ-R1 kinase inhibitor, a Notch signaling pathway inhibitor, a Sonic hedgehog (SHH) signaling pathway inhibitor, a retinoic acid, a Rho-associated, coiled-coil-containing protein kinase (ROCK) inhibitor, a protein kinase inhibitor, a bone morphogenetic (BMP) signaling pathway inhibitor, a histone methyltransferase EZH2 inhibitor, an acetyl-CoA-related metabolite, an HDAC inhibitor, a redox homeostasis regulator, a one-carbon metabolic pathway intermediate, a vitamin, glutamine, and a water-soluble synthetic polymer (e.g., PVA), and the second culture medium does not comprise a FOXO1 inhibitor; (iii) culturing the third population of cells obtained in (ii) using a third culture medium to obtain a fourth population of cells, wherein the third culture medium comprises a Notch signaling pathway inhibitor, a TGFβ-R1 kinase inhibitor, a thyroid hormone, a bone morphogenetic (BMP) signaling pathway, a Rho-associated, coiled-coil-containing protein kinase (ROCK) inhibitor, a protein kinase inhibitor, and a histone methyltransferase EZH2 inhibitor, an acetyl-CoA-related metabolite, an HDAC inhibitor, a redox homeostasis regulator, a one-carbon metabolic pathway intermediate, a vitamin, glutamine, and a water-soluble synthetic polymer, and the third culture medium does not comprise a Wnt signaling pathway inhibitor and a PKC activator; (iv) culturing the fourth population of cells obtained in (iii) using a fourth culture medium to obtain a fifth population of cells, wherein the fourth culture medium comprises a Notch signaling pathway inhibitor, a TGFβ-R1 kinase inhibitor, a thyroid hormone, a bone morphogenetic (BMP) signaling pathway inhibitor, a Rho-associated, coiled-coil-containing protein kinase (ROCK) inhibitor, a protein kinase inhibitor, a histone methyltransferase EZH2 inhibitor, an acetyl-CoA-related metabolite, an HDAC inhibitor, a redox homeostasis regulator, a one-carbon metabolic pathway intermediate, a vitamin, glutamine, glutamate, carnitine, albumin, and ZnSO4, and the fourth culture medium does not comprise a Wnt signaling pathway inhibitor or a PKC activator; (v) culturing the fifth population of cells obtained in (iv) using a fifth medium to obtain a sixth population of cells, wherein the fifth medium comprises albumin (e.g., human serum albumin or HSA) and ZnSO; Includes:

[0194] In some embodiments, the methods described herein further comprise generating a first population of cells comprising PDX1-positive and NKX6.1-negative pancreatic progenitor cells and PDX1-positive and NKX6.1-positive pancreatic progenitor cells. In some embodiments, the first population of cells is differentiated from stem cells (e.g., embryonic stem cells or pluripotent stem cells). In some embodiments, the stem cells (e.g., embryonic stem cells) are generated from the inner cell mass of blastocyst-stage embryos. Stem cells can be maintained in culture, where they self-renew, proliferate indefinitely as undifferentiated ES cells, and differentiate into all cell types of the body, such as ectodermal, mesodermal, and endodermal lineage cells or tissues. Differentiating cell types in the pancreas

[0195] Aspects of the present disclosure provide cell types of the pancreatic lineage obtained during differentiation of stem cells to generate pancreatic islet cells, including any cells that can differentiate into pancreatic islet cells when cultured under conditions suitable for differentiation of precursor cells into pancreatic islet cells, including, for example, pluripotent stem cells, definitive endoderm cells, primitive gut cells, pancreatic progenitor cells, or endocrine precursor cells. stem cells

[0196] In some embodiments, any of the stem cells disclosed herein (e.g., any of the genetically engineered stem cells) may be used to generate genetically engineered SC islet cells or precursors thereof. Definitive endoderm cells

[0197] Definitive endoderm can be generated in vivo from the inner cell mass by the gastrulation process of embryogenesis, in which epiblast cells are instructed to form the three germ layers. Definitive endoderm can give rise to a variety of cells and tissues that contribute to vital organs, such as pancreatic beta cells, hepatocytes of the liver, alveolar cells of the lung, thyroid gland, thymus, and the epithelial lining of the digestive and respiratory tracts. It differs from the primitive endoderm of extraembryonic tissues, which can give rise to visceral and parietal endoderm. Definitive endoderm derived from ES cells is theoretically capable of giving rise to any endodermal derivative.

[0198] Precise patterning of the anterior-posterior axis of the definitive endoderm ultimately leads to the formation of the primitive gut. The primitive gut derived from the definitive endoderm gives rise to the pharynx, esophagus, stomach, duodenum, small and large intestines along the anterior-posterior axis, as well as related organs including the pancreas, lungs, thyroid gland, thymus, parathyroid glands, and liver. The anterior portion of the foregut of the primitive gut gives rise to the lungs, thyroid gland, esophagus, and stomach. The pancreas, liver, and duodenum arise from the posterior portion of the foregut. The midgut and hindgut of the primitive gut give rise to the small and large intestines. The anterior foregut expresses developmental markers, NK2 homeobox 1 (NKX2-1) and SRY (sex-determining region Y)-box 2 (SOX2); the posterior foregut expresses hematopoietic tissue-expressed homeobox 1 (HHEX), pancreatic and duodenal homeobox 1 (PDX1), one-cut homeobox 1 (also known as HNF6, ONECUT1), and hepatocyte nuclear factor 4 alpha (HNF4A); and the midgut / hindgut expresses caudal homeobox 1 (CDX1), caudal homeobox 2 (CDX2), and motor neuron and pancreatic homeobox 1 (MNX1) (3, 19, 20).

[0199] As described herein, the definitive endoderm cell useful herein can be derived from any source or produced according to any suitable protocol.In some embodiments, pluripotent stem cells, for example, iPSCs or hESCs, are differentiated into endoderm cells.In some embodiments, endoderm cells (stage 1) are further differentiated into, for example, primitive intestinal cells (stage 2), PDX1-positive pancreatic progenitor cells (stage 3), NKX6.1-positive pancreatic progenitor cells (stage 4), or Ngn3-positive endocrine progenitor cells or insulin-positive endocrine cells (stage 5), and then guided or matured into SC-β cells (stage 6).

[0200] In some embodiments, definitive endoderm cells can be obtained by differentiating at least some of the pluripotent cells in the population into definitive endoderm cells, for example, by contacting the population of pluripotent cells with i) at least one growth factor from the TGF-β superfamily, and ii) a WNT signaling pathway activator, to induce differentiation of at least some of the pluripotent cells into definitive endoderm cells, wherein the definitive endoderm cells express at least one marker characteristic of definitive endoderm.

[0201] Any growth factor from the TGF-β superfamily that can induce pluripotent stem cells to differentiate into definitive endoderm cells can be used in the methods provided herein (e.g., alone or in combination with a WNT signaling pathway activator). In some embodiments, the growth factor from the TGF-β superfamily comprises activin A. In some embodiments, the growth factor from the TGF-β superfamily comprises growth differentiation factor 8 (GDF8). Any WNT signaling pathway activator that can induce pluripotent stem cells to differentiate into definitive endoderm cells can be used in the methods provided herein (e.g., alone or in combination with a growth factor from the TGF-β superfamily). In some embodiments, the WNT signaling pathway activator comprises CHIR99021. In some embodiments, the WNT signaling pathway activator comprises Wnt3a recombinant protein.

[0202] In some embodiments, differentiating at least some of the pluripotent cells in the population into definitive endoderm cells is achieved by a process of contacting the population of pluripotent cells with i) activin A, and ii) CHIR99021 for a period of time suitable to induce differentiation of at least some of the pluripotent cells in the population into definitive endoderm cells that express at least one marker characteristic of definitive endoderm, e.g., about 2 days, about 3 days, about 4 days, or about 5 days. In some embodiments, the process comprises contacting the population of pluripotent cells with activin A and CHIR99021 for 1 day, followed by contacting with activin A (in the absence of CHIR99021) for an additional 1 or 2 days.

[0203] In some examples, the method includes contacting the population of pluripotent cells with a suitable concentration, e.g., about 10 ng / mL, about 20 ng / mL, about 50 ng / mL, about 75 ng / mL, about 80 ng / mL, about 90 ng / mL, about 95 ng / mL, about 100 ng / mL, about 110 ng / mL, about 120 ng / mL, about 130 ng / mL, about 140 ng / mL, about 150 ng / mL, about 175 ng / mL, about 180 ng / mL, about 200 ng / mL, about 250 ng / mL, or about 300 ng / mL, of a growth factor from the TGF-β superfamily (e.g., activin A), thereby differentiating the pluripotent cells into definitive endoderm cells. In some embodiments, the methods involve the use of about 70-130 ng / ml, 80-120 ng / ml, or 90-110 ng / ml of activin A for the differentiation of pluripotent cells to definitive endoderm cells. In some embodiments, the methods involve the use of about 100 ng / mL of activin A for the differentiation of pluripotent cells to definitive endoderm cells. In some embodiments, the methods involve the use of about 200 ng / mL of activin A for the differentiation of pluripotent cells to definitive endoderm cells.

[0204] In some examples, the method includes contacting a population of pluripotent cells with a suitable concentration of a WNT signaling pathway activator (e.g., CHIR99021), e.g., about 0.01 μM, about 0.05 μM, about 0.1 μM, about 0.2 μM, about 0.5 μM, about 0.8 μM, about 1 μM, about 1.5 μM, about 2 μM, about 2.5 μM, about 3 μM, about 3.5 μM, about 4 μM, about 5 μM, about 8 μM, about 10 μM, about 12 μM, about 15 μM, about 20 μM, about 30 μM, about 50 μM, about 100 μM, or about 200 μM, thereby differentiating the pluripotent cells into definitive endoderm cells. In some embodiments, the method includes using about 1-5 μM or 2-4 μM CHIR99021 for the differentiation of pluripotent cells into definitive endoderm cells. In some embodiments, the methods involve the use of about 2 μM CHIR99021 for the differentiation of pluripotent cells to definitive endoderm cells. In some embodiments, the methods involve the use of about 3 μM CHIR99021 for the differentiation of pluripotent cells to definitive endoderm cells. In some embodiments, the methods involve the use of about 5 μM CHIR99021 for the differentiation of pluripotent cells to definitive endoderm cells.

[0205] In some embodiments, the cells are further contacted with a water-soluble synthetic polymer. In some embodiments, the water-soluble synthetic polymer is polyvinyl alcohol. In some cases, the polyvinyl alcohol is at least 78% hydrolyzed, e.g., 79-81% hydrolyzed, 87-89% hydrolyzed, 87-90% hydrolyzed, or 99% hydrolyzed. In some embodiments, the polyvinyl alcohol is 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% hydrolyzed. In some embodiments, the PVA is 80% hydrolyzed.

[0206] In some embodiments, the definitive endoderm cells produced by the methods disclosed herein express at least one marker selected from the group consisting of Nodal, Tmprss2, Tmem30b, St14, Spink3, Sh3gl2, Ripk4, Rab1S, Npnt, Clic6, Cldn5, Cacna1b, Bnip1, Anxa4, Emb, FoxA1, Sox17, and Rbm35a, and the expression of the at least one marker is upregulated to a statistically significant amount in the definitive endoderm cells compared to the pluripotent stem cells from which they are derived. In some embodiments, the definitive endoderm cells produced by the methods disclosed herein do not express a statistically significant amount of at least one marker selected from the group consisting of Gata4, SPARC, AFP, and Dab2 compared to the pluripotent stem cells from which they are derived. In some embodiments, the definitive endoderm cells produced by the methods disclosed herein do not express at least one marker selected from the group consisting of Zic1, Pax6, Flk1, and CD31 at a statistically significant amount compared to the pluripotent stem cells from which they were derived. In some embodiments, the definitive endoderm cells produced by the methods disclosed herein have a statistically significant higher phosphorylation level of Smad2 compared to the pluripotent stem cells from which they were derived. In some embodiments, the definitive endoderm cells produced by the methods disclosed herein are capable of forming a gut tube in vivo. In some embodiments, the definitive endoderm cells produced by the methods disclosed herein can be differentiated into cells having a morphology characteristic of intestinal cells, and the cells having a morphology characteristic of intestinal cells express FoxA2 and / or Claudin 6. In some embodiments, the definitive endoderm cells produced by the methods disclosed herein can be further differentiated into cells of endodermal origin.

[0207] In some embodiments, the population of pluripotent stem cells is cultured in the presence of at least one beta cell differentiation factor before any differentiation or during the first stage of differentiation. Any pluripotent stem cells, such as human pluripotent stem cells, or human iPS cells, or any of the pluripotent stem cells discussed herein, or other suitable pluripotent stem cells, can be used. In some embodiments, the beta cell differentiation factors described herein can be present in the culture medium of the population of pluripotent stem cells, or can be added as a bolus or periodically during the growth (e.g., replication or propagation) of the population of pluripotent stem cells. In certain examples, the population of pluripotent stem cells can be exposed to at least one beta cell differentiation factor before any differentiation. In other examples, the population of pluripotent stem cells can be exposed to at least one beta cell differentiation factor during the first stage of differentiation. primitive intestinal cells

[0208] The embodiments of the present disclosure include primitive intestinal cells.The primitive intestinal cells useful herein can be derived from any source or can be produced according to any suitable protocol.In some embodiments, definitive endoderm cells are differentiated into primitive intestinal cells.In some embodiments, primitive intestinal cells are further differentiated into, for example, PDX1 positive pancreatic progenitor cells, NKX6.1 positive pancreatic progenitor cells, Ngn3 positive endocrine progenitor cells, insulin positive endocrine cells, and then guided or matured into SC-β cells.

[0209] In some embodiments, primitive gut cells can be obtained by differentiating at least some of the definitive endoderm cells in the population into primitive gut cells, for example, by contacting the definitive endoderm cells with at least one growth factor from the fibroblast growth factor (FGF) family to induce differentiation of at least some of the definitive endoderm cells into primitive gut cells, wherein the primitive gut cells express at least one marker characteristic of primitive gut cells.

[0210] Any growth factor from the FGF family that can induce definitive endoderm cells to differentiate into primitive gut cells can be used in the methods provided herein (e.g., alone or in combination with other factors). In some embodiments, at least one growth factor from the FGF family comprises keratinocyte growth factor (KGF). In some embodiments, at least one growth factor from the FGF family comprises FGF2. In some embodiments, at least one growth factor from the FGF family comprises FGF8B. In some embodiments, at least one growth factor from the FGF family comprises FGF10. In some embodiments, at least one growth factor from the FGF family comprises FGF21.

[0211] In some embodiments, primitive gut cells can be obtained by differentiating at least some of the definitive endoderm cells in the population into primitive gut cells, for example, by contacting the definitive endoderm cells with KGF for a certain period of time, for example, about 1 day, about 2 days, about 3 days, or about 4 days, to induce differentiation of at least some of the definitive endoderm cells into primitive gut cells.

[0212] In some embodiments, the method comprises differentiating the definitive endoderm cells into primitive gut cells by contacting the definitive endoderm cells with a suitable concentration, e.g., about 10 ng / mL, about 20 ng / mL, about 50 ng / mL, about 75 ng / mL, about 80 ng / mL, about 90 ng / mL, about 95 ng / mL, about 100 ng / mL, about 110 ng / mL, about 120 ng / mL, about 130 ng / mL, about 140 ng / mL, about 150 ng / mL, about 175 ng / mL, about 180 ng / mL, about 200 ng / mL, about 250 ng / mL, or about 300 ng / mL, of a growth factor from the FGF family (e.g., KGF). In some embodiments, the method comprises using about 20-80 ng / mL, 30-70 ng / mL, or 40-60 ng / mL of KGF for the differentiation of the definitive endoderm cells into primitive gut cells. In some embodiments, the methods comprise the use of about 50 ng / mL KGF for the differentiation of definitive endoderm cells to primitive gut cells, hi some embodiments, the methods comprise the use of about 100 ng / mL KGF for the differentiation of definitive endoderm cells to primitive gut cells.

[0213] In some embodiments, the cells are further contacted with a water-soluble synthetic polymer. In some embodiments, the water-soluble synthetic polymer is polyvinyl alcohol. In some cases, the polyvinyl alcohol is at least 78% hydrolyzed, e.g., 79-81% hydrolyzed, 87-89% hydrolyzed, 87-90% hydrolyzed, or 99% hydrolyzed. In some embodiments, the polyvinyl alcohol (PVA) is 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% hydrolyzed. In some embodiments, the PVA is 80% hydrolyzed. PDX1-positive pancreatic progenitor cells

[0214] The embodiments of the present disclosure include PDX1 positive pancreatic progenitor cells.The PDX1 positive pancreatic progenitor cells useful herein can be derived from any source or can be produced according to any suitable protocol.In some embodiments, primitive intestinal cells are differentiated into PDX1 positive pancreatic progenitor cells.In some embodiments, PDX1 positive pancreatic progenitor cells are NKX6.1 negative, and can be further differentiated into, for example, NKX6.1 positive pancreatic progenitor cells, Ngn3 positive endocrine progenitor cells, insulin positive endocrine cells, and then can be induced or matured into SC-β cells.

[0215] In some embodiments, PDX1-positive pancreatic progenitor cells can be obtained by differentiating at least some of the primitive intestinal cells in the population into PDX1-positive pancreatic progenitor cells, for example, by contacting the primitive intestinal cells with i) at least one BMP signaling pathway inhibitor, ii) a growth factor from the TGF-β superfamily, iii) at least one growth factor from the FGF family, iv) at least one SHH pathway inhibitor, v) at least one retinoic acid (RA) signaling pathway activator, vi) at least one protein kinase C activator, and vii) a ROCK inhibitor, to induce differentiation of at least some of the primitive intestinal cells into PDX1-positive pancreatic progenitor cells, wherein the PDX1-positive pancreatic progenitor cells express PDX1.

[0216] In some embodiments, PDX1-positive pancreatic progenitor cells can be obtained by differentiating at least some of the primitive intestinal cells in the population into PDX1-positive pancreatic progenitor cells, for example, by contacting the primitive intestinal cells with i) at least one BMP signaling pathway inhibitor, ii) a growth factor from the TGF-β superfamily, iii) at least one growth factor from the FGF family, iv) at least one SHH pathway inhibitor, v) at least one retinoic acid (RA) signaling pathway activator, and vi) at least one protein kinase C activator to induce differentiation of at least some of the primitive intestinal cells into PDX1-positive pancreatic progenitor cells, wherein the PDX1-positive pancreatic progenitor cells express PDX1.

[0217] In some embodiments, PDX1-positive pancreatic progenitor cells can be obtained by differentiating at least some of the primitive intestinal cells in the population into PDX1-positive pancreatic progenitor cells, for example, by contacting the primitive intestinal cells with i) at least one BMP signaling pathway inhibitor, ii) at least one growth factor from the FGF family, iii) at least one SHH pathway inhibitor, iv) at least one retinoic acid (RA) signaling pathway activator, and v) at least one protein kinase C activator to induce differentiation of at least some of the primitive intestinal cells into PDX1-positive pancreatic progenitor cells, wherein the PDX1-positive pancreatic progenitor cells express PDX1.

