Luminescent protein

Abstract

Provided is a luminescent protein that emits light at high light intensity in a plurality of wavelength regions.　The luminescent protein comprises a complex of a bacterial luciferase and a fluorescent protein, wherein the bacterial luciferase has a LuxA subunit and a LuxB subunit, and the fluorescent protein is fused with the bacterial luciferase via the LuxA subunit.

Description

Photoproteins

[0001] The present invention relates to a photoprotein containing luciferase derived from luminescent bacteria.

[0002] Luminescence occurs when a luminescent substrate is oxidized by a catalytic enzyme called luciferase. Luciferases and luminescent substrates have been identified in thousands of known bioluminescent organisms, and these are used, for example, in genetic engineering to quantify proteins in cells using light as an indicator.

[0003] Among eubacteria (bacteria), there are several species that produce luminescence (luminescent bacteria). Light generation in luminescent bacteria occurs through an enzymatic reaction of a substrate catalyzed by bacterial luciferase (Non-Patent Documents 1 and 2). Bacterial luciferase specifically reacts with reduced flavin mononucleotide (FMNH ２ ) and long-chain fatty aldehyde (RCHO) to produce flavin mononucleotide (FMN) and the corresponding long-chain fatty acid (RCOOH), and during this reaction, light with a maximum wavelength around 490 nm is emitted.

[0004] The basic enzymes required for luminescence in luminescent bacteria are encoded by a single operon (lux operon) called luxCDABE, which is found in all species of luminescent bacteria (Non-Patent Documents 1 and 2). luxA and luxB encode the α (LuxA) and β (LuxB) subunits of the heterodimeric protein of bacterial luciferase, respectively. luxC, luxD, and luxE are genes encoding a complex for synthesizing and recycling fatty aldehydes, which are the substrates of luciferase. It has been observed that co-expression of the above five lux genes in bacteria other than luminescent bacteria or yeast cells results in spontaneous luminescence (autoluminescence) without the need for external substrate supply (Non-Patent Documents 3 and 4). In mammalian or plant cells, co-expression of FMN oxidoreductase (LuxG) in addition to the above five lux genes produces sufficient amounts of FMNH.２ can be produced, which enables stable bioluminescence (Non-Patent Documents 5-8).

[0005] Unlike imaging with fluorescent proteins, bioluminescence imaging does not require external excitation light, which has the advantage of being less susceptible to problems such as phototoxicity, photobleaching, and sample-derived fluorescence background. In particular, reporters based on bacterial luciferase have the advantages of a high signal-to-noise ratio (S / N ratio) and ease of use. Furthermore, because excitation light does not interfere with spectral analysis, a broader spectral range can be analyzed than with fluorescent proteins. However, bacterial bioluminescence imaging has limitations, such as low brightness and long exposure times (Non-Patent Documents 9 and 10).

[0006] Non-Patent Document 11 describes that by fusing bacterial LuxB with a circularly permuted yellow fluorescent protein, Venus, bioluminescence resonance energy transfer (BRET) occurs within cells, achieving 10 times the luminescence intensity in a short period of time compared to Lux alone. Furthermore, it was also revealed that introducing this into plant and animal cells also achieved high luminescence intensity in these cells.

[0007] Meighen, E., A., Microbiol. Rev. 55, 123-142 (1991)Dunlap, P., Adv. Biochem. Eng. Biotechnol. 144, 37-64 (2014)Frackman, S. et al., J. Bacteriol. 172, 5767-5773 (1990)Gupta, RK et al. al., FEMS Yeast Res. 4, 305-313 (2003)Close, DM et al., PLoS One 5, e12441 (2010)Krichevsky, A. et al., PLoS One 5, e15461 (2010)Xu, T. et al., PLoS One 9, e96347 (2014)Gregor, C. et al. Proc. Natl. Acad. Sci. USA 116, 26491-26496 (2019)Close, DM et al., J. Biomed. Opt. 16, 047003 (2011)Gregor, C. et al., Proc. Natl. Acad. Sci. USA 115, 962-967 (2018)Kaku, T. et al., Nature Scientific Reports, 11, 14994 (2021)

[0008] As described above, it was demonstrated that by utilizing the bacterial lux operon and fusing the fluorescent protein Venus with luxB, it is possible to construct a highly luminescent photoprotein capable of spontaneously emitting light within cells. The light emitted by this system is yellow-green (maximum wavelength 528 nm), but for use in cell experiments requiring multiple types of reporters, it is desirable to have multiple types of photoproteins that emit light of different wavelengths.

[0009] An object of the present invention is to provide a photoprotein that emits high-intensity light across multiple wavelength ranges. Another object of the present invention is to provide a nucleic acid encoding the photoprotein that emits high-intensity light across multiple wavelength ranges, a vector incorporating the nucleic acid, and a cell incorporating the nucleic acid.

