RNA-only, positive control target for clinical diagnostic testing

Abstract

A control strategy for RNA-based bacterial nucleic acid amplification tests (NAATs), such as reverse transcription PCR (RT-PCR) and reverse transcription loop-mediated isothermal amplification (RT-LAMP), that allows ready discrimination of RNA from DNA templates using self-splicing bacterial introns, such that those nucleic acids ultimately encode different sequences. Described are two exemplary vectors encoding synthetic transgenes based on this principle, one that is active in the gram-negative bacterium Escherichia coli and one that functions in both E. coli and the gram-positive organism Staphylococcus aureus. Using multiplexed fluorescent RT-LAMP of heat-lysed specimens, the practicality of deploying such transgenic organisms as an internal control to ascertain sample integrity and assay performance during clinical diagnostic testing is demonstrated. The approach has broad utility for RNA-based bacterial nucleic acid amplification tests, especially point-of-care assays and other applications where nucleic acids are nonspecifically liberated for testing.

Description

RNA-ONLY, POSITIVE CONTROL TARGET FOR CLINICAL DIAGNOSTIC TESTING

[0001] This application claims benefit of United States provisional patent application number 63 / 513,311, filed July 12, 2023, the entire contents of which are incorporated by reference into this application. REFERENCE TO A SEQUENCE LISTING

[0002] The content of the XML file of the sequence listing named “UW083_seq”, which is 40 kb in size, created on July 10, 2024, and electronically submitted herewith the application, is incorporated herein by reference in its entirety. ACKNOWLEDGEMENT OF GOVERNMENT SUPPORT

[0003] This invention was made with government support under Grant No.200-2022- 15478, awarded by the Centers for Disease Control & Prevention. The government has certain rights in the invention. BACKGROUND

[0004] Although DNA-based nucleic acid amplification tests (NAATs) presently comprise the dominant molecular detection methods for bacteria, RNA-based NAATs are beginning to be developed and adopted by the field1–3. RNA-based microbial NAATs have demonstrated advantages over DNA-based methods in their specificity for live bacteria1,4–8and enhanced sensitivity resulting from signal amplification of highly transcribed bacterial genes1,2,4,5,9,10. Few such assays are able to directly recognize and amplify RNA templates using transcription-mediated amplification (TMA)2,3,11,12, while most depend on the action of reverse transcriptase to convert RNA to DNA templates prior to their amplification by DNA polymerase, as in reverse transcription PCR (RT-PCR)10,13,14and reverse transcription loop- mediated isothermal amplification (RT-LAMP)5. Of particular appeal are RT-LAMP assays, which integrate reverse transcription and isothermal template amplification into a single, one- step reaction15. RT-LAMP provides a low-cost, reliable testing approach that can be performed without specialized instrumentation and that can be made compatible with point- of-care or at-home testing16–20. Already widely developed for the detection of RNA viruses15,21, RT-LAMP assays for pathogenetic bacteria are rapidly emerging4,5,22–27.

[0005] When performing NAATs for clinical molecular diagnosis, it is critical to include an appropriate combination of negative, positive, and internal controls to assess proper assay performance28–30. Negative controls allow the rule-out of false positive results from contamination or other artifacts, while positive controls ensure that false negatives resulting from assay technical failures can be recognized. In contrast, internal controls allowverification of assay performance for each individual sample that is subjected to testing, permitting the recognition of inhibitors from specimen matrices that may impair testing and precipitate false negative outcomes. These well-accepted paradigms for assay controls, however, pose a challenge for most RNA-based NAATs. A comprehensive positive or internal control for such assays must allow the user to ascertain success through all phases of testing, from bacterial lysis and recovery of intact cellular RNA through reverse transcription, amplification, and the ultimate detection of RNA templates. Yet, in RT-PCR and RT-LAMP, one cannot distinguish between amplification of bacterial RNA transcripts and the DNA that encodes them, because DNA is recognized by the polymerases used in such assays and because RNA bears the same sequence as the DNA from which it derives. Consequently, using intact bacteria as controls can identify successful release of nucleic acids but does not have specificity for the recovery or detection of RNA itself. This limitation is especially problematic for qualitative tests where the degree of amplification cannot be accurately measured, and for applications where nucleic acid recovery is achieved via non- selective approaches like thermal bacterial lysis, where both DNA and RNA templates are present in the testing matrix.

[0006] There remains a need for a suitable positive control for use in RNA-based testing that permits distinguishing between RNA and DNA. SUMMARY

[0007] Described herein is an approach that enables users to readily distinguish an expressed RNA transcript from its template DNA sequence in bacteria, and to construct transgenic bacteria with value as positive and internal control material for RNA-based molecular diagnostic assays. This strategy (depicted in Fig.1) takes advantage of autocatalytic, self-splicing bacterial introns31,32, which result in RNA transcripts that differ in sequence from the DNA that encodes them. An intron with activity in the target organism, including its catalytic exonic components, is inserted into a marker gene and expressed. Primers that specifically amplify the spliced RNA transcript can be designed, either by virtue of their binding across exon-exon junctions that are absent from template DNA or because the target length is prohibitively long prior to excision of the intron. The feasibility of this approach has been demonstrated in two different organisms (Escherichia coli and Staphylococcus aureus) and, as described herein, transgenic strains can be used to provide comprehensive positive and internal controls in RT-LAMP assays.

[0008] In some embodiments, described herein is a method for distinguishing between reverse transcribed RNA and DNA in a bacterial sample. In some embodiments, the method comprises obtaining a bacterial plasmid (or bacterial genome) that has been modified toexpress a transgene, wherein the transgene comprises a self-splicing intron. In some embodiments, the bacterial plasmid or transgene is a synthetically designed sequence that

[0009] The method further comprises contacting the bacterial sample with primers that specifically amplify the nucleic acids flanking the self-splicing intron. In some embodiments, the nucleic acids flanking the self-splicing intron comprise the exon-exon junction. Alternatively the primers specifically amplify the nucleic acids within the self-splicing intron or a DNA target that is not transcribed. In addition, the method comprises detecting the amplified nucleic acids. Detected amplification of the nucleic acids flanking the self-splicing intron or, in particular, encoding the exon-exon junction, is indicative of reverse transcribed RNA in the bacterial sample. In some embodiments, detected amplification of the nucleic acids within the self-splicing intron is indicative of DNA in the bacterial sample.

[0010] In some embodiments, described herein is a method for specifically detecting reverse transcribed RNA in a bacterial sample in which the method comprises obtaining a bacterial plasmid or chromosomally-integrated genetic element that has been modified to express a transgene, wherein the transgene comprises a self-splicing intron, and contacting the bacterial sample with primers that specifically amplify the nucleic acids flanking the self- splicing intron and / or comprising the exon-exon junction. The method further comprises detecting nucleic acids so amplified, wherein detected amplification of the nucleic acids flanking the self-splicing intron is indicative of reverse transcribed RNA in the bacterial sample. In some embodiments, the bacterial plasmid or chromosomally-integrated element is derived from a gram-negative bacterium. In some embodiments, the gram-negative bacterium comprises E. coli. In some embodiments, the bacterial plasmid or chromosomally- integrated element is derived from a gram-positive bacterium. In some embodiments, the gram-positive bacterium comprises S. aureus.

[0011] In some embodiments, the transgene is a bacterial antibiotic resistance gene. In some embodiments, the bacterial antibiotic resistance gene comprises kanamycin nucleotidyltransferase. In some embodiments, the transgene is a fluorescent reporter gene, such as green fluorescent protein (GFP), or another reporter gene. In some embodiments, the transgene is derived from a bacteriophage. In some embodiments, the transgene comprises a synthetic gene (e.g., comprising non-native sequence). In some embodiments, the transgene is a chimeric gene.

[0012] In some embodiments, the bacterial sample is obtained from a subject. Such a sample may be in the form of a typical biological sample obtained from a patient, such as urine, blood, saliva, or other bodily fluid. Such a sample may be in the form of a typicalbiological sample obtained from a non-human animal, such as urine, blood, saliva, or other bodily fluid. Such a sample may be in the form of a biological sample obtained from a plant, such as leaves, flowers, seeds, or fruits. In some embodiments, the bacterial sample is obtained in a laboratory or manufacturing setting, as part of quality control testing. In some embodiments, the sample is obtained from foodstuffs, beverages, or other consumables. In some embodiments the sample is obtained from materials in the environment, such as air, water, or soil.

[0013] In some embodiments, the self-splicing intron comprises a ~400bp self-splicing intron derived from Tetrahymena. In some embodiments, the self-splicing intron is a group I or group II intron active in gram-positive bacteria. In some embodiments, the self-splicing intron is a group I or group II intron active in gram-negative bacteria.

[0014] In some embodiments, the amplification comprises reverse transcription loop- mediated isothermal amplification (RT-LAMP). In some embodiments, the amplification comprises LAMP without reverse transcription. For example, some LAMP reactions detect RNA but do not require reverse transcription. In some embodiments, the amplification comprises another reverse transcriptase-based polymerase chain reaction method, such as reverse transcription PCR (RT-PCR), reverse transcription recombinase polymerase amplification (RT-RPA), or other methods. In some embodiments, the amplification directly recognizes RNA as a template.

[0015] Also described herein are a nucleic acid construct and a kit for performing these methods. Kits can be implemented for point-of-care, on site, or at-home testing. In some embodiments, the kit comprises a genetically modified bacterium that expresses a transgene, wherein the transgene comprises a self-splicing intron and expresses a non- native synthetic codon sequence. In some embodiments, the bacterium is a gram-negative bacterium. In some embodiments, the self-splicing intron comprises a ~400bp self-splicing intron derived from Tetrahymena. In some embodiments, the bacterial antibiotic resistance gene comprises kanamycin nucleotidyltransferase.

