Method for converting farnesyl pyrophosphate synthase into a geranyl pyrophosphate synthase

Abstract

Disclosed are techniques for monoterpenes biosynthesis in engineered microorganisms having a mevalonate pathway, where the microorganisms express an engineered enzyme. The engineered enzyme may include one or more peptides that are selected to alter the active site pocket volume of the engineered enzyme as compared to a wild-type farnesyl pyrophosphate synthase. The engineered enzyme may include a first peptide (such as a linker peptide) fused to a C-terminus of a farnesyl pyrophosphate synthase. Optionally, a second peptide (such as a Myc-tag or a HA-tag) be fused to the first peptide. The method may include exposing the engineered microorganism to a carbon source (such a glucose). The method may include allowing the engineered microorganism to generate (i) a first product from the mevalonate pathway and (ii) the engineered enzyme. The method may include forming a monoterpene by allowing the first product and the engineered enzyme to interact.

Description

[0001] METHOD FOR CONVERTING FARNESYL PYROPHOSPHATE S YNTHASE INTO A GERANYL PYROPHOSPHATE SYNTHASE

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] The present application claims priority to U.S. Provisional Patent Application No. 63 / 540,461, filed September 26, 2023, the contents of which are incorporated by reference herein in its entirety.

[0004] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0005] This invention was made with government support under Grant # FA9550-20-1- 0241 awarded by the Air Force Office of Scientific Research MURI. The government has certain rights in the invention.

[0006] REFERENCE TO SEQUENCE LISTING

[0007] The instant application contains a Sequence Listing which has been submitted electronically in ST.26 XML file format, created on September 26, 2024, is named PRIN96176_SL.xml and is 7,148 bytes in size. The ST.26 XML file is hereby incorporated by reference in its entirety.

[0008] TECHNICAL FIELD

[0009] The present disclosure is drawn to biosynthetic production of monoterpenes, and specifically to techniques for such production that substantially suppresses sesquiterpene production.

[0010] BACKGROUND

[0011] Monoterpenes are a large class of 10-carbon molecules widely used in the manufacturing of fragrances, flavors, food additives, insect repellents, pharmaceuticals and other products. Furthermore, monoterpenes are the precursor molecules for the biosynthesis of plant- derived natural products (e.g., cannabinoids, monoterpene indole alkaloids, opioids). The current industrial production of monoterpenes largely relies on two methods: extraction from plant sources and chemical synthesis. However, these methods have become increasingly unsustainable with the growing global demand. Plant extraction requires a large amount of land, and the availability of raw material is highly dependent on weather conditions and climate, making the supply unreliable. Chemical synthesis, on the other hand, requires petrochemical feedstock, which is not only unsustainable but also detrimental to the environment. As a result, biosynthesis of monoterpenes from engineered microorganisms using sustainable carbon sources has become an attractive alternative to meet the rising demand. Despite numerous efforts, biosynthetic production of monoterpenes has long been a challenge because most of the flux is diverted towards sesquiterpene production.

[0012] BRIEF SUMMARY

[0013] A method for monoterpenes biosynthesis may be provided. The method may include providing an engineered microorganism comprising a first gene encoding an engineered enzyme as disclosed herein and having a mevalonate pathway.

[0014] The engineered enzyme may include a first peptide (which may be 1 -2 amino acids in length, and may be a first linker peptide, which may be, e.g., 10-15 amino acids in length) fused to a C-terminus of a famesyl pyrophosphate synthase, (which includes an alpha helix coupled to a disordered region). In some arrangements, the peptide(s) fused to the C-terminus may be configured to extend a length of the disordered region without extending a length of the alpha helix of the C-terminus. In some arrangements, the peptide(s) fused to C-terminus of the enzyme may be configured to extend a length of the alpha helix. The engineered enzyme may include a second peptide fused to the first peptide. The second peptide may be 7-15 amino acids in length. The second peptide may be an affinity tag or an epitope tag, such as a Myc-tag or a HA-tag. The engineered enzyme may include a third peptide (such as a second linker peptide, which may be, e.g., 10-15 amino acids in length) fused to the second peptide. The engineered enzyme may include a fourth peptide fused to the third peptide. The fourth peptide may include a SH3 or PDZ domain ligand.

[0015] The method may include exposing the engineered microorganism to a carbon source. The method may include allowing the engineered microorganism to generate (i) a first product from the mevalonate pathway and (ii) the engineered enzyme. The method may include forming a monoterpene by allowing the first product and the engineered enzyme to interact.

[0016] The monoterpene may be a monoterpene alcohol or monoterpene ester, such as geraniol, linalool, geranyl acetate, and / or linalyl acetate. The monoterpene may be a pharmaceutically active agent, such as a cannabinoid, monoterpene indole alkaloid, opioid, or combination thereof.

[0017] In various aspects, an isolated engineered enzyme may be provided. The engineered enzyme may include a first peptide (such as a first linker peptide, which may be, e.g., 10-15 amino acids in length) fused to a C-terminus of a farnesyl pyrophosphate synthase. The engineered enzyme may include a second peptide fused to the first peptide. The second peptide may be 7-15 amino acids in length. The second peptide may be an affinity tag or an epitope tag, such as a Myc-tag or a HA-tag. The engineered enzyme may include a third peptide (such as a second linker peptide, which may be, e.g. , 10- 15 amino acids in length) fused to the second peptide. The engineered enzyme may include a fourth peptide fused to the third peptide. The fourth peptide may include a SH3 or PDZ domain ligand. In certain aspects, the peptide may reduce (or increase) the active site pocket volume of the engineered enzyme as compared to a wild-type farnesyl diphosphate synthase.

[0018] In various aspects, an engineered DNA sequence may be provided, comprising a first gene configured to encode an engineered enzyme as disclosed herein. In various aspects, an engineered microorganism (such as a strain of yeast, such as S', cerevisiae) may be configured to include an engineered DNA sequence as disclosed herein. The engineered microorganism may be free of genes encoding an endogenous farnesyl pyrophosphate synthase. The engineered microorganism may include a second gene encoding an endogenous farnesyl pyrophosphate synthase. The engineered microorganism may include a second gene encoding an alcohol acyl transferase and / or an alcohol acetyl transferase.

[0019] A method for converting a natural farnesyl pyrophosphate synthase into an engineered geranyl pyrophosphate synthase may be provided. The method may include creating an engineered sequence as disclosed herein. This may be done by, e.g., fusing a first peptide to a C-terminus of a farnesyl pyrophosphate synthase, wherein the first peptide is a first linker peptide. The method may include replacing genes encoding endogenous farnesyl pyrophosphate synthase with the engineered sequence.

[0020] In various aspects, a method for monoterpenes biosynthesis may be provided. The method may include providing an engineered microorganism may include a first gene encoding an engineered enzyme, and having a mevalonate pathway, where the engineered enzyme may include one or more peptides fused to a C-terminus of a farnesyl pyrophosphate synthase. In some embodiments, the one or more peptides may reduce the active site pocket volume of the engineered enzyme as compared to a wild-type farnesyl pyrophosphate synthase. In some embodiments, the one or more peptides may increase the active site pocket volume of the engineered enzyme as compared to a wild -type farnesyl pyrophosphate synthase. The method may include exposing the engineered microorganism to a carbon source. The method may include allowing the engineered microorganism to generate a first product from the mevalonate pathway and the engineered enzyme. The method may include forming a monoterpene byallowing the first product and the engineered enzyme to interact.

[0021] BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 A is a schematic illustration of a simplified monoterpene biosynthesis pathway, where the key precursor molecule mevalonate (MVA) is converted to GPP via the lower MVA pathway, composed of Ergl2p, Erg8p, Ergl9p, and Idilp, and the bifunctional GPP / FPP synthase Erg20. GPP is the common precursor molecule of monoterpenes, but Erg20p quickly converts GPP to FPP. In yeast, FPP is further converted to ergosterol, a molecule essential for yeast growth.

[0023] Figure IB is a schematic illustration of core formed from a Forever Corelet (FC*) base recruiting cargo (a desired enzyme) via domain-peptide interactions.

[0024] Figures 2-5 are schematic illustrations of embodiments of enzymes as disclosed herein.

[0025] Figure 6 is a schematic illustration of a gene encoding an engineered enzyme.

[0026] Figure 7 is a flowchart of a method for converting a natural farnesyl pyrophosphate synthase into an engineered geranyl pyrophosphate synthase.

[0027] Figure 8 is a flowchart of a method for biosynthesis of a monoterpene.

[0028] Figures 9 and 10 are graphs showing production of geraniol (9) or linalool (10) versus p-farnasene in engineered microorganisms.

[0029] Figure 11 is a schematic illustration of an additional gene including an alcohol acyl / acetyl transferase.

[0030] Figures 12A and 12B are graphs showing the production of geranyl acetate as influenced by the number of copies of Ocimum basilicum geraniol synthase (ObGES) and the presence Gt Rosa hybrida alcohol acyltransferase (RhAAT).

[0031] Figure 13 is a graph showing Linalool and Linalyl acetate production over time for organisms with and without a copy of Citrus bergamia alcohol acyltransferase (CbAAT9-lc).

[0032] Figure 14A is a graph describing geraniol and farnesene productions in yeast strains where ERG20 has been replaced with ERG20-peptide fusions of varying lengths. Statistics are calculated using a two-sided t-test. ***P < 0.001.

[0033] Figure 14B is a graph showing a comparison of the geraniol-to-famesene ratio in yeast expressing the Erg20p-7aa linkerl fusion from the endogenous ERG20 locus compared to the wild-type control. Figure 15A is a graph describing linalool and farnesene production in yeast strains where ERG20 has been replaced by ERG20-peptide fusions of varying lengths. Statistics are calculated using a two-sided t-test. ***P < 0.001 .