[0010] The present invention provides the following: [1] A luminescent protein comprising a complex of bacterial luciferase and a fluorescent protein, wherein the bacterial luciferase has a LuxA subunit and a LuxB subunit, and the fluorescent protein is fused to the LuxA subunit; wherein the LuxA subunit is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 1 or a polypeptide consisting of an amino acid sequence having 90% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 1; wherein the LuxB subunit is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or a polypeptide consisting of an amino acid sequence having 90% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 2; wherein the fluorescent protein is selected from cyan fluorescent protein, green fluorescent protein, yellow fluorescent protein, orange fluorescent protein, and red fluorescent protein; and wherein the cyan fluorescent protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 3 or a polypeptide having 97% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 3 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 450 to 500 nm, or a circular permutation of any of these polypeptides; the green fluorescent protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 4, or a polypeptide having 97% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 4 and having the function of emitting fluorescence at a maximum fluorescence wavelength of 500 to 520 nm, or a circular permutation of any of these polypeptides; the yellow fluorescent protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 5, and when fused with the LuxA subunit, has a structure in which the amino acid sequence of positions 1 to 229 of SEQ ID NO: 5 and the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1 are linked together with two amino acids of EL sandwiched therebetween; the orange fluorescent protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 6, and when fused with the LuxA subunit, has a structure in which the amino acid sequence of positions 1 to 218 of SEQ ID NO: 6 and the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1 are linked together with two amino acids of EL sandwiched therebetween;Alternatively, the red fluorescent protein is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 7, or a polypeptide having 97% or more sequence identity with the amino acid sequence shown in SEQ ID NO: 7 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 580 to 620 nm, or a circular permutation product of any of these polypeptides. [2] A nucleic acid comprising a base sequence encoding a fusion of a LuxA subunit of bacterial luciferase and a fluorescent protein; the LuxA subunit is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 1 or a polypeptide consisting of an amino acid sequence having 90% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 1; the fluorescent protein is selected from cyan fluorescent protein, green fluorescent protein, yellow fluorescent protein, orange fluorescent protein, and red fluorescent protein; the cyan fluorescent protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 3, or a polypeptide having 97% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 3 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 450 to 500 nm, or a circular permutation of any of these polypeptides; the green fluorescent protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 4, or a polypeptide having 97% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 4 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 500 to 520 nm, or a circular permutation of any of these polypeptides; the yellow fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 5, and when fused with the LuxA subunit, the amino acid sequence of positions 1 to 229 of SEQ ID NO: 5 is linked to the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1, with two amino acids of EL sandwiched between them; the orange fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 6, and when fused with the LuxA subunit, the amino acid sequence of positions 1 to 218 of SEQ ID NO: 6 is linked to the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1, with two amino acids of EL sandwiched between them;or a nucleic acid in which the red fluorescent protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 7, or a polypeptide having 97% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 7 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 580 to 620 nm, or a circular permutation of any of these polypeptides. [3] The nucleic acid according to [2], further comprising a nucleotide sequence encoding the LuxB subunit of bacterial luciferase, wherein the LuxB subunit is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or a polypeptide consisting of an amino acid sequence having 90% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 2. [4] An expression vector incorporating the nucleic acid according to [2]. [5] A cell into which a nucleic acid having a base sequence encoding a fusion of a LuxA subunit of bacterial luciferase and a fluorescent protein and a nucleic acid having a base sequence encoding a LuxB subunit have been introduced, wherein the LuxA subunit is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 1 or a polypeptide consisting of an amino acid sequence having 90% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 1; the LuxB subunit is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or a polypeptide consisting of an amino acid sequence having 90% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 2; the fluorescent protein is selected from cyan fluorescent protein, green fluorescent protein, yellow fluorescent protein, orange fluorescent protein, and red fluorescent protein; and the cyan fluorescent protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 3 or a polypeptide having 97% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 3 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 450 to 500 nm, or a circular permutation of any of these polypeptides; the green fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 4, or a polypeptide having 97% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 4 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 500 to 520 nm, or a circular permutation product of any of these polypeptides;[6] A cell wherein the yellow fluorescent protein is a polypeptide consisting of the amino acid sequence of SEQ ID NO: 5, and when fused with the LuxA subunit, the amino acid sequence of positions 1 to 229 of SEQ ID NO: 5 is linked to the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1, with two amino acids of EL sandwiched between them; the orange fluorescent protein is a polypeptide consisting of the amino acid sequence of SEQ ID NO: 6, and when fused with the LuxA subunit, the amino acid sequence of positions 1 to 218 of SEQ ID NO: 6 is linked to the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1, with two amino acids of EL sandwiched between them; or the red fluorescent protein is a polypeptide consisting of the amino acid sequence of SEQ ID NO: 7, or a polypeptide that has 97% or more sequence identity with the amino acid sequence of SEQ ID NO: 7 and has the function of emitting fluorescence with a maximum fluorescence wavelength of 580 to 620 nm, or a circular permutation of any of these polypeptides. [6] The cell according to [5], which is a bacterium, fungal cell, plant cell, or animal cell. [7] A method for producing a luminescent protein, comprising expressing a nucleic acid having a base sequence encoding a fusion of a LuxA subunit of bacterial luciferase and a fluorescent protein, and a nucleic acid having a base sequence encoding a LuxB subunit; wherein the LuxA subunit is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 1 or a polypeptide consisting of an amino acid sequence having 90% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 1; the LuxB subunit is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or a polypeptide consisting of an amino acid sequence having 90% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 2; the fluorescent protein is selected from cyan fluorescent protein, green fluorescent protein, yellow fluorescent protein, orange fluorescent protein, and red fluorescent protein; and the cyan fluorescent protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 3, or a polypeptide having 97% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 3 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 450 to 500 nm, or a circular permutation of any of these polypeptides;the green fluorescent protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 4, or a polypeptide having 97% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 4 and having the function of emitting fluorescence at a maximum fluorescence wavelength of 500 to 520 nm, or a circular permutation of any of these polypeptides; the yellow fluorescent protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 5, and when fused with the LuxA subunit, the amino acid sequence of positions 1 to 229 of SEQ ID NO: 5 is linked to the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1, with two amino acids of EL sandwiched between them; the orange fluorescent protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 6, and when fused with the LuxA subunit, the amino acid sequence of positions 1 to 218 of SEQ ID NO: 6 is linked to the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1, with two amino acids of EL sandwiched between them; or A method for producing a photoprotein, wherein the red fluorescent protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 7, or a polypeptide having 97% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 7 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 580 to 620 nm, or a circular permutation of either of these polypeptides. This specification incorporates the disclosure of Japanese Patent Application No. 2023-179446, from which the present application claims priority.