[0016] In some embodiments, the transgene is a bacterial antibiotic resistance gene. In some embodiments, the bacterial antibiotic resistance gene comprises kanamycin nucleotidyltransferase. In some embodiments, the transgene is a fluorescent reporter gene, such as green fluorescent protein (GFP), or another reporter gene. In some embodiments, the transgene is derived from a bacteriophage. In some embodiments, the transgene comprises a synthetic gene. In some embodiments, the transgene is a chimeric gene. In some embodiments, the bacterium is lyophilized. In some embodiments, the transgene has been codon optimized or otherwise re-encoded.

[0017] In some embodiments, the kit further comprises a set of primers that specifically amplify nucleic acids flanking the self-splicing intron. In some embodiments, the nucleic acids flanking the self-splicing intron span the exon-exon junction. In some embodiments, the primers are selected from SEQ ID NO: 5-29 (Table 5). In some embodiments, the primers comprise 3’ termini, and the primers further comprise LNA modified bases at discriminatory sites differentiating between wild type and codon optimized genes at the 3’ termini. In some embodiments, the transgene comprises the nucleotide sequence shown in SEQ ID NO: 1 (Table 1). In some embodiments, the transgene comprises the nucleotide sequence shown in SEQ ID NO: 4 (Table 3). In some embodiments, the transgene comprises the nucleotide sequence shown in SEQ ID NO: 30 (Table 4). BRIEF DESCRIPTION OF THE DRAWINGS

[0018] FIG.1. The engineered control material allows differential amplification of RNA and DNA from transgenic organisms. The bacterium of interest is transformed with a plasmid vector containing a target gene construct, wherein the target gene is disrupted by an autocatalytic, self-splicing intron that has activity in the chosen organism. Primers are designed that specifically amplify the spliced RNA transcript, rather than the template DNA, either by binding across the exon–exon junction (top primer) or because the amplicon length is prohibitively large, unless the intron has first been successfully excised (bottom primer). This schema allows selective amplification of RNA from the transgenic organism, which can be used to monitor successful assay performance through all phases of testing (bacterial lysis, nucleic acid recovery, reverse transcription, template amplification, and signal detection).

[0019] FIGS.2A-2C. Selective amplification of RNA from self-splicing transgenes by RT- LAMP. Time to threshold (Tt) values are shown for RT-LAMP reactions targeting both RNA and DNA or spliced, transgenic RNA. Organisms carrying transgenic expression vectors and precursor vectors lacking the transgene were tested: (2A) E. coli carrying pKTM_IAC or the pUC19 precursor vector, (2B) E. coli carrying pOrf142+gfp_mod or the pCN50wt precursor vector, and (2C) S. aureus carrying pOrf142+gfp_mod or the pCN50wt precursor vector. Various cell equivalents of purified RNA and DNA templates were tested in triplicate, with results of four technical replicates from each test superimposed. Horizontal bars represent the mean for replicates.

[0020] FIG.3. Self-splicing transgenes serve as internal assay controls. Time to threshold (Tt) values are shown for multiplex RT-LAMP reactions incorporating primer sets that target both RNA and DNA and those that are specific for spliced RNA from transgenic expression vectors. Heat-lysed specimens of E. coli carrying pKTM_IAC were combined with theindicated quantity of RNase A prior to RT-LAMP. Results from three technical replicates are superimposed, with Tt values significantly (P ≤ 0.05, two-tailed T test) higher than controls lacking RNase A, indicated with an asterisk (*). Horizontal bars express the mean for replicates.

[0021] FIGS.4A-4B. Diagnostic RT-LAMP assay for P. aeruginosa using transgenic E. coli as an internal assay control. Time to threshold (Tt) values are shown for multiplex RT-LAMP reactions incorporating diagnostic primer sets for P. aeruginosa and RNA-specific primers for the transgenic expression vector pKTM_IAC to serve as an internal assay control. Results are shown for control reactions lacking the clinical specimen matrix and for a series of three separate stool specimens. All specimens were tested in the presence of E. coli carrying pKTM_IAC, (4A) without or (4B) with the introduction of exogenous P. aeruginosa. Dilutions of stool specimens are indicated. Results from three technical replicates for each specimen are superimposed, with Tt values significantly (P ≤ 0.05, two-tailed T test) higher than those of controls lacking clinical matrices indicated with an asterisk (*). Horizontal bars express the mean for replicates. DETAILED DESCRIPTION

[0022] The materials and methods described herein are based on the development of a robust control system that enables users to readily distinguish between DNA and its expressed RNA template in bacteria, and which is suitable as control material for point of care diagnostic tests or conventional laboratory tests that require bacterial lysis.

[0023] A representative embodiment comprises an E. coli plasmid expressing a bacterial antibiotic resistance gene (kanamycin nucleotidyltransferase) into which a ~400bp self- splicing intron derived from Tetrahymena has been inserted1. The intron is rapidly, autocatalytically excised from the mRNA after transcription, such that the mature mRNA does not contain it. An RT-LAMP assay has been designed that utilizes primers flanking this self-splicing intron in a configuration that is unable to amplify the DNA target due to its prohibitively large size, but which is able to robustly amplify the RNA template after it has undergone successful splicing. This design schema consequently achieves complete specificity for detection of reverse transcribed RNA. Because the system is housed within a transgenic gram-negative bacterium, the organism itself (lyophilized or otherwise preserved) can be used as a positive control for all phases of testing: cell lysis, nucleic acid extraction, reverse transcription, and template amplification and detection. This same concept has been found to work with S. aureus, and can be applied to other bacterial species.

[0024] Likewise, assays can conversely be designed to specifically identify the presence of DNA from the control material by using primers or probes that bind to the intron or to DNA that is not transcribed, as those sequences will not be present in the expressed RNA form. Definitions

[0025] All scientific and technical terms used in this application have meanings commonly used in the art unless otherwise specified. As used in this application, the following words or phrases have the meanings specified.

[0026] As used herein, a “control” can refer to a negative or positive or internal control. A positive control provides confirmation that a detection or assay method performed effectively, and enables accurate interpretation of a negative test result. A negative control provides confirmation that a detection or assay method did not respond to artefacts or other noise. An internal control allows verification of assay performance for each individual sample that is subjected to testing, permitting the recognition of inhibitors from specimen matrices that may impair testing and precipitate false negative outcomes.

[0027] As used herein, a “significant difference” means a difference that can be detected in a manner that is considered reliable by one skilled in the art, such as a statistically significant difference, or a difference that is of sufficient magnitude that, under the circumstances, can be detected with a reasonable level of reliability. In one example, an increase or decrease of 10% relative to a reference sample is a significant difference. In other examples, an increase or decrease of 20%, 30%, 40%, or 50% relative to the reference sample is considered a significant difference. In yet another example, an increase of two-fold relative to a reference sample is considered significant.

[0028] “Nucleotide sequence” refers to a heteropolymer of deoxyribonucleotides, ribonucleotides, or peptide-nucleic acid sequences that may be assembled from smaller fragments, isolated from larger fragments, or chemically synthesized de novo or partially synthesized by combining shorter oligonucleotide linkers, or from a series of oligonucleotides, to provide a sequence which is capable of expressing the encoded protein.

[0029] A sequence has been “codon optimized” when the sequence of the encoded amino acid remains the same, but the encoding sequence has been optimized to meet desired criteria or otherwise re-encoded from its naturally occurring sequence.

[0030] The term "primer," as used herein, means an oligonucleotide designed to flank a region of DNA to be amplified. In a primer pair, one primer is complementary to nucleotides present on the sense strand at one end of a polynucleotide fragment to be amplified and another primer is complementary to nucleotides present on the antisense strand at the otherend of the polynucleotide fragment to be amplified. A primer can have at least about 11 nucleotides, and preferably, at least about 16 nucleotides and no more than about 35 nucleotides. LAMP primers (BIP and FIP, specifically) contain 2 domains and are usually longer - 45-60 bp. Typically, a primer has at least about 80% sequence identity, preferably at least about 90% sequence identity with a target polynucleotide to which the primer hybridizes.

[0031] As used herein, the term "subject" includes any human or non-human animal. The term "non-human animal" includes all vertebrates, e.g., mammals and non-mammals, such as non-human primates, horses, sheep, dogs, cows, pigs, chickens, and other veterinary subjects. In a typical embodiment, the subject is a human.

[0032] As used herein, “a” or “an” means at least one, unless clearly indicated otherwise.

[0033] Methods

[0034] Described herein is an approach that enables users to readily distinguish an expressed RNA transcript from its template DNA sequence in bacteria, and to construct transgenic bacteria with value as positive and internal control material for RNA-based molecular diagnostic assays. This strategy (FIG.1) takes advantage of autocatalytic, self- splicing bacterial introns31,32, which result in RNA transcripts that differ in sequence from the DNA that encodes them. An intron with activity in the target organism, including its catalytic exonic components, is inserted into a marker gene and expressed. Primers that specifically amplify the spliced RNA transcript can be designed, either by virtue of their binding across exon-exon junctions that are absent from template DNA or because the target length is prohibitively long prior to excision of the intron. The feasibility of this approach has been demonstrated in two different organisms (Escherichia coli and Staphylococcus aureus) and, as described herein, transgenic strains can be used to provide comprehensive positive and internal controls in RT-LAMP assays.

[0035] In some embodiments, described herein is a method for distinguishing between reverse transcribed RNA and DNA in a bacterial sample. In some embodiments, the method comprises obtaining a nucleotide construct such as a bacterial plasmid (or bacterial genome) that has been modified to express a transgene, wherein the transgene comprises a self- splicing intron. In some embodiments, the bacterial plasmid or transgene is a synthetically designed sequence that is able to self-splice.

[0036] The method further comprises contacting the bacterial sample with primers that specifically amplify the nucleic acids flanking the self-splicing intron. In some embodiments, the nucleic acids flanking the self-splicing intron comprise an exon-exon junction. Alternatively the primers specifically amplify the nucleic acids within the self-splicing intron ora DNA target that is not transcribed. In addition, the method comprises detecting the amplified nucleic acids. Detected amplification of the nucleic acids flanking the self-splicing intron or encoding the exon-exon junction is indicative of reverse transcribed RNA in the bacterial sample. In some embodiments, detected amplification of the nucleic acids within the self-splicing intron is indicative of DNA in the bacterial sample. In some embodiments, the primers are DNA-specific primers that target a non-transcribed portion of the construct.