[0034] Figure 15B is a graph showing a comparison of the linalool-to-farnesene ratio in yeast expressing the ERG20-7aa linker 1 fusion from the endogenous ERG20 locus compared to the wild-type control. Statistics are calculated using a two-sided t-test. ns (non-significant); ***P < 0.001.

[0035] Figures 16A and 16B are graphs showing estimation of intracellular GPP levels in yeast overexpressing Erg20p-Myc, with and without endogenous Erg20p, using either geraniol (16A) or linalool (16B) as readouts.

[0036] Figure 17A is a graph showing geraniol and famesene production levels in yeast strains where the endogenous Erg20p is replaced with either N-terminally 6xHis tagged Erg20p or Erg20p-Myc.

[0037] Figure 17B is a graph showing relative abundances of Erg20p and endogenous yeast reference proteins (encoded by ACT1, PGK1, and TEF1) as determined by whole-cell proteomics analysis; for easier visualization, abundance values were scaled to have an average of 100 across the three yeast strains. Error bars represent one standard deviation from three biological replicates. Statistics are calculated using a two -sided t-test. ns (non-significant); **P < 0.01.

[0038] Figure 18 is a graph showing the effect of various peptides for ERG20(S288C)-peptide fusions on active site pocket volumes.

[0039] Figure 19 is a graph showing the effect of various peptides for ERG20(S288C)-peptide fusions on geraniol and farnesene production.

[0040] Figure 20A is a graph showing optimization of geraniol production by overexpressing additional copies of ObGES and the lower mevalonate pathway. Geraniol can be further converted to geranyl acetate by RhAAT.

[0041] Figure 20B is a graph showing optimization of linalool production by overexpressing additional copies of McLISE343D’E352Hand the lower mevalonate pathway. Linalool can be further converted to linalyl acetate by CbAAT9-l-c.

[0042] Figure 21 is a schematic illustration of the colocalization of Erg20p and ObGES within Forever Corelet (FC*) synthetic condensates using protein domain-peptide interaction pairs to streamline geraniol production. Figure 22 is a graph showing time-course measurements of OD600-normalized geraniol production, comparing strains with and without colocalized Erg20p-Myc-PDZP and ObGES- PDZP, as well as with or without the F96W mutation in Erg20p.

[0043] Figure 23 is a graph showing final ODgoo values and geraniol titers of yeast strains from Figure 22 after 96hr of fermentation. Statistics are calculated using a two-sided t-test. *P < 0.05; ***P < 0.001.

[0044] Figure 24 is a graph showing OD600-nomalized famesene titer in yeast strains expressing Erg20p-Myc-PDZP, either localized within condensates or diffused, with and without the F96W mutation. Error bars represent one standard deviation from three biological replicates. Statistics are calculated using a two-sided t-test. ns (non-significant); ***P < 0.001.

[0045] DETAILED DESCRIPTION

[0046] This technology significantly improves microbial fermentation-based production of monoterpenes, enabling the sustainable production of monoterpenes at scale.

[0047] More particularly, disclosed herein are a method to convert a natural famesyl pyrophosphate synthase (also known as famesyl diphosphate synthase) into an engineered geranyl pyrophosphate synthase (also known as geranyl diphosphate synthase), and a process to improve monoterpenes biosynthesis using the engineered geranyl pyrophosphate synthase.

[0048] The natural famesyl pyrophosphate synthase has the ability to produce small amounts of geranyl pyrophosphate but most of its product is famesyl pyrophosphate. The engineered enzyme preferentially produces geranyl pyrophosphate, but still retains some activity to produce small amounts of farnesyl pyrophosphate needed for steroid biosynthesis. In other words, the engineered enzyme has a reversed product preference.

[0049] The disclosed approach enables improved fermentation-based production of (1) monoterpenes relative to wild type organisms or organisms using endogenous farnesyl pyrophosphate synthase. Such monoterpenes include monoterpene alcohols (e.g., geraniol and linalool) and monoterpene esters (e.g., geranyl acetate and linalyl acetate), which are widely used in the flavor and fragrance industries; (2) pharmaceuticals (e.g., pharmaceutically active agents) derived from natural products, such as cannabinoids, monoterpene indole alkaloids, opioids, etc.; (3) monoterpene-derived biofuels, biomaterials, nutraceuticals, and other natural products.

[0050] As seen in FIG. 1A, a microorganism, such as yeast, may have a metabolic pathway (such as the mevalonate (MVA) pathway, a portion of which is illustrated in FIG. 1 A) that uses acetyl-CoA to produce sterols and isoprenoids. In FIG. 1A, the pathway includes, e.g., the formation of isopentenyl pyrophosphate (IPP) and dimethylallylpyrophosphate (DMAPP).

[0051] Geranyl pyrophosphate (GPP) is an important precursor molecule for microbial production of monoterpenes and cannabinoids. Farnesyl pyrophosphate synthase (Erg20) catalyzes a two-step reaction that produces GPP as well as farnesyl pyrophosphate (FPP) from GPP. See FIG. 1A. Because Erg20 preferentially produces FPP over GPP, economically viable microbial production of monoterpenes and cannabinoids from GPP is very challenging.

[0052] The approach disclosed herein provides a method to engineer Erg20 with improved selectivity towards GPP production and improve the production of GPP-derived monoterpenes and other natural products derived from them.

[0053] More specifically, in the monoterpene biosynthesis pathway, the key precursor molecule mevalonate (MVA) is converted to GPP via the lower MVA pathway, composed of Ergl2p, Erg8p, Ergl9p, and Idilp, and the bifunctional GPP / FPP synthase Erg20p. GPP is the common precursor molecule of monoterpenes, but Erg20p quickly converts GPP to FPP. In yeast, FPP is further converted to ergosterol, a molecule essential for yeast growth. Metabolite abbreviations: isopentenyl pyrophosphate (IPP), dimethylallyl pyrophosphate (DMAPP), geranyl pyrophosphate (GPP), farnesyl pyrophosphate (FPP).

[0054] The disclosed approach improves monoterpenes production by enhancing the geranyl pyrophosphate (GPP) synthase activity of Erg20p through the fusion of short peptides, even as short as two amino acids, to its C-terminus. Yeast expressing the Erg20p-peptide fusion as the endogenous enzyme accumulates significantly higher levels of GPP, enabling robust production of various monoterpenes. An in vitro study of the enzyme kinetics reveals that this C -terminal peptide fusion increases Erg20p's catalytic efficiency (kcatlKv) for GPP formation by 3-fold, while reducing the conversion of GPP to farnesyl pyrophosphate (FPP) by 15-fold.

[0055] The disclosed process can be further enhanced by forming condensates, that cause the desired enzymes for a desired metabolic pathway to cluster together. For example, referring to FIG. IB, as is known in the art, a synthetic condensate / scaffold (120) can be utilized to cause the engineered enzymes (110) to cluster. Typical synthetic condensates involve a plurality of fusion proteins, where an intrinsically disordered region (IDR) (122) (such as FUS or a variant thereof, or a FUS coupled to, e.g., a 60-mer synthetic protein, I3-01Ki29A) is fused to a plurality of binding regions, such as domains (124). The IDRs interact and begin to cluster, and the engineered enzymes (110) (which contain an enzyme (112) fused to a peptide (114)) can be recruited to the synthetic construct via domain-peptide interactions. In this way, a region where that enzyme is concentrated within can be formed, which can further shift the kinetics. Existing methods to engineer improved selectivity for GPP in Erg20 are primarily based on protein mutagenesis approaches whereby key amino acid residues in Erg20 are mutated. The method disclosed herein, however, involves converting Erg20 into a GPP synthase by fusing a short peptide to its C -terminus. This method provides an approach to engineer GPP synthase that can complement existing protein mutagenesis approaches adopted by industry.

[0056] For the disclosed process, short protein peptides are fused to the C -terminal of yeast Saccharomyces Cerevisiae Erg20. One then replaces the yeast endogenous Erg20 with the engineered Erg20 by methods of CRISPR Cas9 gene editing and homology recombination to engineer monoterpene-producing yeasts.

[0057] Thus, disclosed is an engineered enzyme. Referring to FIG. 2, the engineered enzyme (200) may include a first peptide (210) fused to a C-terminus of a famesyl pyrophosphate synthase (Erg20) (205).

[0058] As used herein, the term ‘"peptide” generally refers to one or more amino acids, such as two or more amino acids joined together in a linear or circular chain. The term oligopeptide is typically used to describe peptides having between 2 and about 50 or more amino acids. Peptides larger than about 50 amino acids are often referred to as polypeptides or proteins. For purposes of the present disclosure, however, the term “peptide” is not limited to any particular number of amino acids, and is used interchangeably with the terms “polypeptide” and “protein”.

[0059] In one preferred embodiment, the first peptide may have less than 10 amino acids, preferably 1-5 amino acids, and more preferably 1-2 amino acids.

[0060] In one embodiment, the first peptide may be an oligopeptide, more preferably the first peptide may contain 5-20 amino acids., and still more preferably, the first peptide may contain 10-15 amino acids.

[0061] The first peptide may be a linker peptide.