[0011] According to the present invention, it is possible to provide a plurality of types of photoproteins that emit light with high luminosity in multiple wavelength ranges. Furthermore, according to the present invention, it is possible to provide nucleic acids encoding photoproteins that emit light with high luminosity in multiple wavelength ranges, vectors incorporating the nucleic acids, and cells incorporating the nucleic acids.

[0012]

[0023] Figure 1 is a schematic diagram showing the mechanism of spontaneous luminescence by the lux operon. Figure 2 is a diagram showing the three-dimensional structure of an example of the photoprotein of the present invention. Figure 3 is an alignment of the amino acid sequences of LuxA from Photorhabdus luminescens (SEQ ID NO: 1) and Photobacterium leiognathi (SEQ ID NO: 9). Figure 4 is an alignment of the amino acid sequences of LuxB from Photorhabdus luminescens (SEQ ID NO: 2) and Photobacterium leiognathi (SEQ ID NO: 10). Figure 5 is a schematic diagram showing the structures of fusions of the LuxA subunit constituting the photoprotein of the present invention with various fluorescent proteins (cyan fluorescent protein, green fluorescent protein, yellow fluorescent protein, orange fluorescent protein, and red fluorescent protein). This figure shows photographs of Escherichia coli cultures containing photoproteins (CNLX, GNLX, YNLX, ONLX, and RNLX) expressed by co-expression of LuxBCDE with fusion proteins of various fluorescent proteins and LuxA. The labels "blue-cyan," "cyan," "blue-green-green," "green," "yellow," and "red" at the bottom of the figure indicate the color of each culture as determined visually. This figure shows graphs illustrating the emission spectra of a Lux photoprotein (control) and photoproteins fused with fluorescent proteins (CNLX, GNLX, YNLX, ONLX, and RNLX). The vertical axis indicates the relative emission intensity when the emission intensity at the maximum wavelength of each photoprotein is set to 1. This figure shows the emission intensity of various photoproteins (CNLX, GNLX, YNLX, ONLX, and RNLX) (n=3). The vertical axis indicates the relative emission intensity when the emission intensity of the control is set to 1. In the figure, error bars indicate standard errors.

[0013] 1. Definitions and Structure As used herein, the term "photoprotein" refers to a protein that induces a luminescent reaction in a specific substrate through an enzymatic reaction, and is also referred to as a "chemiluminescent protein." As used herein, the term "cyan nano-lantern based on Lux (CNLX)" refers to a protein that emits light with a maximum wavelength of 450 to 500 nm (450 nm or more and less than 500 nm, the same applies below). As used herein, the term "green nano-lantern based on Lux (GNLX)" refers to a protein that emits light with a maximum wavelength of 500 to 520 nm. As used herein, the term "yellow nano-lantern based on Lux (YNLX)" refers to a protein that emits light with a maximum wavelength of 520 to 550 nm. As used herein, "orange nano-lantern based on Lux (ONLX)" refers to a protein that emits light with a maximum wavelength of 550 to 580 nm. As used herein, "red nano-lantern based on Lux (RNLX)" refers to a protein that emits light with a maximum wavelength of 580 to 620 nm.