[0037] In some embodiments, described herein is a method for specifically detecting reverse transcribed RNA in a bacterial sample in which the method comprises obtaining a bacterial plasmid or chromosomally-integrated genetic element that has been modified to express a transgene, wherein the transgene comprises a self-splicing intron, and contacting the bacterial sample with primers that specifically amplify the nucleic acids flanking the self- splicing intron. The method further comprises detecting nucleic acids so amplified, wherein detected amplification of the nucleic acids flanking the self-splicing intron is indicative of reverse transcribed RNA in the bacterial sample.

[0038] In some embodiments, the bacterial plasmid or chromosomally-integrated element is derived from a gram-negative bacterium. In some embodiments, the gram-negative bacterium comprises E. coli. In some embodiments, the bacterial plasmid or chromosomally- integrated element is derived from a gram-positive bacterium. In some embodiments, the gram-positive bacterium comprises S. aureus. In some embodiments, the transgene is a bacterial antibiotic resistance gene. In some embodiments, the bacterial antibiotic resistance gene comprises kanamycin nucleotidyltransferase.

[0039] In some embodiments, the amplification comprises reverse transcription loop- mediated isothermal amplification (RT-LAMP). In some embodiments, the amplification comprises LAMP without reverse transcription. For example, some LAMP reactions detect RNA but do not require reverse transcription. As one example, BST 3.0 polymerase can recognize both RNA and DNA templates (see neb.com / products / m1804-warmstart- colorimetric-lamp-2x-master-mix-with-udg#Product%20Information ). In some embodiments, the amplification comprises another reverse transcriptase-based polymerase chain reaction method, such as reverse transcription PCR (RT-PCR), reverse transcription recombinase polymerase amplification (RT-RPA), or other methods. In some embodiments, the amplification directly recognizes RNA as a template.

[0040] Nucleic Acid Molecules, Kits and Assay Standards

[0041] The invention provides various molecules, constructs, and reagents for use in the methods described herein. In some embodiments, the construct is a nucleic acid cassette comprising a self-splicing intron. The self-splicing intron may be naturally occurring orsynthetically designed to self-splice. Representative examples of such a cassette are shown in Table 1 (SEQ ID NO: 1), Table 3 (SEQ ID NO: 4), and Table 4 (SEQ ID NO: 30). The cassette may include additional elements, such as one or more promoters, and a ribosomal binding site.

[0042] Table 1: Marker Gene Cassette of pKTM_IAC (SEQ ID NO: 1)

[0043] T7 promoter is displayed in italic type, Pcap promoter and ribosomal binding site is shown double underlining. KTM gene coding sequence is shown within square brackets. Intron sequence is underlined. Bold font indicates T7hyb10 transcriptional terminator. Restriction sites flanking the expression cassette are shown in parentheses.

[0044] (CCTGCAGG)CTAGGAGGCAATTGT TAATACGACTCACTATAG AGAGTTTGCAAAATATA CAGGGGATTATATATAATGGAAAACAAGAAAGGAAAATAGGAGGTTTATCAT[ATGAACGGACCGATTA TAATGACTAGAGAAGAGCGTATGAAAATAGTACATGAAATAAAAGAGAGAATATTAGACAAATATGGTGACGACG TGAAAGCTATTGGaGTGTATGGCTCTCT]ATGTAGCAATATTACGACCTGGAGGGAAAAGTTATCAGGCATGCA CCTGGTAGCTAGTCTTTAAACCAATAGATTGCATCGGTTTAAAAGGCAAGACCGTCAAATTGCGGGAAAGGGGTC AACAGCCGTTCAGTACCAAGTCTCAGGGGAAACTTTGAGATGGCCTTGCAAAGGGTATGGTAATAAGCTGACGGA CATGGTCCTAACCACGCAGCCAAGTCCTAAGTCAACAGATCTTCTGTTGATATGGATGCAGTTCACAGACTAAAT GTCGGTCGGGGAAGATGTATTCTTCTCATAAGATATAGTCGGACCTCTCCTTAATGGGAGCTAGCGGATGAAGTG ATGCAACACTGGAGCCGCTGGGAACTAATTTGTATGCGAAAGTATATTGATTAGTTTTGGAGTACTCG[TGGTC GTCAGACAGATGGACCGTACTCAGATATCGAGATGATGTGCGTGATGAGTACAGAGGAAGCAGAGTTCTCTCACG AGTGGACGACGGGTGAATGGAAAGTCGAGGTAAATTTTGATAGTGAGGAGATATTGTTGGATTACGCTAGTCAAG TGGAATCAGATTGGCCTTTAACTCACGGACAATTCTTTTCAATCTTACCGATCTATGATTCAGGTGGATATTTAG AAAAAGTTTACCAAACAGCAAAAAGTGTGGAGGCGCAAACGTTCCACGACGCGATATGTGCTTTGATTGTTGAGG AATTATTTGAATACGCTGGTAAGTGGCGAAATATTAGAGTTCAGGGTCCTACGACTTTCTTGCCTTCTTTAACTG TGCAAGTAGCGATGGCGGGAGCGATGTTGATTGGCTTGCACCATCGAATCTGTTACACGACTTCAGCGTCTGTAT TAACGGAGGCTGTCAAGCAAAGTGACTTACCATCTGGATACGATCATTTATGTCAATTCGTAATGTCAGGTCAAT TGAGTGATTCAGAAAAGTTGTTGGAGAGTTTGGAAAACTTTTGGAACGGTATTCAGGAATGGACGGAACGACACG GCTATATAGTTGACGTGTCTAAGCGTATTCCTTTTTGA]CTCCTCTCTCACTCGAGATAACAGATACTTCGGTA TCTGTTATCTGTTTTTTTTCAACAGATAGCCGCGTTCGCGCGGCTATCTGTTTTTTTTATAACAATGCTTACT(C CCGGG)

[0045] In some embodiments, the self-splicing intron comprises a ~400bp self-splicing intron derived from Tetrahymena. In some embodiments, the self-splicing intron is a group I or group II intron active in gram-positive bacteria. (See, e.g., Landthaler M, Shub DA. Unexpected abundance of self-splicing introns in the genome of bacteriophage Twort: introns in multiple genes, a single gene with three introns, and exon skipping by group I ribozymes. Proc Natl Acad Sci U S A.1999 Jun 8;96(12):7005-10. doi: 10.1073 / pnas.96.12.7005. PMID: 10359829; PMCID: PMC22036. See also Landthaler M,Begley U, Lau NC, Shub DA. Two self-splicing group I introns in the ribonucleotide reductase large subunit gene of Staphylococcus aureus phage Twort. Nucleic Acids Res. 2002 May 1;30(9):1935-43. doi: 10.1093 / nar / 30.9.1935. PMID: 11972330; PMCID: PMC113830. See also Belfort M, Lambowitz AM. Group II Intron RNPs and Reverse Transcriptases: From Retroelements to Research Tools. Cold Spring Harb Perspect Biol. 2019 Apr 1;11(4):a032375. doi: 10.1101 / cshperspect.a032375. PMID: 30936187; PMCID: PMC6442199.). In some embodiments, the self-splicing intron is a group I or group II intron active in gram-negative bacteria. (See, e.g., Holländer V, Kück U. Group II intron splicing in Escherichia coli: phenotypes of cis-acting mutations resemble splicing defects observed in organelle RNA processing. Nucleic Acids Res.1999 Jun 1;27(11):2339-44. doi: 10.1093 / nar / 27.11.2339. PMID: 10325423; PMCID: PMC148800. See also Sandegren L, Sjöberg BM. Self-splicing of the bacteriophage T4 group I introns requires efficient translation of the pre-mRNA in vivo and correlates with the growth state of the infected bacterium. J Bacteriol.2007 Feb;189(3):980-90. doi: 10.1128 / JB.01287-06. Epub 2006 Nov 22. PMID: 17122344; PMCID: PMC1797299.)

[0046] In some embodiments, the transgene for use in the invention has been modified to facilitate distinction between the introduced transgene and any corresponding native gene that could be present. A representative example of a modified transgene suitable for use in the claimed methods is provided in Table 2.

[0047] Table 2: KTM Native and Corresponding Synthetic Marker Coding Genes

[0048] Alignment of native KTM gene coding sequence (SEQ ID NO: 2) and synthetic KTM marker gene coding sequence (SEQ ID NO: 3) is shown, with mismatches indicated by dots. Vertical lines indicate bases that match between the two sequences. Key mismatches targeted by LNA modifications in RT-LAMP primers are shown in bold. F3 and B3 primer binding sites are shown in boxed areas. F2 and B2 domains of the FIP and BIP primers, respectively, are indicated with thick horizontal lines. The splice junction occurs between nucleotides shown thin underlining. Alignment was produced using EMBOSS NEEDLE, with maximum gap opening and gap extension applied.||.|||||||||||.||.|||...||||||||||||||||||...||.|| KTM_MODIFIED 151 ATCGAGATGATGTGCGTGATGAGTACAGAGGAAGCAGAGTTCTCTCACGA 200KTM_ORIGINAL 20 .|||||.||.|||||.|||||.||.||.||.|||||||||||.||.||||KTM_ORIGINAL KTM_MODIFIEDKTM_ORIGINAL 401 CGATTTGTGCCCTTATCGTAGAAGAGCTGTTTGAATATGCAGGCAAATGG 450 ||||.|||||..|.||.||.||.||..|.||||||||.||.||.||.||| KTM_MODIFIED 401 CGATATGTGCTTTGATTGTTGAGGAATTATTTGAATACGCTGGTAAGTGG 450 KTM_ORIGINAL KTM_MODIFIEDKTM_ORIGINAL 501 ACAGGTAGCAATGGCAGGTGCCATGTTGATTGGTCTGCATCATCGCATCT 550 KTM_MODIFIEDKTM_ORIGINAL 551 GTTATACGACGAGCGCTTCGGTCTTAACTGAAGCAGTTAAGCAATCAGAT 600 KTM_MODIFIED KTM_ORIGINAL.|.||.||.||.||.||.|||.|.||.||.|||||||||||.||||||.| KTM_MODIFIED KTM_ORIGINAL....||.||.||.||..|..||||.....|.||.||.||.|||||.||.| KTM_MODIFIED KTM_ORIGINALKTM_MODIFIED 701 TTCAGGAATGGACGGAACGACACGGCTATATAGTTGACGTGTCTAAGCGT 750 KTM_ORIGINALKTM_MODIFIED 751 ATTCCTTTTTGA 762

[0049] Table 3: Marker gene cassette of pOrf142+gfp_mod (SEQ ID NO: 4)

[0050] T7 promoter is displayed in italicized type, Pcap promoter and ribosomal binding site is shown with double underlining. Orf142 gene coding sequence (first exon and first 22 bp of second exon) is shown inside square brackets. Intron sequence is underlined. Curly brackets indicates spacer to improve primer design characteristics against the transgene. GFP gene is shown with dashed underlining, with ablated start codon indicated in lower case. Bold font indicates T7hyb10 transcriptional terminator. Restriction sites flanking the expression cassette are shown in parentheses.