[0062] As used herein, the term “peptide linker” or “linker peptide” generally refers to a peptide that typically includes about 2 to 20 amino acids, and peptide linkers are generally well known in the art, or as disclosed herein. The linkers may include a plurality of glycine and serine amino acids. For example, a linker may have an amino acid sequence of LEGGSAAGTGSGG (SEQ ID NO: 1 ) (sometimes referred to as “linkerl ”). Other non-limiting examples of linker peptides include, e.g., glycine-serine linkers, which are flexible or rigid linkers having a general formula of (GrSjn, wherein “n” is generally a number between 1 and 10, typically between 2 and 4. The glycine-serine linkers may optionally include one or more amino acids preceding the (G4S)Ustructure; for example, a linker may have an amino acid sequence of VEGGGGSGGGGS (SEQ ID NO:2) (sometimes referred to as “linker?”). In some embodiments, the peptide may have only a portion of the amino acids of a known linker (e.g., the first n amino acids of linkerl, such as the first 1-2 amino acids).

[0063] In a preferred embodiment, the first peptide may preferably be LEGGSAAGTGSGG (SEQ ID NO: 1).

[0064] Referring to FIG. 3, in some embodiments, the engineered enzyme (300) may include a first peptide (210) fused to a C-terminus of a farnesyl pyrophosphate synthase (205 ), and may also include a second peptide (310) fused to the first peptide.

[0065] Preferably, the second peptide may be an oligopeptide, more preferably the second peptide may contain 5-20 amino acids., and still more preferably, the second peptide may contain 7-15 amino acids.

[0066] In various embodiments, the second peptide may be an affinity tag or an epitope tag.

[0067] As used herein, the term “affinity tag” generally refers to a ligand that permits detection and / or selection of an oligonucleotide sequence to which the ligand is attached. Non-limiting examples of affinity tags include biotin, digoxigenin, streptavidin, polyhistine (e.g., His6), glutathione-S-transferase (GST), HALOTAG® affinity tags, AviTag, Calmodulin-tag, polyglutamate tag, FLAG-tag, HA-tag, Myc-tag, S-tag, or SBP-tag.

[0068] As used herein, the term “epitope tag” generally refers to an artificial epitope, also known as an antigenic determinant, which is fused to a polypeptide sequence by placing the sequence encoding the epitope in-frame with the coding sequence or open reading frame of a polypeptide. Epitope tags are typically relatively short peptide sequences ranging from about 10-30 amino acids in length. Epitope tags are reactive to high-affinity antibodies that can be reliably produced in many different species. Non-limiting examples of epitope tags include the V5-tag, Myc-tag, HA-tag and 3 x FLAG-tag. These tags may be useful for, e.g., detection or purification of fusion proteins by Western blotting, immunofluorescence, or immunoprecipitation techniques .

[0069] In some preferred embodiments, the affinity tag or epitope tag is a Myc-tag (EQKLISEEDL, SEQ ID NO:3) or a HA-tag (YPYDVPDYA, SEQ ID NO:4).

[0070] Referring to FIG. 4, in some embodiments, the engineered enzyme (400) may include a first peptide (210) fused to a C-terminus of a farnesyl pyrophosphate synthase (205), and may also include both a second peptide (310) fused to the first peptide (210), and a third peptide (410) fused to the second peptide (310). Preferably, the third peptide may be an oligopeptide, more preferably the second peptide may contain 5-20 amino acids., and still more preferably, the second peptide may contain 10-15 amino acids.

[0071] In a preferred embodiment, the third peptide may be a second linker peptide. In some embodiments, the second linker peptide may be a glycine-serine linker, such as VEGGGGSGGGGS (SEQ ID NO:2).

[0072] Referring to FIG. 5, in some embodiments, the engineered enzyme (500) may include a first peptide (210) fused to a C-terminus of a farnesyl pyrophosphate synthase (205), a second peptide (310) fused to the first peptide (210), a third peptide (410) fused to the second peptide (310), and may also include a fourth peptide (510) fused to the third peptide (410).

[0073] Preferably, the fourth peptide may include a ligand, such as a ligand from a known binding domain - ligand pair, such as a SH3 binding domain ligand (e.g. , PPPALPPKRRR, SEQ ID NO:5) or a PDZ binding domain ligand (e.g., GVKESLV, SEQ ID NO:6). As used herein, the term “ligand” generally refers to a molecule that binds a specific binding partner. As used herein, a “binding domain” comprises any region of a peptide or polypeptide which is responsible for selectively binding to a molecule of interest (e.g. an antigen, ligand, receptor, substrate or inhibitor). In certain preferred embodiments, the fourth peptide may include a SH3 domain ligand (e.g., SEQ ID NO:5) or a PDZ domain ligand (e.g., SEQ ID NO:6).

[0074] In a preferred embodiment, the total length of all peptides fused to the C-terminus of the farnesyl pyrophosphate synthase may be less than 50 amino acids. In certain embodiments, the total length of peptides fused to the C-terminus of the farnesyl pyrophosphate synthase may be less than 45 amino acids, less than 40 amino acids, less than 35 amino acids, less than 30 amino acids, or less than 25 amino acids.

[0075] In some aspects, an engineered DNA sequence may be provided. Referring to FIG. 6, the DNA sequence (600) may include a first gene (610) (e.g., a first nucleotide sequence) encoding an engineered enzyme (200, 300, 400, 500) as disclosed herein. The first gene (610) may be under the control of a promoter (620). Any appropriate promoter may be utilized, including constitutive or inducible promoters.

[0076] In some arrangements, the peptides fused to C-terminus of the enzyme may be configured to extend a length of the disordered region of the C-terminus without impact (such as extending) a length of the alpha helix of the C-terminus. In some arrangements, the peptides fused to C-terminus of the enzyme may be configured to extend a length of the alpha helix. In some aspects, an engineered microorganism (or cell) may be provided. The microorganism or cell may include the engineered DNA sequence (600) as disclosed herein. The engineered microorganism or cell may be any organism or cell with a required metabolic pathway, such as the mevalonate pathway. As will be understood, this may be an organism in which at least a portion of the mevalonate pathway is naturally occurring, or may be an organism that has been modified to contain some or all of the mevalonate pathway.

[0077] As will be understood, the mevalonate pathway is found across a wide range of life forms, in a diverse range of organisms, including, e.g., many mammals (including humans), many invertebrates, such as insects, plants, algae, fungi (including yeasts, such as Saccharomyces cerevisiae), molds (such as Aspergillus and Pemcillium species), bacteria (including, e.g., members of the Actinobacteria phylum.

[0078] In a preferred embodiment, the microorganism is a strain of yeast, and more preferably, S’, cerevisiae.

[0079] In preferred embodiments, the engineered microorganism may be free of genes encoding an endogenous farnesyl pyrophosphate synthase. In some embodiments, the engineered microorganism may include a gene that encodes an endogenous farnesyl pyrophosphate synthase.

[0080] In some embodiments, the engineered microorganism may be configured to overexpress some or all of the mevalonate pathway, such as the lower mevalonate pathway. In some embodiments, the engineered microorganism may be configured to overexpress a synthase for producing a desired compound (e.g., Ocimum basilicum geraniol synthase (ObGES) for producing geranyl acetate or Mentha citrata linalool synthase for producing linalyl acetate).

[0081] In various aspects, a method for converting a natural farnesyl pyrophosphate synthase into an engineered geranyl pyrophosphate synthase may be provided. Referring to FIG. 7, the method (700) may include creating (710) an engineered sequence by fusing a first peptide to a C -terminus of a farnesyl pyrophosphate synthase, wherein the first peptide is a first linker peptide. The method may include replacing (720) genes encoding endogenous farnesyl pyrophosphate synthase with the engineered sequence.

[0082] In various aspects, a method for method for biosynthesis of a monoterpene may be provided. In various embodiments, the monoterpene may be a monoterpene alcohol or monoterpene ester, such as geraniol, linalool, geranyl acetate, and / or linalyl acetate. In various embodiments, the monoterpene may be one or more pharmaceutically active agent(s). The pharmaceutically active agent(s) may include, e.g., a cannabinoid, a monoterpene indole alkaloid, an opioid, or a combination thereof.

[0083] Referring to FIG. 8, the method (800) may include providing (810) an engineered microorganism as disclosed herein, that includes a gene encoding an engineered enzyme (200, 300, 400, 500) as disclose herein, and having a mevalonate pathway. The method may include exposing (820) the engineered microorganism to a carbon source. The method may include allowing (830) the engineered microorganism to generate (i) a first product from the mevalonate pathway, and (ii) the engineered enzyme. The method may include forming (840) a monoterpene by allowing the first product and the engineered enzyme to interact.

[0084] Additionally, the inventors have discovered that fusing peptides to the C -terminus of a famesyl pyrophosphate synthase may be used to alter the active site pocket volume, which can impact the catalytic efficiency of the process, influencing selectivity of the process. This can be used to reduce or increase production rates of certain compounds, depending on what enzymes are modified in the metabolic pathway.

[0085] Thus, in some embodiments, a method for monoterpenes biosynthesis may be provided. The method may include providing an engineered microorganism comprising a first gene encoding an engineered enzyme. Tire microorganism may have a mevalonate metabolic pathway.

[0086] In some embodiments, the engineered enzyme may include one or more peptides fused to a C-terminus of a farnesyl pyrophosphate synthase, where the one or more peptides decreases the active site pocket volume of the engineered enzyme as compared to a wild-type farnesyl pyrophosphate synthase. In some embodiments, the engineered enzyme may include one or more peptides fused to a C-terminus of a famesyl pyrophosphate synthase, where the one or more peptides increases the active site pocket volume of the engineered enzyme as compared to a wild-type famesyl pyrophosphate synthase.

[0087] The method may include exposing the engineered microorganism to a carbon source (such as glucose), and allowing the engineered microorganism to generate (i) a first product from the mevalonate pathway and (ii) the engineered enzyme. The method may include forming a monoterpene by allowing the first product and the engineered enzyme to interact.