[0218] In some embodiments, PDX1-positive pancreatic progenitor cells can be obtained by differentiating at least some of the primitive intestinal cells in a population into PDX1-positive pancreatic progenitor cells, for example, by contacting the primitive intestinal cells with i) at least one SHH pathway inhibitor, ii) at least one retinoic acid (RA) signaling pathway activator, and iii) at least one protein kinase C activator, wherein the PDX1-positive pancreatic progenitor cells express PDX1.

[0219] In some embodiments, PDX1-positive pancreatic progenitor cells can be obtained by differentiating at least some of the primitive intestinal cells in a population into PDX1-positive pancreatic progenitor cells, for example, by contacting the primitive intestinal cells with i) at least one growth factor from the FGF family and ii) at least one retinoic acid (RA) signaling pathway activator to induce differentiation of at least some of the primitive intestinal cells into PDX1-positive pancreatic progenitor cells, wherein the PDX1-positive pancreatic progenitor cells express PDX1.

[0220] Any BMP signaling pathway inhibitor that can induce primitive intestinal cells to differentiate into PDX1-positive pancreatic progenitor cells (for example, alone or with any combination of a growth factor from the TGF-β superfamily, at least one growth factor from the FGF family, at least one SHH pathway inhibitor, at least one retinoic acid signaling pathway activator, at least one protein kinase C activator, and a ROCK inhibitor) can be used in the methods provided herein. In some embodiments, the BMP signaling pathway inhibitor comprises LDN193189 or DMH-1. In some examples, the method includes contacting primitive intestinal cells with a BMP signaling pathway inhibitor (e.g., LDN1931189) at a concentration of about 30 nM, about 40 nM, about 50 nM, about 60 nM, about 70 nM, about 80 nM, about 90 nM, about 100 nM, about 110 nM, about 120 nM, about 130 nM, about 140 nM, about 150 nM, about 160 nM, about 170 nM, about 180 nM, about 190 nM, about 200 nM, about 210 nM, about 220 nM, about 230 nM, about 240 nM, about 250 nM, about 280 nM, about 300 nM, about 400 nM, about 500 nM, or about 1 μM. In some examples, the method includes contacting primitive intestinal cells with a BMP signaling pathway inhibitor (e.g., DMH-1) at a concentration of about 0.01 μM, about 0.02 μM, about 0.05 μM, about 0.1 μM, about 0.2 μM, about 0.5 μM, about 0.8 μM, about 1 μM, about 1.2 μM, about 1.5 μM, about 1.75 μM, about 2 μM, about 2.2 μM, about 2.5 μM, about 2.75 μM, about 3 μM, about 3.25 μM, about 3.5 μM, about 3.75 μM, about 4 μM, about 4.5 μM, about 5 μM, about 8 μM, about 10 μM, about 15 μM, about 20 μM, about 30 μM, about 40 μM, about 50 μM, or about 100 μM. In some examples, the method includes contacting the primitive intestinal cells with a BMP signaling pathway inhibitor (e.g., DMH-1) at a concentration of about 220-280 nM, about 230-270 nM, about 240-260 nM, or about 245-255 nM, etc. In some examples, the method includes contacting the primitive intestinal cells with a BMP signaling pathway inhibitor (e.g., DMH-1) at a concentration of about 250 nM.

[0221] Any growth factor from the TGF-β superfamily that can induce primitive intestinal cells to differentiate into PDX1-positive pancreatic progenitor cells can be used (e.g., alone or with any combination of at least one BMP signaling pathway inhibitor, a growth factor from the FGF family, at least one SHH pathway inhibitor, at least one retinoic acid signaling pathway activator, at least one protein kinase C activator, and a ROCK inhibitor). In some embodiments, the growth factor from the TGF-β family includes activin A. In some embodiments, the growth factor from the TGF-β family includes GDF8. In some examples, the method includes contacting primitive intestinal cells with a growth factor from the TGF-β superfamily (e.g., activin A) at a concentration of about 5 ng / mL, about 7.5 ng / mL, about 8 ng / mL, about 9 ng / mL, about 10 ng / mL, about 11 ng / mL, about 12 ng / mL, about 13 ng / mL, about 14 ng / mL, about 15 ng / mL, about 16 ng / mL, about 17 ng / mL, about 18 ng / mL, about 19 ng / mL, about 20 ng / mL, about 21 ng / mL, about 22 ng / mL, about 23 ng / mL, about 24 ng / mL, about 25 ng / mL, about 26 ng / mL, about 27 ng / mL, about 28 ng / mL, about 29 ng / mL, about 30 ng / mL, about 35 ng / mL, about 40 ng / mL, about 50 ng / mL, or about 100 ng / mL. In some examples, the method includes contacting the primitive intestinal cells with a growth factor from the TGF-β superfamily (e.g., activin A) at a concentration of about 17-23 ng / ml, about 18-22 ng / ml, or about 19-21 ng / ml, etc. In some examples, the method includes contacting the primitive intestinal cells with a growth factor from the TGF-β superfamily (e.g., activin A) at a concentration of about 20 ng / ml.

[0222] Any growth factor from the FGF family that can induce primitive intestinal cells to differentiate into PDX1-positive pancreatic progenitor cells can be used (e.g., alone or with any combination of at least one BMP signaling pathway inhibitor, a growth factor from the TGF-β superfamily, at least one SHH pathway inhibitor, at least one retinoic acid signaling pathway activator, at least one protein kinase C activator, and a ROCK inhibitor). In some embodiments, the at least one growth factor from the FGF family includes keratinocyte growth factor (KGF). In some embodiments, the at least one growth factor from the FGF family is selected from the group consisting of FGF2, FGF8B, FGF10, and FGF21. In some examples, the method includes contacting the primitive intestinal cells with a growth factor from the FGF family (e.g., KGF) at a concentration of about 10 ng / mL, about 20 ng / mL, about 50 ng / mL, about 75 ng / mL, about 80 ng / mL, about 90 ng / mL, about 95 ng / mL, about 100 ng / mL, about 110 ng / mL, about 120 ng / mL, about 130 ng / mL, about 140 ng / mL, about 150 ng / mL, about 175 ng / mL, about 180 ng / mL, about 200 ng / mL, about 250 ng / mL, or about 300 ng / mL, etc. In some examples, the method includes contacting the primitive intestinal cells with a growth factor from the FGF family (e.g., KGF) at a concentration of about 20-80 ng / mL, about 30-70 ng / mL, about 40-60 ng / mL, or about 45-55 ng / mL, etc. In some examples, the method includes contacting the primitive intestinal cells with a growth factor from the FGF family (eg, KGF) at a concentration of about 50 ng / ml.

[0223] Any SHH pathway inhibitor that can induce primitive intestinal cells to differentiate into PDX1-positive pancreatic progenitor cells can be used (e.g., alone or with any combination of at least one BMP signaling pathway inhibitor, at least one growth factor from the FGF family, a growth factor from the TGF-β superfamily, at least one retinoic acid signaling pathway activator, at least one protein kinase C activator, and a ROCK inhibitor). In some embodiments, the SHH pathway inhibitor comprises Sant1. In some examples, the method includes injecting primitive gut cells into the gut at about 0.001 μM, about 0.002 μM, about 0.005 μM, about 0.01 μM, about 0.02 μM, about 0.03 μM, about 0.05 μM, about 0.08 μM, about 0.1 μM, about 0.12 μM, about 0.13 μM, about 0.14 μM, about 0.15 μM, about 0.16 μM, about 0.17 μM, about 0.18 μM, about 0.19 μM, about 0.2 μM, about 0.21 μM, about 0.22 μM, about 0.23 μM , about 0.24 μM, about 0.25 μM, about 0.26 μM, about 0.27 μM, about 0.28 μM, about 0.29 μM, about 0.3 μM, about 0.31 μM, about 0.32 μM, about 0.33 μM, about 0.34 μM, about 0.35 μM, about 0.4 μM, about 0.45 μM, about 0.5 μM, about 0.6 μM, about 0.8 μM, about 1 μM, about 2 μM, or about 5 μM. In some examples, the method includes contacting the primitive intestinal cells with an SHH pathway inhibitor (e.g., Sant1) at a concentration of about 220-280 nM, about 230-270 nM, about 240-260 nM, or about 245-255 nM. In some examples, the method includes contacting the primitive intestinal cells with an SHH pathway inhibitor (e.g., Sant1) at a concentration of about 250 nM.

[0224] Any RA signaling pathway activator that can induce primitive intestinal cells to differentiate into PDX1-positive pancreatic progenitor cells can be used (e.g., alone or with any combination of at least one BMP signaling pathway inhibitor, at least one growth factor from the FGF family, at least one SHH pathway inhibitor, at least one protein kinase C activator, and a ROCK inhibitor). In some embodiments, the RA signaling pathway activator comprises retinoic acid. In some examples, the method includes injecting primitive intestinal cells with at least about 0.02 μM, about 0.1 μM, about 0.2 μM, about 0.25 μM, about 0.3 μM, about 0.4 μM, about 0.45 μM, about 0.5 μM, about 0.55 μM, about 0.6 μM, about 0.65 μM, about 0.7 μM, about 0.75 μM, about 0.8 μM, about 0.85 μM, about 0.9 μM, about 1 μM, about 1.1 μM, about 1.2 μM, about 1.3 μM, about 1.4 μM, about 1.5 μM, about 1.6 μM, about 1.7 μM, about 1.8 μM, about 1.9 μM, about 2 μM, about 2.1 μM, about 2.2 μM, about 2.3 μM, about 2.4 μM, about 2.5 μM, about 2 ... The method includes contacting the RA signaling pathway activator (e.g., retinoic acid) at a concentration of about 0.6 μM, about 2.7 μM, about 2.8 μM, about 3 μM, about 3.2 μM, about 3.4 μM, about 3.6 μM, about 3.8 μM, about 4 μM, about 4.2 μM, about 4.4 μM, about 4.6 μM, about 4.8 μM, about 5 μM, about 5.5 μM, about 6 μM, about 6.5 μM, about 7 μM, about 7.5 μM, about 8 μM, about 8.5 μM, about 9 μM, about 9.5 μM, about 10 μM, about 12 μM, about 14 μM, about 15 μM, about 16 μM, about 18 μM, about 20 μM, about 50 μM, or about 100 μM. In some examples, the method includes contacting the primitive intestinal cells with an RA signaling pathway activator (e.g., retinoic acid) at a concentration of about 1.7-2.3 μM, about 1.8-2.2 μM, or about 1.9-2.1 μM, etc. In some examples, the method includes contacting the primitive intestinal cells with an RA signaling pathway activator (e.g., retinoic acid) at a concentration of about 2 μM.

[0225] Any PKC activator that can induce primitive intestinal cells to differentiate into PDX1-positive pancreatic progenitor cells can be used (e.g., alone or with any combination of at least one BMP signaling pathway inhibitor, at least one growth factor from the FGF family, at least one SHH pathway inhibitor, at least one RA signaling pathway activator, and a ROCK inhibitor). In some embodiments, the PKC activator comprises PdBU. In some embodiments, the PKC activator comprises TPPB. In some examples, the method involves inducing primitive intestinal cells to differentiate into PDX1-positive pancreatic progenitor cells at about 10 nM, 50 nM, 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 90 ... 00nM, 950nM, 1μM, 10μM, approx. 20μM, approx. 50μM, approx. 75μM, approx. 80μM, approx. 100μM, approx. 120μM, approx. 140μ M, approx. 150 μM, approx. 175 μM, approx. 180 μM, approx. 200 μM, approx. 210 μM, approx. 220 μM, approx. 240 μM, approx. 250 μM, approx. 260 μM , about 280 μM, about 300 μM, about 320 μM, about 340 μM, about 360 μM, about 380 μM, about 400 μM, about 420 μM, about 440 μM, about 460 μM, about 480 μM, about 500 μM, about 520 μM, about 540 μM, about 560 μM, about 580 μM, about 600 μM, about 620 μM, about 640 μM, about 660 μM, about 680 μM, about 700 μM, about 750 μM, about 800 μM, about 850 μM, about 900 μM, about 1 mM, about 2 mM, about 3 mM, about 4 mM, or about 5 mM. In some embodiments, the method includes contacting primitive intestinal cells with a PKC activator (e.g., PdBU or TPPB) at a concentration of 10 nM to 1 mM, 10 nM to 500 μM, 10 nM to 1 μM, 10 to 800 nM, 100 to 900 nM, 300 to 800 nM, 300 to 600 nM, 400 to 600 nM, 450 to 550 nM, or about 500 nM.In some examples, the method includes contacting the primitive intestinal cells with a PKC activator (e.g., PdBU or TPPB) at a concentration of about 450-550 mM, about 475-525 nM, about 490-510 nM, or about 495-505 nM, etc. In some examples, the method includes contacting the primitive intestinal cells with a PKC activator (e.g., PdBU or TPPB) at a concentration of about 500 nM. In some embodiments, the primitive intestinal cells are not treated with a PKC activator (e.g., PDBU).

[0226] Any ROCK inhibitor that can induce primitive intestinal cells to differentiate into PDX1-positive pancreatic progenitor cells can be used (e.g., alone or with any combination of at least one BMP signaling pathway inhibitor, at least one growth factor from the FGF family, at least one SHH pathway inhibitor, a PKC activator, and at least one RA signaling pathway activator). In some embodiments, the ROCK inhibitor comprises thiazovivin, Y-27632, fasudil / HA1077, or H-1152. In some embodiments, the ROCK inhibitor comprises Y-27632. In some embodiments, the ROCK inhibitor comprises thiazovivin. In some examples, the method includes injecting primitive intestinal cells with at least about 0.2 μM, about 0.5 μM, about 0.75 μM, about 1 μM, about 2 μM, about 3 μM, about 4 μM, about 5 μM, about 6 μM, about 7 μM, about 7.5 μM, about 8 μM, about 9 μM, about 10 μM, about 11 μM, about 12 μM, about 13 μM, about 14 μM, about 15 μM, about 16 μM, about 17 μM, about 18 μM, The method includes contacting the primitive intestinal cells with a ROCK inhibitor (e.g., Y-27632 or thiazovivin) at a concentration of about 19 μM, about 20 μM, about 21 μM, about 22 μM, about 23 μM, about 24 μM, about 25 μM, about 26 μM, about 27 μM, about 28 μM, about 29 μM, about 30 μM, about 35 μM, about 40 μM, about 50 μM, or about 100 μM, etc. In some examples, the method includes contacting the primitive intestinal cells with a ROCK inhibitor (e.g., Y-27632 or thiazovivin) at a concentration of about 2.2 to 2.8 μM, about 2.3 to 2.7 μM, or about 2.4 to 2.6 μM, etc. In some examples, the method includes contacting the primitive intestinal cells with a ROCK inhibitor (e.g., Y-27632 or thiazovivin) at a concentration of about 2.5 μM.

[0227] In some embodiments, the cells are further contacted with a water-soluble synthetic polymer. In some embodiments, the water-soluble synthetic polymer is polyvinyl alcohol. In some cases, the polyvinyl alcohol is at least 78% hydrolyzed, e.g., 79-81% hydrolyzed, 87-89% hydrolyzed, 87-90% hydrolyzed, or 99% hydrolyzed. In some embodiments, the polyvinyl alcohol (PVA) is 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% hydrolyzed. In some embodiments, the PVA is 80% hydrolyzed.

[0228] In some embodiments, PDX1-positive pancreatic progenitor cells can be obtained by differentiating at least a portion of the primitive intestinal cells in the population into PDX1-positive pancreatic progenitor cells, e.g., by contacting the primitive intestinal cells with retinoic acid, KGF, Sant1, DMH-1, PdBU, thiazovivin, and activin A for a suitable period of time, e.g., about 1 day, about 2 days, about 3 days, or about 4 days. In some embodiments, PDX1-positive pancreatic progenitor cells can be obtained by differentiating at least a portion of the primitive intestinal cells in the population into PDX1-positive pancreatic progenitor cells, e.g., by contacting the primitive intestinal cells with retinoic acid, KGF, Sant1, DMH-1, PdBU, thiazovivin, and activin A for about 2 days. In some embodiments, PDX1-positive pancreatic progenitor cells can be obtained by differentiating at least some of the primitive intestinal cells in a population into PDX1-positive pancreatic progenitor cells, for example, by contacting the primitive intestinal cells with retinoic acid, KGF, Sant1, DMH-1, PdBU, thiazovivin, and activin A for one day, and subsequently contacting the cells with retinoic acid, KGF, Sant1, PdBU, thiazovivin, and activin A for one day (in the absence of DMH-1). NKX6.1-positive pancreatic progenitor cells

[0229] The embodiments of the present disclosure include NKX6.1 positive pancreatic progenitor cells.The NKX6.1 positive pancreatic progenitor cells useful herein can be derived from any source or can be produced according to any suitable protocol.In some embodiments, PDX1 positive, NKX6.1 negative pancreatic progenitor cells are differentiated into PDX1 positive, NKX6.1 positive pancreatic progenitor cells.In some embodiments, NKX6.1 positive pancreatic progenitor cells are further differentiated, for example, into Ngn3 positive endocrine progenitor cells or insulin positive endocrine cells, and then guided or matured into SC-β cells.

[0230] In some aspects, a method for producing NKX6.1-positive pancreatic progenitor cells from PDX1-positive pancreatic progenitor cells includes contacting a population of cells comprising PDX1-positive pancreatic progenitor cells (e.g., under conditions that promote cell clustering and / or promote cell survival) with at least two beta cell differentiation factors comprising: a) at least one growth factor from the fibroblast growth factor (FGF) family, b) a sonic hedgehog pathway inhibitor, and optionally c) a low concentration of a retinoic acid (RA) signaling pathway activator, to induce differentiation of at least one PDX1-positive pancreatic progenitor cell in the population into an NKX6.1-positive pancreatic progenitor cell, wherein the NKX6.1-positive pancreatic progenitor cell expresses NKX6.1.

[0231] In some embodiments, the PDX1-positive, NKX6.1-positive pancreatic progenitor cells are obtained by contacting PDX1-positive pancreatic progenitor cells with i) at least one growth factor from the FGF family, ii) at least one SHH pathway inhibitor, and optionally iii) an RA signaling pathway activator to induce differentiation of at least a portion of the PDX1-positive pancreatic progenitor cells into PDX1-positive, NKX6.1-positive pancreatic progenitor cells, wherein the PDX1-positive, NKX6.1-positive pancreatic progenitor cells express PDX1 and NKX6.1.

