Method for constructing virus-resistant pig on basis of gene editing

Abstract

A method for constructing a virus-resistant pig on the basis of gene editing, which method comprises the following steps: (1) synthesizing a chemically modified mRNA encoding one or more of Oct4, Sox2, Klf4, Glis1, and Lin28; (2) constructing and synthesizing a transposon vector containing gRNA and CRISPR sequences; (3) transforming the mRNA and the complete transposon vector containing gRNA into a primary porcine skin fibroblast to obtain a monoclonal target cell; (4) inserting the nucleus of the monoclonal target cell into a enucleated oocyte to obtain a recombinant cell; and (5) transplanting the recombinant cell into the fallopian tube of a receptor, and culturing same to obtain the virus-resistant pig. On the basis of a cell reprogramming protein factor, the effective gene editing window is extended, the multi-site gene editing of a genome is realized, and the virus-resistant pig is constructed.

Description

A method for constructing virus-resistant pigs based on gene editing Technical Field

[0001] The present invention relates to the field of gene editing technology, and in particular to a method for constructing virus-resistant pigs based on gene editing. Background Art

[0002] Porcine endogenous virus (PERV) is a retrovirus that is integrated into the pig genome and has dozens to hundreds of viral copies. Although there are currently no reports of it infecting humans, it can infect human cells in vitro. Under the influence of xenotransplantation and immunosuppressants, it may infect immunosuppressed organ recipients. From the perspective of xenotransplantation safety, it is very necessary to completely eliminate porcine endogenous viruses.

[0003] Currently, the CRISPR system is used to "transiently" knock out and destroy key common sequences of porcine endogenous viruses to prepare so-called "gene-edited pigs without porcine endogenous viruses." However, a major technical loophole in these pigs is that porcine endogenous viruses have their own inherent hosts, so these "gene-edited pigs without porcine endogenous viruses" will be re-infected with porcine endogenous viruses. Therefore, the current "gene-edited pigs without porcine endogenous viruses" are simply unable to detect the activity of porcine endogenous viruses under existing conditions.

[0004] At the same time, there are dozens to hundreds of copies of porcine endogenous virus sequences in the porcine genome. The "gene-edited pigs without porcine endogenous viruses" reported above actually underwent gene editing (knockout and destruction) at more than 40 sites in the genome. This will induce and accelerate the aging of pig somatic cells, resulting in a particularly low ratio of complete knockout and destruction of effective porcine endogenous virus sequences and cloned pig preparation.

[0005] In view of this, there is a need to provide a method for constructing pigs that are resistant to gene editing of porcine endogenous viruses, or even a method for constructing pigs that are resistant to gene editing of viruses that are effective against multiple viruses.

[0006] Summary of the Invention

[0007] The purpose of the present invention is to address the deficiencies in the existing technology and provide a cell reprogramming protein factor-based method to maintain and / or reverse the aging of pig somatic cells, thereby extending the effective gene editing window of pig somatic cells and achieving multi-site gene editing of the pig somatic cell genome, thereby constructing a virus-resistant pig.

[0008] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0009] The present invention provides a method for constructing a virus-resistant pig based on gene editing, comprising the following steps:

[0010] (1) synthesizing chemically modified mRNA encoding one or more of Oct4, Sox2, Klf4, Glis1, and Lin28;

[0011] (2) construct and synthesize a transposon vector containing gRNA and CRISPR sequences;

[0012] (3) transforming the mRNA and the complete transposon vector containing the gRNA into primary porcine skin fibroblasts to obtain monoclonal target cells;

[0013] (4) inserting the nucleus of the monoclonal target cell into an enucleated oocyte to obtain a recombinant cell;

[0014] (5) The recombinant cells are transplanted into the oviduct of the recipient and cultured to obtain virus-resistant pigs.

[0015] Preferably, the mRNA sequence of Oct4 is shown as SEQ ID NO: 1; the mRNA sequence of Sox2 is shown as SEQ ID NO: 2; the mRNA sequence of Klf4 is shown as SEQ ID NO: 3; the mRNA sequence of Glis1 is shown as SEQ ID NO: 4; and the mRNA sequence of Lin28 is shown as SEQ ID NO: 5.

[0016] Preferably, the transposon vector comprises a puromycin resistance gene and a doxycycline switch.

[0017] Preferably, the nucleotide sequence of the complete transposon vector containing gRNA is shown in SEQ ID NO: 6.