[0088] Example 1

[0089] With respect to experimental verification, yeast strains have been developed expressing the disclosed engineered Erg20 with C-terminal peptide fusion, as have controls expressing Erg20 without C-terminal peptide fusions. Production of monoterpenes (geraniol or linalool) and β-farnesene was used as readouts for GPP and FPP availability in yeast, respectively, by integrating Ocimum basilicum geraniol synthase (ObGES) or Mentha citrata linalool synthase (McLIS) and Artemisia annua β-farnesene synthase (AaFS) genes to the yeast genome.

[0090] Starting from a base strain (CEN.PK2-1C, “SI”) of S. cerevisiae, two variants were produced, with the endogenous ERG20 of the base strain removed. A first variant (AERG20::coERG20(S288C), “S2”) only replaced the removed endogenous ERG20 with a codon optimized sequence of ERG20 from a different strain (S288C) of S. cerevisiae. The ERG20 from S288C is generally identical to that of CEN.PK2-1C, save for two substitutions: D308E and V318I. A second variant (AERG20::coERG20(S288C)-Myc, “S3”) was generated that includes the same codon optimized sequence of ERG20 as with the first variant, as well as a first linker (SEQ ID NO:1) fused to the ERG20, and a Myc-tag (SEQ ID NOG) fused to the first linker. See, e.g., FIG. 3.

[0091] As seen in FIGS. 9 and 10, there is some variation in the ratio of geraniol or linalool to β-farnesene when moving from cells having the ERG20 from the first strain (CEN.PK2-1C) to ERG20 from the second strain (S288C), but the amount of β-farnesene produced was not substantially impacted. This makes sense; the substitutions in S288C vs CEN.PK2-1C are very conservative, so there was no expectation for them to contribute significantly to the increased preference of the engineered enzyme to producing monoterpenes over sesquiterpenes (increased GPP / FPP synthesis ratios

[0092] However, as seen, the second variant (S3), with the Myc-tag and linker peptide, has a radically different performance, with a very large increase in geraniol, and also a large reduction in the production of β-farnesene.

[0093] Thus, it was observed that yeast with the disclosed engineered enzymes produces significantly more geraniol or linalool and less β-farnesene compared to the control strains (see FIGS. 9 and 10), which indicates that the disclosed engineered enzyme with C-terminal peptide fusion has improved selectivity towards GPP production.

[0094] Similar results, with a very high selectivity towards Geraniol, were also seen with variants that built on the second variant by further including (as seen in FIG. 5), a second linker and either a SH3 domain ligand (e.g., SEQ ID NO:5) or a PDZ domain ligand (e.g, SEQ ID NO:6).

[0095] Example 2

[0096] Use of the technology disclosed herein also translates into increased production of monoterpene-derived compounds. For example, the disclosed engineered strains, with the addition of one or more alcohol acyl transferases and / or alcohol acetyl transferases (AATs), are able to further covert geraniol and linalool into geranyl acetate or linalool acetate, respectively. For example, as seen in FIG. 11 , the microorganisms may be modified to include a nucleotide sequence comprising a sequence (1110) encoding an AAT, which may be under the control of a promoter (1120), such as a constitutive or inducible promoter.

[0097] Referring to FIGS. 12A and 12B, it can be seen that, by integrating multiple copies of Ocimum basilicum geraniol synthase (ObGES) and Rose alcohol acetyltransferase (RoseAAT), microorganisms can be modified to produce an increased amount of geranyl acetate. As would be expected, the more copies of ObGES that are utilized, the more geranyl acetate is produced.

[0098] Referring to FIG. 13, microorganisms were created that include 2 copies of Mentha citrata linalool synthase (McLIS), some with a copy of CbAAT9-l-c, and some with a single copy of CbAAT9-l-c. Titers were analyzed at 48, 72, and 96 hours, for both. As seen, without the copy of CbAAT9-l-c, no Linalyl acetate was produced, but with a single copy, larger total titers of linalool / linalyl acetate were produced, that included substantial quantities of linalyl acetate are formed.

[0099] Example 3

[0100] To localize yeast Erg20p into the synthetic condensate, the condensate was functionalized with the PDZ domain from a-Syntrophin (PDZD). By using CRISPR / Cas9- mediated homology recombination, one can replace the endogenous ERG20 (CEN.PK2-1C origin) with a S. cerevisiae S288C ERG20 variant that has a C -terminal fusion of a short peptide (43 amino acids), which includes the cognate PDZ peptide (PDZp), a Myc tag, and two linker sequences (linkerl and linker2). See, e.g., FIG. 5.

[0101] To produce geraniol, two copies of geraniol synthase from Ocimum basilicum (ObGES) were integrated into the LEU2 locus. The strain expressing the Erg20p-Myc-PDZP fusion enzyme as the endogenous GPP / FPP synthase produced 172 ± 2 mg / L of geraniol, representing a substantial 1.8-fold improvement over the wild-type control strain expressing the untagged Erg20p (see FIGS. I4A-14B). To verify that the increase in geraniol production correlates with a decrease in cellular FPP levels, given that the upstream pathway remains unchanged, farnesene production was used as an indicator of the cellular FPP levels by expressing AaFSmut. Indeed, the strain expressing the Erg20p-Myc-PDZP fusion enzyme exhibits an 18% decrease in farnesene production compared to the untagged control (see FIG. 14A). To determine whether the observed increase is specific to geraniol or indicative of a broader increase in the intracellular GPP levels, linalool-producing strains were developed by integrating two copies of a previously reported engineered linalool synthase from Mentha citrata (t67McLISE343D’E352H) into the LEU2 locus of strains expressing the Erg20p-Myc- PDZP fusion. Consistent with the results from the geraniol-producing strains, the C-terminal fusion of Myc-PDZP improved linalool titer 2-fold, increasing from 42 ± 1 mg / L to 86 ± 2 mg / L compared to the control strain expressing untagged Erg20p (see FIGS. 15A-15B). PDZp was demonstrated as not being solely responsible for the enhanced geraniol production, as a strain expressing Erg20p-Myc-SH3P also exhibited a similar increase in geraniol titer.

[0102] Next, the minimum length of C-terminal peptide fusion needed to improve geraniol and linalool production was explored by testing a range of peptides with varying lengths and compositions: “linkerl-Myc”, “linkerl-HA”, “linkerl”, “7 amino acids linkerl” (e.g., first 7 amino acids of linkerl), and “2 amino acids linkerl” (e.g., first 2 amino acids of linkerl ). Surprisingly, it was observed that, with the exception of the linkerl-HA fusion, which appears to abolish Erg20p activity, all tested modifications of Erg20p, including the addition of just two amino acids to the C-terminus, improved geraniol and linalool production. See FIGS. 14A, 15 A. Moreover, it was found that an optimal peptide fusion length of 7 amino acids increased geraniol titer by 2.9-fold to 278 ± 8 mg / L with a 10-fold improvement in the geraniol-to- farnesene ratio, and linalool titer by 3.5-fold to 146 ± 5 mg / L, with a 7-fold improvement in the linalool-to-farnesene ratio, relative to the wild-type control strain (see FIGS. 14A-15B). These results collectively demonstrate that the C-terminal fusion of short peptides to yeast Erg20p significantly improves monoterpene production.

[0103] To determine whether replacing the endogenous ERG20 with ERG20-peptide fusions is critical for the observed increase in monoterpene titers, an additional copy of the ERG20- Myc fusion was integrated into the LEU2 locus of strains expressing either the endogenous Erg20p or Erg20p-Myc from the ERG20 locus. Despite the overexpression of Erg20p-Myc, the presence of endogenous Erg20p significantly impacts monoterpene titers and potentially intracellular GPP levels. See FIGS. 16A-16B. Furthermore, replacing the endogenous expression of Erg20p-Myc from the ERG20 locus alone is sufficient to improve production by 2-fold without further overexpression of Erg20p-Myc, which suggests Erg20p-Myc acts as a recessive chimeric of Erg20p. See FIGS. 16A-16B.

[0104] Interestingly, while the titer of geraniol remains unaffected, additional overexpression of Erg20p-Myc leads to a decrease in linalool production. See FIGS. 16A-16B. A previous study reported that overexpression of Erg20p decreases geraniol production. However, in the disclosed strains, it decreases the production of linalool but not geraniol. This discrepancy may be attributed to the delicate balance between the rates of GPP conversion to monoterpenes (catalyzed by monoterpene synthase) and GPP conversion to FPP (catalyzed by Erg20p). Specifically, the disclosed strain expressing Erg20p-Myc produces about twice as much geraniol as linalool, suggesting a lower reaction rate for linalool synthase that can be more sensitive to competition from the FPP synthase activity of Erg20p. Nonetheless, it is shown that C-terminal modification of Erg20p is a recessive trait for improving monoterpenes production.

[0105] Example 4

[0106] The mechanisms of increased intracellular GPP / FPP ratio resulting from C-terminal peptide fusion to Erg20p were investigated. In preparation to purify Erg20p and Erg20p-Myc, we introduced a 6xHis tag at the N-terminus of Erg20p and Erg20p-Myc. The strain expressing the 6xHis-Erg20p produced 112 ± 4 mg / L of geraniol, which is similar to the geraniol titer of the control strain expressing Erg20p without the N-terminal 6xHis tag (98 ± 5 mg / L; see FIG. 17A. In contrast, fusing a linker1-Myc to the C-terminus of 6xHis-Erg20p resulted in a 2-fold increase in geraniol titer reaching 227 ± 13 mg / L, consistent with previous findings. See FIG. 17A. It was further confirmed that N-terminal peptide fusion to Erg20p (e.g., 13aa linkerl) does not significantly alter the intracellular GPP / FPP ratio, even though the N-terminus and C- terminus of Erg20p are in proximity.