[0232] In some embodiments, the PDX1-positive, NKX6.1-positive pancreatic progenitor cells are obtained by contacting PDX1-positive pancreatic progenitor cells with i) at least one growth factor from the FGF family, ii) at least one SHH pathway inhibitor, and optionally iii) an RA signaling pathway activator, iv) a ROCK inhibitor, and v) at least one growth factor from the TGF-β superfamily, to induce differentiation of at least a portion of the PDX1-positive pancreatic progenitor cells into PDX1-positive, NKX6.1-positive pancreatic progenitor cells. In some embodiments, PDX1-positive, NKX6.1-positive pancreatic progenitor cells are obtained by contacting PDX1-positive pancreatic progenitor cells with i) at least one growth factor from the FGF family, ii) at least one SHH pathway inhibitor, and optionally, iii) a RA signaling pathway activator, iv) a ROCK inhibitor, and v) at least one growth factor from the TGF-β superfamily. After 3, 4, or 5 days of contact, the cells are contacted with i) at least one growth factor from the FGF family, ii) at least one SHH pathway inhibitor, and optionally, iii) a RA signaling pathway activator, iv) a ROCK inhibitor, and v) at least one growth factor from the TGF-β superfamily, and vi) a PKC activator and optionally, a gamma-secretase inhibitor. In some embodiments, PDX1-positive, NKX6.1-positive pancreatic progenitor cells are obtained by contacting PDX1-positive pancreatic progenitor cells with at least one growth factor from the FGF family under conditions that promote cell clustering. In some embodiments, the growth factor from the FGF family is KGF.

[0233] In some embodiments, the disclosure provides methods of culturing a first population of cells comprising PDX1-positive, NKX6.1-negative cells in medium comprising any one or combination of: i) at least one growth factor from the FGF family, ii) at least one SHH pathway inhibitor, iii) an RA signaling pathway activator, iv) a ROCK inhibitor, and v) a growth factor from the TGF-β superfamily, for a period of about 1, 2, 3, 4, or 5 days (e.g., 2-4, 3-4, or 4-5 days), thereby generating a second population of cells. In some embodiments, the second population of cells is then incubated for about 1, 2, or 3 days (e.g., 1-2, 1-3, or 2-3 days) in a composition comprising any one or combination of: i) at least one growth factor from the FGF family, ii) at least one SHH pathway inhibitor, iii) an RA signaling pathway activator, iv) a ROCK inhibitor, v) a growth factor from the TGF-β superfamily, vi) a PKC activator, vii) a FoxO1 inhibitor, and optionally viii) a Notch signaling inhibitor.

[0234] In some embodiments, in the medium for culturing the first population of cells, the growth factor from the FGF family is present at a concentration of about 45-55 ng / ml, about 46-54 ng / ml, about 47-53 ng / ml, about 48-52 ng / ml, or about 49-51 ng / ml, the SHH pathway inhibitor is present at a concentration of about 200-300 nM, about 220-280 nM, or about 240-260 nM, and the RA syndrome inhibitor is present at a concentration of about 200-300 nM, about 220-280 nM, or about 240-260 nM. The signaling pathway activator is present at a concentration of about 1.7-2.3 μM, about 1.8-2.2 μM, or about 1.9-2.1 μM, the ROCK inhibitor is present at a concentration of about 2-3 μM, about 2.2-2.8 μM, or about 2.4-2.6 μM, and / or the growth factor from the TGF-β superfamily is present at a concentration of about 2-8 ng / ml, about 3-7 ng / ml, or about 4-6 ng / ml.

[0235] In some embodiments, in the medium for culturing the second population of cells, the growth factor from the FGF family is present at a concentration of about 45-55 ng / ml, about 46-54 ng / ml, about 47-53 ng / ml, about 48-52 ng / ml, or about 49-51 ng / ml; the SHH pathway inhibitor is present at a concentration of about 200-300 nM, about 220-280 nM, or about 240-260 nM; the RA signaling pathway activator is present at a concentration of about 1.7-2.3 μM, about 1.8-2.2 μM, or about 1.9-2.1 μM; the ROCK inhibitor is present at a concentration of about 2-3 μM, about 2.2-2.8 μM, or about 2.4-2.6 μM; and the growth factor from the TGF-β superfamily is present at a concentration of about 2-8 ng / ml (2 about -8 the PKC activator is present at a concentration of about 0.2-0.8 μM, about 0.3-0.7 μM, or about 0.4-0.6 μM; the FoxO1 inhibitor is present at a concentration of about 0.7-1.3 μM, about 0.8-1.2 μM, or about 0.9-1.1 μM; and optionally, the Notch signaling inhibitor is present at a concentration of about 1.7-2.3 μM, about 1.8-2.2 μM, or about 1.9-2.1 μM.

[0236] In some embodiments, the PDX1-positive pancreatic progenitor cells are produced from a population of pluripotent cells. In some embodiments, the PDX1-positive pancreatic progenitor cells are produced from a population of iPS cells. In some embodiments, the PDX1-positive pancreatic progenitor cells are produced from a population of ESC cells. In some embodiments, the PDX1-positive pancreatic progenitor cells are produced from a population of definitive endoderm cells. In some embodiments, the PDX1-positive pancreatic progenitor cells are produced from a population of primitive intestinal cells.

[0237] Any growth factor from the FGF family that can induce PDX1-positive pancreatic progenitor cells to differentiate into NKX6.1-positive pancreatic progenitor cells (for example, alone or with any combination of at least one SHH pathway inhibitor, ROCK inhibitor, growth factor from the TGF-β superfamily, and at least one retinoic acid signaling pathway activator) can be used in the methods provided herein. In some embodiments, the at least one growth factor from the FGF family comprises keratinocyte growth factor (KGF). In some embodiments, the at least one growth factor from the FGF family is selected from the group consisting of FGF8B, FGF10, and FGF21. In some examples, the method includes contacting the PDX1-positive pancreatic progenitor cells with a growth factor from the FGF family (e.g., KGF) at a concentration of about 10 ng / mL, about 20 ng / mL, about 50 ng / mL, about 75 ng / mL, about 80 ng / mL, about 90 ng / mL, about 95 ng / mL, about 100 ng / mL, about 110 ng / mL, about 120 ng / mL, about 130 ng / mL, about 140 ng / mL, about 150 ng / mL, about 175 ng / mL, about 180 ng / mL, about 200 ng / mL, about 250 ng / mL, or about 300 ng / mL. In some examples, the method includes contacting the PDX1-positive pancreatic progenitor cells with a growth factor from the FGF family (e.g., KGF) at a concentration of about 20-80 ng / ml, about 30-70 ng / ml, about 40-60 ng / ml, or about 45-55 ng / ml, etc. In some examples, the method includes contacting the PDX1-positive pancreatic progenitor cells with a growth factor from the FGF family (e.g., KGF) at a concentration of about 50 ng / ml.

[0238] Any SHH pathway inhibitor that can induce PDX1-positive pancreatic progenitor cells to differentiate into NKX6.1-positive pancreatic progenitor cells (for example, alone or with any combination of at least one growth factor from the FGF family, a retinoic acid signaling pathway activator, a ROCK inhibitor, and at least one growth factor from the TGF-β superfamily) can be used in the methods provided herein.In some embodiments, the SHH pathway inhibitor comprises Sant1. In some examples, the method includes administering PDX1-positive pancreatic progenitor cells to a patient at about 0.001 μM, about 0.002 μM, about 0.005 μM, about 0.01 μM, about 0.02 μM, about 0.03 μM, about 0.05 μM, about 0.08 μM, about 0.1 μM, about 0.12 μM, about 0.13 μM, about 0.14 μM, about 0.15 μM, about 0.16 μM, about 0.17 μM, about 0.18 μM, about 0.19 μM, about 0.2 μM, about 0.21 μM, about 0.22 μM, about 0.23 μM, about 0.24 μM, about 0.25 μM, about 0.26 μM, about 0.27 μM, about 0.28 μM, about 0.29 μM, about 0.30 μM, about 0.31 μM, about 0.32 μM, about 0.33 μM, about 0.34 μM, about 0.35 μM, about 0.36 μM, about 0.37 μM, about 0.38 μM, about 0.39 μM, about 10 ... The method includes contacting the cell culture medium with an SHH pathway inhibitor (e.g., Sant1) at a concentration of about 0.24 μM, about 0.25 μM, about 0.26 μM, about 0.27 μM, about 0.28 μM, about 0.29 μM, about 0.3 μM, about 0.31 μM, about 0.32 μM, about 0.33 μM, about 0.34 μM, about 0.35 μM, about 0.4 μM, about 0.45 μM, about 0.5 μM, about 0.6 μM, about 0.8 μM, about 1 μM, about 2 μM, or about 5 μM. In some examples, the method includes contacting the PDX1-positive pancreatic progenitor cells with an SHH pathway inhibitor (e.g., Sant1) at a concentration of about 220-280 nM, about 230-270 nM, about 240-260 nM, or about 245-255 nM, etc. In some examples, the method includes contacting the PDX1-positive pancreatic progenitor cells with an SHH pathway inhibitor (e.g., Sant1) at a concentration of about 250 nM.

[0239] Any RA signaling pathway activator that can induce PDX1-positive pancreatic progenitor cells to differentiate into NKX6.1-positive pancreatic progenitor cells can be used (for example, alone or with any combination of at least one growth factor from the FGF family, at least one SHH pathway inhibitor, a ROCK inhibitor, and at least one growth factor from the TGF-β superfamily).In some embodiments, the RA signaling pathway activator comprises retinoic acid. In some examples, the methods include administering PDX1-positive pancreatic progenitor cells at a concentration of about 0.02 μM, about 0.1 μM, about 0.2 μM, about 0.25 μM, about 0.3 μM, about 0.4 μM, about 0.45 μM, about 0.5 μM, about 0.55 μM, about 0.6 μM, about 0.65 μM, about 0.7 μM, about 0.75 μM, about 0.8 μM, about 0.85 μM, about 0.9 μM, about 1 μM, about 1.1 μM, about 1.2 μM, about 1.3 μM, about 1.4 μM, about 1.5 μM, about 1.6 μM, about 1.7 μM, about 1.8 μM, about 1.9 μM, about 2 μM, about 2.1 μM, about 2.2 μM, about 2.3 μM, about 2.4 μM, or about 2.5 μM. , about 2.6 μM, about 2.7 μM, about 2.8 μM, about 3 μM, about 3.2 μM, about 3.4 μM, about 3.6 μM, about 3.8 μM, about 4 μM, about 4.2 μM, about 4.4 μM, about 4.6 μM, about 4.8 μM, about 5 μM, about 5.5 μM, about 6 μM, about 6.5 μM, about 7 μM, about 7.5 μM, about 8 μM, about 8.5 μM, about 9 μM, about 9.5 μM, about 10 μM, about 12 μM, about 14 μM, about 15 μM, about 16 μM, about 18 μM, about 20 μM, about 50 μM, or about 100 μM. In some examples, the method includes contacting the PDX1-positive pancreatic progenitor cells with an RA signaling pathway activator (e.g., retinoic acid) at a concentration of about 70-130 nM, about 80-120 nM, about 90-110 nM, or about 95-105 nM, etc. In some examples, the method includes contacting the PDX1-positive pancreatic progenitor cells with an RA signaling pathway activator (e.g., retinoic acid) at a concentration of about 100 nM.

[0240] Any ROCK inhibitor that can induce PDX1-positive pancreatic progenitor cells to differentiate into NKX6.1-positive pancreatic progenitor cells can be used (for example, alone or in combination with at least one growth factor from the FGF family, at least one SHH pathway inhibitor, RA signaling pathway activator, and at least one growth factor from the TGF-β superfamily). In some embodiments, the ROCK inhibitor comprises thiazovivin, Y-27632, fasudil / HA1077, or 14-1152. In some examples, the method includes administering PDX1-positive pancreatic progenitor cells at about 0.2 μM, about 0.5 μM, about 0.75 μM, about 1 μM, about 2 μM, about 3 μM, about 4 μM, about 5 μM, about 6 μM, about 7 μM, about 7.5 μM, about 8 μM, about 9 μM, about 10 μM, about 11 μM, about 12 μM, about 13 μM, about 14 μM, about 15 μM, about 16 μM, about 17 μM, about 18 μM, about 20 μM, about 21 μM, about 22 μM, about 23 μM, about 24 μM, about 25 μM, about 26 μM, about 27 μM, about 28 μM, about 29 μM, about 30 μM, about 31 μM, about 32 μM, about 33 μM, about 34 μM, about 35 μM, about 36 μM, about 37 μM, about 38 μM, about 39 μM, about 40 μM, about 41 μM, about 42 μM, about 43 μM, about 44 μM, about 45 μM, about 46 μM, about 47 μM, about 48 μM, about 49 μM, about 50 μM, about 51 μM, about 52 μM, about 53 μM, about 54 μM, about 55 μM, about 56 μM, about 57 μM, about 58 μM, about 59 μM, about 60 μM, about 61 μM, about 62 μM, about 63 μM, about 64 μM, about 65 μM, about 66 μM, about 67 μM, about The method includes contacting the PDX1-positive pancreatic progenitor cells with a ROCK inhibitor (e.g., Y-27632 or thiazovivin) at a concentration of about 2.2-2.8 μM, about 2.3-2.7 μM, or about 2.4-2.6 μM, such as about 2.2-2.8 μM, about 2.3-2.7 μM, or about 2.4-2.6 μM. In some examples, the method includes contacting the PDX1-positive pancreatic progenitor cells with a ROCK inhibitor (e.g., Y-27632 or thiazovivin) at a concentration of about 2.5 μM.

[0241] Any activator from TGF-β superfamily can be used (for example, alone or with any combination of at least one growth factor from FGF family, at least one SHH pathway inhibitor, RA signaling pathway activator and ROCK inhibitor), which can induce PDX1 positive pancreatic progenitor cells to differentiate into NKX6.1 positive pancreatic progenitor cells.In some embodiments, the activator from TGF-β superfamily comprises activin A or GDF8. In some examples, the methods include denaturing PDX1-positive pancreatic progenitor cells to a concentration of about 0.1 ng / mL, about 0.2 ng / mL, about 0.3 ng / mL, about 0.4 ng / mL, about 0.5 ng / mL, about 0.6 ng / mL, about 0.7 ng / mL, about 0.8 ng / mL, about 1 ng / mL, about 1.2 ng / mL, about 1.4 ng / mL, about 1.6 ng / mL, about 1.8 ng / mL, about 2 ng / mL, about 2.2 ng / mL, about 2.4 ng / mL, about 2.6 ng / mL, about 2.8 ng / mL, about 3 ng / mL, about 3.2 ng / mL, about 3.4 ng / mL, about 3.6 ng / mL, about 3.8 ng / mL, about 4 ng / mL The method includes contacting the cells with a growth factor from the TGF-β superfamily (e.g., activin A) at a concentration of about 4.2 ng / mL, about 4.4 ng / mL, about 4.6 ng / mL, about 4.8 ng / mL, about 5 ng / mL, about 5.2 ng / mL, about 5.4 ng / mL, about 5.6 ng / mL, about 5.8 ng / mL, about 6 ng / mL, about 6.2 ng / mL, about 6.4 ng / mL, about 6.6 ng / mL, about 6.8 ng / mL, about 7 ng / mL, about 8 ng / mL, about 9 ng / mL, about 10 ng / mL, about 20 ng / mL, about 30 ng / mL, or about 50 ng / mL. In some examples, the method includes contacting the PDX1-positive pancreatic progenitor cells with a growth factor from the TGF-β superfamily (e.g., activin A) at a concentration of about 2-8 ng / ml, about 3-7 ng / ml, about 4-6 ng / ml, or about 4.5-5.5 ng / ml, etc. In some examples, the method includes contacting the PDX1-positive pancreatic progenitor cells with a growth factor from the TGF-β superfamily (e.g., activin A) at a concentration of about 5 ng / mL, etc.

[0242] Any FoxO1 inhibitor that can induce PDX1-positive pancreatic progenitor cells to differentiate into NKX6.1-positive pancreatic progenitor cells (for example, alone or with any combination of at least one growth factor from the FGF family, at least one retinoic acid signaling pathway activator, ROCK inhibitor, at least one growth factor from the TGF-β superfamily, PKC activator, and Notch signaling inhibitor) can be used in the methods provided herein.In some embodiments, the FoxO1 inhibitor is AS1842856. In some examples, the method includes administering PDX1-positive pancreatic progenitor cells at a concentration of about 0.1 μM, about 0.12 μM, about 0.13 μM, about 0.14 μM, about 0.15 μM, about 0.16 μM, about 0.17 μM, about 0.18 μM, about 0.19 μM, about 0.2 μM, about 0.21 μM, about 0.22 μM, about 0.23 μM, about 0.24 μM, about 0.25 μM, about 0.26 μM, about 0.27 μM, The method includes contacting PDX1-positive pancreatic progenitor cells with a FoxO1 inhibitor (e.g., AS1842856) at a concentration of about 0.28 μM, about 0.29 μM, about 0.3 μM, about 0.31 μM, about 0.32 μM, about 0.33 μM, about 0.34 μM, about 0.35 μM, about 0.4 μM, about 0.45 μM, about 0.5 μM, about 0.6 μM, about 0.8 μM, about 1 μM, about 2 μM, or about 5 μM. In some examples, the method includes contacting PDX1-positive pancreatic progenitor cells with a FoxO1 inhibitor (e.g., AS1842856) at a concentration of about 0.7-1.3 μM, about 0.8-1.2 μM, or about 0.9-1.1 μM. In some examples, the method includes contacting PDX1-positive pancreatic progenitor cells with a FoxO1 inhibitor (e.g., AS1842856) at a concentration such as about 1 μM.

[0243] Any PKC activator that can induce PDX1-positive pancreatic progenitor cells to differentiate into NKX6.1-positive pancreatic progenitor cells (for example, alone or with any combination of at least one growth factor from the FGF family, at least one retinoic acid signaling pathway activator, ROCK inhibitor, at least one growth factor from the TGF-β superfamily, FoxO1 inhibitor, and Notch signaling inhibitor) can be used in the methods provided herein.In some embodiments, the PKC activator is PDBU. In some examples, the method includes administering PDX1-positive pancreatic progenitor cells at about 0.1 μM, about 0.12 μM, about 0.13 μM, about 0.14 μM, about 0.15 μM, about 0.16 μM, about 0.17 μM, about 0.18 μM, about 0.19 μM, about 0.2 μM, about 0.21 μM, about 0.22 μM, about 0.23 μM, about 0.24 μM, about 0.25 μM, about 0.26 μM, about 0.27 μM, about 0.28 μM, about 0.29 μM, about 0.30 μM, about 0.31 μM, about 0.32 μM, about 0.33 μM, about 0.34 μM, about 0.35 μM, about 0.36 μM, about 0.37 μM, about 0.38 μM, about 0.39 μM, about 10 ... The method includes contacting PDX1-positive pancreatic progenitor cells with a PKC activator (e.g., PDBU) at a concentration of about 0.2 μM, about 0.28 μM, about 0.29 μM, about 0.3 μM, about 0.31 μM, about 0.32 μM, about 0.33 μM, about 0.34 μM, about 0.35 μM, about 0.4 μM, about 0.45 μM, about 0.5 μM, about 0.6 μM, about 0.8 μM, about 1 μM, about 2 μM, or about 5 μM. In some examples, the method includes contacting PDX1-positive pancreatic progenitor cells with a PKC activator (e.g., PDBU) at a concentration of about 0.2-0.8 μM, about 0.3-0.7 μM, about 0.4-0.6 μM, or the like. In some examples, the method includes contacting PDX1-positive pancreatic progenitor cells with a PKC activator (e.g., PDBU) at a concentration of about 0.5 μM, or the like.