[0014] As used herein, the term "fluorescent protein" refers to a fluorescent protein that emits fluorescence when irradiated with excitation light having a specific wavelength. The fluorescent protein used herein is selected from cyan fluorescent protein, green fluorescent protein, yellow fluorescent protein, orange fluorescent protein, and red fluorescent protein. As used herein, the term "cyan fluorescent protein" refers to a fluorescent protein with a maximum fluorescence wavelength of 450 to 500 nm. The cyan fluorescent protein is not particularly limited as long as it emits fluorescence in this range, but examples of suitable cyan fluorescent proteins include mTurquoise 2 (excitation wavelength: 434 nm, maximum fluorescence wavelength: 474 nm). As used herein, the term "green fluorescent protein" refers to a fluorescent protein with a maximum fluorescence wavelength of 500 to 520 nm. As long as it emits fluorescence in this range, it is not particularly limited, but examples of suitable cyan fluorescent proteins include sfGFP (maximum fluorescence wavelength: 510 nm) and Gamillux (excitation wavelength: 504 nm, maximum fluorescence wavelength: 519 nm). As used herein, the term "yellow fluorescent protein" refers to a fluorescent protein having a maximum fluorescence wavelength of 520 to 550 nm. The yellow fluorescent protein is not particularly limited as long as it emits fluorescence in this range, and examples of such proteins include Venus (excitation wavelength 515 nm, maximum fluorescence wavelength 528 nm). As used herein, the term "orange fluorescent protein" refers to a fluorescent protein having a maximum fluorescence wavelength of 550 to 580 nm. The orange fluorescent protein is not particularly limited as long as it emits fluorescence in this range, and examples of such proteins include mKOκ (excitation wavelength 551 nm, maximum fluorescence wavelength 563 nm). As used herein, the term "red fluorescent protein" refers to a fluorescent protein having a maximum fluorescence wavelength of 580 to 620 nm. The red fluorescent protein is not particularly limited as long as it emits fluorescence in this range, and examples of such proteins include mScarlet-I (excitation wavelength 569 nm, maximum fluorescence wavelength 594 nm).

[0015] As used herein, "bacterial luciferase" refers to luciferase expressed by luminescent bacteria. More specifically, "bacterial luciferase" refers to an enzyme containing a complex of two subunits, a LuxA subunit and a LuxB subunit. "Luminescent bacteria" as used herein refers to bacteria that have the property of chemiluminescence, and more specifically, bacteria that have a lux operon in their genome. Known luminescent bacteria include Photorhabdus luminescens, Photobacterium leiognathi, Photobacterium phosphoreum, and Vibrio fischeri, all of which are encompassed by the term "luminescent bacteria" in this specification.

[0016] As used herein, the term "nucleic acid" refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), and unless otherwise specified herein, it refers to DNA.

[0017] As used herein, the term "lux operon" refers to a group of genes involved in the spontaneous luminescence of luminous bacteria, specifically an operon with the structure luxC-luxD-luxA-luxB-luxE. Furthermore, luxE may be followed by luxG. Figure 1 shows the relationship between the lux operon of luminous bacteria and the mechanism of spontaneous luminescence. luxD encodes an enzyme that reduces intracellular fatty acyl-acyl carrier protein (ACP) to produce fatty acids. luxE encodes an enzyme that produces an acyl-enzyme intermediate from fatty acids. luxC encodes an enzyme that synthesizes fatty aldehydes, which serve as substrates for luciferase, from the acyl-enzyme intermediate. luxA and luxB encode two subunits of luciferase, the LuxA subunit and the LuxB subunit, respectively. Luciferase is a catalyzed reaction of fatty aldehydes and reduced flavin mononucleotide (FMNH). ２ ) to produce fatty acids and FMN, emitting light in the process. luxG encodes the enzyme that reduces FMN. As mentioned above, the lux operon oxidizes and recycles the luminescent substrate, thereby enabling spontaneous light emission within the cell.

[0018] As used herein, "sequence identity" refers to the percentage of identical amino acids or bases in the entire overlapping amino acid sequence (including the amino acid that serves as the translation start point) or base sequence (including the start codon) in the optimal alignment when two amino acid sequences or base sequences are aligned with or without gaps, and is calculated using formula (1). Sequence identity can be easily determined using BLAST (Basic Local Alignment Search Tool), an algorithm commonly used in this field. For example, BLAST is available to anyone from websites such as NCBI (National Center for Biotechnology Information) and KEGG (Kyoto Encyclopedia of Genes and Genomes), and sequence identity can be easily determined using default parameters. Sequence identity (%) = number of matches (gap ignoring) / length of shorter sequence (length excluding gaps) × 100 Formula (1)