[0107] To further investigate the effect of the C-terminus peptide fusion on Erg20p enzymatic activity, different Erg20p variants were produced in E. coll, purified by affinity chromatography, and their steady-state kinetic parameters were determined. See Table 1, below.

[0108] The C-terminal fusion of Myc tag to wild-type Erg20p results in a 2- fold higher affinity (lower KM) for DMAPP and 10-fold lower affinity for GPP. Together with monoterpene production results, this suggests that the observed improvement in monoterpene production is a combination of faster GPP synthesis (i.e., a 3-fold increase in the kcat / KMfor DMAPP) and slower GPP-to-FPP conversion (i.e., a 15-fold decrease in the kcat / KMfor GPP). In contrast, a widely used GPP synthase mutant Erg20p(F96W) was found to have a 2-fold lower affinity for DMAPP and 22-fold lower affinity for GPP, which suggests Erg20p(F96W) improves monoterpene production mainly by slowing down GPP-to-FPP conversion. Interestingly, C- terminal fusion of Myc tag to Erg20p(F96W) also improves this mutant Erg20p’s affinity for DMAPP by 30%. For the turnover rate ( kcat), fusing a C-terminal Myc tag to Erg20p increases the kcai by 46% and 56% for DMAPP and GPP, respectively. Taken together, the increase in monoterpene production from C-terminus peptide fusions is a result of change in the Erg20p’s steady-state kinetic parameters.

[0109] Erg20p 0.574 ± 0.181 3.527 ± 0.368 6. 149 ± 2.044

[0110] Erg20p-Myc 5.894 ± 2.625 5.508 ± 1.472 0.935 ± 0.485

[0111] Erg20p(F96W) 12.820 ± 6.452 3.922 ± 1.363 0.306 ± 0.187

[0112] Erg20p(F96W)-Myc 3.538 ± 0.540 2.513 ± 0.173 0.710 ± 0.119

[0113] To evaluate the impact of C-terminal peptide fusion on Erg20p accumulation, the intracellular levels of 6xHis-Erg20p and 6xHis-Erg20p-Myc were qualified using whole-cell proteomics. Interestingly, while 6xHis-Erg20p abundance is similar to that of the control strain expressing Erg20p, 6xHis-Erg20p-Myc abundance is elevated by 2-fold compared to the control. See FIG. 17B. Furthermore, we observed an overall up-regulation in the levels of native enzymes in the native upper and lower MVA pathways and the ergosterol biosynthesis pathway in response to the C-terminal linkerl-Myc fusion to Erg20p. This change is likely a respond to the effect of decreased intracellular FPP pool on ergosterol biosynthesis. This observation is consistent with two previous studies reporting up-regulation of genes involved in ergosterol biosynthesis. One study reported that the transcriptional repression of squalene synthase (ERG9), an enzyme in the ergosterol biosynthesis pathway, leads to increased production of mevalonate, suggesting an up-regulation of the upper MVA pathway in response to ergosterol starvation. The second study reported the inhibition of HMG-CoA reductase, an enzyme in the upper MVA pathway, by statins (i.e. , lovastatin, fluvastatin, and atorvastatin) up- regulates nearly every gene in the upper and lower MVA pathways as well as the ergosterol biosynthesis pathway. Since 6xHis-Erg20p-Myc is expressed at the endogenous ERG20 locus, its increased accumulation could be due to up-regulation of gene transcription, as well as other potential mechanisms, including alterations in protein translation or protein degradation. Nonetheless, our results suggest the mechanism of increased monoterpenes production by C- terminus peptide fusion to Erg20p is a combination of improved Erg20p GPP synthase activity, improved Erg20p accumulation, and an up-regulation of upstream pathways enhancing flux towards Erg20p.

[0114] Example 5

[0115] To elucidate the mechanism behind the observed effect of C-terminal fusion of short peptides on Erg20p activity, particularly the significant reduction in GPP-to-FPP conversion, physics-based machine learning models were employed to investigate changes in the Erg20p active site. The wild- type S. cerevisiae Erg20p model indicates that the C -terminus is disordered and located in close proximity to the enzyme's active site. Additionally, the model suggests that fusing 'linker 1-Myc' extends the disordered C-terminus into the active site pocket, reducing its volume by 53%.

[0116] Interestingly, the addition of just two amino acids, leucine and glutamic acid (LE), to the C-terminus, previously shown to enhance monoterpene production (see, e.g., FIGS. 14A- 16B), also effectively reduces the active site pocket volume. See FIG. 18.

[0117] It is hypothesized that changes in Erg20p activity are correlated with the active site pocket volume, where a reduction may hinder the binding of the larger GPP molecule while still allowing the smaller DMAPP and IPP to bind. Through rational design of amino acid additions to the C-terminus, Erg20p variants were generated with a range of predicted active site pocket volumes (see FIG. 18). Notably, most designs extend the disordered C-terminus and reduce the active site pocket volume, except for the addition of two leucine residues (LL), which is predicted to transform a disordered region of the Erg20p into a structured a-helix. This structural change resulted in minimal alteration of the active site pocket volume compared to wild-type Erg20p. Strains expressing Erg20p variants with reduced active site volume demonstrated a 2- to 3-fold increase in geraniol production, with a corresponding decrease in farnesene production. In contrast, strains expressing the Erg20p-LL variant produced 53% less geraniol compared to the wild-type. See FIG. 19.

[0118] Example 6

[0119] Given the significant improvement in GPP synthase activity observed with Erg20p- Myc, it was tested whether the disclosed mevalonate overproducing yeast strain, expressing only Erg20p-Myc, could serve as a chassis strain for the high-titer production of various monoterpenes. For geraniol production, increasing the amount of geraniol synthase (ObGES) by increasing the ObGES gene copy number from 2 to 6 did not further increase geraniol titer. See FIG. 20A. In contrast, overexpression of the lower mevalonate pathway in yeast expressing 6 copies of ObGES increased geraniol titer by 67% from 323 ± 9 mg / L to 538 ± 9 mg / L. See FIG. 20A. To convert geraniol into geranyl acetate, we integrated a single copy of the Rosa hybrida alcohol acyltransferase (RhAAT) and the resulting strain produced 1040 ± 30 mg / L of geranyl acetate, the highest titer reported in S. cerevisiae, with almost no unconverted geraniol. See FIG. 20A. Interestingly, the strain producing geranyl acetate achieved a molar equivalent of 5.3 mM geraniol, which is 50% higher than the 3.5 mM geraniol produced by the strain without RhAAT overexpression. This is consistent with previous studies on geranyl acetate production in Escherichia coli, and can be attributed to several factors: (1) geranyl acetate partitions more effectively into the dodecane phase than geranioF7; (2) the conversion of geraniol to geranyl acetate prevents geraniol from being metabolized into byproducts, such as citronellol58; and (3) potential end-product feedback inhibition by geraniol, as previously reported5'. Nonetheless, we have demonstrated that our chassis yeast can produce geranyl acetate at a high titer exceeding Ig / L.

[0120] Similarly, integrating additional copies of McLISE343D’E352H(6 copies in total) and overexpressing the lower mevalonate pathway increased linalool production to 270 ± 6 mg / L, to our best knowledge, the highest titer reported in S', cerevisiae shake flask cultures. See FIG. 20B. The overexpression of Citrus bergamia alcohol acyltransferase (CbAAT9-i-c)60further converted linalool into linalyl acetate. A strain with 6 copies of CbAAT9-l-c integrated produced 768 ± 24 mg / L of linalyl acetate with 79 ±2 mg / L of linalool remaining. Surprisingly, the best linalyl acetate-producing strain in this example yielded a molar equivalent of 4.4 mM linalool in total, a significant 2.5-fold increase over the 1 .8 mM linalool produced by the strain without CbAAT9-l-c overexpression. See FIG. 20B. This finding is consistent with previous observations in the strain producing geranyl acetate and suggests that esterification of monoterpenes could be a generalized strategy to improve monoterpene production. Finally, this demonstrates the disclosed Erg20p-peptide fusion enzymes can support the high-level production of four different monoterpenes (i.e., geraniol, linalool, geranyl acetate, and linalyl acetate) and shown that yeast expressing Erg20p-Myc can be used as a chassis strain for monoterpene production. Example 7

[0121] It was tested whether additional improvements in monoterpene production could be achieved by post- translational assembly of enzyme complexes. Prior theoretical modeling and experimental studies have shown that colocalizing enzymes into clusters at metabolic branch points can effectively channel shared intermediates towards a preferred pathway, enhancing the production of desired compounds. Specifically, for GPP, it was hypothesized that colocalizing Erg20p with geraniol synthase within synthetic condensates would increase the likelihood of GPP being converted into geraniol before it could either be converted into FPP or diffuse away from the condensate. To test this hypothesis, the PDZ domain-functionalized “Forever Corelet” synthetic condensate (FC*), which involves fusing the N-terminal intrinsically disordered region (IDR) of the FUS protein to a 60-mer synthetic protein, 13-01K129A(see Hsia, Y. et al., “Design of a hyperstable 60-subunit protein icosahedron”, Nature 535, 136-139 (2016)) was overexpressed to colocalize Erg20p-Myc-PDZp and ObGES-PDZp. See FIG. 21. While colocalization of these two enzymes into synthetic condensates did not improve geraniol production when normalized by optical density (OD600) (see FIG. 22), it resulted in a 16% increase in geraniol titer compared to the control expressing unfunctionalized condensate. See FIG. 23. This improvement in geraniol titer corresponds to an 11% increase in final OD600, suggesting an unexpected effect of synthetic condensate-regulated metabolism on cell growth. See FIG. 23.