[0051] (CCTGCAGG)CTAGGAGGCAATTGT TAATACGACTCACTATAG AGAGTTTGCAAAATATA CAGGGGATTATATATAATGGAAAACAAGAAAGGAAAATAGGAGGTTTATCAT[ATGGCATCTCAAGCTA AACAGACAGTCCATACTGGTAATACCGTAATGCTTATGATTAAAGGTAAACCTGTAGGTAGAGCTCAATCA GCGTCTGGTACACGTTCTTACGGTACAGAAGGGGTATATGAGATTGGTTCTATCATGCCACAAGAACACGTTTACCTTAAGTATGAAGGTGAATTAACAGTAGAACGTCTACGAATGAAAAAAGAGAACTTTGCAAAATTAG GATATGCTTCTCTTGGTGAAGAAATCCTTAAGAAAGATATTATTGACATTGTTGTTATTGACAACTTGACT AAAGAAGTGCTTGTGTCATATCACGGTTGTAGTGCTAATAACTAT]GAACTTCGTAGCTTCACATAGTAAT ATGTGTCGAAAAACTTTTCTAAACAGGGAAGCCTAAGTCTATTAGATATGGTAATCCTGTGCTAAATCAGA TTAATAATCTGTAAATGCCAAACGACTAACTGAAACCTACTTGATAATTCAAGGGGAGTAAGTGTAGAGCC AAGCGGTAGAAGTTTTAAGTAATTATTATGTAAATCTTCTTTAAATCGAAAAGAAAAGAGTCCTTTTTTAG GATTGTGATATAGTCTGAACATATATGGAAACATATAGCAGTTCCTAGAGAACGGGCAGTGAGTAGCGACC ACTGTTGAACATAATG[GATGAAGCATGGAACACTAATG]{AAATAACTACTGAAAGC}ATtTCAAAAGGC GAAGAGTTGTTCACGGGTGTTGTGCCGATCTTAGTAGAATTGGATGGTGACGTTAACGGCCATAAATTTTC TGTGCGAGGTGAAGGAGAGGGCGACGCGACTAACGGAAAATTGACATTAAAGTTCATTTGTACGACAGGTA AGTTGCCTGTTCCATGGCCTACTTTAGTGACGACGTTAACATACGGAGTCCAATGCTTCAGTCGTTATCCA

[0052] Additional nucleic acid molecules described herein include primers for use in carrying out the claimed methods. In some embodiments, the primers specifically amplify nucleic acids flanking the self-splicing intron. In some embodiments, the primers specifically amplify nucleic acids encoding the exon-exon junction. In some embodiments, the primers are selected from SEQ ID NO: 5-29 (Table 5). In some embodiments, the primers comprise 3’ termini, and the primers further comprise LNA modified bases at discriminatory sites differentiating between wild type and codon optimized genes at the 3’ termini. Representative primers are shown in Table 5, in Example 3 below.

[0053] The invention also provides kits comprising a set of reagents as described herein, such as bacterial plasmids, transgenic bacteria, and / or primers as described, and optionally, one or more suitable containers containing reagents of the invention. Reagents can optionally include a detectable label. Labels can be fluorescent, luminescent, enzymatic, chromogenic, or radioactive.

[0054] The kit can optionally include a buffer. Reagents and standards can be provided in combinations reflecting the combinations of reagents described herein as useful. In some embodiments, elements of the kit are provided in lyophilized form.

[0055] Also described herein is a kit for performing these methods. In some embodiments, the kit comprises a genetically modified bacterium that expresses a transgene, wherein the transgene comprises a self-splicing intron and expresses a non-native synthetic codon sequence. In some embodiments, the bacterium is a gram-negative bacterium. In some embodiments, the transgene is a bacterial antibiotic resistance gene. In some embodiments, the self-splicing intron comprises a ~400bp self-splicing intron derived from Tetrahymena. In some embodiments, the bacterial antibiotic resistance gene comprises kanamycin nucleotidyltransferase. In some embodiments, the bacterium is lyophilized. In some embodiments, the transgene has been codon optimized.

[0056] In some embodiments, the kit further comprises a set of primers that specifically amplify nucleic acids flanking the self-splicing intron. In some embodiments, the primers are selected from SEQ ID NO: 5-29 (Table 5). In some embodiments, the primers comprise 3’ termini, and the primers further comprise LNA modified bases at discriminatory sites differentiating between wild type and codon optimized genes at the 3’ termini. In some embodiments, the primers are selected from SEQ ID NO: 31-35.

[0057] In some embodiments, the transgene comprises the nucleotide sequence shown in Table 1 and SEQ ID NO: 1 (pKTM_IAC marker gene cassette). In some embodiments, the transgene comprises the nucleotide sequence shown in Table 3 and SEQ ID NO: 4 (pOrf142+gfp_mod marker gene cassette). In some embodiments, the transgene comprises the nucleotide sequence shown in Table 4 and SEQ ID NO: 30 (nrdE_twort_intron_aureus). EXAMPLES

[0058] The following examples are presented to illustrate the present invention and to assist one of ordinary skill in making and using the same. The examples are not intended in any way to otherwise limit the scope of the invention.

[0059] Example 1: Validation Studies

[0060] This Example demonstrates validation of the usefulness of this strategy in an assay. We performed studies to evaluate the sensitivity and specificity of this assay for target RNA.

[0061] RNA (subsequently DNAse treated) or DNA (subsequently RNAse treated) were purified from two strains of E. coli, one of which expressed the synthetic RNA controlconstruct, and the other of which carried pUC19, the parent vector into which the synthetic RNA control construct was built.

[0062] RT-LAMP was performed using 10-fold serial dilutions of purified RNA or DNA, ranging from 1 pg to 10 fg of total nucleic acid. It should be noted that, because bacterial cells contain roughly 6 fold more RNA than DNA (~100 fg and 17 fg, respectively; thermofisher.com / us / en / home / references / ambion-tech-support / rna-tools-and- calculators / macromolecular-components-of-e.html), the maximum input amount tested for the RNA reactions corresponds to approximately 10 E. coli cell equivalents, whereas the DNA reactions contain proportionately more cell equivalents, approximately 59.

[0063] Even despite this difference, the RT-LAMP reaction was fully specific for RNA derived from the synthetic RNA control construct. Detection of transgenic RNA product was sensitive to 0.1 pg total RNA, or a single cell equivalent of material. Amplification was not achieved for sub one cell equivalent (0.1) RNA template. No amplification was observed for DNA derived from the strain expressing the control construct, or from either nucleic acid extracted from the strain carrying the parental pUC19 vector. These findings illustrate both the sensitivity and specificity of this control system.

[0064] This synthetic RNA control system provides robust reference material enabling RNA and DNA to be differentiated during clinical testing, and for assays to simultaneously control for multiple pre-analytic and analytic points of failure (cell lysis, nucleic acid extraction, reverse transcription, and template amplification and detection). This system will be applicable in a wide range of clinical molecular diagnostic tests in both laboratory-based and point of care settings. Although E. coli is a useful representative gram-negative bacterial species, the system could also potentially be adapted to other bacterial species, or analogous systems constructed in other bacterial species. It is understood that other group I or group II sequences would be appropriate to use in other organisms.

[0065] Example 2: Transgenic Expression Cassette

[0066] It is possible that native forms of the antibiotic resistance gene target could be present in patient specimens (for example, if carried by other organisms in the patient microbiome), and could lead to false positive results from the detection of DNA targets from those sources. To ensure specificity for detection of this synthetic target RNA, rather than native antibiotic resistance gene DNA that may originate from exogenous sources, we therefore recoded the resistance cassette to express a synthetic codon sequence that is not found in nature, while preserving key sites required for RNA splicing (See Table 2). Assay primers are designed to leverage sites of sequence divergence between the wild-type and recoded form of the gene, with discrimination between the two states further enhanced bythe inclusion of LNA modified bases at discriminatory sites occurring at the 3’ termini of primers. (See You, Y.2006, Design of LNA probes that improve mismatch discrimination. Nucleic Acids Research 34, e60–e60.)

[0067] The transgenic expression cassette of the vector also contains a T7 promoter and a transcriptional terminator showing strong activity against T7 RNA polymerase, allowing the plasmid to be used without further modifications as a template for generating spliced RNA through in vitro transcription. (See Calvopina-Chavez, D. G., et al., 2022, Engineering efficient termination of bacteriophage T7 RNA polymerase transcription. G3 Genes| Genomes|Genetics 12, jkac070.)