[0019] 2. Luminescent Protein A first embodiment of the present invention is a luminescent protein. The luminescent protein of this embodiment is characterized in that it comprises a complex of bacterial luciferase and a fluorescent protein, the bacterial luciferase having a LuxA subunit and a LuxB subunit, and the fluorescent protein fused to the LuxA subunit. More specifically, the photoprotein of this embodiment is one in which: the LuxA subunit is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 1 or a polypeptide consisting of an amino acid sequence having 90% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 1; the LuxB subunit is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or a polypeptide consisting of an amino acid sequence having 90% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 2; the fluorescent protein is selected from cyan fluorescent protein, green fluorescent protein, yellow fluorescent protein, orange fluorescent protein, and red fluorescent protein; the cyan fluorescent protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 3, or a polypeptide having 97% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 3 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 450 to 500 nm, or a circular permutation of any of these polypeptides; the green fluorescent protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 4, or a polypeptide having 97% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 4 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 500 to 520 nm, or a circular permutation of any of these polypeptides; the yellow fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 5, and when fused with the LuxA subunit, the structure is such that the amino acid sequence from positions 1 to 229 of SEQ ID NO: 5 and the amino acid sequence from positions 2 to 359 of SEQ ID NO: 1 are linked with two amino acids of EL interposed therebetween;the orange fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 6, and when fused with the LuxA subunit, the amino acid sequence from positions 1 to 218 of SEQ ID NO: 6 is linked to the amino acid sequence from positions 2 to 359 of SEQ ID NO: 1, with two amino acids of EL sandwiched between them; or the red fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 7, or a polypeptide that has 97% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 7 and has the function of emitting fluorescence with a maximum fluorescence wavelength of 580 to 620 nm, or a circular permutation product of any of these polypeptides;

[0020] FIG. 2 shows a three-dimensional structure of an example of the photoprotein of the present invention. The photoprotein of this embodiment includes a complex of a LuxA subunit fused to a fluorescent protein and a LuxB subunit. The complex of the LuxA subunit and the LuxB subunit has the function of bacterial luciferase, i.e., the function of oxidizing a substrate (luciferin) and generating luminescence in the process. Although bacterial luciferase alone generates luminescence, the present inventors have found that fusing a fluorescent protein to the LuxA subunit of bacterial luciferase results in even stronger luminescence. This is thought to be due to BRET occurring in the fluorescent protein in response to light generated by the action of luciferase. Furthermore, the present inventors have found that BRET similarly occurs even when the fluorescent protein fused to the LuxA subunit is changed to a fluorescent protein with a different fluorescent wavelength range. In other words, the photoprotein of this embodiment is capable of generating light over a wide wavelength range.

[0021] In this embodiment, the LuxA subunit is preferably a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 1, or a polypeptide consisting of an amino acid sequence having 50% or more, particularly 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more, sequence identity to the amino acid sequence represented by SEQ ID NO: 1. The amino acid sequence represented by SEQ ID NO: 1 is identical to the amino acid sequence of the LuxA subunit of Photorhabdus luminescens. A polypeptide consisting of an amino acid sequence having 50% or more (particularly 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more) sequence identity to the amino acid sequence represented by SEQ ID NO: 1 is preferably a polypeptide that functions as a LuxA subunit, i.e., a polypeptide that functions as a luciferase by forming a complex with the LuxB subunit.

[0022] 3 shows an alignment of the amino acid sequences of the LuxA subunit of Photorhabdus luminescens (SEQ ID NO: 1) and the LuxA subunit of Photobacterium leiognathi (SEQ ID NO: 9). The sequence homology between the two sequences is 62.7%.

[0023] In this embodiment, the LuxB subunit is preferably a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 2, or a polypeptide consisting of an amino acid sequence having 50% or more, particularly 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more, sequence identity to the amino acid sequence represented by SEQ ID NO: 2. The amino acid sequence represented by SEQ ID NO: 2 is identical to the amino acid sequence of the LuxB subunit of Photorhabdus luminescens. A polypeptide consisting of an amino acid sequence having 50% or more (particularly 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more) sequence identity to the amino acid sequence represented by SEQ ID NO: 2 is preferably a polypeptide that functions as a LuxB subunit, i.e., functions as a luciferase by forming a complex with the LuxA subunit.

[0024] 4 shows an alignment of the amino acid sequences of the LuxB subunit of Photorhabdus luminescens (SEQ ID NO: 2) and the LuxB subunit of Photobacterium leiognathi (SEQ ID NO: 10). The sequence homology between the two sequences is 51.7%.