[0244] Any Notch signaling inhibitor that can induce PDX1-positive pancreatic progenitor cells to differentiate into NKX6.1-positive pancreatic progenitor cells can be used in the methods provided herein (for example, alone or with any combination of at least one growth factor from the FGF family, at least one retinoic acid signaling pathway activator, ROCK inhibitor, at least one growth factor from the TGF-β superfamily, FoxO1 inhibitor, and PKC activator).In some embodiments, the Notch signaling inhibitor is XXI. In some examples, the method includes administering PDX1-positive pancreatic progenitor cells at a concentration of about 0.1 μM, about 0.12 μM, about 0.13 μM, about 0.14 μM, about 0.15 μM, about 0.16 μM, about 0.17 μM, about 0.18 μM, about 0.19 μM, about 0.2 μM, about 0.21 μM, about 0.22 μM, about 0.23 μM, about 0.24 μM, about 0.25 μM, about 0.26 μM, about 0.27 μM, or ... The method includes contacting PDX1-positive pancreatic progenitor cells with a Notch signaling inhibitor (e.g., XXI) at a concentration of about 0.28 μM, about 0.29 μM, about 0.3 μM, about 0.31 μM, about 0.32 μM, about 0.33 μM, about 0.34 μM, about 0.35 μM, about 0.4 μM, about 0.45 μM, about 0.5 μM, about 0.6 μM, about 0.8 μM, about 1 μM, about 2 μM, or about 5 μM. In some examples, the method includes contacting PDX1-positive pancreatic progenitor cells with a Notch signaling inhibitor (e.g., XXI) at a concentration of about 1.7-2.3 μM, about 1.8-2.2 μM, or about 1.9-2.1 μM. In some examples, the method includes contacting PDX1-positive pancreatic progenitor cells with a Notch signaling inhibitor (e.g., XXI) at a concentration of about 2 μM.

[0245] In some embodiments, the cells are further contacted with a water-soluble synthetic polymer. In some embodiments, the water-soluble synthetic polymer is polyvinyl alcohol. In some cases, the polyvinyl alcohol is at least 78% hydrolyzed, e.g., 79-81% hydrolyzed, 87-89% hydrolyzed, 87-90% hydrolyzed, or 99% hydrolyzed. In some embodiments, the polyvinyl alcohol (PVA) is 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% hydrolyzed. In some embodiments, the PVA is 80% hydrolyzed.

[0246] In some embodiments, PDX1-positive, NKX6.1-positive pancreatic progenitor cells are obtained by contacting PDX1-positive pancreatic progenitor cells with KGF, Sant1, and RA under conditions that promote cell clustering for a period of 5 or 6 days. In some embodiments, PDX1-positive, NKX6.1-positive pancreatic progenitor cells are obtained by contacting PDX1-positive pancreatic progenitor cells with KGF, Sant1, RA, thiazovivin, and activin A under conditions that promote cell clustering for a period of 5 or 6 days. In some embodiments, PDX1-positive, NKX6.1-positive pancreatic progenitor cells are obtained by contacting PDX1-positive pancreatic progenitor cells with KGF under conditions that promote cell clustering for a period of 5 days. In some embodiments, PDX1-positive, NKX6.1-positive pancreatic progenitor cells are obtained by contacting PDX1-positive pancreatic progenitor cells with KGF under conditions that promote cell clustering for a period of 6 days. In some embodiments, PDX1-positive, NKX6.1-positive pancreatic progenitor cells are obtained by a) contacting PDX1-positive pancreatic progenitor cells with KGF, Sant1, RA, thiazovivin, and activin A for a period of 3, 4, or 5 days (e.g., 4 days), followed by b) contacting the cells of a) with PDBU, XXI, KGF, Sant1, RA, thiazovivin, and activin A, and optionally AS1842856, for a period of 1, 2, or 3 days (e.g., 2 days). Insulin-positive endocrine cells

[0247] Embodiments of the present disclosure include insulin-positive endocrine cells (e.g., NKX6.1-positive, ISL1-positive, or β-like cells) and additional methods for generating insulin-positive endocrine cells. The insulin-positive endocrine cells useful herein can be derived from any source or generated according to any suitable protocol. In some embodiments, NKX6.1-positive pancreatic progenitor cells are differentiated into insulin-positive endocrine cells (e.g., NKX6.1-positive, ISL1-positive, or β-like cells). In some embodiments, the insulin-positive endocrine cells are further differentiated, for example, by induction or maturation into SC-β cells.

[0248] In some aspects, a method for producing insulin-positive endocrine cells from NKX6.1-positive pancreatic progenitor cells includes contacting a population of cells comprising NKX6.1-positive pancreatic progenitor cells (e.g., under conditions that promote cell clustering) with a) a TGF-β signaling pathway inhibitor, b) a thyroid hormone signaling pathway activator, c) a BMP pathway inhibitor, and / or d) a protein kinase inhibitor to induce differentiation of at least one NKX6.1-positive pancreatic progenitor cell in the population into an insulin-positive endocrine cell, wherein the insulin-positive endocrine cell expresses insulin. In some embodiments, the insulin-positive endocrine cell expresses PDX1, NKX6.1, ISL1, NKX2.2, Mafb, glis3, Sur1, Kir6.2, Znt8, SLC2A1, SLC2A3, and / or insulin.

[0249] Any TGF-β signaling pathway inhibitor that can induce the differentiation of NKX6.1-positive pancreatic progenitor cells to differentiate into insulin-positive endocrine cells can be used (e.g., alone or in combination with other β cell differentiation factors, such as thyroid hormone signaling pathway activators). In some embodiments, the TGF-β signaling pathway comprises type I TGF-β receptor kinase signaling. In some embodiments, the TGF-β signaling pathway inhibitor comprises Alk5 inhibitor II. In some examples, the method includes administering the NKX6.1 positive pancreatic progenitor cells at about 0.1 μM, about 0.5 μM, about 1 μM, about 1.5 μM, about 2 μM, about 2.5 μM, about 3 μM, about 3.5 μM, about 4 μM, about 4.5 μM, about 5 μM, about 5.5 μM, about 6 μM, about 6.5 μM, about 7 μM, about 7.5 μM, about 8 μM, about 8.5 μM, about 9 μM, about 9.5 μM, about 10 μM, about 10.5 μM, about 11 μM, about 11.5 μM, about 12 μM, about 12.5 μM, about 13 μM, about The method includes contacting the NKX6.1-positive pancreatic progenitor cells with a TGF-β signaling pathway inhibitor (e.g., an Alk5 inhibitor, e.g., Alk5 inhibitor II) at a concentration of about 13.5 μM, about 14 μM, about 14.5 μM, about 15 μM, about 15.5 μM, about 16 μM, about 16.5 μM, about 17 μM, about 17.5 μM, about 18 μM, about 18.5 μM, about 19 μM, about 19.5 μM, about 20 μM, about 25 μM, about 30 μM, about 35 μM, about 40 μM, about 45 μM, or about 50 μM. In some examples, the method includes contacting the NKX6.1-positive pancreatic progenitor cells with a TGF-β signaling pathway inhibitor (e.g., an Alk5 inhibitor, e.g., Alk5 inhibitor II) at a concentration of about 7-13 μM, about 8-12 μM, or about 9-11 μM. In some examples, the method includes contacting the NKX6.1-positive pancreatic progenitor cells with a TGF-β signaling pathway inhibitor (e.g., an Alk5 inhibitor, e.g., Alk5 inhibitor II) at a concentration such as about 10 μM.

[0250] Any thyroid hormone signaling pathway activator capable of inducing differentiation of NKX6.1-positive pancreatic progenitor cells to differentiate into insulin-positive endocrine cells can be used (e.g., alone or in combination with other beta cell differentiation factors, e.g., TGF-β signaling pathway inhibitors). In some embodiments, the thyroid hormone signaling pathway activator comprises triiodothyronine (T3). In some embodiments, the thyroid hormone signaling pathway activator comprises GC-1. In some examples, the method comprises inducing NKX6.1-positive pancreatic progenitor cells to differentiate into insulin-positive endocrine cells at about 0.1 μM, about 0.12 μM, about 0.13 μM, about 0.14 μM, about 0.15 μM, about 0.16 μM, about 0.17 μM, about 0.18 μM, about 0.19 μM, about 0.2 μM, about 0.21 μM, about 0.22 μM, about 0.23 μM, about 0.24 μM, about 0.25 μM, about 0.26 μM, about 0.27 μM, about 0.30 μM, about 0.32 μM, about 0.33 μM, about 0.34 μM, about 0.35 μM, about 0.36 μM, about 0.37 μM, about 0.38 μM, about 0.39 μM, about 0.40 μM, about 0.41 μM, about 0.42 μM, about 0.43 μM, about 0.44 μM, about 0.45 μM, about 0.46 μM, about 0.47 μM, about 0.48 μM, about 0.49 μM, about 0.50 μM, about 0.51 μM, about 0.52 μ The method includes contacting the NKX6.1-positive pancreatic progenitor cells with a thyroid hormone signaling pathway activator (e.g., GC-1) at a concentration of about 0.28 μM, about 0.29 μM, about 0.3 μM, about 0.31 μM, about 0.32 μM, about 0.33 μM, about 0.34 μM, about 0.35 μM, about 0.4 μM, about 0.45 μM, about 0.5 μM, about 0.6 μM, about 0.8 μM, about 1 μM, about 2 μM, or about 5 μM, etc. In some examples, the method includes contacting the NKX6.1-positive pancreatic progenitor cells with a thyroid hormone signaling pathway activator (e.g., GC-1) at a concentration of about 0.7-1.3 μM, about 0.8-1.2 μM, or about 0.9-1.1 μM, etc. In some examples, the method includes contacting the NKX6.1-positive pancreatic progenitor cells with a thyroid hormone signaling pathway activator (e.g., GC-1) at a concentration such as about 1 μM.

[0251] In some embodiments, the method includes contacting a population of cells (e.g., NKX6.1-positive pancreatic progenitor cells) with at least one additional factor. In some embodiments, the method includes contacting PDX1-positive, NKX6.1-positive pancreatic progenitor cells with at least one of: i) an SHH pathway inhibitor, ii) a gamma-secretase inhibitor, iii) at least one growth factor from the epidermal growth factor (EGF) family, iv) a TGF-β signaling pathway inhibitor, or vii) a thyroid hormone signaling pathway activator. In some embodiments, the method includes contacting a population of cells (e.g., NKX6.1-positive pancreatic progenitor cells) with at least one additional factor. In some embodiments, the method includes contacting PDX1-positive, NKX6.1-positive pancreatic progenitor cells with at least one of: i) an SHH pathway inhibitor, ii) an RA signaling pathway activator, iii) a gamma-secretase inhibitor, iv) at least one growth factor from the epidermal growth factor (EGF) family, v) a protein kinase inhibitor, vi) a TGF-β signaling pathway inhibitor, vii) a thyroid hormone signaling pathway activator, viiii) a wnt signaling pathway inhibitor, or ix) a PKC activator.

[0252] In some embodiments, the method includes contacting PDX1-positive, NKX6.1-positive pancreatic progenitor cells with at least one of: i) an SHH pathway inhibitor, ii) an RA signaling pathway activator, iii) a gamma-secretase inhibitor, iv) at least one growth factor from the epidermal growth factor (EGF) family, v) at least one bone morphogenetic protein (BMP) signaling pathway inhibitor, vi) a TGF-β signaling pathway inhibitor, vii) a thyroid hormone signaling pathway activator, viii) a protein kinase inhibitor, or ix) a ROCK inhibitor.

[0253] In some embodiments, the method includes contacting PDX1-positive, NKX6.1-positive pancreatic progenitor cells with at least one of: i) an SHH pathway inhibitor, ii) an RA signaling pathway activator, iii) a gamma-secretase inhibitor, iv) at least one growth factor from the epidermal growth factor (EGF) family, v) at least one bone morphogenetic protein (BMP) signaling pathway inhibitor, vi) a TGF-β signaling pathway inhibitor, vii) a thyroid hormone signaling pathway activator, viii) an epigenetic modifying compound, ix) a protein kinase inhibitor, or x) a ROCK inhibitor. In some embodiments, the method includes contacting PDX1-positive, NKX6.1-positive pancreatic progenitor cells in culture with i) an SHH pathway inhibitor, ii) an RA signaling pathway activator, iii) a gamma-secretase inhibitor, iv) at least one growth factor from the epidermal growth factor (EGF) family, v) at least one bone morphogenetic protein (BMP) signaling pathway inhibitor, vi) a TGF-β signaling pathway inhibitor, vii) a thyroid hormone signaling pathway activator, viii) an epigenetic modifying compound, ix) a protein kinase inhibitor, x) a ROCK inhibitor, xi) a PKC activator, and xii) a Wnt signaling pathway inhibitor for 1, 2, or 3 days (e.g., 1-2, 1-3, or 2-3 days), and then contacting the cells in culture with i) an SHH pathway inhibitor, ii) an RA signaling pathway activator, iii) a gamma-secretase inhibitor, iv) at least one growth factor from the epidermal growth factor (EGF) family, v) at least one bone morphogenetic protein (BMP) signaling pathway inhibitor, vi) a TGF-β signaling pathway inhibitor, vii) a thyroid hormone signaling pathway activator, viii) an epigenetic modifying compound, ix) a protein kinase inhibitor, x) a ROCK inhibitor, xi) a PKC activator, and xii) a Wnt signaling pathway inhibitor for 1, 2, or 3 days (e.g., 1-2, 1-3, or 2-3 days). a gamma-secretase inhibitor, ii) at least one growth factor from the epidermal growth factor (EGF) family, iii) at least one bone morphogenetic protein (BMP) signaling pathway inhibitor, iv) a TGF-β signaling pathway inhibitor, v) a thyroid hormone signaling pathway activator, vi) an epigenetic modifying compound, vii) a protein kinase inhibitor, and viii) a ROCK inhibitor, for a period of 1, 2, 3, 4, 5, 6, or 7 days (e.g., 1-7, 1-5, 1-3, 3-7, 3-5, 5-7, or 4-6 days) in the absence of an SHH pathway inhibitor, an RA signaling pathway activator, a Wnt signaling pathway inhibitor, a PKC activator, and / or a growth factor from the epidermal growth factor (EGF) family.

[0254] In some embodiments, in the method for generating insulin-positive endocrine cells from PDX1-positive, NKX6.1-positive pancreatic progenitor cells, some of the differentiation factors are present only during the first 1, 2, 3, 4, or 5 days of the differentiation step. In some embodiments, some of the differentiation factors, such as an SHH pathway inhibitor, an RA signaling pathway activator, a PKC activator, and at least one growth factor from the EGF family, are removed from the culture medium after the first 1, 2, or 3 days of incubation.

[0255] Any gamma-secretase inhibitor that can induce the differentiation of NKX6.1-positive pancreatic progenitor cells in the population into insulin-positive endocrine cells can be used (e.g., alone or in combination with either a TGF-β signaling pathway inhibitor and / or a thyroid hormone signaling pathway activator). In some embodiments, the gamma-secretase inhibitor comprises XXI. In some embodiments, the gamma-secretase inhibitor comprises DAPT. In some examples, the method includes administering NKX6.1 positive pancreatic progenitor cells to a patient at about 0.01 μM, about 0.02 μM, about 0.05 μM, about 0.075 μM, about 0.1 μM, about 0.2 μM, about 0.3 μM, about 0.4 μM, about 0.5 μM, about 0.6 μM, about 0.7 μM, about 0.8 μM, about 0.9 μM, about 1 μM, about 1.1 μM, about 1.2 μM, about 1.3 μM, about 1.4 μM, about 1.5 μM, about 1.6 μM, about 1.7 μM, about 1.8 μM, about 1.9 μM, about 2 μM, about 2.1 μM, about 2.2 μM, about 2.3 μM, about 2.4 μM, about 2.5 μM, about 2.6 μM, The method includes contacting the antibody with a gamma secretase inhibitor (e.g., XXI) at a concentration of about 2.7 μM, about 2.8 μM, about 2.9 μM, about 3 μM, about 3.2 μM, about 3.4 μM, about 3.6 μM, about 3.8 μM, about 4 μM, about 4.2 μM, about 4.4 μM, about 4.6 μM, about 4.8 μM, about 5 μM, about 5.2 μM, about 5.4 μM, about 5.6 μM, about 5.8 μM, about 6 μM, about 6.2 μM, about 6.4 μM, about 6.6 μM, about 6.8 μM, about 7 μM, about 8 μM, about 9 μM, about 10 μM, about 20 μM, about 30 μM, or about 50 μM. In some examples, the method includes contacting the NKX6.1-positive pancreatic progenitor cells with a gamma-secretase inhibitor (e.g., XXI) at a concentration of about 1.7-2.3 μM, about 1.8-2.2 μM, or about 1.9-2.1 μM, etc. In some examples, the method includes contacting the NKX6.1-positive pancreatic progenitor cells with a gamma-secretase inhibitor (e.g., XXI) at a concentration of about 2 μM, etc.

[0256] Any growth factor from the EGF family that can induce the differentiation of NKX6.1-positive pancreatic progenitor cells in the population into insulin-positive endocrine cells can be used (e.g., alone or in combination with either a TGF-β signaling pathway inhibitor and / or a thyroid hormone signaling pathway activator). In some embodiments, at least one growth factor from the EGF family comprises betacellulin. In some embodiments, at least one growth factor from the EGF family comprises EGF. In some examples, the method includes contacting the NKX6.1-positive pancreatic progenitor cells with a growth factor from the EGF family (e.g., betacellulin) at a concentration of about 1 ng / mL, about 2 ng / mL, about 4 ng / mL, about 6 ng / mL, about 8 ng / mL, about 10 ng / mL, about 12 ng / mL, about 14 ng / mL, about 16 ng / mL, about 18 ng / mL, about 20 ng / mL, about 22 ng / mL, about 24 ng / mL, about 26 ng / mL, about 28 ng / mL, about 30 ng / mL, about 40 ng / mL, about 50 ng / mL, about 75 ng / mL, about 80 ng / mL, about 90 ng / mL, about 95 ng / mL, about 100 ng / mL, about 150 ng / mL, about 200 ng / mL, about 250 ng / mL, or about 300 ng / mL. In some examples, the method includes contacting the NKX6.1-positive pancreatic progenitor cells with a growth factor from the EGF family (e.g., betacellulin) at a concentration of about 17-23 ng / ml, about 18-22 ng / ml, or about 19-21 ng / ml, etc. In some examples, the method includes contacting the NKX6.1-positive pancreatic progenitor cells with a growth factor from the EGF family (e.g., betacellulin) at a concentration of about 20 ng / ml, etc.