[0018] Preferably, the sequence of the gRNA is shown as SEQ ID NO: 7 and SEQ ID NO: 8.

[0019] Preferably, the virus-resistant pigs are pigs resistant to porcine endogenous viruses, African swine fever virus or blue ear disease virus.

[0020] Preferably, when the virus-resistant pig is a pig resistant to endogenous porcine virus, the gRNA targets the Pol sequence of the porcine endogenous virus sequence.

[0021] The present invention also provides an application of the virus-resistant pig obtained by the construction method as an organ transplant material.

[0022] The present invention provides a method for constructing a pig that is resistant to gene editing by retroviruses, which is based on chemically modified mRNA encoding and transient expression of cell reprogramming protein factors (one or more of Oct4, Sox2, Klf4, Glis1 and Lin28) to maintain and / or reverse the aging of pig somatic cells, thereby extending the effective gene editing window of pig somatic cells and achieving the tolerance of pig somatic cells to multi-site gene editing of their genome. At the same time, the complete CRISPR system sequence contains guide RNA (2) and CRISPR protein for the effective sequence of pig endogenous viruses, achieving complete gene knockout and destruction of more than 40 copies of pig endogenous viruses. Because the complete CRISPR system can be present in the pig genome, it can continuously destroy pig endogenous viruses, thereby achieving resistance to pig endogenous viruses, which is highly advantageous compared to the existing reported "pigs without pig endogenous virus gene editing". At the same time, the method provided by the present invention can also be used for the prevention and resistance of other viruses, such as African swine fever virus and blue ear disease virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] FIG1 is a diagram of the transposon vector constructed in Example 2;

[0024] FIG2 is the identification result of the porcine endogenous virus active sequence knocked out by CRISPR in Example 5;

[0025] FIG3 is the identification result of porcine endogenous virus resistance and porcine somatic cell resistance to porcine endogenous virus in Example 5. DETAILED DESCRIPTION

[0026] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0027] Example 1

[0028] Step 1. Synthesis of specific DNA templates: 5 reprogramming protein factors Oct4, Sox2, Klf4, Glis1, and Lin28.

[0029] 1. Double-stranded DNA encoding reprogramming protein factors

[0030] A: Double-stranded DNA encoding Oct4 protein factor: gblock, directly ordered from IDT Corporation in the United States. The DNA sequence information is as follows (1)+(2)+(3)+(4):

[0031] (1) T7 promoter: TAATACGACTCACTATAGGG.

[0032] (2) 5' untranslated region sequence:

[0033] (3) Oct4 open reading frame sequence:

[0034] (4) 3' untranslated region sequence:

[0035] B: Double-stranded DNA encoding Sox2 protein factor:

[0036] Double-stranded DNA encoding Sox2 protein factor: gblock, was directly ordered from IDT Corporation in the United States. The DNA sequence information is as follows (1)+(2)+(3)+(4):

[0037] (1) T7 promoter: TAATACGACTCACTATAGGG.

[0038] (2) 5' untranslated region sequence:

[0039] (3) Sox2 open reading frame sequence:

[0040] (4) 3' untranslated region sequence:

[0041] C: Double-stranded DNA encoding Klf4 protein factor:

[0042] Double-stranded DNA encoding Klf4 protein factor: gblock, was directly ordered from IDT Corporation in the United States. The DNA sequence information is as follows (1)+(2)+(3)+(4):

[0043] (1) T7 promoter: TAATACGACTCACTATAGGG.

[0044] (2) 5' untranslated region sequence:

[0045] (3) Klf4 open reading frame sequence:

[0046] (4) 3' untranslated region sequence:

[0047] D: Double-stranded DNA encoding Glis1 protein factor:

[0048] Double-stranded DNA encoding Glis1 protein factor: gblock, was directly ordered from IDT Corporation in the United States. The DNA sequence information is as follows (1)+(2)+(3)+(4):

[0049] (1) T7 promoter: TAATACGACTCACTATAGGG.

[0050] (2) 5' untranslated region sequence:

[0051] (3) Glis1 open reading frame sequence:

[0052] (4) 3' untranslated region sequence:

[0053] E: Double-stranded DNA encoding Lin28 protein factor:

[0054] Double-stranded DNA encoding Lin28 protein factor: gblock, directly ordered from IDT Corporation, USA. The DNA sequence information is as follows (1)+(2)+(3)+(4):

[0055] (1) T7 promoter: TAATACGACTCACTATAGGG.