[0025] In this embodiment, the fluorescent protein fused to LuxA is preferably any one of cyan fluorescent proteins selected from cyan fluorescent protein, green fluorescent protein, yellow fluorescent protein, orange fluorescent protein, and red fluorescent protein. The cyan fluorescent protein is not particularly limited as long as it is a protein that emits fluorescence with a maximum fluorescence wavelength of 450 to 500 nm, but may be, for example, a polypeptide (mTurquoise2ΔC10) consisting of the amino acid sequence set forth in SEQ ID NO: 3, or a polypeptide that has 60% or more, particularly 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity to the amino acid sequence set forth in SEQ ID NO: 3 and has the function of emitting fluorescence with a maximum fluorescence wavelength of 450 to 500 nm, or a circular permutation product of any of these polypeptides. The green fluorescent protein is not particularly limited as long as it is a protein that emits fluorescence with a maximum fluorescence wavelength of 500 to 520 nm, but can be, for example, a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 4 (sfGFPΔC10), or a polypeptide that has 60% or more, particularly 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 4 and has the function of emitting fluorescence with a maximum fluorescence wavelength of 500 to 520 nm, or a circularly permuted form of any of these polypeptides. The yellow fluorescent protein is not particularly limited as long as it is a protein that emits fluorescence with a maximum fluorescence wavelength of 520 to 550 nm, but can be, for example, a polypeptide (VenusΔC10) consisting of the amino acid sequence represented by SEQ ID NO: 5, or a polypeptide that has 60% or more, particularly 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity to the amino acid sequence represented by SEQ ID NO: 5 and has the function of emitting fluorescence with a maximum fluorescence wavelength of 520 to 550 nm, or a circular permutation product of any of these polypeptides.The orange fluorescent protein is not particularly limited as long as it is a protein that emits fluorescence with a maximum fluorescence wavelength of 550 to 580 nm, but can be, for example, a polypeptide (mKOκ) consisting of the amino acid sequence represented by SEQ ID NO: 6, or a polypeptide that has 60% or more, particularly 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity to the amino acid sequence represented by SEQ ID NO: 6 and has the function of emitting fluorescence with a maximum fluorescence wavelength of 550 to 580 nm, or a circularly permuted form of any of these polypeptides. The red fluorescent protein is not particularly limited as long as it is a protein that emits fluorescence with a maximum fluorescence wavelength of 580 to 620 nm, but can be, for example, a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 7 (mScarlet-IΔC10), or a polypeptide that has 60% or more, particularly 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity to the amino acid sequence represented by SEQ ID NO: 7 and has the function of emitting fluorescence with a maximum fluorescence wavelength of 580 to 620 nm, or a circular permutation of any of these polypeptides. As used herein, "ΔC10" refers to a deletion of 10 amino acids from the C-terminus of the known amino acid sequence.

[0026] A fusion product of LuxA with cyan fluorescent protein, green fluorescent protein, yellow fluorescent protein, orange fluorescent protein, or red fluorescent protein forms a complex with LuxB to form cyan fluorescent protein (CNLX), green fluorescent protein (GNLX), yellow fluorescent protein (YNLX), orange fluorescent protein (ONLX), or red fluorescent protein (RNLX), respectively.

[0027] 3. Nucleic Acid A second embodiment of the present invention is a nucleic acid for expressing a photoprotein. The nucleic acid of this embodiment is characterized by comprising a base sequence encoding a fusion product of the LuxA subunit of bacterial luciferase and a fluorescent protein.More specifically, the nucleic acid of this embodiment is one in which: the LuxA subunit is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 1 or a polypeptide consisting of an amino acid sequence having 90% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 1; the fluorescent protein is selected from cyan fluorescent protein, green fluorescent protein, yellow fluorescent protein, orange fluorescent protein, and red fluorescent protein; the cyan fluorescent protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 3 or a polypeptide having 97% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 3 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 450 to 500 nm, or a circular permutation of any of these polypeptides; the green fluorescent protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 4 or a polypeptide having 97% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 4 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 500 to 520 nm, or a circular permutation of any of these polypeptides; the yellow fluorescent protein is a polypeptide consisting of the amino acid sequence of SEQ ID NO: 5, and when fused with the LuxA subunit, the amino acid sequence of positions 1 to 229 of SEQ ID NO: 5 is linked to the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1, with two amino acids of EL sandwiched between them; the orange fluorescent protein is a polypeptide consisting of the amino acid sequence of SEQ ID NO: 6, and when fused with the LuxA subunit, the amino acid sequence of positions 1 to 218 of SEQ ID NO: 6 is linked to the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1, with two amino acids of EL sandwiched between them; or the red fluorescent protein is a polypeptide consisting of the amino acid sequence of SEQ ID NO: 7, or a polypeptide that has 97% or more sequence identity with the amino acid sequence of SEQ ID NO: 7 and has the function of emitting fluorescence with a maximum fluorescence wavelength of 580 to 620 nm, or a circular permutation of any of these polypeptides.

[0028] The nucleic acid of this embodiment preferably contains a base sequence encoding the LuxB subunit of bacterial luciferase, either in the same nucleic acid molecule or as a separate nucleic acid molecule. The nucleic acid of this embodiment is used to co-express a fusion product of the LuxA subunit and a fluorescent protein and the LuxB subunit in a single cell, thereby enabling the expression of the luminescent protein described in the first embodiment in the cell.