[0122] A possible explanation for the modest effect of colocalizing Erg20p-Myc-PDZp and ObGES-PDZp is that the FPP synthase activity of Erg20p-Myc-PDZp competes with ObGES- PDZp for the shared GPP intermediate within the condensates. This is supported by previous studies showing that colocalizing two enzymes in a linear pathway (e.g., Erg20p catalyzing two consecutive reactions) can accelerate intermediate processing, provided that the reaction rate is faster than the diffusion rate out of the enzyme clusters. To test this hypothesis, it was investigated whether localizing Erg20p-Myc-PDZp into synthetic condensates alone could increase the intracellular FPP level, reasoning that any increase in FPP, (measured as famesene production) would indicate accelerated GPP-to-FPP conversion. Indeed, localizing Erg20p- Myc-PDZp into synthetic condensates leads to a 58% increase in farnesene titer compared to the control without localization (1.09 ± 0.06 vs 0.67 ± 0.05 mg / L / OD600) (see FIG. 24), which confirms that Erg20p-Myc-PDZp can effectively compete with ObGES-PDZp for GPP inside the condensate. This finding aligns with the observed impact on cell growth, where increased intracellular FPP potentially enhances ergosterol biosynthesis. Nonetheless, to better regulate flux at the GPP branch point, the FPP synthase activity of Erg20p-Myc-PDZp must be reduced. To this end, the previously characterized F96W and N 127W mutations were introduced into Erg20p-Myc-PDZp to weaken its ability to covert GPP. However, yeast expressing only Erg20p(F96W-N127W)-Myc-PDZp from the endogenous ERG20 locus was non- viable (data not shown), likely due to the drastically reduced FPP synthase activity of Erg20p(F96W-N 127W), which impaired ergosterol synthesis. To address this challenge, only the F96W mutation was introduced, which has been reported to allow Erg20p to retain more FPP synthase activity compared to the F96W-N127W double mutations. Indeed, a single copy of Erg20p(F96W)-Myc-PDZp at the endogenous ERG20 locus is sufficient to support yeast growth, albeit with defects that decrease the final OD600by 28% compared to yeast expressing Erg20p-Myc-PDZp. See FIG. 23. Nonetheless, the introduction of F96W into Erg20p-Myc- PDZp reduces FPP accumulation (0.37 ± 0.005 vs 0.67 ± 0.05 mg / L / OD600) as expected, and localizing Erg20p(F96W)-Myc-PDZp into condensates does not further increase the intracellular FPP level. See FIG. 24.

[0123] Contrary to the expectation that reduced FPP accumulation in yeast expressing Erg20p(F96W)-Myc-PDZp would correspond to increased GPP accumulation, the F96W substitution in endogenous Erg20p-Myc-PDZp actually results in a 58% reduction in geraniol titer, decreasing to 190 ± 7 mg / L after 96hr of fermentation. Additionally, the OD-normalized geraniol titer decreases by 43%, yielding 19.6 ± 0.1 mg / L / OD600when the enzymes are not colocalized. See FIGS. 22-23. Furthermore, in yeast expressing uncolocalized Erg20p-Myc- PDZp, the OD-normalized geraniol titer increases from 24 to 72 hours after the start of fermentation. However, this increase is not observed in yeast expressing the uncolocalized Erg20p(F96W)-Myc-PDZp. See FIG. 22. Finally, significant increases in the accumulation of overflow metabolites (i.e., glycerol and ethanol) was also observed, associated with the F96W substitution. Taken together, these findings indicate that the reduction in cell growth alone cannot fully account for the observed decrease in geraniol titer, suggesting the presence of an additional bottleneck in the pathway. This bottleneck may be caused by intermediates toxicity. The F96W substitution in Erg20p results in a 4-fold decrease in catalytic efficiency (kcat / KM) for DMAPP (Table 1), and it is known that IPP / DMAPP can be toxic to the cell. In addition, the possible inhibition of Erg20p by GPP may further exacerbate the accumulation of toxic IPP / DMAPP. Another possible bottleneck could be reduced pathway flux, as previous studies have shown that S. cerevisiae Ergl2p is inhibited by the accumulation of DMAPP and GPP70.

[0124] Thus, it is reasoned that colocalizing Erg20p(F96W)-Myc-PDZp with ObGES-PDZp could enhance the conversion of GPP to geraniol, therefore mitigating potential feedback inhibition and preventing the accumulation of toxic IPP / DMAPP. Indeed, colocalizing Erg20p(F96W)-Myc-PDZp and ObGES-PDZp resulted in a 3.4-fold increase in OD- normalized geraniol titer (66.7 ± 8.0 mg / L / OD600) and a 3.5-fold increase in overall geraniol titer (669 ± 32 mg / L) after 96hr of fermentation compared to the uncolocalized enzymes, which are also higher than those obtained from the strain colocalizing Erg20p-Myc-PDZp with ObGES-PDZp. See FIGS. 22-23. Additionally, in yeast with colocalized Erg20p(F96W)- Myc-PDZp and ObGES-PDZp, the OD-normalized geraniol titer continues to increase from 24 to 72 hours after the start of fermentation, suggesting that the observed toxicity is alleviated.

[0125] In addition, it has also been demonstrated that in geranyl acetate-producing yeast, colocalizing Erg20p-Myc-PDZp, both with and without the F96W substitution, alongside ObGES-PDZp, improves geranyl acetate production, thus highlighting the generalizability of using synthetic condensates to enhance monoterpene production. These results show that spatially controlling enzyme localization with synthetic condensates can effectively regulate metabolic flux at the GPP branch point and complement protein engineering strategies to improve production titers.

[0126] For plasmid construction in these examples, sll integration (LEU2, HIS3, TRP1) and 2p plasmids were created based on the pJLA vectors, using either the restriction digest and ligation method with T4 DNA ligase (NEB) or the In-Fusion HD cloning kit (Takara Bio). Additionally, the EasyClone2.0 vector pCFB2225 was used to integrate gene constructs into the XII-2 locus. The following restriction enzymes were used for cloning: Mrel (Thermo Fisher Scientific), BspEI (NEB), SpeI-HF(NEB), BamHI-HF(NEB), Nhel-HF (NEB), Notl-HF(NEB), Agel- HF(NEB), Asci (NEB), and Xhol (NEB). Promoters (CCW12p and HHF2p) and terminators (TDHlt, PGKlt, ENO2t, and ENO It) that are not in the pJLA vectors were obtained from a published yeast toolkit on Addgene (Kit #1000000061). The C-terminal peptide modifications are introduced via oligo annealing followed by In-Fusion cloning. All oligos and primers are purchased from Integrated DNA Technologies (IDT). Recombinant DNA of heterologous enzymes (RhAAT , McLIS, and CbAAT9-l-c) were codon-optimized for >S’. cerevisiae using IDT codon optimization tool and purchased as GBLOCKS® gene fragments from IDT.

[0127] The cloned plasmids were transformed into Stellar E. coli competent cells (Takara Bio), plated on Luria-Bertani (LB) plates containing 100 μg / ml ampicillin, and incubated at 30ºC overnight. Single colonies carrying the correct plasmid constructs were identified by colony PCR using ONETAG® HOT-START QUICK LOAD® 2X Master Mix (NEB), and plasmids were purified from overnight culture in LB containing 150 pg / ml ampicillin at 37ºC. All cloned plasmids were verified by Sanger sequencing (Genewiz) or Whole Plasmid sequencing (Plasmidsaurus).

[0128] For yeast transformation and fermentation, Integration plasmids were linearized with Pmel (NEB) or Swal (NEB) and transformed into yeast using the standard lithium acetate method93. S. cerevisiae CEN.PK2-1C (MATa, ura3-52, trpl-289, leu2-3112, his3Al, MAL2- 8c, SUC2) is the origin for all the engineered strains used in these examples. Transformants were selected on synthetic complete (SC) with 2% (w / v) glucose agar plates lacking appropriate amino acid for auxotrophic marker selection. To verify integration of linearized DNA construct into the yeast genome, single colonies were isolated and screened using Phire Tissue Direct PCR Master Mix (Thermo Fisher Scientific). Positive colonies were then screen in high-cell-density fermentations in 24- well plates as follows. Yeast was grown overnight in 1 mL SC media containing 2% (w / v) glucose lacking appropriate amino acid. After 24 hr at 30ºC with shaking at 200 rpm, plates were centrifuged at 1000 rpm for 5 min. After the supernatant was discarded, the yeast pellets were resuspended in 1 mL SC media containing 2% (w / v) glucose with 20% (v / v) dodecane (Sigma Aldrich) overlay (200 μL) at 30ºC for 48 hr with shaking at 200 rpm. At the end of the fermentation, monoterpenes production was quantified as described below. The highest producing colonies were stored as 20% (v / v) glycerol stocks at -80ºC.

[0129] To compare strain performance, strains were streaked from glycerol stocks onto yeast extract peptone dextrose (YPD) agar plates and incubated at 30ºC until individual colonies were clearly visible. Single colonies were then used to inoculate 1 mL of SC-amino acid dropout media with 2% (w / v) glucose with 20% (v / v) dodecane (200 μL) in glass tubes, followed by overnight culture. The following day, the overnight culture was used to inoculate 3 mL of SC media containing 2% (w / v) glucose with 20% (v / v) dodecane (600 μL) in 14 mL test tubes (Falcon) at a starting OD600of 0.2 and cultures were incubated at 30ºC for 96 hr with shaking at 265 rpm.