[0257] Any RA signal transduction pathway activator that can induce the differentiation of NKX6.1 positive pancreatic progenitor cells to differentiate into insulin-positive endocrine cells can be used (for example, alone or in combination with any of TGF-β signal transduction pathway inhibitors and / or thyroid hormone signal transduction pathway activators).In some embodiments, the RA signal transduction pathway activator comprises RA. In some examples, the methods include administering NKX6.1 positive pancreatic progenitor cells to a patient at about 0.02 μM, about 0.05 μM, about 0.1 μM, about 0.2 μM, about 0.25 μM, about 0.3 μM, about 0.4 μM, about 0.45 μM, about 0.5 μM, about 0.55 μM, about 0.6 μM, about 0.65 μM, about 0.7 μM, about 0.75 μM, about 0.8 μM, about 0.85 μM, about 0.9 μM, about 1 μM, about 1.1 μM, about 1.2 μM, about 1.3 μM, about 1.4 μM, about 1.5 μM, about 1.6 μM, about 1.7 μM, about 1.8 μM, about 1.9 μM, about 2 μM, about 2.1 μM, about 2.2 μM, about 2.3 μM, about 2.4 μM, about The method includes contacting the subject with a RA signaling pathway activator (e.g., retinoic acid) at a concentration of, for example, 2.5 μM, about 2.6 μM, about 2.7 μM, about 2.8 μM, about 3 μM, about 3.2 μM, about 3.4 μM, about 3.6 μM, about 3.8 μM, about 4 μM, about 4.2 μM, about 4.4 μM, about 4.6 μM, about 4.8 μM, about 5 μM, about 5.5 μM, about 6 μM, about 6.5 μM, about 7 μM, about 7.5 μM, about 8 μM, about 8.5 μM, about 9 μM, about 9.5 μM, about 10 μM, about 12 μM, about 14 μM, about 15 μM, about 16 μM, about 18 μM, about 20 μM, about 50 μM, or about 100 μM. In some examples, the method includes contacting the NKX6.1-positive pancreatic progenitor cells with an RA signaling pathway activator (e.g., retinoic acid) at a concentration of about 20-80 nM, about 30-70 nM, or about 40-60 nM, etc. In some examples, the method includes contacting the NKX6.1-positive pancreatic progenitor cells with an RA signaling pathway activator (e.g., retinoic acid) at a concentration of about 50 nM, etc.

[0258] Any SHH pathway inhibitor that can induce the differentiation of NKX6.1-positive pancreatic progenitor cells to differentiate into insulin-positive endocrine cells (for example, alone or in combination with any TGF-β signaling pathway inhibitor and / or thyroid hormone signaling pathway activator) can be used in the methods provided herein.In some embodiments, the SHH pathway inhibitor comprises Sant1. In some examples, the method includes administering NKX6.1 positive pancreatic progenitor cells at about 0.001 μM, about 0.002 μM, about 0.005 μM, about 0.01 μM, about 0.02 μM, about 0.03 μM, about 0.05 μM, about 0.08 μM, about 0.1 μM, about 0.12 μM, about 0.13 μM, about 0.14 μM, about 0.15 μM, about 0.16 μM, about 0.17 μM, about 0.18 μM, about 0.19 μM, about 0.2 μM, about 0.21 μM, about 0.22 μM, about 0.23 μM, about 0.24 μM, about 0.25 μM, about 0.26 μM, about 0.27 μM, about 0.28 μM, about 0.29 μM, about 0.30 μM, about 0.31 μM, about 0.32 μM, about 0.33 μM, about 0.34 μM, about 0.35 μM, about 0.36 μM, about 0.37 μM, about 0.38 μM, about 0.39 μM, about 10 ... The method includes contacting the subject with an SHH pathway inhibitor (e.g., Sant1) at a concentration of about 3 μM, about 0.24 μM, about 0.25 μM, about 0.26 μM, about 0.27 μM, about 0.28 μM, about 0.29 μM, about 0.3 μM, about 0.31 μM, about 0.32 μM, about 0.33 μM, about 0.34 μM, about 0.35 μM, about 0.4 μM, about 0.45 μM, about 0.5 μM, about 0.6 μM, about 0.8 μM, about 1 μM, about 2 μM, or about 5 μM. In some examples, the method includes contacting the NKX6.1-positive pancreatic progenitor cells with an SHH pathway inhibitor (e.g., Sant1) at a concentration of about 220-280 nM, about 230-270 nM, about 240-260 nM, or about 245-255 nM, etc. In some examples, the method includes contacting the NKX6.1-positive pancreatic progenitor cells with an SHH pathway inhibitor (e.g., Sant1) at a concentration of about 250 nM, etc.

[0259] Any BMP signaling pathway inhibitor that can induce the differentiation of NKX6.1-positive pancreatic progenitor cells to differentiate into insulin-positive endocrine cells can be used (for example, alone or in combination with any TGF-β signaling pathway inhibitor and / or thyroid hormone signaling pathway activator).In some embodiments, the BMP signaling pathway inhibitor comprises LDN193189 or DMH-1. In some examples, the method includes contacting the NKX6.1-positive pancreatic progenitor cells with a BMP signaling pathway inhibitor (e.g., LDN1931189) at a concentration of about 30 nM, about 40 nM, about 50 nM, about 60 nM, about 70 nM, about 80 nM, about 90 nM, about 100 nM, about 110 nM, about 120 nM, about 130 nM, about 140 nM, about 150 nM, about 160 nM, about 170 nM, about 180 nM, about 190 nM, about 200 nM, about 210 nM, about 220 nM, about 230 nM, about 240 nM, about 250 nM, about 280 nM, about 300 nM, about 400 nM, about 500 nM, or about 1 μM. In some examples, the method includes contacting the NKX6.1-positive pancreatic progenitor cells with a BMP signaling pathway inhibitor (e.g., LDN1931189) at a concentration of about 70-130 nM, about 80-120 nM, about 90-110 nM, etc. In some examples, the method includes contacting the NKX6.1-positive pancreatic progenitor cells with a BMP signaling pathway inhibitor (e.g., LDN1931189) at a concentration of about 100 nM, etc.

[0260] Any ROCK inhibitor that can induce the differentiation of NKX6.1-positive pancreatic progenitor cells in the population into insulin-positive endocrine cells can be used (e.g., alone or in combination with either a TGF-β signaling pathway inhibitor and / or a thyroid hormone signaling pathway activator). In some embodiments, the ROCK inhibitor comprises thiazovivin, Y-27632, fasudil / HA1077, or H-1152. In some embodiments, the ROCK inhibitor comprises Y-27632. In some embodiments, the ROCK inhibitor comprises thiazovivin. In some examples, the method includes administering to the patient PDX1-positive, NKX6.1-positive pancreatic progenitor cells at a concentration of about 0.2 μM, about 0.5 μM, about 0.75 μM, about 1 μM, about 2 μM, about 3 μM, about 4 μM, about 5 μM, about 6 μM, about 7 μM, about 7.5 μM, about 8 μM, about 9 μM, about 10 μM, about 11 μM, about 12 μM, about 13 μM, about 14 μM, about 15 μM, about 16 μM, about 17 μM, or about 18 μM. The method includes contacting the PDX1-positive, NKX6.1-positive pancreatic progenitor cells with a ROCK inhibitor (e.g., Y-27632 or thiazovivin) at a concentration of about 18 μM, about 19 μM, about 20 μM, about 21 μM, about 22 μM, about 23 μM, about 24 μM, about 25 μM, about 26 μM, about 27 μM, about 28 μM, about 29 μM, about 30 μM, about 35 μM, about 40 μM, about 50 μM, or about 100 μM. In some embodiments, the ROCK inhibitor comprises thiazovivin. In some examples, the method includes contacting the PDX1-positive, NKX6.1-positive pancreatic progenitor cells with a ROCK inhibitor (e.g., Y-27632 or thiazovivin) at a concentration of about 2.2-2.8 μM, about 2.3-2.7 μM, or about 2.4-2.6 μM. In some embodiments, the ROCK inhibitor comprises thiazovivin. In some examples, the method includes contacting PDX1-positive, NKX6.1-positive pancreatic progenitor cells with a ROCK inhibitor (e.g., Y-27632 or thiazovivin) at a concentration such as about 2.5 μM.

[0261] Any epigenetic modification compound that can induce the differentiation of NKX6.1-positive pancreatic progenitor cells in the population into insulin-positive endocrine cells can be used (e.g., alone or in combination with either a TGF-β signaling pathway inhibitor and / or a thyroid hormone signaling pathway activator). In some embodiments, the epigenetic modification compound comprises a histone methyltransferase inhibitor or an HDAC inhibitor. In some embodiments, the epigenetic modification compound comprises a histone methyltransferase inhibitor, such as DZNep. In some embodiments, the epigenetic modification compound comprises an HDAC inhibitor, such as KD5170. In some examples, the method includes contacting PDX1-positive, NKX6.1-positive pancreatic progenitor cells with an epigenetically modified compound (e.g., DZNep or KD5170) at a concentration of about 0.01 μM, about 0.025 μM, about 0.05 μM, about 0.075 μM, about 0.1 μM, about 0.15 μM, about 0.2 μM, about 0.5 μM, about 0.75 μM, about 1 μM, about 2 μM, about 3 μM, about 4 μM, about 5 μM, about 6 μM, about 7 μM, about 7.5 μM, about 8 μM, about 9 μM, about 10 μM, about 15 μM, about 20 μM, about 25 μM, about 30 μM, about 35 μM, about 40 μM, about 50 μM, or about 100 μM. In some examples, the method includes contacting PDX1-positive, NKX6.1-positive pancreatic progenitor cells with an epigenetically modified compound (e.g., DZNep or KD5170) at a concentration of about 70-130 nM, about 80-120 nM, or about 90-110 nM, etc. In some examples, the method includes contacting PDX1-positive, NKX6.1-positive pancreatic progenitor cells with an epigenetically modified compound (e.g., DZNep or KD5170) at a concentration of about 100 nM, etc.

[0262] Any Wnt signaling pathway inhibitor that can induce the differentiation of NKX6.1-positive pancreatic progenitor cells in the population into insulin-positive endocrine cells can be used (for example, alone or in combination with either a TGF-β signaling pathway inhibitor and / or a thyroid hormone signaling pathway activator). In some embodiments, the Wnt signaling pathway inhibitor comprises a tankyrase inhibitor. In some embodiments, the tankyrase inhibitor is NVP-TNKS656. In some examples, the method includes contacting PDX1-positive, NKX6.1-positive pancreatic progenitor cells with a Wnt signaling pathway inhibitor (e.g., a tankyrase inhibitor, e.g., NVP-TNKS656) at a concentration of about 0.1 μM, about 0.15 μM, about 0.2 μM, about 0.25 μM, about 0.3 μM, about 0.35 μM, about 0.4 μM, about 0.45 μM, about 0.5 μM, about 0.55 μM, about 0.6 μM, about 0.65 μM, about 0.7 μM, about 0.75 μM, about 0.8 μM, about 0.85 μM, about 0.9 μM, about 0.95 μM, about 1 μM, about 1.5 μM, about 2 μM, about 2.5 μM, about 3 μM, about 3.5 μM, about 4 μM, about 4.5 μM, or about 5 μM. In some examples, the method includes contacting the PDX1-positive, NKX6.1-positive pancreatic progenitor cells with a Wnt signaling pathway inhibitor (e.g., a tankyrase inhibitor, e.g., NVP-TNKS656) at a concentration of about 1.7-2.3 μM, about 1.8-2.2 μM, or about 1.9-2.1 μM, etc. In some examples, the method includes contacting the PDX1-positive, NKX6.1-positive pancreatic progenitor cells with a Wnt signaling pathway inhibitor (e.g., a tankyrase inhibitor, e.g., NVP-TNKS656) at a concentration of about 2 μM, etc.

[0263] Any PKC activator capable of inducing differentiation of NKX6.1-positive pancreatic progenitor cells in a population into insulin-positive endocrine cells can be used (e.g., alone or in combination with either a TGF-β signaling pathway inhibitor and / or a thyroid hormone signaling pathway activator). In some embodiments, the PKC activator is TPB or PDBU. In some examples, the method involves inducing differentiation of PDX1-positive, NKX6.1-positive pancreatic progenitor cells at a concentration of about 0.01 μM, about 0.025 μM, about 0.05 μM, about 0.075 μM, about 0.1 μM, about 0.15 μM, about 0.2 μM, about 0.25 μM, about 0.3 μM, about 0.35 μM, about 0.4 μM, about 0.45 μM, about 0.5 μM, about 0.55 μM, about 0.6 μM, or about 0.65 μM. , about 0.7 μM, about 0.75 μM, about 0.8 μM, about 0.85 μM, about 0.9 μM, about 0.95 μM, about 1 μM, about 2 μM, about 3 μM, about 4 μM, about 5 μM, about 6 μM, about 7 μM, about 7.5 μM, about 8 μM, about 9 μM, about 10 μM, about 15 μM, or about 20 μM. In some examples, the method includes contacting PDX1-positive, NKX6.1-positive pancreatic progenitor cells with a PKC activator (TPB or PDBU) at a concentration of about 450-550 mM, about 475-525 nM, about 490-510 nM, or about 495-505 nM. In some examples, the method includes contacting PDX1-positive, NKX6.1-positive pancreatic progenitor cells with a PKC activator (TPB or PDBU) at a concentration such as about 500 nM.

[0264] In some embodiments, the cell population is optionally contacted with a protein kinase inhibitor. In some embodiments, the cell population is not contacted with a protein kinase inhibitor. In some embodiments, the cell population is contacted with a protein kinase inhibitor. Any protein kinase inhibitor (e.g., alone or in combination with either a TGF-β signaling pathway inhibitor and / or a thyroid hormone signaling pathway activator) that can induce the differentiation of NKX6.1-positive pancreatic progenitor cells in the population into insulin-positive endocrine cells. In some embodiments, the protein kinase inhibitor comprises staurosporine. In some examples, the method comprises administering to the patient NKX6.1-positive pancreatic progenitor cells at about 0.1 nM, about 0.2 nM, about 0.3 nM, about 0.4 nM, about 0.5 nM, about 0.6 nM, about 0.7 nM, about 0.8 nM, about 0.9 nM, about 1 nM, about 1.1 nM, about 1.2 nM, about 1.3 nM, about 1.4 nM, about 1.5 nM, about 1.6 nM, about 1.7 nM, about 1.8 nM, about 1.9 nM, about 2.0 nM, about 2.1 nM, about 2.2 nM, about 2.3 nM, about 2.4 nM, about 2.5 nM, about 2.6 nM, about 2.7 nM, about 2.8 nM, about 2.9 nM, about 3.0 nM, about 3.1 nM, about 3.2 nM, about 3.3 nM, about 3.4 nM, about 3.5 nM, about 3.6 nM, about 3.7 nM, about 3.8 nM, about 3.9 nM, about 4.0 nM, about 4.1 nM, about 4.2 nM, about 4.3 nM, about 4.4 nM, about 4.5 nM, about 4.6 nM, about 4.7 nM, about 4.8 nM, about 4.9 nM, about 5.0 nM, about 5.1 nM, about 5.2 nM, about 5.3 nM, about 5.4 nM, about 5.5 nM, about 5.6 nM, about 5.7 nM, about 5.8 nM, about 5.9 nM, about 6.0 nM, about 6. The method includes contacting the NKX6.1-positive pancreatic progenitor cells with a protein kinase inhibitor (e.g., staurosporine) at a concentration of about 7 nM, about 2.8 μM, about 2.9 nM, about 3 nM, about 3.1 nM, about 3.2 nM, about 3.3 nM, about 3.4 nM, about 3.5 nM, about 3.6 nM, about 3.7 nM, about 3.8 nM, about 3.9 nM, about 4.0 nM, about 4.1 nM, about 4.2 nM, about 4.3 nM, about 4.4 nM, about 4.5 nM, about 4.6 nM, about 4.7 nM, about 4.8 μM, about 4.9 nM, or about 5 nM, etc. In some examples, the method includes contacting the NKX6.1-positive pancreatic progenitor cells with a protein kinase inhibitor (e.g., staurosporine) at a concentration of about 1 to 5 nM, about 2 to 4 nM, or about 2.5 to 3.5 nM, etc. In some examples, the method includes contacting the NKX6.1-positive pancreatic progenitor cells with a protein kinase inhibitor (eg, staurosporine) at a concentration such as about 3 nM.

[0265] In some embodiments, the cells are further contacted with a water-soluble synthetic polymer. In some embodiments, the water-soluble synthetic polymer is polyvinyl alcohol. In some cases, the polyvinyl alcohol is at least 78% hydrolyzed, e.g., 79-81% hydrolyzed, 87-89% hydrolyzed, 87-90% hydrolyzed, or 99% hydrolyzed. In some embodiments, the polyvinyl alcohol (PVA) is 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% hydrolyzed. In some embodiments, the PVA is 89% hydrolyzed.

[0266] In some embodiments, the method includes contacting a population of cells (e.g., NKX6.1-positive pancreatic progenitor cells) with XXI, Alk5i, T3 or GC-1, RA, Sant1, and betacellulin, PDBU, and NVP-TNKS656 for a period of 7 days to induce differentiation of at least one NKX6.1-positive pancreatic progenitor cell in the population into an insulin-positive endocrine cell, wherein the insulin-positive endocrine cell expresses insulin. In some embodiments, the method includes contacting a population of cells (e.g., NKX6.1-positive pancreatic progenitor cells) with XXI, Alk5i, T3 or GC-1, RA, Sant1, betacellulin, and LDN193189 for a period of 7 days to induce differentiation of at least one NKX6.1-positive pancreatic progenitor cell in the population into an insulin-positive endocrine cell, wherein the insulin-positive endocrine cell expresses insulin. In some embodiments, the one or more differentiation factors are added for only a portion of stage 5, e.g., only the first 1, 2, 3, 4, 5, or 6 days of stage 5, or only the last 1, 2, 3, 4, 5, or 6 days of stage 5. In one example, cells are contacted with an SHH signaling pathway inhibitor, a PKC activator, retinoic acid, and / or a wnt signaling pathway inhibitor for only the first 2, 3, 4, or 5 days of stage 5, after which the SHH signaling pathway inhibitor, PKC activator, retinoic acid, and / or a wnt signaling pathway inhibitor is not included in or is removed from the culture medium. In another example, cells are contacted with a BMP signaling pathway inhibitor for only the first 1, 2, or 3 days of stage 5, after which the BMP signaling pathway inhibitor is removed from the culture medium.

[0267] In some embodiments, the method includes contacting a population of cells (e.g., NKX6.1-positive pancreatic progenitor cells) with one or more metabolites. In some embodiments, the method includes contacting a population of cells (e.g., NKX6.1-positive pancreatic progenitor cells) with one or more of acetyl-CoA-related metabolites, vitamins, histone deacetylase inhibitors (HDACi), redox homeostasis regulators, one-carbon metabolic pathway intermediates, and / or glutamine. Examples of metabolites include glutamine, taurine, acetate, beta-hydroxybutyrate, biotin, and formate.