[0029] The nucleotide sequence of the gene encoding LuxA may be optimized to suit the host into which it is to be incorporated. For example, when incorporated into Escherichia coli, the gene (luxA) encoding LuxA having the amino acid sequence represented by SEQ ID NO: 1 may have the nucleotide sequence represented by SEQ ID NO: 11. Furthermore, the gene (luxA) encoding LuxA having the amino acid sequence represented by SEQ ID NO: 9 may have the nucleotide sequence represented by SEQ ID NO: 19. In this case, the gene having the nucleotide sequence represented by SEQ ID NO: 19 corresponds to an ortholog of the gene having the nucleotide sequence represented by SEQ ID NO: 11. That is, in the method of the present invention, LuxA may be a protein encoded by an ortholog of the gene encoding the LuxA subunit of Photorhabdus luminescens.

[0030] The nucleotide sequence of the gene encoding LuxB may be optimized to suit the host into which it is to be incorporated. For example, when incorporated into Escherichia coli, the gene (luxB) encoding LuxB having the amino acid sequence represented by SEQ ID NO: 2 may have the nucleotide sequence represented by SEQ ID NO: 12. Furthermore, the gene (luxB) encoding LuxB having the amino acid sequence represented by SEQ ID NO: 10 may have the nucleotide sequence represented by SEQ ID NO: 20. In this case, the gene having the nucleotide sequence represented by SEQ ID NO: 20 corresponds to an ortholog of the gene having the nucleotide sequence represented by SEQ ID NO: 12. That is, in the method of the present invention, LuxB may be a protein encoded by an ortholog of the gene encoding the LuxB subunit of Photorhabdus luminescens.

[0031] The nucleotide sequence of a gene encoding a fluorescent protein (fluorescent protein gene) may be optimized to suit the host into which it is to be introduced. For example, when introduced into Escherichia coli, a gene encoding a cyan fluorescent protein having the amino acid sequence represented by SEQ ID NO: 3 may have the nucleotide sequence represented by SEQ ID NO: 13. A gene encoding a green fluorescent protein having the amino acid sequence represented by SEQ ID NO: 4 may have the nucleotide sequence represented by SEQ ID NO: 14. A gene encoding a yellow fluorescent protein having the amino acid sequence represented by SEQ ID NO: 5 may have the nucleotide sequence represented by SEQ ID NO: 15. A gene encoding an orange fluorescent protein having the amino acid sequence represented by SEQ ID NO: 6 may have the nucleotide sequence represented by SEQ ID NO: 16. A gene encoding a red fluorescent protein having the amino acid sequence represented by SEQ ID NO: 7 may have the nucleotide sequence represented by SEQ ID NO: 17.

[0032] The fluorescent protein gene and luxA may be linked in any manner as long as they are expressed as a fusion protein. However, they are preferably linked in the order of fluorescent protein gene-luxA from the 5' end (upstream). A sequence encoding a linker or the like may be provided at the linking site between the two genes, as long as it does not interfere with expression as a fusion protein. LuxB may also be linked to the 3' end (downstream) of luxA. In this case, a ribosome binding sequence (e.g., CTAAGGAGAAAGAA (SEQ ID NO: 8)) is preferably provided between luxA and luxB to allow each of luxA and luxB to express its own subunit.

[0033] Furthermore, luxC, luxD, luxE and / or luxG may be included within the same nucleic acid molecule or as separate nucleic acid molecules, if necessary.

[0034] 4. Expression Vector The third embodiment of the present invention is a vector for expressing a photoprotein. The expression vector of this embodiment is characterized in that it contains the nucleic acid of the second embodiment.

[0035] The type of expression vector is not particularly limited as long as it is suitable for the host cell into which it is to be introduced, and can be selected appropriately. For example, a plasmid, a phage, etc. can be used. The expression vector can be particularly suitable for introduction into bacteria, fungal cells, plant cells, or animal cells. As the expression vector, commercially available vectors can be used as appropriate. For example, when Escherichia coli is used as the host, pRSET Ｂ (Thermo Fisher Scientific), pBAD (Thermo Fisher Scientific), pCold (Takara Bio Inc.), etc. can be suitably used.

[0036] The expression vector contains at least a nucleotide sequence encoding a fusion of the LuxA subunit and a fluorescent protein. It may also contain a nucleotide sequence encoding the LuxB subunit. If necessary, it may also contain luxC, luxD, luxE, and / or luxG. Alternatively, these genes may be incorporated separately into two or more expression vectors and then introduced simultaneously into the same cell.