[0068] One example of a transgenic expression having these features is provided in Table 4 and SEQ ID NO: 30. S. aureus self-splicing intron was used in a construct based on work showing that twort phage makes genes that encode self-splicing introns in S. aureus. (Landthaler M, Begley U, Lau NC, Shub DA. Two self-splicing group I introns in the ribonucleotide reductase large subunit gene of Staphylococcus aureus phage Twort. Nucleic Acids Res.2002 May 1;30(9):1935-43. doi: 10.1093 / nar / 30.9.1935. PMID: 11972330; PMCID: PMC113830.

[0069] Table 4: Self-splicing intron expression cassette nrdE twort intron aureus

[0070] Construct nrdE_twort_intron_aureus as follows (SEQ ID NO: 30).

[0071] nrdE gene is in square brackets. Intron is shown with underlining. T7 promoter is shown with italicized type. Bacterial PCAP promoter is shown with double underlining. Bold font indicates T7hyb10 transcriptional terminator. Restriction sites flanking the expression cassette are shown in parentheses.

[0072] (CCTGCAGG)CTAGGAGGCAATTGTTAATACGACTCACTATAG Agagtttgcaaaatatacaggggattatatataatggaaaacaagaaaggaaaataggaggtttatcat [ ATGGCAACTTATGGTAAGTGGATTGACCTTAATAATGAGGTCACTCAACTAGACGAAAATGGAAAAA ATAAACTCTATAAGGACAAAGAAGCCTTAGAAGAGTACTCAAAATATATTGAAAAGAATACACGTAAT TTTGATAATGAAGTAGAGCGTGTACGTACCTTAACTAAAGAGGGTACTTATGATAAGGTGTTTGATAG TATTCCTGATACTATTATTGAAGAAATGACAAAGTTAGCTTATAGTTTTAACTTTCAATTTCAGAGCT TTATGGCATGTCAAAAGTTCTATGAATCATATGCTGTGACACAGTATGATAAAGATGATAATCCTATT TTTGTAGAAGATTATGAACAACATAATGTACGTGTTGCGCTTTATTTATTTCAAGACGATTATGTTAA AGCTAGAGAAATGTTAATTCAATTAATGGAACAGACATTACAGCCCGCTACACCAGTATATCTTAACT CAGGGTTAGGTAAACGTGGTGAATTGTCATCTTGTTATTTATTTATTGTAGATGATACTATCGAATCT ATTAACTTTATTACAGACTCCGTACGACAAGCATCTAAAAATGCAGGAGGTTGTGCAGTAGACTTAAC AAGATTACGCCCTAGAGGAACAGAGGTTAATGGTGTTCCTAATGCTAGTAAGGGTGTAATACCATTTG CAAAAAATATCGAGCAGAGCGTATCATATTTCAACCAGGGTAAA]CAATTCTGCCCCCTATATTAGTAATAGTGTAGGTTAAAAAACTTCCTTAATTCATGGGAAATCTCCTTGACTTTTATTATAAATTTTGGTA TAGTAAAATGAGAAGGAGATAATCATGAGCAAGATAACCAATAGCAAAGAAACCCAAAAAAGTACCTA ACGCTACTAAAAGTATTTACCACCATATAAAAAGTAAAAGAAGATGGAAGTCATTAAATCACTTAATG AATTGGTAATTATCTTGTGCAACGACTAGAGAAAAGATAGTTTATTGTTACAGGCAGTAAATGAAGAC TGAGTATCGTACACTCAAGTGAGTGGAAACAGGAAGTATCCTAGAGTAACGACTAGGATAATGATATA GTCTGAACATTGTAGGTGACTACAAGAAGGTAAGGAGTAACGAACCTTATCGTAACATAATTG [GGAAAACGTGAAGGCTCTGCAGTATGTTATTTAAATATATTCCACCCAGATATTCATGAATTTTTAA GTTCTAAAAAAATTAATGCTAGTGATAAAGTAAGATTAGACACATTATCTATTGGTGTAACAATACCA AATAAGTTTATGGAATTACTTAAAGAAGATAAATACTACTATACATTTAATGTATATGATGTTAAACA AAAATATGGGTTTACATTAAATGAAATAAACATGTCCGAGTATTATGATATATTTGTGAATGATGATG ATATTAGAAAAGAAAAATATTATACAAGAGATATAATGACTGACATTGCAAGAACACAACTAGAGTCA GGATACCCTTATGTTTTCTACATTGATAACGCAAATGACAATCACCCTTTGAAGAAACTAGGTAAAGT TCAAATGTCTAATTTATGCTGTGAGGTGACACAGCTACAAGAAGTATCCGACATATTCCCATATTTAC AATCACATAATGATACTATTGGGAATGATGTTGTGTGTACGTTAGGTTCATTAAATTTAGTGAATGTT GTAGAAAAAGGATTGCTTAAAGAATCCGTAGATAGTGGTATTCGTTCGTTATCTAAAGTAACGGATTT AATGAACGTTCCATTTTTACCAAGTGTTCAGAAGGCAAACGATGAGCTACGAGCTATAGGTCTTGGAG CAATGAACTGGCATGGACTTCTAGCAAAGAATATGCTTAGTTATGGTTCTAGGGAATCTCTAGACATT GCTAATAGTTTATTTAGTGCTATTAGATACTACTCTATTAAGTCTAGTATGGAACTAGCTAAAGAAAC TGGTAAAGTTTTTAAAGGTTTTAAAGAATCAGAATACTATACTGGAGAAGTGTTTAGTTCATATATTC AAAAGTCACATGAACCTAGAACTAAAAAAGCTAAAAAAGTACTAGAAAAGGTATATATCCCTACGGAA GAAGACTGGAACTCTTTAAGCAAAGATGTAAAAGAGTATGGTATGTACAACGGATACTTAAATAATCT TGCACCT]TATATATTAGGGCGTGTATAAGAATACATGATAACTCTTTCGAATTGCTGGAACACCCTT AGAGCCTAATAAACTACAACGTAACTAGAAATGGTAAGCGTGAATGTTTAAAAATTATTGGGATTGGG CAATCAGCATCTAAGATTCTAAATAATTATAATTAAAATAAAGTGTAACAAAGGAAGATATATTATAG AGGAGTTATGGAAAGAAATACCTGGGTTTAATTCATACATGATTAGTAATAAAGGTCAGGTTTACTCA AGAAAAAGAAATAAGATACTAGCTTTACGAACAGATAAAAATGGGTATAAAAGAATATCTATTTTTAA CAATGAAGGTAAAAGAATTCTATTAGGAGTTCATAAGTTAGTTCTCTTAGGTTTTAAAGGTATTAATA CTGAAAAGCCTATACCTCACCATAAGAATAATATTAAAGATGATAACAGATTAGAAAATTTGGAATGG GTTACAGTTAGTGAAAATACCAAGCATGCATATGATATAGGGGCTTTAAAATCACCTAGGAGAGTTAC ATGTACTCTTTATTATAAAGGAGAACCTTTATCATGCTATGACTCGTTGTTTGACTTAGCTAAGGCTT TAAAAGTAAGTAGAAGTGTAATAGAGAGTCCTAGAAATGGTTTGGTGTTATCTACTTTTGAAGTAAAA AGAGAACCTACAATACAAGGACTACCTTTAAATAAAGAGATATTTGAGCATAGTTTAATTAAGGGCTT GGGTAATCCTCCTTTAAAAGTGTATAATGAAGATGAAACCTACTACTTTTTAACTTTAATGGACATAA GTAAGTACTTTAATGAATCATACTCTAAAGTACAACGAGGATATTATAAAGGTAAGTGGAAAAGTTAT ATTATAGAACATATTGATTTTTATGAGTATTACAAACAAACACATTAATTATAATTACAAGAATAAAG TTCAACGACTATCCCGTTGCTGGGAGTACACTCAAGTGAGTGGAAGTGGAAGAGGTCTTACTTAAGTA AGATGTGATATAGTCTGGACGTATATGGAAACATATAGAAGGTAAGGAGTAACGAACCTTATCGTAACATAATCG[ACACAATCCATTTCGTATGTACAAAATGCAACTTCTAGTATTATGCCAGTACCTTCACCT ATTGAAAATAGACGCTATGGTAACATGGACACATACTATCCTATGCCGTTTATGTCACCAATTACACA ATTTTTCTACGAGAGTGAAACAGCATATAAATTAGATAATAAACGTATTATTAATACAAGTGCGGTGA TTCAAAAACACGTAGACCAAGCTATTTCTACTATTCTTTACGTAGAGTCTGAAATACCAACTAATAAA TTAGTAAGTTTATATTATTATGCTTGGGAAAAAGGTTTAAAATCTTTATACTATACCCGTTCACAAAC ATTAAAAGTTATTGAGTGTGAATCTTGTAGTGTA TGA] CTCCTCTCTCACTCG

[0073] AGATAACAGATACttcgGtatctgttatctgttTTTTTTcAACAGATAGCCGCGttcg CGCGGCtatctgttTTTTTTATAACAATGCTTACT (CCCGGG)TACC

[0074] LAMP primers that span the second (larger) intron (first intron does not allow loop primers) include: TwortF3 CAAAGATGTAAAAGAGTATGGTATG (SEQ ID NO: 31); twortB3 CCGCACTTGTATTAATAATACGT (SEQ ID NO: 32); twortFIP GGTGAAGGTACTGGCATAATACTAGGGATACTTAAATAATCTTGCACCT (SEQ ID NO: 33); twortBIP GACGCTATGGTAACATGGACACATATGCTGTTTCACTCTCGT (SEQ ID NO: 34); twortLB TCCTATGCCGTTTATGTCACCAATT (SEQ ID NO: 35).