[0268] In some embodiments, the composition (e.g., medium) of the present disclosure comprises an acetyl-CoA-related metabolite. Exemplary acetyl-CoA-related metabolites include, but are not limited to, acetate, pyruvate, ketogenic amino acids, valine, leucine, isoleucine, phenylalanine, tyrosine, lysine, tryptophan, fatty acids, CoA, isovaleryl-CoA, and β-hydroxybutyrate. In some embodiments, the acetyl-CoA-related metabolite is acetate. In some embodiments, an acetyl-CoA-related metabolite is present in or added to a composition of the disclosure at a concentration of about 10 nM, about 50 nM, about 80 nM, about 100 nM, about 120 nM, about 140 nM, about 150 nM, about 200 nM, about 300 nM, about 500 nM, about 800 nM, about 1 μM, about 10 μM, about 100 μM, about 500 μM, about 800 μM, about 900 μM, about 1 mM, about 2 mM, about 3 mM, about 5 mM, or about 10 mM. In some embodiments, the acetyl-CoA-related metabolite is present in or added to a composition of the present disclosure at a concentration of about 0.01-50 mM, 0.1-50 mM, 0.5-50 mM, 0.01-20 mM, 0.1-20 mM, 0.5-20 mM, 0.01-10 mM, 0.1-10 mM, 0.5-10 mM, 0.8-25 mM, 0.8-10 mM, 0.8-5 mM, 0.8-2 mM, 0.8-1.5 mM, 0.8-1.2 mM, 0.9-1.1 mM, or 0.95-1.05 mM. In some embodiments, the acetyl-CoA-related metabolite is acetate present at a concentration of about 1 mM. In some embodiments, the acetyl-CoA-related metabolite is acetate present at a concentration of about 50-1000 nM, 50-800 nM, 50-500 nM, 50-300 nM, 50-250 nM, 100-200 nM, or 125-175 nM. In some embodiments, the acetyl-CoA-related metabolite is acetate present at a concentration of about 160 nM.

[0269] In some embodiments, the compositions (e.g., media) of the present disclosure include one or more vitamins. Exemplary vitamins include, but are not limited to, biotin, vitamin B1 (thiamine), vitamin B2 (riboflavin), vitamin B3 (niacin), vitamin B6 (pyridoxine), and vitamin B12 (cyanocobalamin). In some embodiments, the vitamin modulates fatty acid synthesis. In some embodiments, the vitamin modulates branched-chain amino acid metabolism. In some embodiments, the vitamin modulates the TCA cycle or participates in the TCA cycle as a cofactor, for example, as a cofactor for pyruvate carboxylase. In some embodiments, the vitamin is biotin. In some embodiments, the vitamin is present in or added to the compositions of the present disclosure at a concentration of about 100 nM, about 300 nM, about 500 nM, about 600 nM, about 700 nM, about 800 nM, about 900 nM, about 1 μM, about 1.5 μM, about 3 μM, about 5 μM, about 10 μM, or about 100 μM. In some embodiments, the vitamin is biotin present at a concentration of about 800 nM. In some embodiments, the vitamin is present in the compositions of the present disclosure at a concentration of about 1 nM to 500 μM, 1 nM to 100 μM, 1 nM to 10 μM, 1 nM to 1 μM, 1 nM to 800 nM, 1 nM to 600 nM, 1 nM to 400 nM, 1 nM to 300 nM, 1 nM to 200 nM, 25 nM to 500 μM, 25 nM to 100 μM, 25 nM to 10 μM, 25 nM to 1 μM, 25 nM to 800 nM, 25 nM to 600 nM, 25 nM to 400 nM, 25 nM to 300 nM, 25 nM to 200 nM, 50 nM to 5 The compound is present or added at a concentration of 100 μM, 50 nM to 100 μM, 50 nM to 10 μM, 50 nM to 1 μM, 50 nM to 800 nM, 50 nM to 600 nM, 50 nM to 400 nM, 50 nM to 300 nM, 50 nM to 200 nM, 100 nM to 500 μM, 100 nM to 100 μM, 100 nM to 10 μM, 100 nM to 1 μM, 100 nM to 800 nM, 100 nM to 600 nM, 100 nM to 400 nM, 100 nM to 300 nM, or 100 nM to 200 nM.

[0270] In some embodiments, the compositions (e.g., media) of the present disclosure comprise a histone deacetylase inhibitor (HDACi). Exemplary histone deacetylase inhibitors (HDACi) include β-hydroxybutyrate, butyrate, Class I HDACi, Class IIA HDACi, Class IIB HDACi, Class III HDACi, Class IV ... HDACi, HDAC-1, HDAC-2, HDAC-3, HDAC-4, HDAC-5, HDAC-6, HDAC-7, HDAC-8, HDAC-9, HDAC-10, HDAC-11, sirtuin, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, SIRT7, vorinostat (suberoylanilide hydroxamic acid, SAHA, MK0683), entinostat (MS-275, SNDX-275), panobinostat (LBH589, NVP-LBH589), trichostatin A (TSA), mocetinostat (MGCD0103, MG0103), GSK3117391 (GSK3117391A, HDAC-IN-3), BRD3308, tubastatin A TFA (Tubastatin A trifluoroacetate), Tubastatin A, SIS17, NKL 22, BML-210 (CAY10433), TC-H 106, SR-4370, Belinostat (PXD101, NSC726630, PX-105684), Romidepsin (FK228, Depsipeptide, FR 901228, NSC 630176), MC1568, Gibinostat (ITF2357), Dacinostat (LAQ824, NVP-LAQ824), CUDC-101, Xynostat (JNJ-26481585), Prasinostat (SB939), PCI-34051, Droxinostat (NS 41080), abexinostat (PCI-24781), abexinostat (PCI-24781, CRA-024781), RGFP966, AR-42 (HDAC-42), ricolinostat (ACY-1215, rosirinostat), valproic acid sodium salt (sodium valproate), tacedinaline (CI994, PD-123654, GOE-5549, acetyldinaline), fimepinostat (CUDC-907), sodium butyrate (NaB), curcumin, diferuloylmethane, M344, tubacin,RG2833 (RGFP109), RG2833 (RGFP109), resminostat (RAS2410), divalproex sodium, scriptaid (GCK 1026), sodium phenylbutyrate, sinapinic acid (sinapic acid), TMP269, santacruzamate A (CAY10683), TMP195 (TFMO 2), valproic acid (VPA), UF010, tasquinimod (ABR-215050), SKLB-23bb, isoguanosine, sulforaphane, BRD73954, citalinostat (ACY-241, HDAC-IN-2), suberohydroxamic acid, splitomycin, HPOB, LMK-235, biphenyl-4-sulfonyl chloride (p-phenylbenzenesulfonyl, 4-phenylbenzenesulfonyl, p-biphenylsulfonyl), nextulastat A, TH34, tushidinostat (chidamide, HBI-8000, CS-055), (-)-parthenolide, WT161, CAY10603, CAY10603, ACY-738, raddeanin A, tinostamustin (EDO-S101), domatinostat (4SC-202), and BG45. In some embodiments, the HDACi is beta-hydroxybutyric acid. In some embodiments, the HDACi is present or added to the compositions of the present disclosure at a concentration of about 100 nM, about 300 nM, about 500 nM, about 600 nM, about 700 nM, about 800 nM, about 900 nM, about 1 μM, about 1.5 μM, about 3 μM, about 5 μM, about 10 μM, or about 100 μM. In some embodiments, the HDACi is beta-hydroxybutyric acid present at a concentration of about 200 nM. In some embodiments, the HDACi is present in the compositions of the present disclosure at a concentration of about 1 nM to 500 μM, 1 nM to 100 μM, 1 nM to 10 μM, 1 nM to 1 μM, 1 nM to 800 nM, 1 nM to 600 nM, 1 nM to 400 nM, 1 nM to 300 nM, 1 nM to 200 nM, 25 nM to 500 μM, 25 nM to 100 μM, 2 5nM~10μM, 25nM~1μM, 25nM~800nM, 25nM~600nM, 25nM~400nM, 25nM~300nM, 25nM~2 00nM, 50nM~500μM, 50nM~100μM, 50nM~10μM, 50nM~1μM, 50nM~800nM, 50nM~600nM,It is present or added at a concentration of 50nM to 400nM, 50nM to 300nM, 50nM to 200nM, 100nM to 500μM, 100nM to 100μM, 100nM to 10μM, 100nM to 1μM, 100nM to 800nM, 100nM to 600nM, 100nM to 400nM, 100nM to 300nM, or 100nM to 200nM.

[0271] In some embodiments, the composition (e.g., medium) of the present disclosure comprises a redox homeostasis regulator. Exemplary redox homeostasis regulators include, but are not limited to, taurine, respiratory chain regulators, free radical scavengers, mitochondrial protein synthesis regulators, sulfur compounds in onions, anthocyanins, beta-carotene, catechins, copper, cryptoxanthin, flavonoids, indoles, isoflavonoids, lignans, lutein, lycopene, alpha-lipoic acid, ellagic acid, manganese, polyphenols, selenium, glutathione, vitamin A, vitamin C, vitamin E, zinc, superoxide dismutase, GSHPx, Prx-I, catalase, and coenzyme Q10. In some embodiments, the redox homeostasis regulator is taurine. In some embodiments, the redox homeostasis regulator is present or added to the composition of the present disclosure at a concentration of about 100 nM, about 500 nM, 1 μM, about 10 μM, about 20 μM, about 30 μM, about 40 μM, about 50 μM, about 60 μM, about 70 μM, about 80 μM, about 90 μM, about 100 μM, about 110 μM, about 110 μM, about 150 μM, or about 200 μM. In some embodiments, the redox homeostasis regulator is taurine. In some embodiments, the redox homeostasis regulator is taurine present at a concentration of about 90 μM.In some embodiments, the redox homeostasis regulator intermediate is between about 100 nM and 1 mM, 500 nM and 1 mM, 1 μM and 1 mM, 10 μM and 1 mM, 20 μM and 1 mM, 30 μM and 1 mM, 30 μM and 1 mM, 40 μM and 1 mM, 50 μM and 1 mM, 60 μM and 1 mM, 70 μM and 1 mM, 80 μM and 1 mM, 100 nM and 250 μM, 500 nM and 250 μM, 1 μM and 250 μM, 10 μM and 250 μM, 20 μM and 250 μM, 30 μM and 250 μM ...250 μM, 40 μM and 250 μM, 50 μM and 250 μ It is present or added at a concentration of 50 μM, 30 μM to 250 μM, 40 μM to 250 μM, 50 μM to 250 μM, 60 μM to 250 μM, 70 μM to 250 μM, 100 nM to 100 μM, 500 nM to 100 μM, 1 μM to 100 μM, 10 μM to 100 μM, 20 μM to 100 μM, 30 μM to 100 μM, 40 μM to 100 μM, 50 μM to 100 μM, 60 μM to 100 μM, 70 μM to 100 μM, or 80 μM to 100 μM.

[0272] In some embodiments, the composition (e.g., medium) of the present disclosure comprises a one-carbon metabolic pathway intermediate. Exemplary one-carbon metabolic pathway intermediates include, but are not limited to, formic acid, tetrahydrofolic acid (THF), 10-formyl THF; 5,10-meTHF; 5,10-meTHF; and 10-formyl THF. In some embodiments, the one-carbon metabolic pathway intermediate is formic acid present at a concentration of about 50 μM. In some embodiments, the one-carbon metabolic pathway intermediate is at a concentration of about 100 nM to 1 mM, 500 nM to 1 mM, 1 μM to 1 mM, 10 μM to 1 mM, 20 μM to 1 mM, 30 μM to 1 mM, 100 nM to 250 μM, 500 nM to 250 μM, 1 μM to 250 μM, 10 μM to 250 μM, 20 μM to 250 μM, 30 μM to 250 μM, 100 nM to 100 μM , 500 nM to 100 μM, 1 μM to 100 μM, 10 μM to 100 μM, 20 μM to 100 μM, 30 μM to 100 μM, 100 nM to 60 μM, 500 nM to 60 μM, 1 μM to 60 μM, 10 μM to 60 μM, 20 μM to 60 μM, 30 μM to 60 μM, 40 μM to 60 μM, or 45 μM to 55 μM.

[0273] In some embodiments, the compositions (e.g., media) of the present disclosure include glutamine. Thus, in some embodiments, the compositions and methods of the present disclosure utilize glutamine in a form with increased bioavailability, such as a free glutamine form, e.g., a non-dipeptide form, a non-alanine-glutamine dipeptide form (e.g., a non-alanyl-l-glutamine form), a non-glycine-glutamine dipeptide form (e.g., a non-glycyl-l-glutamine form); a form in which glutamine is not conjugated to another amino acid or stabilizing moiety; a monomeric form, a free form, or a combination thereof. In some embodiments, glutamine is provided as a protein hydrolysate. In some embodiments, glutamine is present in or added to the compositions of the present disclosure at a concentration of 0.5-20 mM, 0.5-10 mM, 0.5-5 mM, 1-5 mM, 2-5 mM, or 1 mM-10 mM. In some embodiments, glutamine is present in or added to a composition of the present disclosure at a concentration of 3.8-4.2 mM. In some embodiments, glutamine is present in or added to a composition of the present disclosure at a concentration of 1-10, 1-7, 1-8, 1-6, 1-5, 1-4, 2-10, 2-7, 2-8, 2-6, 2-5, 2-4, 3-10, 3-7, 3-8, 3-6, 3-5, 3-4, 3.5-4.5, 3.8-4.2, or 3.9-4.1 mM. In some embodiments, glutamine is present in or added to a composition of the present disclosure at a concentration of about 4 mM. In some embodiments, at least 0.5 mM, 0.6 mM, 0.7 mM, 0.8 mM, 0.9 mM, 1 mM, 1.5 mM, 2 mM, 2.5 mM, 3 mM, 3.5 mM, 4 mM, 4.5 mM, or 5 mM of the glutamine is not in the dipeptide form.In some embodiments, at least 500 μM, at least 750 μM, at least 1 mM, at least 1.5 mM, at least 2 mM, at least 2.5 mM, at least 2.6 mM, at least 2.7 mM, at least 2.8 mM, at least 2.9 mM, at least 3 mM, at least 3.1 mM, at least 3.2 mM, at least 3.3 mM, at least 3.4 mM, at least 3.5 mM, at least 3.6 mM, at least 3.7 mM, at least 3.8 mM, at least 3.9 mM, at least 4 mM, at least 5 mM, at least 5.5 mM, at least 6 mM, at least 6.5 mM, at least 7 mM, at least 7.5 mM, at least 8 mM, at least 8.5 mM, at least 9 mM, at least 9.5 mM, or at least 10 mM of the glutamine is in free form.

[0274] In some embodiments, the method includes culturing a population of cells (e.g., NKX6.1-positive pancreatic progenitor cells) in a medium to induce differentiation of at least one NKX6.1-positive pancreatic progenitor cell in the population into an insulin-positive endocrine cell, wherein the insulin-positive endocrine cell expresses insulin.

[0275] Embodiments of the present disclosure include treating a cell population comprising PDX1-positive, NKX6.1-positive pancreatic progenitor cells with a PKC activator and / or a wnt signaling pathway inhibitor, resulting in an increase in the percentage of pancreatic alpha cells, an increase in the percentage of pancreatic delta cells, an increase in the percentage of pancreatic beta cells, a decrease in the percentage of EC cells, or any combination thereof, in the cell population of pancreatic endocrine cells generated according to the methods disclosed herein.

[0276] In some embodiments, the method includes contacting a population of cells comprising PDX1-positive, NKX6.1-positive pancreatic progenitor cells with a first composition comprising a FOXO1 inhibitor, a Notch signaling inhibitor, a PKC activator, a ROCK inhibitor, a growth factor from the TGF-β superfamily, a growth factor from the FGF family, a RA signaling pathway activator, and an SHH pathway inhibitor for 1-2 days, thereby obtaining a first transformed cell population comprising PDX1-positive, NKX6.1-positive pancreatic progenitor cells; and contacting the first transformed cell population comprising PDX1-positive, NKX6.1-positive pancreatic progenitor cells with a second composition comprising a PKC activator, a Notch signaling inhibitor, a TGF-β signaling pathway inhibitor, a TH signaling pathway activator, a BMP pathway inhibitor, a ROCK inhibitor, retinoic acid, and an EGF family growth factor, a Wnt signaling pathway inhibitor, and / or an epigenetic modifying compound for 1-2 days, thereby obtaining a second transformed cell population comprising NKX6.1-positive, ISL1-positive endocrine cells. Pancreatic beta cells

[0277] Aspects of the present disclosure include generating and additional methods of generating pancreatic β cells (e.g., non-native pancreatic β cells / SC-β cells), which in some embodiments resemble endogenous mature β cells in morphology and function, yet are still distinct from native β cells.

[0278] In some embodiments, the insulin-positive pancreatic endocrine cells generated using the methods provided herein can form cell clusters, alone or together with other types of cells, e.g., their precursors, e.g., stem cells, definitive endoderm cells, primitive gut cells, PDX1-positive pancreatic progenitor cells, or NKX6.1-positive pancreatic progenitor cells.

[0279] In some embodiments, any of the cells or populations of cells disclosed herein are present in cell clusters. In some embodiments, the present disclosure provides compositions comprising one or more cell clusters. In some embodiments, the composition comprises 500-20,000, 500-15,000, 500-10,000, 500-5,000, 500-2,000, 500-1,000, 1,000-20,000, 1,000-15,000, 1,000-10,000, 1,000-5,000, 1,000-2,000, 2,000-20,000, 2,000-15,000, 2,000-10,000, 2,000-5,000, 5,000-20,000, 5,000-15,000, 5,000-10,000, 10,000-20,000, 10,000-15,000, 15,000-20,000, or 3,000-9,000 cell clusters. In some aspects, provided herein are cell clusters that resemble the functions and characteristics of endogenous pancreatic islets, such as those that can mimic the function of endogenous pancreatic islets in regulating metabolism, e.g., glucose metabolism, in a subject.

[0280] In some embodiments, the compositions or cell populations of the present disclosure comprise NKX6.1-positive, ISL-positive cells that express lower levels of MAFA than NKX6.1-positive, ISL-positive cells from the pancreas of a healthy control adult subject. In some embodiments, the compositions or cell populations comprise NKX6.1-positive, ISL-positive cells that express higher levels of MAFB than NKX6.1-positive, ISL-positive cells from the pancreas of a healthy control adult subject. In some embodiments, the compositions or cell populations comprise NKX6.1-positive, ISL-positive cells that express higher levels of SIX2, HOPX, IAPP, and / or UCN3 than NKX6.1-positive, ISL-positive cells from the pancreas of a healthy control adult subject.

[0281] In some embodiments, the compositions or cell populations of the present disclosure comprise NKX6.1-positive, ISL-positive cells that do not express MAFA. In some embodiments, the compositions or cell populations comprise NKX6.1-positive, ISL-positive cells that express MAFB.

[0282] In some embodiments, a cell population comprising insulin-positive endocrine cells can be directly induced to mature into SC-β cells without the addition of any exogenous differentiation factors (e.g., an inhibitor of the TGF-β signaling pathway, a thyroid hormone signaling pathway activator, a PKC activator, a growth factor from the TGF-β superfamily, the FGF family, or the EGF family, an SHH signaling pathway inhibitor, a γ-secretase inhibitor, a ROCK inhibitor, or a BMP signaling pathway inhibitor). In some embodiments, the methods provided herein comprise contacting a cell population comprising NKX6.1-positive, ISL1-positive endocrine cells with serum albumin protein, a TGF-β signaling pathway inhibitor, an SHH pathway inhibitor, a TH signaling pathway activator, a protein kinase inhibitor, a ROCK inhibitor, a BMP signaling pathway inhibitor, and / or an epigenetic modification compound. In some embodiments, the methods provided herein comprise contacting a cell population comprising NKX6.1-positive, ISL1-positive endocrine cells with human serum albumin protein. In some embodiments, the methods provided herein comprise contacting a cell population comprising NKX6.1-positive, ISL1-positive endocrine cells with a PKC activator.