[0056] (2) 5' untranslated region sequence:

[0057] (3) Lin28 open reading frame sequence:

[0058] (4) 3' untranslated region sequence:

[0059] 2. Add the mRNA poly-(a) tail DNA template by PCR:

[0060] Prepare PCR master mix according to Table 1 (total volume 200 μl, 25 μl for each of eight reactions).

[0061] Table 1. Composition of PCR master mix

[0062] Tailing primer-F1: 5′-TTGGACCCTCGTACAGAAGCTAATACG-3′.

[0063] Add tail-F2-T120:

[0064] 3. Perform PCR using the conditions in Table 2:

[0065] Table 2 PCR conditions

[0066] 4. Check the quality of PCR products by gel electrophoresis.

[0067] 5. Gel excision and recovery of PCR products (QIAquick PCR purification kit, Qiagen, cat. no. 28106): The final concentration of the tail template was adjusted to 100 ng / μl and used as a template for in vitro transcription and synthesis of mRNA.

[0068] The mRNA sequence of Oct4 is shown in SEQ ID NO: 1; the mRNA sequence of Sox2 is shown in SEQ ID NO: 2; the mRNA sequence of Klf4 is shown in SEQ ID NO: 3; the mRNA sequence of Glis1 is shown in SEQ ID NO: 4; and the mRNA sequence of Lin28 is shown in SEQ ID NO: 5.

[0069] Step 2: In vitro transcription and synthesis of mRNA

[0070] 1. Assemble the mRNA cap structure and nucleotide mixture according to Table 3 and Table 4:

[0071] The cap structure was 3′-O-Me-m7G(5′)ppp(5′)G RNA cap analog (New England Biolabs, cat. no. S1411S), methylcytidine-5′-triphosphate (Me-CTP; Trilink, cat. no. N1014), pseudouridine-5'-triphosphate (Pseudo-UTP; Trilink, cat. no. N1019), and other components were from the MEGAscript T7 kit (Ambion, cat. no. AM1334).

[0072] Table 3 mRNA cap structure

[0073] 2. Assemble the mRNA in vitro transcription system according to Table 4:

[0074] Table 4 mRNA in vitro transcription system

[0075] 3. Place the reaction in a PCR instrument and incubate at 37°C for 5 hours.

[0076] 4. Add 2 μl of Turbo DNase (from MEGAscript T7 kit, Ambion, cat. no. AM1334) to each sample.

[0077] 5. Mix gently and incubate at 37°C for 15 minutes.

[0078] 6. Purify the DNase-treated reaction using the MEGAclear kit (Ambion, cat. no. AM1908); elute the modified mRNA with a total of 100 μl of elution buffer (elute twice with 50 μl of elution buffer).

[0079] 7. Treat the purified modified mRNA with Antarctic phosphatase (New England Biolabs, cat. no. M0289S).

[0080] 8. To each sample (~100 μl), add 11 μl of 10× phosphatase buffer, then add 2 μl of phosphatase; gently mix the samples and incubate at 37°C for 0.5-1 h.

[0081] 9. After elution, measure the concentration of modified mRNA in a NanoDrop spectrophotometer. The expected total yield should be ~50 μg (30-70 μg range; a 100 μl elution volume for a 40 μl IVT reaction is 300-700 ng / μl). Adjust the concentration to 100 ng / μl by adding elution buffer or TE buffer (pH 7.0).

[0082] Example 2

[0083] Construct and synthesize a transposon vector containing two gRNAs and CRISPR sequences.

[0084] The 2 gRNAs are:

[0085] gRNA1: ggtaccctcctccagtacgtgg (SEQ ID NO: 7);

[0086] gRNA2: ggtcatccacgtactggaggagg (SEQ ID NO: 8).

[0087] The designed transposon vector sequence is shown in SEQ ID NO:6.

[0088] The synthesis method is:

[0089] (1) The designed vector was first divided into three segments, PB-1, PB-2, and PB-3 (commissioned to the gene synthesis company IDT for synthesis) for Gibson assembly.

[0090] (2) Calculate the pmol value of each fragment based on 2 μg of the synthesized fragment: pmols is calculated according to the formula ng value × 1000 / fragment length (bp) × 660.

[0091] Prepare a 0.08 pmol / μL solution and add the following amount of TE buffer to each fragment:

[0092] PB-1=19.25μL, PB-2=19.25μL, PB-3=19.25μL.