[0075] Example 3: Development of advanced control material for reverse transcription-mediated bacterial nucleic acid amplification tests

[0076] Detection of bacterial RNA by nucleic acid amplification tests (NAATs), such as reverse transcription PCR (RT-PCR) and reverse transcription loop-mediated isothermal amplification (RT-LAMP), offer distinct advantages over DNA-based methods. However, such assays also present challenges in ascertaining positive and internal control material that can reliably monitor success over all phases of testing (bacterial lysis, nucleic acid recovery, reverse transcription, amplification, and signal detection): since they are unable to distinguish between amplification of bacterial RNA transcripts and the DNA templates that encode them, using intact organisms as controls can inform cell lysis but not the successful detection of RNA. This Example describes the development of a control strategy for RNA- based bacterial NAATs that allows ready discrimination of RNA from DNA templates using self-splicing bacterial introns, such that those nucleic acids ultimately encode different sequences. Two vectors encoding synthetic transgenes were engineered based on this principle, one that is active in the gram-negative bacterium Escherichia coli and one that functions in both E. coli and the gram-positive organism Staphylococcus aureus. RT-LAMP assays were subsequently designed that either target RNA and DNA from transgenic organisms or that target RNA exclusively, and demonstrated specificity of amplification using purified nucleic acids. Using multiplexed fluorescent RT-LAMP of heat-lysed specimens, the practicality of deploying such transgenic organisms as an internal control to ascertain sample integrity and assay performance during clinical diagnostic testing is demonstrated.This approach has broad utility for RNA-based bacterial nucleic acid amplification tests, especially point-of-care assays and other applications where nucleic acids are nonspecifically liberated for testing.

[0077] Materials & Methods

[0078] Bacterial strains and growth conditions.

[0079] S. aureus strain JE2 and E. coli IM08B were obtained from the Biodefense and Emerging Infections Research Resources Repository (BEI Resources). E. coli DH5alpha was obtained from New England Biolabs. Pseudomonas aeruginosa PAO1 was a generous gift of Dr. Colin Manoil (University of Washington). All bacteria were cultured at 37°C in LB containing antibiotics if appropriate to select for maintenance of plasmid vectors (100 μg / mL ampicillin for E. coli and 10 μg / mL chloramphenicol for S. aureus).

[0080] Vector design and construction.

[0081] The general design of expression cassettes used in this study were the same in both engineered vectors. Cassettes incorporated a T7 promoter sequence for possible in vitro transcription of the cloned transgenes, followed by a broad host range Pcap promoter and ribosome binding site33to drive transcription in vivo. Downstream of the transgene, cassettes incorporated the T7hyb10 terminator sequence, which has strong activity against both T7 RNA polymerase and native bacterial RNA polymerases34.

[0082] The E. coli splicing vector (pKTM_IAC) was synthesized by IDT into the pUC19- derived pUCIDT (Amp) Golden Gate vector. The KTM_IAC transgene (Table 1) contained the Tet-119-derivative of the Tetrahymena group I intron (wild-type sequence from Genbank JN547815.1) inserted into a version of KTM (Genbank HM151400.1) as previously described35, except that KTM was re-encoded using E. coli codon optimization (Table 2) through the IDT codon optimization tool (www.idtdna.com / pages / tools / codon-optimization- tool) while preserving exonic residues deemed critical to splicing.

[0083] The S. aureus splicing cassette (Table 3) was initially synthesized by GenScript into pUC19. The transgene comprised the first exon, intron, and initial 22 bp of the second exon from bacteriophage Twort orf142 (Genbank AF132670.1) with a short spacer sequence added at the 5’ end to improve primer design characteristics, and followed by an in-frame superfolder GFP36coding sequence codon optimized for S. aureus as above and from which the start codon was removed. We generated a temperature-stable derivative of the E. coli- S. aureus shuttle vector pCN50-BSAI37by replacing the temperature-sensitive pT181 cop- 634ts repC4 replicon with the wild type pT181 cop-wt repC replicon from pCN3338, yielding pCN50wt. The expression cassette was subsequently cloned into pCN50wt to yield the finalS. aureus splicing vector (pOrf142+gfp_mod). Vectors were transformed into S. aureus JE2 after plasmid conditioning in IM08B as previously described39.

[0084] Nucleic acid extraction.

[0085] Total RNA was extracted from E. coli after lysis with lysozyme (Sigma) using Monarch® Total RNA Miniprep Kit (NEB), with on-column DNase I (NEB) treatment. S. aureus total RNA was similarly extracted after lysis with lysostaphin (Sigma) using RNeasy Kit (Qiagen), followed by an in-solution DNase I digestion and secondary cleanup with RNeasy Kit. Total DNA was extracted from both organisms using DNeasy® UltraClean® Microbial Kit (Qiagen), followed by removal of residual RNA from eluate by RNase A digestion (Thermo Fisher) and secondary purification using AMPure XP beads (Beckman).

[0086] RT-LAMP assays.

[0087] Primers, probes, and quenchers were synthesized by IDT (Table 5). LAMP primers were designed using NEB LAMP Primer Design tool v 1.4.1 (lamp.neb.com / #! / ), with LB primers subsequently modified to carry 5’ adaptor sequences for interaction with primer- specific fluorescent probes and quenchers21. Fluorescent probes and quencher sequences were as previously described21.

[0088] Table 5: Primer SequencesATCCTTGAGAGTTTTCGCCCCGAATACCGCGCCACATA ampBIP_P1L1 GC (SEQ ID NO: 13) ACCAACACCTCACATCACACATAATAAGAACGTTTTC ampLB_P1L1 CAATGATGAGCACT (SEQ ID NO: 14)* Plus sign precedes LNA-modified bases † Bold font indicates homology tails between loop primers and probes Sequence from Panpradist, N. et al. Sci Adv 7, eabj1281 (2021)

[0089] Cell equivalents of DNA used as template for RT-LAMP were calculated as elsewhere40, based on the genome sizes of E. coli DH5alpha and S. aureus JE2. Cell equivalents of RNA used were based on an estimate of 100 fg total RNA per bacterial cell41.

[0090] All RT-LAMP reactions were conducted at 65°C using WarmStart® LAMP Kit (DNA & RNA) (NEB) following manufacturer instructions. Primer and probe concentrations were as specified elsewhere21. Reaction fluorescence was measured using QuantStudio 3 (Applied Biosystems) in 30 second intervals over the course of a 1hr incubation.

[0091] Bacterial thermal lysis experiments utilized aliquots of 10,000 cells per RT-LAMP reaction, based on spectrophotometric readings of overnight cultures42,43. Cells were diluted into TE buffer (pH 8.0), heated to 65°C for 10 m followed by cooling on ice. Varying concentrations of RNase A were then added to lysed cell aliquots prior to RT-LAMP.

[0092] Fully deidentified residual stool specimens (~20-100mg) were resuspended in 500 μl molecular grade water by vortexing. Serial dilutions were prepared using molecular grade water. E. coli carrying pKTM_IAC was added to each specimen and dilution at a final concentration of 1,140 cells per μl. Aliquots were spiked with P. aeruginosa to a final concentration of 57 cells per μl. Bacterial thermal lysis followed by RT-LAMP was conducted as before, using 8.75 μl specimen volume per reaction.

[0093] Results & Discussion

[0094] Design of a self-splicing marker gene in E. coli and RNA-specific RT-LAMP.

[0095] A system was developed for enabling specific detection of RNA in the canonical gram-negative bacterium E. coli. A previously described, self-splicing construct comprising a bacterial antibiotic resistance gene (kanamycin nucleotidyltransferase KNT) into which a 413 bp self-splicing intron derived from Tetrahymena was inserted35was repurposed (Table 1; SEQ ID NO: 1). It is theoretically possible that a native form of the KNT gene (Table 2; SEQ ID NO: 2) could be present in test specimens, for example, if carried by other organisms in a patient microbiome or contaminating organisms from the environment, and that this could lead to false positive amplification from exogenous DNA sequences. To ensure specificity for the synthetic, spliced RNA target, the sequence of this resistance gene was therefore re- encoded to a form that is not found in nature (Table 2; SEQ ID NO: 3).

[0096] E. coli transformed with the transgene-containing vector (pKTM_IAC), but not the parental vector backbone (pUC19), proved resistant to kanamycin at a level of 50 μg / mL, indicating successful splicing of the synthetic construct into an active form of the RNA transcript.

[0097] RNA-specific RT-LAMP assay primers were designed to span the target gene’s intron such that it fell both between the FIP and BIP primers and also between the F1 and F2 domains targeted by the FIP primer itself8,20. This configuration disrupts FIP primer binding to DNA templates and simultaneously makes the target region too large (621 bp from the ends of the outermost F3 and B3 primers) to be effectively amplified by RT-LAMP44unless splicing has successfully occurred (208 bp from the ends of F3 and B3 primers). RT-LAMP primers were additionally designed to leverage sites of sequence divergence between the native and re-encoded forms of the gene, with discrimination for the synthetic construct further enhanced by incorporating locked nucleic acid (LNA) bases at mismatched sites overlying the 3’ termini of assay primers45.

[0098] An RT-LAMP primer set was separately developed for the ampicillin resistance gene (ampR) encoded by the pUC19 plasmid vector backbone itself, which is expected to amplify both DNA encoding that gene and the RNA that is constitutively expressed from it.

[0099] RT-LAMP assays can specifically identify RNA template in E. coli.

[0100] To test the strategy for differential detection of nucleic acids in RNA-based NAATs, RNA and DNA was selectively purified from transgenic bacteria and RT-LAMP reactions were conducted with primer sets targeting either plasmid DNA and RNA (ampRprimers) or those designed to be specific for spliced RNA from the plasmid-encoded target gene (transgene primers). RT-LAMP was performed using a commercially available cocktail of Bst polymerase and reverse transcriptase. Tests were performed with 10-fold serial dilutions of purified RNA and DNA templates spanning 10,000 to 100 cell equivalents of E. coli that carried either transgene-expressing pKTM_IAC or the precursor pUC19 vector (FIG.2A).