[0283] In some embodiments, a cell population comprising insulin-positive endocrine cells can be induced to mature into SC-β cells by contacting the insulin-positive endocrine cells with a differentiation factor. The differentiation factor can include at least one inhibitor of the TGF-β signaling pathway and an activator of the thyroid hormone signaling pathway, as described herein. In some embodiments, SC-β cells can be obtained by contacting a cell population comprising insulin-positive endocrine cells with Alk5i and T3 or GC-1.

[0284] In some embodiments, the methods provided herein include contacting a cell population comprising NKX6.1-positive, ISL1-positive endocrine cells with (i) a growth factor from the FGF family, (ii) a TGF-β signaling pathway inhibitor, (iii) a thyroid hormone signaling pathway activator, (iv) an epigenetic modifying compound, (v) a protein kinase inhibitor, (vi) a ROCK inhibitor, (vii) a BMP signaling pathway inhibitor, and (viii) a lipase inhibitor for about 1, 2, or 5 days. In some embodiments, the contacting is for about 3 days.

[0285] Any TGF-β signaling pathway inhibitor that can induce differentiation of insulin-positive endocrine cells to mature into SC-β cells can be used (e.g., alone or in combination with other β cell differentiation factors, such as thyroid hormone signaling pathway activators). In some embodiments, the TGF-β signaling pathway comprises type I TGF-β receptor kinase signaling. In some embodiments, the TGF-β signaling pathway inhibitor comprises Alk5 inhibitor II. In some examples, the method comprises injecting insulin-positive endocrine cells with at least about 0.1 μM, about 0.5 μM, about 1 μM, about 1.5 μM, about 2 μM, about 2.5 μM, about 3 μM, about 3.5 μM, about 4 μM, about 4.5 μM, about 5 μM, about 5.5 μM, about 6 μM, about 6.5 μM, about 7 μM, about 7.5 μM, about 8 μM, about 8.5 μM, about 9 μM, about 9.5 μM, about 10 μM, about 10.5 μM, about 11 μM, about 11.5 μM, about 12 μM, about 12.5 μM, about 13 μM, about The method includes contacting the insulin-positive endocrine cells with a TGF-β signaling pathway inhibitor (e.g., an Alk5 inhibitor, e.g., Alk5 inhibitor II) at a concentration of about 13.5 μM, about 14 μM, about 14.5 μM, about 15 μM, about 15.5 μM, about 16 μM, about 16.5 μM, about 17 μM, about 17.5 μM, about 18 μM, about 18.5 μM, about 19 μM, about 19.5 μM, about 20 μM, about 25 μM, about 30 μM, about 35 μM, about 40 μM, about 45 μM, or about 50 μM. In some examples, the method includes contacting the insulin-positive endocrine cells with a TGF-β signaling pathway inhibitor (e.g., an Alk5 inhibitor, e.g., Alk5 inhibitor II) at a concentration of about 7-13 μM, about 8-12 μM, or about 9-11 μM. In some examples, the method includes contacting the insulin-positive endocrine cells with a TGF-β signaling pathway inhibitor (e.g., an Alk5 inhibitor, e.g., Alk5 inhibitor II) at a concentration such as about 10 μM.

[0286] Any thyroid hormone signaling pathway activator capable of inducing differentiation of insulin-positive endocrine cells to mature into SC-β cells can be used (e.g., alone or in combination with other β cell differentiation factors, e.g., TGF-β signaling pathway inhibitors). In some embodiments, the thyroid hormone signaling pathway activator comprises triiodothyronine (T3). In some embodiments, the thyroid hormone signaling pathway activator comprises GC-1. In some examples, the method comprises inducing insulin-positive endocrine cells to mature into SC-β cells at concentrations of about 0.1 μM, about 0.12 μM, about 0.13 μM, about 0.14 μM, about 0.15 μM, about 0.16 μM, about 0.17 μM, about 0.18 μM, about 0.19 μM, about 0.2 μM, about 0.21 μM, about 0.22 μM, about 0.23 μM, about 0.24 μM, about 0.25 μM, about 0.26 μM, about 0.27 μM, or about 0.3 μM. The method includes contacting the insulin-positive endocrine cells with a thyroid hormone signaling pathway activator (e.g., GC-1) at a concentration of about 28 μM, about 0.29 μM, about 0.3 μM, about 0.31 μM, about 0.32 μM, about 0.33 μM, about 0.34 μM, about 0.35 μM, about 0.4 μM, about 0.45 μM, about 0.5 μM, about 0.6 μM, about 0.8 μM, about 1 μM, about 2 μM, or about 5 μM. In some examples, the method includes contacting the insulin-positive endocrine cells with a thyroid hormone signaling pathway activator (e.g., GC-1) at a concentration of about 0.7-1.3 μM, about 0.8-1.2 μM, or about 0.9-1.1 μM. In some examples, the method includes contacting the insulin-positive endocrine cells with a thyroid hormone signaling pathway activator (e.g., GC-1) at a concentration of about 1 μM.

[0287] Any BMP signaling pathway inhibitor that can induce the differentiation of insulin-positive endocrine cells to mature into SC-β cells can be used (e.g., alone or in combination with either a TGF-β signaling pathway inhibitor and / or a thyroid hormone signaling pathway activator). In some embodiments, the BMP signaling pathway inhibitor comprises LDN193189 or DMH-1. In some examples, the method includes contacting insulin-positive endocrine cells with a BMP signaling pathway inhibitor (e.g., LDN1931189) at a concentration such as about 30 nM, about 40 nM, about 50 nM, about 60 nM, about 70 nM, about 80 nM, about 90 nM, about 100 nM, about 110 nM, about 120 nM, about 130 nM, about 140 nM, about 150 nM, about 160 nM, about 170 nM, about 180 nM, about 190 nM, about 200 nM, about 210 nM, about 220 nM, about 230 nM, about 240 nM, about 250 nM, about 280 nM, about 300 nM, about 400 nM, about 500 nM, or about 1 μM. In some examples, the method includes contacting insulin-positive endocrine cells with a BMP signaling pathway inhibitor (e.g., LDN1931189) at a concentration of about 70-130 nM, about 80-120 nM, about 90-110 nM, etc. In some examples, the method includes contacting NKX6.1-positive pancreatic progenitor cells with a BMP signaling pathway inhibitor (e.g., LDN1931189) at a concentration of about 100 nM, etc.

[0288] Any ROCK inhibitor that can induce differentiation of insulin-positive endocrine cells to mature into SC-β cells can be used (e.g., alone or in combination with either a TGF-β signaling pathway inhibitor and / or a thyroid hormone signaling pathway activator). In some embodiments, the ROCK inhibitor comprises thiazovivin, Y-27632, fasudil / HA1077, or H-1152. In some embodiments, the ROCK inhibitor comprises Y-27632. In some embodiments, the ROCK inhibitor comprises thiazovivin. In some examples, the method includes injecting insulin-positive endocrine cells with at least one of about 0.2 μM, about 0.5 μM, about 0.75 μM, about 1 μM, about 2 μM, about 3 μM, about 4 μM, about 5 μM, about 6 μM, about 7 μM, about 7.5 μM, about 8 μM, about 9 μM, about 10 μM, about 11 μM, about 12 μM, about 13 μM, about 14 μM, about 15 μM, about 16 μM, about 17 μM, about 18 μM, about 20 μM, about 21 μM, about 22 μM, about 23 μM, about 24 μM, about 25 μM, about 26 μM, about 27 μM, about 28 μM, about 29 μM, about 30 μM, about 31 μM, about 32 μM, about 33 μM, about 34 μM, about 35 μM, about 36 μM, about 37 μM, about 38 μM, about 39 μM, about 40 μM, about 41 μM, about 42 μM, about 43 μM, about 44 μM, about 45 μM, about 46 μM, about 47 μM, about 48 μM, about 49 μM, about 50 μM, about 51 μM, about 52 μM, about 53 μM, about 54 μM, about 55 μM, about 56 μM, about 57 μM, about 58 μM, about 59 μM, about 60 μM, about 61 μM, about 62 μM, about 63 μM, about 64 μM, about 65 μM, about 66 μM, about 67 μM, about 6 The method includes contacting the insulin-positive endocrine cells with a ROCK inhibitor (e.g., Y-27632 or thiazovivin) at a concentration of about 2.2-2.8 μM, about 2.3-2.7 μM, or about 2.4-2.6 μM, or the like. In some embodiments, the ROCK inhibitor comprises thiazovivin. In some examples, the method includes contacting the insulin-positive endocrine cells with a ROCK inhibitor (e.g., Y-27632 or thiazovivin) at a concentration of about 2.2-2.8 μM, about 2.3-2.7 μM, or about 2.4-2.6 μM, or the like. In some embodiments, the ROCK inhibitor comprises thiazovivin. In some examples, the method includes contacting insulin-positive endocrine cells with a ROCK inhibitor (eg, Y-27632 or thiazovivin) at a concentration such as about 2.5 μM.

[0289] Any epigenetic modification compound that can induce the differentiation of insulin-positive endocrine cells to mature into SC-β cells can be used (e.g., alone or in combination with either a TGF-β signaling pathway inhibitor and / or a thyroid hormone signaling pathway activator). In some embodiments, the epigenetic modification compound comprises a histone methyltransferase inhibitor or an HDAC inhibitor. In some embodiments, the epigenetic modification compound comprises a histone methyltransferase inhibitor, such as DZNep. In some embodiments, the epigenetic modification compound comprises an HDAC inhibitor, such as KD5170. In some examples, the method includes contacting insulin-positive endocrine cells with an epigenetic modifying compound (e.g., DZNep or KD5170) at a concentration of about 0.01M, about 0.025 μM, about 0.05 μM, about 0.075 μM, about 0.1 μM, about 0.15 μM, about 0.2 μM, about 0.5 μM, about 0.75 μM, about 1 μM, about 2 μM, about 3 μM, about 4 μM, about 5 μM, about 6 μM, about 7 μM, about 7.5 μM, about 8 μM, about 9 μM, about 10 μM, about 15 μM, about 20 μM, about 25 μM, about 30 μM, about 35 μM, about 40 μM, about 50 μM, or about 100 μM, such as about 0.01M, about 0.025 μM, about 0.05 μM, about 0.075 μM, about 0.1 μM, about 0.15 μM, about 0.2 μM, about 0.5 μM, about 0.75 μM, about 1 μM, about 2 μM, about 3 μM, about 4 μM, about 5 μM, about 6 μM, about 7 μM, about 7.5 μM, about 8 μM, about 9 μM, about 10 μM, about 15 μM, about 20 μM, about 25 μM, about 30 μM, about 35 μM, about 40 μM, about 50 μM, or about 100 μM, to mature into SC-β cells. In some examples, the method includes contacting insulin-positive endocrine cells with an epigenetic modifying compound (e.g., DZNep or KD5170) at a concentration of about 70-130 nM, about 80-120 nM, or about 90-110 nM, etc., to mature into SC-β cells. In some examples, the method includes contacting insulin-positive endocrine cells with an epigenetic modifying compound (e.g., DZNep or KD5170) at a concentration of about 100 nM, etc., to mature into SC-β cells.

[0290] Any protein kinase inhibitor (e.g., alone or in combination with either a TGF-β signaling pathway inhibitor and / or a thyroid hormone signaling pathway activator) that can induce the differentiation of insulin-positive endocrine cells to mature into SC-β cells. In some embodiments, the protein kinase inhibitor comprises staurosporine. In some examples, the method comprises inducing insulin-positive endocrine cells to about 0.1 nM, about 0.2 nM, about 0.3 nM, about 0.4 nM, about 0.5 nM, about 0.6 nM, about 0.7 nM, about 0.8 nM, about 0.9 nM, about 1 nM, about 1.1 nM, about 1.2 nM, about 1.3 nM, about 1.4 nM, about 1.5 nM, about 1.6 nM, about 1.7 nM, about 1.8 nM, about 1.9 nM, about 2.0 nM, about 2.1 nM, about 2.2 nM, about 2.3 nM, about 2.4 nM, about 2.5 nM, about 2.6 nM, about 2.7 nM, about 2.8 nM, about 2.9 nM, about 3.0 nM, about 3.1 nM, about 3.2 nM, about 3.3 nM, about 3.4 nM, about 3.5 nM, about 3.6 nM, about 3.7 nM, about 3.8 nM, about 3.9 nM, about 4.0 nM, about 4.1 nM, about 4.2 nM, about 4.3 nM, about 4.4 nM, about 4.5 nM, about 4.6 nM, about 4.7 nM, about 4.8 nM, about 4.9 nM, about 5.0 nM, about 5.1 nM, about 5.2 nM, about 5.3 nM, about 5.4 nM, about 5.5 nM, about 5.6 nM, about 5.7 nM, about 5.8 nM, about 5.9 nM, about 6.0 nM, about 6.1 nM, about 6.2 nM The method includes contacting the insulin-positive endocrine cells with a protein kinase inhibitor (e.g., staurosporine) at a concentration of about 7 nM, about 2.8 μM, about 2.9 nM, about 3 nM, about 3.1 nM, about 3.2 nM, about 3.3 nM, about 3.4 nM, about 3.5 nM, about 3.6 nM, about 3.7 nM, about 3.8 nM, about 3.9 nM, about 4.0 nM, about 4.1 nM, about 4.2 nM, about 4.3 nM, about 4.4 nM, about 4.5 nM, about 4.6 nM, about 4.7 nM, about 4.8 μM, about 4.9 nM, or about 5 nM, etc. In some examples, the method includes contacting the insulin-positive endocrine cells with a protein kinase inhibitor (e.g., staurosporine) at a concentration of about 1 to 5 nM, about 2 to 4 nM, or about 2.5 to 3.5 nM, etc. In some examples, the method includes contacting the insulin-positive endocrine cells with a protein kinase inhibitor (eg, staurosporine) at a concentration such as about 3 nM.

[0291] In some embodiments, the method includes contacting a population of cells (e.g., NKX6.1-positive, ISL1-positive, insulin-positive cells) with one or more metabolites. In some embodiments, the method includes contacting a population of cells (e.g., NKX6.1-positive, ISL1-positive, insulin-positive cells) with one or more of an acetyl-CoA-related metabolite, a vitamin, a histone deacetylase inhibitor (HDACi), a redox homeostasis regulator, a one-carbon metabolic pathway intermediate, glutamate, and / or carnitine. Examples of metabolites include taurine, acetate, beta-hydroxybutyrate, biotin, carnitine, glutamate, and formate.

[0292] In some embodiments, the composition (e.g., medium) of the present disclosure comprises acetyl-CoA-related metabolites.Exemplary acetyl-CoA-related metabolites include, but are not limited to, acetic acid, pyruvate, ketogenic amino acids, valine, leucine, isoleucine, phenylalanine, tyrosine, lysine, tryptophan, fatty acids, CoA, isovaleryl-CoA, and β-hydroxybutyric acid.In some embodiments, the acetyl-CoA-related metabolite is acetic acid. In some embodiments, an acetyl-CoA-related metabolite is present in or added to a composition of the disclosure at a concentration of about 10 nM, about 50 nM, about 80 nM, about 100 nM, about 120 nM, about 140 nM, about 150 nM, about 200 nM, about 300 nM, about 500 nM, about 800 nM, about 1 μM, about 10 μM, about 100 μM, about 500 μM, about 800 μM, about 900 μM, about 1 mM, about 2 mM, about 3 mM, about 5 mM, or about 10 mM. In some embodiments, the acetyl-CoA-related metabolite is present in or added to a composition of the present disclosure at a concentration of about 0.01-50 mM, 0.1-50 mM, 0.5-50 mM, 0.01-20 mM, 0.1-20 mM, 0.5-20 mM, 0.01-10 mM, 0.1-10 mM, 0.5-10 mM, 0.8-25 mM, 0.8-10 mM, 0.8-5 mM, 0.8-2 mM, 0.8-1.5 mM, 0.8-1.2 mM, 0.9-1.1 mM, or 0.95-1.05 mM. In some embodiments, the acetyl-CoA-related metabolite is acetate present at a concentration of about 1 mM. In some embodiments, the acetyl-CoA-related metabolite is acetate present at a concentration of about 50-1000 nM, 50-800 nM, 50-500 nM, 50-300 nM, 50-250 nM, 100-200 nM, or 125-175 nM. In some embodiments, the acetyl-CoA-related metabolite is acetate present at a concentration of about 160 nM.

[0293] In some embodiments, the compositions (e.g., media) of the present disclosure comprise one or more vitamins. Exemplary vitamins include, but are not limited to, biotin, vitamin B1 (thiamine), vitamin B2 (riboflavin), vitamin B3 (niacin), vitamin B6 (pyridoxine), and vitamin B12 (cyanocobalamin). In some embodiments, the vitamin modulates fatty acid synthesis. In some embodiments, the vitamin modulates branched-chain amino acid metabolism. In some embodiments, the vitamin modulates the TCA cycle or participates in the TCA cycle as a cofactor, for example, as a cofactor for pyruvate carboxylase. In some embodiments, the vitamin is biotin. In some embodiments, the vitamin is present in or added to the compositions of the present disclosure at a concentration of about 100 nM, about 300 nM, about 500 nM, about 600 nM, about 700 nM, about 800 nM, about 900 nM, about 1 μM, about 1.5 μM, about 3 μM, about 5 μM, about 10 μM, or about 100 μM. In some embodiments, the vitamin is biotin present at a concentration of about 800 nM. In some embodiments, the vitamin is present in the compositions of the present disclosure at a concentration of about 1 nM to 500 μM, 1 nM to 100 μM, 1 nM to 10 μM, 1 nM to 1 μM, 1 nM to 800 nM, 1 nM to 600 nM, 1 nM to 400 nM, 1 nM to 300 nM, 1 nM to 200 nM, 25 nM to 500 μM, 25 nM to 100 μM, 25 nM to 10 μM, 25 nM to 1 μM, 25 nM to 800 nM, 25 nM to 600 nM, 25 nM to 400 nM, 25 nM to 300 nM, 25 nM to 200 nM, 50 nM to 5 The compound is present or added at a concentration of 100 μM, 50 nM to 100 μM, 50 nM to 10 μM, 50 nM to 1 μM, 50 nM to 800 nM, 50 nM to 600 nM, 50 nM to 400 nM, 50 nM to 300 nM, 50 nM to 200 nM, 100 nM to 500 μM, 100 nM to 100 μM, 100 nM to 10 μM, 100 nM to 1 μM, 100 nM to 800 nM, 100 nM to 600 nM, 100 nM to 400 nM, 100 nM to 300 nM, or 100 nM to 200 nM.