[0130] For CRISPR / Cas9 assisted gene editing, all monoterpene-producing strains with modified endogenous ERG20 in the examples were derived from a mevalonate over-producing strain (JCY51). The Ellis lab CRISPR / 'Cas9 toolkit was used to endogenously tag the ERG20 gene. The sgRNA sequences were designed to target the ERG20 coding region (5’- ATGTTCTTGGGTAATCAACAAGG (SEQ ID NO. 7)). The upstream and downstream regions of the target gene of interest were amplified from the yeast genome to construct the repair template. Colonies were screened and sequence verified as described above. To cure the Cas9 plasmid, colonies were cultured overnight in YPD media with 2% (w / v) glucose and then plated onto a YPD agar plate. To cure Cas9 plasmid with URA3 marker, overnight culture was plated onto YPD plate supplemented with Ig / L 5-fluoroorotic acid.

[0131] For whole-cell Proteomics, starter yeast was grown overnight in 3 mL YPD media at 30ºC and then used to inoculate 1 L YPD media at a starting OD600of 0.2 and incubated at 30ºC for 48 hr with shaking at 220 rpm. After 48 hr, the cultures were centrifuged at 7500 x g for 20 minutes at 4ºC. The supernatant was discarded, and the pellets were resuspended in 10 mL of phosphate buffered saline (PBS) buffer. The resuspended pellets were flash-frozen in dots in liquid nitrogen and subsequently disrupted at cryogenic temperatures using a Cryo-Mill system (1.5 hr / run). The resulting powder was collected and stored in 50 mL conical tubes at - 80ºC.

[0132] Before trypsin digestion, the total protein content of samples was determined using the Bradford assay by measuring the absorbance of Coomassie brilliant blue G at 595 nm. Cryomilled yeast samples were dissolved in 5% SDS and 50 mM TEAB buffer and digested following the S-Trap mini spin column digestion protocol. Trypsin digested samples were dried completely in a SpeedVac and resuspended with 20 μL of 0.1% formic acid in water (pH = 3). 2 μL (~ 1 qg digested protein) was injected per run using an Easy-nLC 1200 UPLC system. Samples were loaded directly onto a nano capillary column (45 cm length, 75 ^m inner diameter) packed with 1.9 μm C18-AQ resin (Dr. Maisch) mated to metal emitter in-line with an ORBITRAP® FUSION LUMOS™ mass spectrometer (Thermo Fisher Scientific). Column temperature was set at 45ºC and two-hour gradient method with 360 nL / min flow was used. The mass spectrometer was operated in data dependent mode with the 120,000 resolution MSI scan (positive mode, profile data type, AGC gain of 4e5, maximum injection time of 54 sec, and mass range of 375-1500 m / z) in the mass spectrometer followed by HCD fragmentation in ion trap with 35% collision energy. Dynamic exclusion list was invoked to exclude previously sequenced peptides for 60 sec and maximum cycle time of 3 sec was used. Peptides were isolated for fragmentation using quadrupole (1.2 m / z isolation window). Ion-trap was operated in Rapid mode. Post-analysis was performed using the Proteome Discoverer v2.5 (Thermo Fisher Scientific). Heterologous protein sequences were added to S. cerevisiae CEN.PK113- 7D reference database before database searching.

[0133] For recombinant Erg20p expression and purification, Erg20p wild type and variants were purified using N-terminal 6xHis tag and metal affinity chromatography. Production of the recombinant Erg20p variants was carried out in E. coli BL21(DE3) cells harboring the construct plasmids grown overnight at 30ºC in 10 mL of Luria-Bertani (LB) broth (using 50 mL conical tubes) supplemented with Kanamycin (Kan) at 50 pg / mL. A dilution of 1 / 1000 of the overnight culture was used the next day to inoculate 1 L of LB+Kan. Protein production was induced by the addition of 0.5 mM IPTG when cell densities were at OD6000.4-0.8 after incubation at 37ºC. After induction, cells were grown at 19 ºC for an additional 20 hours and harvested by centrifugation at 7,500 x g for 20 minutes at 4 ºC. After discarding the supernatant, the resulting pellet was resuspended in washing buffer (Tris-buffered saline-TBS, pH 7.6, 10 mL / L culture). To disrupt the cells, the resuspended pellets were then flash-frozen forming droplets directly into liquid nitrogen (LN?) and immediately transferred to big (LN2-cold) grinding vials to be disrupted using a CRYOMILL® grinding system (SPEX® sample prep) with 14 cycles of 2 min grinding (with impact frequency set at 13 cycles per second) and 3 min of cooling. Broken cells (frozen powder) were thawed in 50 mL Falcon tubes on ice with the addition of Lysis buffer (Binding buffer supplemented with 1 mM PMSF, 2 mg / mL of DNase and 100 μL of commercial protease inhibitor cocktail) up to 5% of the initial cell culture volume. Once the viscous consistency of the thawed mixture of cell powder and Lysis buffer became a fluid liquid, the bacterial lysates were clarified by centrifugation at 12,000 x g for 30 minutes at 4 C and the supernatants (clarified lysate) were transferred to 50 mL conical tubes. These clarified lysates were loaded at 1.8 mL / min onto columns of 2.5 mL (50% suspension) of TALON® SUPERFLOW™ histidine-tagged protein purification resin previously equilibrated with Binding buffer (100 mM Tris pH 8.0, 150 mM NaCl, 5 mM imidazole, and 5% v / v glycerol), using a MINIPULS® 3 peristaltic pump (Gilson® ) within a cold room (4ºC). Columns were washed with 40-50 column volumes of Binding buffer and proteins eluted with Elution buffer (Binding buffer supplemented with 250 mM of imidazole).

[0134] Purification buffers were as follows: washing buffer 1 (lOOmM Tris, 300 mM NaCl, 10 mM imidazole, pH 8.0), washing buffer 2 (100 mM Tris, 300 mM NaCl, 20 mM imidazole, pH 8.0), and elution buffer (100 mM Tris, 300 mM NaCl, 250 mM imidazole, pH 8.0). At each step of the purification process, 30 pl aliquots were collected for sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) analysis. To remove the high concentration of imidazole present in the elution buffer, protein was dialyzed using a Spectra Por 1 Dialysis Membrane with a molecular weight cutoff of 6-8 kD. The eluted protein was dialyzed in 1 L of dialysis buffer (300 mM NaCl and 20 mM HEPES) for 2 hours and then the buffer was discarded, and 1 L of fresh buffer was added to dialyze the protein for an additional 24hr at 4ºC.

[0135] Protein was then concentrated by centrifugation (in cycles of 10 min) at maximum speed in a Son-all Legend XTR Benchtop centrifuge (Thermo Scientific™) using 15 mL centricons® (Millipore) with a cutoff selected according to the molecular size of each protein, until concentrations between 5 and lO mg / mL were reached. Finally, the protein was run through Size Exclusion Chromatography (SEC) using a Hiprep™ HR 16 / 60 Sephacryl™ 200 with Buffer A (50 mM Tris pH 8.0 and 150 mM NaCl) in an FPLC column (AKTA pure from GE® Healthcare). The SEC was monitored by UV absorbance at 280 nm. The aliquots enriched with the target proteins were immediately used for the enzymatic assays. The concentrations of the fractions eluted with light were calculated using absorbance at 280 nm with a spectrometer.

[0136] For determination of kinetic parameters, recombinant Erg20p activities were assayed following previous studies with slight modifications by varying the concentrations of DMAPP or GPP added as substrates in a total volume of 0.2 mL reaction containing 10 mM MOPS (pH 7.0), 10 mM MgC12, 4 mM DTT, 0.1 mg / mL BSA, 0.05 mM IPP, and 50 ng of recombinant Erg20p (wild-type or variants). Reactions were carried out for 30 min at 30ºC; and then, they were terminated by the addition of 0.2 mL 2N HQ in 83% ethanol and 0.2 mL ethyl acetate overlay to trap the volatile products. After 10 min at 37ºC to hydrolyze the acid-labile diphosphates, reactions were neutralized by adding 0.35 mL 10% NaOH. The ethyl acetate phase (50 itL ) was analyzed by GC-FID. Tire GC method is as follows. Samples were injected and subjected to a split (0.5 μL injection volume; 1 :20 split) with a constant flow of 1.5 mL / min. The temperatures of the injector and detector are 230ºC and 260ºC, respectively. The initial oven temperature was 45ºC, increasing at a rate of 1.5ºC / min until 150ºC, then at 40ºC / min until 220cC, being held at this temperature for the last 10 min. For the quantification of products, calibration curves of geraniol, linalool, famesol, and nerolidol were prepared and diluted in the same sample matrix used for enzyme assays. Enzyme activity was calculated as the total amount of GPP products (geraniol and linalool) or FPP products (famesol and nerolidol) produced per minute per ng of protein. All the experiments were carried out in triplicate. Graphs and statistical analysis for enzyme kinetics were done using GraphPad PRISM software VI 0.3.

[0137] For modeling of wild type Erg20p and Erg20p-peptide fusions, ColabFold vl.5.5 with AlphaFold 2.0 parameters was used to produce all structural models. The crystal structure of homologous protein isoprenyl diphosphate synthase from Phaedon cochleariae (PDB: 8A6V) was provided as a template: the same structure was used to provide an initial pose for IPP in the proximal homoallylic site (HA1) site. DMAPP was positioned in the allylic site (Al) by superimposing the solved DMAPP within the homologous protein structure of isoprenoid synthase A3MSH1 (PDB: 4GP2). GPP was positioned similarly in the Al from the solved pose within homologous protein structure (PDB: 8A70).

[0138] The wild-type Erg20p with IPP and GPP or DMAPP posed was subject to energy minimization with the Rosetta FastRelax protocol using the “ref2015” score function. Optimization of the ligand positioning and pocket sidechains was performed with RosettaLigand using the ROSIE server. 200 conformers of each ligand were generated using BCL. Independent trajectories were started from 200 random seeds, and the lowest energy pose for GPP / IPP and DMAPP / IPP was used as the starting pose for generating mutant models.