[0101] RT-LAMP primers targeting pUC19-encoded ampRamplified both DNA and RNA fractions purified from bacteria proportionately to the amount of template provided. Amplification was achieved from E. coli carrying either pUC19 or pKTM_IAC, indicating the presence of intact nucleic acids for each condition tested. In contrast, amplification using the RNA-specific transgene primers occurred only for RNA purified from E. coli expressing the pKTM_IAC construct, with no measurable signal generated from the DNA fraction of those cells. RNA-specific RT-LAMP similarly failed to amplify either RNA or DNA of E. coli transformed with pUC19, which lacks the spliced transgene.

[0102] RT-LAMP targeted against the spliced KTM target is highly specific for RNA templates and does not amplify the DNA template that encodes it.

[0103] Design of a self-splicing transcript with activity in both E. coli and S. aureus.

[0104] To expand the strategy to a harder-to-lyse, gram-positive organism, an analogous system was designed that would function in S. aureus. A second vector (pOrf142+gfp_mod) was constructed to house a synthetic fusion of the self-splicing orf142 gene from bacteriophage Twort46,47and a start-loss mutated GFP36that was codon optimized for S. aureus and cloned in-frame with the second exon of orf142 (Table 3; SEQ ID NO: 4). Since in this implementation the GFP target gene is both synthetic and exogenous to bacteria, the design does not risk contamination from organisms in the environment or in tested specimens. The construct was built into an E. coli-S. aureus shuttle vector (pCN50wt) that carried pUC19 and pT181-derived replicons38in order to facilitate its construction and ultimate transformation into S. aureus39.

[0105] The pOrf142+gfp_mod transcript underwent successful splicing in S. aureus, as evidenced by visible GFP fluorescence in transgenic bacteria, but this phenotype was unexpectedly also observed for E. coli carrying the vector. This result indicated that the intron’s autocatalytic activity was conserved across these two distantly related bacteria, and that the vector construct could be used in both organisms.

[0106] The ability of pOrf142+gfp_mod to act as a control in both E. coli and S. aureus was then tested. Primers were designed for RT-LAMP of the spliced target gene using the same schema as in the earlier construct, and again serial dilutions were tested of purified nucleic acids from transgenic E. coli (FIG.2B) and S. aureus (FIG.2C) that harbored either pOrf142+gfp_mod or the precursor pCN50wt vector that lacks the transgene construct.

[0107] As before, amplification of DNA and RNA fractions using ampR-targeted primers confirmed the presence of both nucleic acids in specimens derived from E. coli and S. aureus. RT-LAMP of ampRwas less robust from S. aureus RNA fractions at 1,000 and 100 cell equivalents than from corresponding cell equivalents of S. aureus DNA, E. coli DNA, and E. coli RNA, evidenced both by increased time to threshold (Tt) values and greater variability between replicates. These outcomes48are consistent with less efficient transcription being driven by the gram-negative ampRpromoter when transferred from E. coli to S. aureus, resulting in fewer template molecules per organism. Regardless, amplification with transgene-specific primers was specific for purified RNA from both E. coli and S. aureus expressing the Orf142+gfp_mod cassette. No product was detected from the DNA of those organisms or from RNA or DNA of bacteria carrying the empty pCN50wt vector backbone. These findings indicate that selective amplification of the spliced RNA transcript was achieved in both E. coli and S. aureus, without measurable amplification from plasmid DNA that encodes the expression cassette.

[0108] Multiplexed RT-LAMP provides an internal control for assay performance.

[0109] The next test was to determine whether the approach could be used to provide an internal control for monitoring RT-LAMP assay performance when deployed alongside testing for a diagnostic target. To allow for simultaneous detection of signal from separate primer sets within the same reaction, a strategy was adopted for multiplexed RT-LAMP employing fluorescently labeled probes and quencher complexes that differentially bind to nucleotide tails on assay loop primers21, allowing distinct amplification products to be fluorometrically distinguished.

[0110] The viability of this multiplexed assay strategy was initially evaluated by ascertaining nucleic acid recovery and detection after thermal lysis of E. coli carrying pKTM_IAC, a crude method of total nucleic acid extraction that is compatible with point-of-care testing49–51. In order to test a range of conditions under which RNA would be variably degraded, aliquots of cell lysate were spiked with varying amounts of RNase A prior to multiplexed RT-LAMP containing primers targeting pUC19 ampR(serving as a diagnostic target) and the spliced KTM transgene (acting as an internal control) (FIG.3).

[0111] Amplification of ampRand the spliced KTM transgene were readily achieved by multiplexed RT-LAMP after heat lysis, demonstrating robust signal detection from both targets simultaneously. Signal from the spliced KTM internal control decreased inversely with the amount of RNase A added to reactions, indicating that the assay’s ability to detect RNA had been compromised. Significantly (p≤0.05, 2-tailed T test) delayed Tt values relative to a lysed cell control were observed when using ≥0.01 ng RNase A per reaction, and complete signal loss from RNA-specific primers occurred with inclusion of 1 ng or more RNase A. In contrast, signal from ampRtarget was not measurably decreased under any test condition, consistent both with amplification occurring off the DNA present in those specimens and an insensitivity of the pan-nucleic acid primer set to identify reduced RT- LAMP assay performance for RNA templates.

[0112] Last, the feasibility of using transgenic organisms to monitor assay performance in a clinical context was explored. To this end, an independent diagnostic target was tested within clinical matrices that could contain additional microorganisms and inhibitory substances able to confound testing. Organism-specific RT-LAMP primers were designed to target a gene that identifies Pseudomonas aeruginosa52, an opportunistic pathogen able to seed hematogenous and respiratory infections after colonizing the gut of critically ill patients53, and this diagnostic assay was multiplexed with RNA-specific primers for the pKTM_IAC control. For these studies, stool specimens were evaluated as a relevant and challenging clinical matrix containing a high burden of molecular inhibitors54,55and residentmicrobiota56. E. coli carrying pKTM_IAC was added to stool specimens as an internal control, and aliquots were spiked with exogenous, cultured P. aeruginosa to generate positive reference material. Thermal bacterial lysis and multiplexed RT-LAMP testing was then performed (FIG.4).

[0113] In control specimens tested without clinical matrices, multiplexed amplification from P. aeruginosa and transgenic control targets yielded similar Tt when both templates were present. Stool specimens showed complete inhibition of amplification from the internal control target, indicating that assay performance had been compromised using that sample type. Serial dilutions of the stool specimens were then evaluated that had been similarly spiked with control and target organisms to identify conditions under which valid testing results could be achieved. Amplification from the internal control and spiked P. aeruginosa, if present, could be detected using 1:25 dilutions of specimens, although Tt from both targets was significantly delayed relative to controls (p≤0.05, 2-tailed T test). Assay performance was more fully restored with 1:125 dilution, although some specimens continued to show inhibition as indicated by nominally higher Tt for internal controls (p≤0.05, 2-tailed T test).

[0114] These experiments demonstrate the feasibility of using autocatalytic splicing constructs as an internal control for monitoring the RNA-dependent functions and diagnostic performance of RT-LAMP reactions, as well as the compatibility of such an approach with point-of-care testing procedures used in clinical diagnostic assays.

[0115] Discussion

[0116] This Example demonstrates the development of a robust strategy that enables users to specifically detect a targeted RNA transcript in bacteria using synthetic genes containing autocatalytic introns (FIG.1). This system can be leveraged to design NAATs that are able to amplify templates only after self-splicing has occurred, achieving specificity for successfully reverse transcribed RNA (FIG.2). Although this concept has long been applied to the design of RT-qPCR assays for monitoring human gene expression57, its application in prokaryotes represents a novel means to provide control material suitable for RNA-based bacterial NAATs, including RT-PCR and RT-LAMP. Because the system is self-contained within transgenic bacteria, the intact organisms themselves can be used as a control for all phases of testing: cell lysis, nucleic acid extraction, reverse transcription, template amplification, and detection. This Example has shown that control-encoded RNA transcripts and an experimental target can be simultaneously detected in multiplexed RT-LAMP assays, which can be leveraged in clinical molecular diagnostic assays to provide an internal control for assessing test performance21(FIGS.3 and 4). This internal control schema is expected to provide especially high value to applications such as point-of-care testing, where nucleicacid release is typically achieved by non-specific methods and inhibitors present in testing matrix are not removed prior to testing. Indeed, several P. aeruginosa-containing clinical matrices subjected to diagnostic RT-LAMP in this study would have been falsely reported as negative for that organism, rather than indeterminate due to assay inhibition, without the interpretive framework enabled by the internal control. Inhibited tests could be validly interpreted after dilution of specimen matrix was sufficient to allow amplification from the internal control (FIG.4), illustrating how this schema could be used to assess assay performance in clinical practice.

[0117] Two versions of a transgenic control vector were generated in order to facilitate its use in bacteria having different physical and genetic properties: One encodes an antibiotic resistance gene and is active in E. coli, while the other contains a synthetic GFP gene and functions in both E. coli and S. aureus. The functionality of the latter construct in gram- positive and gram-negative species alike was surprising, as prior work has suggested that the autocatalytic activity of such sequences require species-specific optimization35. This finding instead suggests that the synthetic target gene developed here may have even broader range generalizability outside of the bacteria tested in this study, and could potentially be utilized in other species after integration with vector backbones and / or promoters that are compatible with those organisms.

[0118] Transgenic bacteria expressing the target genes could be lyophilized or otherwise preserved to be rendered as stable control reagents for use in molecular assays58. Inducible or repressible promoters could be introduced to tailor expression of the target gene to specific levels. Separately, although the phenotypes encoded by the target genes were convenient for confirming proper splicing in vivo, they are not relevant to the control schema during molecular testing. Transgenes could consequently be altered to exhibit particular GC content or amplicon lengths, making control assays targeting them better matched to the primary diagnostic targets they are intended to be used with. Relatedly, the fluorescence of GFP does not interfere with the detection assays, but the function of that gene could be ablated through inactivating mutations if deemed necessary for some applications.

[0119] The systems presented in this Example enable a novel form of internal and positive control material that is useful for RT-LAMP, RT-PCR, and other RNA-based bacterial NAATs. The strategy enables testing to simultaneously control for the full complement of pre-analytic and analytic points of failure possible with such assays. This approach will be applicable for both laboratory-based and point-of-care molecular diagnostics, and may be generalizable or adaptable to other bacterial species that are targeted for testing or that are selected to emulate key properties of such targeted organisms.