[0093] (3) Experimental steps

[0094] aGeneArt TM Gibson After thawing HiFi Master Mix on ice, vortex mix first;

[0095] b. Prepare the reaction solution in a 0.2 ml centrifuge tube pre-cooled on ice according to Table 5:

[0096] Table 5 Gibson assembly reaction solution

[0097] After preparing the reaction system according to the components in the table above, incubate in a 50°C water bath for 15 minutes until the reaction is complete. This will yield the assembled transposon vector, as shown in Figure 1. This transposon vector contains two gRNAs targeting the porcine endogenous viral active sequence Pol, the Cas9 protein, a puromycin resistance gene, and a doxycycline switch. Place the reaction product on ice for transformation experiments (store at -20°C if not in use).

[0098] Example 3

[0099] The Gibson high-fidelity reaction product (prepared in Example 2) was transformed into competent cells and stored.

[0100] (1) Preheat a water bath to 42°C, preheat SOC medium to 37°C, preheat an Amp-resistant plate (containing 50 μg / mL ampicillin) at 37°C for 30 min, and thaw TOP10 Chemically Competent E. coli cells on ice;

[0101] (2) Dilute the Gibson high-fidelity reaction product with nuclease-free ddH2O4:1 (12 μL nuclease-free water and 3 μL Gibson high-fidelity reaction product), vortex mix, centrifuge briefly, and store on ice;

[0102] (3) Add 2 μL of diluent to the competent cells and gently pipette to mix. (Transformation control experiment: follow the transformation experiment process and transfer 2.5 μL of pUC19 plasmid into TOP10 Chemically Competent E. coli cells to test the transformation efficiency.) Incubate the transformation mixture on ice for 25 min.

[0103] (4) Heat shock the transformation mixture at 42°C for 30 seconds without shaking, then immediately transfer to ice and incubate for 2 minutes;

[0104] (5) Then, add 250 μL of room temperature SOC medium to the transformation mixture, cap the tube tightly, and shake at 200 rpm at 37°C for 1 h to recover;

[0105] (6) After recovery, centrifuge at 6000 rpm for 3 minutes and remove 200 μL of supernatant. Spread approximately 100 μL of the remaining mixture evenly on a preheated Amp-resistant plate. Spread 100 μL of each transformation reaction on a preheated selective culture plate. (For a positive control, inoculate 100 μL of the transformation reaction onto an LB plate containing 100 μg / mL ampicillin or 50 μg / mL kanamycin.)

[0106] (7) The plate was incubated at 37°C overnight;

[0107] (8) The next day, single colonies were selected and preserved.

[0108] After streaking the single colony to be tested, perform colony PCR to verify whether the plasmid has been successfully assembled and successfully transformed into E. coli cells. The PCR system is as follows:

[0109] Table 6 PCR reaction system

[0110] Table 7 PCR reaction procedure

[0111] The PCR product was detected by 1% agarose gel electrophoresis (1×TAE buffer). The target fragment was consistent with the expected size. A single colony with the same band size was selected and inoculated into LB liquid medium for enrichment. The plasmid was extracted and sent to a sequencing company for sequencing. The sequencing results were consistent with the expectations and the complete sequence of the transposon was obtained.

[0112] Example 4

[0113] At the same time, the five mRNAs constructed in Example 1 and the Piggybac transposon vector (containing two PERV-specific gRNAs) constructed in Example 2 were introduced into primary porcine skin fibroblasts by electroporation (Neon transfection). After puromycin selection for 4 days and doxycycline induction for one week, the Pol sequence was amplified by PCR.

[0114] Positive strand primer:

[0115] ACACTCTTTCCCTACACGACGCTCTTCCGATCTCGACTGCCCCAAGGGTTCAA (as shown in SEQ ID NO: 9);

[0116] Minus strand primer:

[0117] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCTCTCCTGCAAATCTGGGCC (as shown in SEQ ID NO: 10).

[0118] Monoclonal target cells were selected to confirm PERV resistance by sequencing.

[0119] Cultured cumulus-oocyte complexes (COCs) were treated with 0.1% (w / v) hyaluronidase. After treatment, the COCs contained no cumulus cells but instead contained the first polar body, whose nucleus was carefully removed. The monoclonal target cells constructed above were used as donor cells and inserted into the cytoplasm of enucleated oocytes to generate recombinant cells. Recombinant cells were fused by applying a single direct current pulse of 200 V / mm for 20 microseconds in a fusion medium (0.25 mol / L D-sorbitol, 0.05 mmol / L Mg(C2H3O2)2, 20 mg / mL BSA, and 0.5 mmol / L HEPES). The recombinant cells were then cultured in PZM-3 medium for 45 min and then activated with a single pulse of 150 V / mm for 100 ms in an activation medium consisting of 0.25 mol / L D-sorbitol, 0.01 mmol / L Ca(C2H3O2)2, 0.05 mmol / L Mg(C2H3O2)2, and 0.1 mg / mL BSA.