[0294] In some embodiments, the compositions (e.g., media) of the present disclosure comprise a histone deacetylase inhibitor (HDACi). Exemplary histone deacetylase inhibitors (HDACi) include β-hydroxybutyrate, butyrate, Class I HDACi, Class IIA HDACi, Class IIB HDACi, Class III HDACi, Class IV ... HDACi, HDAC-1, HDAC-2, HDAC-3, HDAC-4, HDAC-5, HDAC-6, HDAC-7, HDAC-8, HDAC-9, HDAC-10, HDAC-11, sirtuin, SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6, SIRT7, vorinostat (suberoylanilide hydroxamic acid, SAHA, MK0683), entinostat (MS-275, SNDX-275), panobinostat (LBH589, NVP-LBH589), trichostatin A (TSA), mocetinostat (MGCD0103, MG0103), GSK3117391 (GSK3117391A, HDAC-IN-3), BRD3308, tubastatin A TFA (Tubastatin A trifluoroacetate), Tubastatin A, SIS17, NKL 22, BML-210 (CAY10433), TC-H 106, SR-4370, Belinostat (PXD101, NSC726630, PX-105684), Romidepsin (FK228, Depsipeptide, FR 901228, NSC 630176), MC1568, Gibinostat (ITF2357), Dacinostat (LAQ824, NVP-LAQ824), CUDC-101, Xynostat (JNJ-26481585), Prasinostat (SB939), PCI-3...

Claims

1. Mammalian cells that have been genetically engineered to reduce or eliminate expression of the renalase gene, compared to the expression level of the same cell type that has not been genetically engineered. a) to reduce or eliminate expression of the ABO gene; b) reducing or eliminating the expression of the CXCL10 gene; c) reducing or eliminating expression of the beta-2 microglobulin (B2M) gene; d) to reduce or eliminate the expression of the tissue factor (F3) gene, and / or e) increasing the expression of CD47 or mutant CD47 Mammalian cells, which have also been genetically engineered.

2. The cell of claim 1, which has been genetically engineered to reduce or eliminate expression of the ABO gene compared to the expression level of the same cell type that is not genetically engineered.

3. The cell of claim 1 or 2, which has been genetically engineered to reduce or eliminate expression of the CXCL10 gene compared to the expression level of the same cell type that is not genetically engineered.

4. 4. The cell of claim 1, wherein the cell has been genetically engineered to reduce or eliminate expression of the B2M gene compared to the expression level of the same cell type that is not genetically engineered.

5. 5. The cell of any one of claims 1 to 4, which has been genetically engineered to reduce or eliminate expression of the F3 gene compared to the expression level of the same cell type that is not genetically engineered.

6. 6. The cell of any one of claims 1 to 5, which has been genetically engineered to increase expression of CD47 compared to the expression level of the same cell type that has not been genetically engineered.

7. The cell of claim 6, comprising an exogenous CD47 gene insertion.

8. A cell according to any one of claims 1 to 5, which has been genetically engineered to express a mutant form of CD47.

9. A mammalian cell that has been genetically engineered to reduce or eliminate expression of the CXCL10 gene, a) the ABO gene, and / or b) tissue factor (F3) gene Mammalian cells that have also been genetically engineered to reduce or eliminate expression of

10. 10. The cell of claim 9, which has been genetically engineered to reduce or eliminate expression of the ABO gene compared to the expression level of the same cell type that is not genetically engineered.

11. 11. The cell of claim 9 or 10, which has been genetically engineered to reduce or eliminate expression of the tissue factor gene compared to the expression level of the same cell type that is not genetically engineered.

12. 12. The cell of any one of claims 9 to 11, which has been genetically engineered to reduce or eliminate expression of the beta-2-microglobulin (B2M) gene compared to the expression level of the same cell type that is not genetically engineered.

13. A cell described in any one of claims 9 to 12, which has been genetically engineered to reduce or eliminate expression of the renalase gene compared to the expression level of the same cell type that has not been genetically engineered.

14. 14. The cell of any one of claims 9 to 13, which has been genetically engineered to increase expression of CD47 compared to the expression level of the same cell type that has not been genetically engineered.

15. The cell of claim 14, comprising an insertion of an exogenous CD47 gene.

16. 14. A cell according to any one of claims 9 to 13, which has been genetically engineered to express a mutant CD47 protein.

17. compared to expression levels in the same unengineered cell type. a) to reduce or eliminate the expression of the B2M, CXCL10, renalase, ABO and F3 genes; and b) to increase CD47 expression 17. The cell of any one of claims 1 to 16, which is genetically engineered.

18. compared to expression levels in the same unengineered cell type. a) to reduce or eliminate the expression of the B2M, CXCL10, renalase, ABO and F3 genes; and b) To express mutant CD47 17. The cell of any one of claims 1 to 16, which is genetically engineered.

19. The CD47 protein comprises at least three amino acids added to the N-terminus of the mature CD47 protein, the three added amino acids being represented by the formula X ３ -X ２ -X １ wherein X ３ is W and X ２ is selected from Q, A and G; X １ is selected from R, P, L, T, F, I and M.

20. 20. The cell of claim 8, 16, or 18, wherein the mutant CD47 protein comprises an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 145 or 146, except that Q at position 1 is replaced with at least three amino acids.

21. 21. The cell of claim 20, wherein the Q at position 1 is replaced with any one of WQR, WAP, WQL, WQP, WQPP, WQT, WQF, WQI, WGP, and WQM.

22. The cell of claim 20 or 21, comprising a gene encoding the mutant CD47 protein, wherein the gene encodes a CD47 protein in which at least three amino acids are added between the CD47 leader sequence (e.g., the amino acid sequence of SEQ ID NO: 244) and the beginning of the mature CD47 amino acid sequence (e.g., an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 145 or 146).

23. 22. The cell of claim 20 or 21, comprising a gene encoding the CD47 protein, wherein the gene encodes a CD47 protein in which "Q" at the position corresponding to position 19 of an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 14 or 243 is replaced with at least three amino acids.

24. 24. The cell of claim 22 or 23, wherein the at least three amino acids are selected from any of WQR, WAP, WQL, WQP, WQPP, WQT, WQF, WQI, WGP, or WQM.

25. 25. The cell of claim 24, wherein the at least three amino acids are WQPP.

26. 22. The cell of claim 21, wherein Q at position 1 is replaced with WQPP.

27. The at least three amino acids are of formula X ３ -X ２ -X １ wherein X ３ is W and X ２ is selected from Q, A and G; X １ is selected from R, P, L, T, F, I and M.

28. the CD47 protein comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 145 or 146, and the CD47 protein comprises at least three amino acids added to the N-terminus of the mature CD47 protein, wherein the three added amino acids are represented by the formula X ３ -X ２ -X １ wherein X ３ is W and X ２ is selected from Q, A and G; X １ is selected from R, P, L, T, F, I and M.

29. 29. The mammalian cell of claim 19 or 28, wherein the three amino acids are selected from WQR, WAP, WQL, WQP, WQT, WQF, WQI, WGP, and WQM.

30. A mammalian cell of ABO blood type O, a) to reduce or eliminate the expression of the renalase gene and / or the CXCL10 gene, and / or b) to express a mutant CD47 protein Genetically engineered mammalian cells.

31. compared to expression levels in the same unengineered cell type. a) to reduce or eliminate the expression of the B2M, CXCL10, renalase and F3 genes; and b) to increase CD47 expression The cell of claim 30, which is genetically engineered.

32. A mammalian cell expressing a membrane-bound CD47 protein, said CD47 protein comprising at least three amino acids added to the N-terminus of the mature CD47 protein, said three added amino acids being represented by the formula X ３ -X ２ -X １ wherein X ３ is W and X ２ is selected from Q, A and G; X １ is selected from R, P, L, T, F, I and M.

33. the CD47 protein comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 145 or 146, and the CD47 protein comprises at least three amino acids added to the N-terminus of the mature CD47 protein, wherein the three added amino acids are represented by the formula X ３ -X ２ -X １ wherein X ３ is W and X ２ is selected from Q, A and G; X １ is selected from R, P, L, T, F, I and M.

34. 34. The cell of claim 32 or 33, wherein the three amino acids are selected from WQR, WAP, WQL, WQP, WQT, WQF, WQI, WGP, and WQM.

35. 1. A mammalian cell that expresses a membrane-bound CD47 protein, wherein the CD47 protein comprises an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 145 or 146, except that Q at position 1 is replaced with at least three amino acids.

36. 36. The cell of claim 35, wherein the Q at position 1 is replaced with any one of WQR, WAP, WQL, WQP, WQPP, WQT, WQF, WQI, WGP, and WQM.

37. The cell of claim 35 or 36, comprising a gene encoding a mutant CD47 protein, wherein the gene encodes a CD47 protein in which at least three amino acids are added between the CD47 leader sequence (e.g., the amino acid sequence of SEQ ID NO: 244) and the beginning of the mature CD47 amino acid sequence (e.g., an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 145 or 146).

38. 37. The cell of claim 35 or 36, comprising a gene encoding a mutant CD47 protein, wherein the gene encodes a CD47 protein in which "Q" at position 19 of an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 14 or 243 is replaced with at least three amino acids.

39. 39. The cell of claim 37 or 38, wherein the at least three amino acids are selected from any of WQR, WAP, WQL, WQP, WQPP, WQT, WQF, WQI, WGP, or WQM.

40. 40. The cell of claim 39, wherein the at least three amino acids are WQPP.

41. 37. The cell of claim 36, wherein Q at position 1 is replaced with WQPP.

42. The at least three amino acids are of formula X ３ -X ２ -X １ wherein X ３ is W and X ２ is selected from Q, A and G; X １ is selected from R, P, L, T, F, I and M.

43. 43. The cell of any one of claims 32 to 42, which has been genetically engineered to reduce or eliminate expression of the B2M gene.

44. 44. The cell of any one of claims 32 to 43, which has been genetically engineered to reduce or eliminate expression of the F3 gene.

45. 45. The cell of any one of claims 32 to 44, which has been genetically engineered to reduce or eliminate expression of the CXCL10 gene.

46. 46. ​​A cell described in any one of claims 32 to 45, which has been genetically engineered to reduce or eliminate expression of the renalase gene.

47. 47. A cell according to any one of claims 32 to 46, which is of ABO blood group O.

48. 48. The cell of claim 47, which has been genetically engineered to reduce or eliminate expression of the ABO gene.

49. 48. The cell of claim 47, which is naturally of ABO blood group O.

50. A cell described in any one of claims 32 to 49, wherein a transgene encoding the CD47 protein is inserted into the genome of the cell such that expression of the CD47 transgene is related to expression of an endogenous target gene in the cell.

51. 50. The cell of any one of claims 32 to 49, wherein the endogenous target gene is a housekeeping gene, such as ACTB, NANOG, or GAPDH.

52. 52. The cell of claim 51, wherein the transgene is inserted such that the 3'UTR of the housekeeping gene (e.g., the 3'UTR of the GAPDH gene) is intact.

53. The endogenous CD47 gene of the cell has been mutated such that the cell expresses a CD47 protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 145 or 146, wherein the CD47 protein comprises at least three amino acids added to the N-terminus of the mature CD47 protein, and wherein the three added amino acids are represented by the formula X ３ -X ２ -X １ wherein X ３ is W and X ２ is selected from Q, A and G; X １ is selected from R, P, L, T, F, I and M.

54. 54. The cell of any one of claims 32 to 53, wherein the CD47 protein comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 245, 162, or 163.

55. 10. The cell of any one of the preceding claims, which is a stem cell.

56. 10. The cell of any one of the preceding claims, which is a pluripotent stem cell (PSC), an embryonic stem cell (ESC), an induced pluripotent stem cell (iPSC), or an embryonic germ stem cell (EGSC).

57. 55. The cell of any one of claims 1 to 54, which is differentiated from a pluripotent stem cell.

58. 55. The cell of any one of claims 1 to 54, which is a somatic cell.

59. 55. The cell of any one of claims 1 to 54, which is a definitive endoderm cell.

60. 55. A cell according to any one of claims 1 to 54, which is a primitive intestinal cell.

61. 55. The cell of any one of claims 1 to 54, which is a PDX1-positive pancreatic progenitor cell.

62. 55. The cell of any one of claims 1 to 54, which is an NKX6.1-positive pancreatic progenitor cell.

63. 55. The cell of any one of claims 1 to 54, which is an Ngn3-positive endocrine precursor cell.

64. 55. The cell of any one of claims 1 to 54, which is an insulin-positive endocrine cell.

65. 55. The cell of any one of claims 1 to 54, which is a pancreatic SC-β cell.

66. A cell described in any one of claims 1 to 54, which is NKX6.1 positive.

67. The cell of claim 66, which is ISL1 negative.

68. A cell described in any one of claims 1 to 54, which is NKX6.1 positive and ISL1 positive.

69. 55. A cell according to any one of claims 1 to 54, which is NKX6.1 negative and ISL1 negative.

70. A cell described in any one of claims 1 to 53, which is ISL1 positive.

71. The cell of claim 70, which is NKX6.1 negative.

72. 2. The cell of any one of the preceding claims, wherein the gene manipulation is performed using CRISPR / Cas, piggyBac transposon, TALEN, zinc finger technology, homing endonucleases, or meganucleases.

73. 10. The cell of claim 1, wherein at least one genetic modification is made in an intron region of the gene.

74. 10. The cell of claim 1, wherein at least one genetic modification is made in an exon of the gene.

75. 10. The cell of claim 1, wherein at least one genetic modification is made in the promoter of the gene.

76. the mammalian cells have been genetically engineered to reduce or eliminate expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:3 and / or SEQ ID NO:5, and the cells have a reduced or eliminated expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:3 and / or SEQ ID NO:5, compared to the expression level of the same cell type that has not been genetically engineered; a) reducing or eliminating expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1; b) reducing or eliminating expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:7; c) reducing or eliminating expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:9; d) to reduce or eliminate expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 11; and / or e) to increase expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 13 and / or SEQ ID NO:

15.

10. The cell of any one of the preceding claims, which is also genetically engineered.

77. A mammalian cell that has been genetically engineered to have reduced or eliminated / reduced expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:7, compared to the expression level of the same cell type that has not been genetically engineered. a) comprising reduced or no expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the gene SEQ ID NO: 1; and / or b) comprising reduced or no expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:

11. Mammalian cells, which have also been genetically engineered.

78. 78. The mammalian cell of claim 77, further genetically engineered to reduce or eliminate expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:9, compared to the expression level of the same cell type that is not genetically engineered.

79. 79. The cell of any one of claims 77 to 78, which has been genetically engineered to reduce or eliminate expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:3 and / or SEQ ID NO:5, compared to the expression level of the same cell type that is not genetically engineered.

80. 80. The cell of any one of claims 77 to 79, which has been genetically engineered to increase expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 13 and / or SEQ ID NO: 15, compared to the expression level of the same cell type that is not genetically engineered.

81. compared to expression levels in the same unengineered cell type. a) to reduce or eliminate expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:9, SEQ ID NO:7, SEQ ID NO:1, and SEQ ID NO:11; b) to reduce or eliminate expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 3 and / or SEQ ID NO: 5, and c) to increase the expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 13 and / or SEQ ID NO:

15.

81. The cell of any one of claims 76 to 80, which is genetically engineered.

82. A mammalian cell, the mammalian cell being an ABO cell type O and having been genetically engineered to reduce or eliminate expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:3, SEQ ID NO:5, and / or SEQ ID NO:7, compared to the expression level of the same cell type that is not genetically engineered.

83. compared to expression levels in the same unengineered cell type. a) to reduce or eliminate expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:9, SEQ ID NO:7, and SEQ ID NO:11; b) to reduce or eliminate expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 3 and / or SEQ ID NO: 5, and c) to increase the expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 13 and / or SEQ ID NO:

15.

83. The cell of claim 82, which is genetically engineered.

84. A mammalian cell that has been genetically engineered to reduce or eliminate expression of a protein encoded by the renalase gene, compared to the protein expression level of the same cell type that has not been genetically engineered. a) to reduce or eliminate the expression of the protein encoded by the ABO gene; b) reducing or eliminating the expression of the protein encoded by the CXCL10 gene; c) reducing or eliminating the expression of the protein encoded by the beta-2 microglobulin (B2M) gene; d) to reduce or eliminate the expression of the protein encoded by the tissue factor (F3) gene, and / or e) to increase the expression of the protein encoded by the CD47 gene. Mammalian cells, which have also been genetically engineered.

85. 84. The cell of any one of claims 8, 16, 18, 19, 28-30, 32-34, and 43-83, wherein the CD47 protein comprises an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 145 or 146, and wherein the CD47 protein comprises substitutions at one or more of the amino acids corresponding to amino acid positions Q1, L3, A53, and L54 of SEQ ID NO: 145 or 146.

86. The cell of claim 85, wherein the CD47 protein comprises a P or an L at the amino acid position corresponding to position 1 of SEQ ID NO: 145 or 146.

87. The cell of claim 85, wherein the CD47 protein comprises R, A, K, N, E, or V at the amino acid position corresponding to position 3 of SEQ ID NO: 145 or 146.

88. The cell of claim 85, wherein the CD47 protein comprises W, Y, D, Q, or V at the amino acid position corresponding to position 53 of SEQ ID NO: 145 or 146.

89. The cell of claim 85, wherein the CD47 protein comprises A, I, K, M, E, W, S, or V at the amino acid position corresponding to position 54 of SEQ ID NO: 145 or 146.

90. 86. The cell of claim 85, wherein the CD47 protein comprises a P at the amino acid position corresponding to position 1 of SEQ ID NO: 145 or 146.

91. 86. The cell of claim 85, wherein the CD47 comprises an amino acid other than Q at the amino acid position corresponding to position 1 of SEQ ID NO: 145 or 146.

92. 86. The cell of claim 85, wherein the CD47 comprises an amino acid other than L at the amino acid position corresponding to position 3 of SEQ ID NO: 145 or 146.

93. 86. The cell of claim 85, wherein the CD47 comprises an amino acid other than A at the amino acid position corresponding to position 53 of SEQ ID NO: 145 or 146.

94. 86. The cell of claim 85, wherein the CD47 comprises an amino acid other than L at the amino acid position corresponding to position 54 of SEQ ID NO: 145 or 146.

95. 95. A cell according to any one of claims 1 to 94, wherein the CD47 protein is membrane-bound.

96. 96. A composition comprising one or more of the cells of any one of claims 1 to 95.

97. 97. The composition of claim 96, comprising a plurality of non-native cells; a) at least 30% of the cells in the composition are NKX6.1-positive, ISL1-positive cells; b) at least 25% of the cells in said composition are NKX6.1-negative, ISL1-positive cells; c) there are more NKX6.1-positive, ISL1-positive cells than NKX6.1-negative, ISL1-positive cells in said composition; d) i) less than 12% of the cells in said composition are NKX6.1-negative, ISL1-negative cells; and / or ii) between 9-25% of the cells in the composition are NKX6.1-positive, ISL1-negative cells; and e) less than 40% of the cells in the composition are VMAT1 positive cells; composition.

98. 98. A method of administering the composition of claim 96 or 97 to a subject.

99. 99. The method of claim 98, wherein the subject has diabetes.

Images