[0120] References

[0121] 1. Ma, Y. et al. Microbiol Spectr 11, e01497-23 (2023).

[0122] 2. Gaydos, C. A. et al. J Clin Microbiol 41, 304–309 (2003).

[0123] 3. Boyadzhyan, B. et al. J Clin Microbiol 42, 3089–3093 (2004).

[0124] 4. Chen, D. et al. Jundishapur J Microbiol 14, (2022).

[0125] 5. Wu, D. et al. J Clin Lab Anal 32, e22326 (2018).

[0126] 6. Burton, M. J. et al. Clin Infect Dis 42, 463–470 (2006).

[0127] 7. Fang, X.-Y. et al. Orthop Surg 10, 40–46 (2018).

[0128] 8. Li, R. et al. Sci Rep 7, 5752 (2017).

[0129] 9. Mei, X. et al. Food Control 104, 9–19 (2019).

[0130] 10. Wang, X. et al. Sci Rep 6, 20393 (2016).

[0131] 11. Yasukawa, K. et al. Enzyme and Microbial Technology 46, 391–396 (2010).

[0132] 12. Getman, D. et al. J Clin Microbiol 59, e0051121 (2021).

[0133] 13. Merold, V. et al. Front. Microbiol.12, 738868 (2021).

[0134] 14. Aarthi, P. et al. Microbiological Research 168, 497–503 (2013).

[0135] 15. Garg, N. et al. Curr Res Microb Sci 3, 100120 (2022).

[0136] 16. Song, X. et al. Sci Rep 12, 7043 (2022).

[0137] 17. Agarwal, S. et al. Anal Bioanal Chem 414, 3177–3186 (2022).

[0138] 18. Hambalek, J. A. et al. ACS Sens.6, 3242–3252 (2021).

[0139] 19. Das, D. et al. Biosensors 12, 1068 (2022).

[0140] 20. Wong, Y.-P. et al. J Appl Microbiol 124, 626–643 (2018).

[0141] 21. Panpradist, N. et al. Sci Adv 7, eabj1281 (2021).

[0142] 22. Li, N. et al. Microsyst Nanoeng 7, 94 (2021).

[0143] 23. Lee, M.-F. et al. J Microbiol Methods 76, 174–180 (2009).

[0144] 24. Techathuvanan, C. et al. J Food Sci 77, M200-205 (2012).

[0145] 25. Techathuvanan, C. et al. J Food Sci 75, M165-172 (2010).

[0146] 26. Techathuvanan, C. et al. J Food Prot 74, 294–301 (2011).

[0147] 27. Zhan, L.-Z. et al. Can J Microbiol 65, 913–921 (2019).

[0148] 28. Burd, E. M. Clin Microbiol Rev 23, 550–576 (2010).

[0149] 29. Whiley, D. M. et al. J Mol Diagn 8, 3–15 (2006).

[0150] 30. Hoorfar, J. et al. J Clin Microbiol 41, 5835 (2003).

[0151] 31. Martínez-Abarca, F. et al. Mol Microbiol 38, 917–926 (2000).

[0152] 32. Tourasse, N. J. et al. Nucleic Acids Res 36, 4529–4548 (2008).

[0153] 33. Schwendener, S. et al. Appl Environ Microbiol 81, 3243–3254 (2015).

[0154] 34. Calvopina-Chavez, D.G. et al. G3 Genes|Genomes|Genetics 12, jkac070 (2022).

[0155] 35. Guo, F. et al. RNA 8, 647–658 (2002).

[0156] 36. Pédelacq, J.-D. et al. Nat Biotechnol 24, 79–88 (2006).

[0157] 37. Penewit, K. et al. MBio 9, (2018).

[0158] 38. Charpentier, E. et al. Appl. Environ. Microbiol.70, 6076–6085 (2004).

[0159] 39. Monk, I. R. et al. MBio 3, (2012).

[0160] 40. McLean, K. et al. J. Clin. Microbiol.57, (2019).

[0161] 41. Liu, Y. et al. Anal Chem 91, 8036–8044 (2019).

[0162] 42. Sezonov, G. et al. J Bacteriol 189, 8746–8749 (2007).

[0163] 43. Armijo, L. M. et al. J Nanobiotechnol 18, 35 (2020).

[0164] 44. Notomi, T. et al. Nucleic Acids Res 28, E63 (2000).

[0165] 45. You, Y. Nucleic Acids Research 34, e60–e60 (2006).

[0166] 46. Landthaler, M. et al. Proc. Natl. Acad. Sci. U.S.A.96, 7005–7010 (1999).

[0167] 47. Landthaler, M. et al. Nucleic Acids Res 30, 1935–1943 (2002).

[0168] 48. Karlen, Y. et al. BMC Bioinformatics 8, 131 (2007).

[0169] 49. Naik, P. et al. Sensors and Actuators B: Chemical 291, 74–80 (2019).

[0170] 50. Packard, M. et al. Diagnostics 3, 105–116 (2013).

[0171] 51. Heiniger, E. K. et al. Journal of Microbiological Methods 128, 80–87 (2016).

[0172] 52. Li, C. et al. Exp Ther Med 17, 131–136 (2019).

[0173] 53. Okuda, J. et al. Infect Immun 78, 4511–4522 (2010).

[0174] 54. Buckwalter, S. P. et al. J Clin Microbiol 52, 2139–2143 (2014).

[0175] 55. Nwe, M. K. et al. Sci Rep 14, 5916 (2024).

[0176] 56. Faust, K. et al. PLoS Comput Biol 8, e1002606 (2012).

[0177] 57. Padhi, B. K. et al. Regulatory Toxicology and Pharmacology 111, 104575 (2020).

[0178] 58. Tanabe, K. et al. Med Devices & Sens 2, e10030 (2019).

[0179] Throughout this application various publications are referenced. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to describe more fully the state of the art to which this invention pertains.

[0180] Those skilled in the art will appreciate that the conceptions and specific embodiments disclosed in the foregoing description may be readily utilized as a basis for modifying or designing other embodiments for carrying out the same purposes of the present invention. Those skilled in the art will also appreciate that such equivalent embodiments do not depart from the spirit and scope of the invention as set forth in the appended claims.

Claims

What is claimed is:

1. A method for distinguishing between reverse transcribed RNA and DNA in a bacterial sample, the method comprising: (a) obtaining a bacterial plasmid or bacterial genome that has been modified to express a transgene, wherein the transgene comprises a self-splicing intron; (b) contacting the bacterial sample with primers that specifically amplify either the nucleic acids flanking the self-splicing intron, or the nucleic acids within the self-splicing intron; and (c) detecting nucleic acids amplified in step (b); wherein detected amplification of the nucleic acids flanking the self-splicing intron is indicative of reverse transcribed RNA in the bacterial sample, and wherein detected amplification of the nucleic acids within the self-splicing intron is indicative of DNA in the bacterial sample.

2. A method for specifically detecting reverse transcribed RNA in a bacterial sample, the method comprising: (a) obtaining a bacterial plasmid or bacterial genome that has been modified to express a transgene, wherein the transgene comprises a self-splicing intron; (b) contacting the bacterial sample with primers that specifically amplify the nucleic acids flanking the self-splicing intron; and (c) detecting nucleic acids amplified in step (b); wherein detected amplification of the nucleic acids flanking the self-splicing intron is indicative of reverse transcribed RNA in the bacterial sample.

3. The method of claim 1 or 2, wherein the bacterial plasmid or transgene is derived from a gram-negative bacterium.

4. The method of claim 3, wherein the gram-negative bacterium comprises E. coli.

5. The method of claim 1 or 2, wherein the bacterial plasmid or transgene is derived from a gram-positive bacterium.

6. The method of claim 5, wherein the gram-positive bacterium comprises S. aureus.

7. The method of claim 1 or 2, wherein the transgene is a bacterial antibiotic resistance gene or a fluorescent reporter gene.

8. The method of claim 7, wherein the bacterial antibiotic resistance gene comprises kanamycin nucleotidyltransferase.

9. The method of claim 1 or 2, wherein the transgene is derived from a bacteriophage.

10. The method of claim 1 or 2, wherein the self-splicing intron comprises a group I or group II intron.

11. The method of claim 10, wherein the self-splicing intron comprises a ~400bp self- splicing intron derived from Tetrahymena.

12. The method of claim 1 or 2, wherein the amplification comprises loop-mediated isothermal amplification (LAMP).

13. The method of claim 12, wherein the LAMP comprises reverse transcription loop- mediated isothermal amplification (RT-LAMP).

14. A kit for performing the method of claim 1 or 2, the kit comprising a genetically modified bacterium that expresses a transgene, wherein the transgene comprises a self- splicing intron and expresses a non-native synthetic codon sequence.

15. The kit of claim 14, wherein the bacterium is a gram-negative bacterium.

16. The kit of claim 14, wherein the bacterium is a gram-positive bacterium.

17. The kit of claim 14, wherein the transgene is a bacterial antibiotic resistance gene.

18. The kit of claim 14, wherein the self-splicing intron comprises a ~400bp self-splicing intron derived from Tetrahymena.

19. The kit of claim 14, wherein the bacterial antibiotic resistance gene comprises kanamycin nucleotidyltransferase.

20. The kit of claim 14, wherein the bacterium is lyophilized.

21. The kit of claim 14, wherein the transgene has been codon optimized.

22. The kit of claim 14, further comprising a set of primers that specifically amplify nucleic acids flanking the self-splicing intron.

23. The kit of claim 22, wherein the primers comprise 3’ termini, and wherein the primers further comprise LNA modified bases at discriminatory sites at the 3’ termini.

24. The kit of claim 14, wherein the transgene comprises the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO:

4.

25. The kit of claim 22, wherein the primers are selected from SEQ ID NO: 5-29.

Images