[0120] The recombinant cells were cultured and developed in BPZM-3 medium supplemented with 5 μg / mL cytochalasin in an incubator (APM-30D, ASTEC, Japan) at 38.5°C, 5% CO₂, 5% O₂, and 90% N₂ until embryo transfer. The embryos were surgically transferred into the oviducts of surrogate pigs.

[0121] Example 5

[0122] After the pigs are resistant to porcine endogenous viruses, samples of pig kidneys, spleens and skin are collected to determine the knockout status of the Pol sequence, the active sequence of porcine endogenous viruses, and the pigs' resistance to porcine endogenous viruses. The details are as follows:

[0123] (1) Identification of CRISPR-knockout of active sequences of porcine endogenous viruses: The pol genes of three samples were amplified by PCR and sequenced using IlluminaNext. Next-generation sequencing was performed using PE250 to obtain data. The two overlapping reads were then combined and mapped to the reference region using PEAR and BLAT. After mapping, the garbled code of the sequence after CRISPR gene editing (i.e., random insertion of the exogenous gene and deletion of the native sequence) was read out. The results are shown in Figure 2.

[0124] As can be seen from Figure 2, the endogenous virus activity sequence within the porcine endogenous virus resistance pig genome has been destroyed by knockout.

[0125] (2) Identification of resistance to porcine endogenous viruses: Fibroblasts from porcine endogenous virus-resistant pigs and fibroblasts from porcine endogenous virus knockout pigs (transiently transfected with CRISPR + two gRNAs) were co-cultured with porcine PK cells (containing porcine endogenous viruses) for 100 days without direct contact. The 30th and 100th days were used as test time points to detect infection with the PK cell porcine endogenous virus. The results are shown in Figure 3.

[0126] As can be seen from Figure 3, pig fibroblasts with a simple knockout of endogenous viruses will be infected by the virus when co-cultured with PK cells containing pig endogenous viruses, and the virus copy number increases with the culture time. However, the endogenous virus-resistant pig fibroblasts constructed by the present invention still maintain the endogenous virus copy number at zero after 100 days of co-culture.

[0127] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A method for constructing a virus resistant to pigs based on gene editing, characterized in that: The steps include: (1) synthesizing chemically modified mRNA encoding one or more of Oct4, Sox2, Klf4, Glis1 and Lin28; (2) constructing and synthesizing a transposon vector containing gRNA and CRISPR sequences; (3) transforming the mRNA and the complete transposon vector containing the gRNA into primary porcine skin fibroblasts to obtain monoclonal target cells; (4) inserting the nucleus of the monoclonal target cell into an enucleated oocyte to obtain a recombinant cell; (5) The recombinant cells are transplanted into the oviduct of the recipient and cultured to obtain virus-resistant pigs.

2. The construction method according to claim 1, characterized in that: The mRNA sequence of Oct4 is shown in SEQ ID NO: 1; the mRNA sequence of Sox2 is shown in SEQ ID NO: 2; the mRNA sequence of Klf4 is shown in SEQ ID NO: 3; the mRNA sequence of Glis1 is shown in SEQ ID NO: 4; and the mRNA sequence of Lin28 is shown in SEQ ID NO:

5.

3. The construction method according to claim 2, characterized in that: The transposon vector contains a puromycin resistance gene and a doxycycline switch.

4. The construction method according to claim 3, characterized in that: The nucleotide sequence of the transposon vector is shown in SEQ ID NO:

6.

5. The construction method according to claim 4, characterized in that: The sequences of the gRNA are shown in SEQ ID NO: 7 and SEQ ID NO:

8.

6. The construction method according to claim 5, characterized in that: The virus-resistant pigs are pigs resistant to porcine endogenous viruses, African swine fever viruses or blue ear disease viruses.

7. The construction method according to claim 6, characterized in that: When the virus-resistant pig is a pig resistant to endogenous porcine virus, the gRNA targets the Pol sequence of the endogenous porcine virus sequence.

8. Use of the virus-resistant pig obtained by the construction method according to any one of claims 1 to 7 as an organ transplant material.

Images