[0139] Secondary structures of a library' of C-terminal extensions to Erg20p was determined by RaptorX. Selected mutations and extensions were chosen to build structural models using PyRosetta's point mutation feature. A constrained FastRelax protocol was performed on the additional residues and any residues within a 5Å radius of the extensions. The resulting structures were assessed for DMAPP and GPP absolute binding affinity through Kdeep, a 3D- convolutional network method. Pocket volume was measured through Fpocket.

[0140] For fed-Batch Fermentation in a bioreactor, to quantify monoterpenes and farnesene production, 200 μL of the dodecane layer was sampled and diluted with 800 μL of ethyl acetate (Sigma Aldrich). The mixture was vortexed for 5 min and then centrifuged at 12,500 g for 30 min at 4ºC to remove any residual debris. Then, 450 μL of the supernatant was collected for GC-FID analysis using an AGILENT® 7890B GC System equipped with a DB-Wax column (30 m length, 0.25 mm diameter, 0.5 μm film). The GC method is as follows. Samples were injected and subjected to a split injection (0.5 μL injection volume; 1 :20 split) with a constant flow of 1.5 mL / min. The oven temperature was initially set to 70ºC and held for 5 minutes, followed by a temperature increase at a rate of 30ºC / min until reaching 230ºC, and then held for 3 minutes. Quantification of the samples was performed using flame-ionization detection (300ºC with H2 flow at 30 mL / min, air flow at 400 mL / min, and makeup flow at 25 mL / min). Monoterpenes and β-farnesene concentrations were calculated using calibration curves generated from standard solutions of geraniol (Sigma- Aldrich), geranyl acetate (Sigma- Aldrich), linalool (Sigma-Aldrich), linalyl Acetate (TCI Chemicals), and β-famesene.

[0141] Concentrations of glucose, ethanol, and glycerol were measured using HPLC. ImL of aqueous sample was collected and centrifuged in 1.5 mL Eppendorf tubes at 12,500 g for 30 min at 4 °C to remove residual debris. Subsequently, 500 μL of the upper layer was transferred to a 2 mL glass vial for HPLC analysis using an Agilent 6100 system equipped with a BioRad Aminex HPX-87H column (300 x 7.8 mm, 9 pm particle size, 0.25 mm diameter) and a refractive index detector. Both the column and detector temperatures were set to 55ºC. Samples were eluted with 5 mM H2SO4at a flow rate of 0.6 mL / min for 50 min.

[0142] Inter alia, the improved GPP synthase derived from C-terminally tagged Erg20, as disclosed herein, could potentially be used in any engineered fungal or bacterial strain to improve the production of valuable products derived from monoterpenes. This includes biofuels, commodity chemicals, flavors, fragrances, biomaterials, pigments, vitamins, nutraceuticals, pharmaceutical precursors, natural products, drugs, biomaterials, etc. Moreover, the engineering strategy disclosed herein can be used in parallel with existing approaches to further improve production.

Claims

What is claimed is:

1. A method for monoterpenes biosynthesis, comprising: providing an engineered microorganism comprising a first gene encoding an engineered enzyme, and having a mevalonate pathway, where the engineered enzyme comprises a first peptide fused to a C-terminus of a famesyl pyrophosphate synthase: exposing the engineered microorganism to a carbon source; allowing the engineered microorganism to generate a first product from the mevalonate pathway and the engineered enzyme; and forming a monoterpene by allowing the first product and the engineered enzyme to interact.

2. The method of claim 1, wherein the monoterpene is a monoterpene alcohol or monoterpene ester.

3. The method of claim 1, wherein the monoterpene is geraniol, linalool, geranyl acetate, and / or linalyl acetate.

4. The method of claim 1, wherein the monoterpene is a pharmaceutically active agent.

5. The method of claim 4, wherein the pharmaceutically active agent is a cannabinoid, monoterpene indole alkaloid, opioid, or combination thereof.

6. The method of claim 1, wherein the first peptide consists of 1-2 amino acids.

7. The method of claim 1, wherein the first peptide causes a length of a disordered region of the C-terminus to be extended without impacting a length of an alpha helix at the C-terminus.

8. The method of claim 1, wherein the first peptide causes a length of an alpha helix at the C- terminus to be extended.

9. The method of claim 1, wherein the first peptide is a first linker peptide.

10. The method of claim 9, wherein the first linker peptide comprises 10-15 amino acids.

11. The method of claim 1, wherein the engineered enzyme further comprises a second peptide fused to the first peptide.

12. The method of claim 11, wherein the second peptide comprises 7-15 amino acids.

13. The method of claim 11, wherein the second peptide is an affinity tag or an epitope tag.

14. The method of claim 13, wherein the affinity tag or epitope tag is a Myc-tag or a HA-tag.

15. The method of claim 11, wherein the engineered enzyme further comprises a third peptide fused to the second peptide.

16. The method of claim 15, wherein the third peptide is a second linker peptide.

17. The method of claim 16, wherein the second linker peptide comprises 10-15 amino acids.

18. The method of claim 15, wherein the engineered enzyme further comprises a fourth peptide fused to the third peptide.

19. The method of claim 18, wherein the fourth peptide comprises a SH3 or PDZ domain ligand.

20. The method of claim 1, wherein the engineered microorganism is free of genes encoding an endogenous farnesyl pyrophosphate synthase.

21. The method of claim 1 , wherein the engineered microorganism further comprises a gene encoding an endogenous farnesyl pyrophosphate synthase.

22. The method of claim 1, wherein the engineered microorganism further comprises a gene encoding an alcohol acyl transferase and / or an alcohol acetyl transferase.

23. An engineered enzyme, comprising:a first peptide fused to a C-terminus of a farnesyl pyrophosphate synthase.

24. The engineered enzyme of claim 23, wherein the first peptide is a first linker peptide.

25. The engineered enzyme of claim 24, wherein the first linker peptide comprises 10-15 amino acids.

26. The engineered enzyme of claim 23, further comprising a second peptide fused to the first peptide.

27. The engineered enzyme of claim 26, wherein the second peptide comprises 7-15 amino acids.

28. The engineered enzyme of claim 26, wherein the second peptide is an affinity tag or an epitope tag.

29. The engineered enzyme of claim 28, wherein the affinity tag or epitope tag is a Myc-tag or a HA-tag.

30. The engineered enzyme of claim 26, further comprising a third peptide fused to the second peptide.

31. The engineered enzyme of claim 30, wherein the third peptide is a second linker peptide.

32. The engineered enzyme of claim 31 , wherein the second linker peptide comprises 10-15 amino acids.

33. The engineered enzyme of claim 30, further comprising a fourth peptide fused to the third peptide.

34. The engineered enzyme of claim 33, wherein the fourth peptide comprises a SH3 or PDZ domain ligand.

35. The engineered enzyme of claim 23, wherein the first peptide reduces an active site pocket volume of the engineered enzyme as compared to a wild-type farnesyl diphosphate synthase.

36. The engineered enzyme of claim 23, wherein the first peptide increases an active site pocket volume of the engineered enzyme as compared to a wild-type farnesyl diphosphate synthase.

37. An engineered DNA sequence, comprising a first gene encoding an engineered enzyme of claim 23.

38. An engineered microorganism, comprising an engineered DNA sequence of claim 37.

39. The engineered microorganism of claim 38, wherein the engineered microorganism is a strain of yeast.

40. The engineered microorganism of claim 39, wherein the yeast is >S’. cerevisiae.

41. The engineered microorganism of claim 38, wherein the engineered microorganism is free of genes encoding an endogenous farnesyl pyrophosphate synthase.

42. The engineered microorganism of claim 38, further comprising a second gene encoding an endogenous farnesyl pyrophosphate synthase.

43. The engineered microorganism of claim 38, further comprising a second gene encoding an alcohol acyl transferase and / or an alcohol acetyl transferase.

44. A method for converting a natural farnesyl pyrophosphate synthase into an engineered geranyl pyrophosphate synthase, comprising: creating an engineered sequence by fusing a first peptide to a C-terminus of a farnesyl pyrophosphate synthase, wherein the first peptide is a first linker peptide.

45. The method of claim 44, further comprising replacing genes encoding endogenous farnesyl pyrophosphate synthase with the engineered sequence.

46. A method for monoterpenes biosynthesis, comprising: providing an engineered microorganism comprising a first gene encoding an engineered enzyme, and having a mevalonate pathway, where the engineered enzyme comprises one or more peptides fused to a C-terminus of a famesyl pyrophosphate synthase, wherein the one or more peptides reduces an active site pocket volume of the engineered enzyme as compared to a wild-type famesyl pyrophosphate synthase; exposing the engineered microorganism to a carbon source; allowing the engineered microorganism to generate a first product from the mevalonate pathway and the engineered enzyme; and forming a monoterpene by allowing the first product and the engineered enzyme to interact.

47. A method for monoterpenes biosynthesis, comprising: providing an engineered microorganism comprising a first gene encoding an engineered enzyme, and having a mevalonate pathway, where the engineered enzyme comprises one or more peptides fused to a C-terminus of a farnesyl pyrophosphate synthase, wherein the one or more peptides increases an active site pocket volume of the engineered enzyme as compared to a wild-type farnesyl pyrophosphate synthase; exposing the engineered microorganism to a carbon source; allowing the engineered microorganism to generate a first product from the mevalonate pathway and the engineered enzyme; and forming a monoterpene by allowing the first product and the engineered enzyme to interact.

Images