[0037] 5. Cells A fourth embodiment of the present invention is a cell incorporating a gene for expressing a photoprotein. The cell of this embodiment is characterized in that a nucleic acid having a base sequence encoding a fusion of LuxA, a bacterial luciferase, and a fluorescent protein, and a nucleic acid having a base sequence encoding LuxB, have been introduced into the cell.More specifically, the cell of this embodiment is characterized in that: the LuxA subunit is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 1 or a polypeptide consisting of an amino acid sequence having 90% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 1; the LuxB subunit is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or a polypeptide consisting of an amino acid sequence having 90% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 2; the fluorescent protein is selected from cyan fluorescent protein, green fluorescent protein, yellow fluorescent protein, orange fluorescent protein, and red fluorescent protein; the cyan fluorescent protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 3, or a polypeptide having 97% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 3 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 450 to 500 nm, or a circular permutation of any of these polypeptides; the green fluorescent protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 4, or a polypeptide having 97% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 4 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 500 to 520 nm, or a circular permutation of any of these polypeptides; the yellow fluorescent protein is a polypeptide consisting of the amino acid sequence of SEQ ID NO: 5, and when fused with the LuxA subunit, the amino acid sequence of positions 1 to 229 of SEQ ID NO: 5 is linked to the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1, with two amino acids of EL sandwiched between them; the orange fluorescent protein is a polypeptide consisting of the amino acid sequence of SEQ ID NO: 6, and when fused with the LuxA subunit, the amino acid sequence of positions 1 to 218 of SEQ ID NO: 6 is linked to the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1, with two amino acids of EL sandwiched between them; or the red fluorescent protein is a polypeptide consisting of the amino acid sequence of SEQ ID NO: 7, or a polypeptide that has 97% or more sequence identity with the amino acid sequence of SEQ ID NO: 7 and has the function of emitting fluorescence with a maximum fluorescence wavelength of 580 to 620 nm, or a circular permutation of any of these polypeptides.

[0038] The type of cell is not particularly limited, but is sometimes preferably a bacterial, fungal, plant, or animal cell. Since the photoprotein of the present invention can be used, for example, as a marker for monitoring cellular behavior, it is preferable to appropriately select the host cell into which the gene is to be introduced depending on the purpose.

[0039] The cell of this embodiment is prepared by, for example, introducing the expression vector of the third embodiment into a target cell. The expression vector contains at least the fluorescent protein gene, luxA, and, if necessary, luxB may also be contained in the same vector. Alternatively, luxB may be contained in a separate vector and introduced into the same cell together with the vector containing luxA. Furthermore, if necessary, luxC, luxD, luxE, and / or luxG may each be contained in the above vector or a separate vector and introduced into the same cell together with at least the fluorescent protein, luxA, and luxB.

[0040] The cell of this embodiment contains at least the fluorescent protein genes luxA and luxB, and optionally luxC, luxD, luxE, and / or luxG. By introducing the above genes into the cell of this embodiment, the cell can emit light when a substrate is added or can emit light spontaneously.

[0041] 6. Method for Producing a Photoprotein A sixth embodiment of the present invention is a method for producing a photoprotein. The method of this embodiment is characterized by comprising expressing a nucleic acid having a base sequence encoding a fusion of LuxA of bacterial luciferase with a fluorescent protein, and a nucleic acid having a base sequence encoding LuxB.More specifically, in the method of this embodiment, the LuxA subunit is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 1 or a polypeptide consisting of an amino acid sequence having 90% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 1; the LuxB subunit is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or a polypeptide consisting of an amino acid sequence having 90% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 2; the fluorescent protein is selected from cyan fluorescent protein, green fluorescent protein, yellow fluorescent protein, orange fluorescent protein, and red fluorescent protein, and the cyan fluorescent protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 3, or a polypeptide having 97% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 3 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 450 to 500 nm, or a circular permutation of any of these polypeptides; the green fluorescent protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 4, or a polypeptide having 97% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 4 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 500 to 520 nm, or a circular permutation of any of these polypeptides; the yellow fluorescent protein is a polypeptide consisting of the amino acid sequence of SEQ ID NO: 5, and when fused with the LuxA subunit, the amino acid sequence of positions 1 to 229 of SEQ ID NO: 5 is linked to the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1, with two amino acids of EL sandwiched between them; the orange fluorescent protein is a polypeptide consisting of the amino acid sequence of SEQ ID NO: 6, and when fused with the LuxA subunit, the amino acid sequence of positions 1 to 218 of SEQ ID NO: 6 is linked to the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1, with two amino acids of EL sandwiched between them; or the red fluorescent protein is a polypeptide consisting of the amino acid sequence of SEQ ID NO: 7, or a polypeptide that has 97% or more sequence identity with the amino acid sequence of SEQ ID NO: 7 and has the function of emitting fluorescence with a maximum fluorescence wavelength of 580 to 620 nm, or a circular permutation product of any of these polypeptides.

[0042] The method of this embodiment may include a step of preparing an expression vector containing a nucleic acid having a nucleotide sequence encoding a fusion of bacterial luciferase LuxA and a fluorescent protein, and a nucleic acid having a nucleotide sequence encoding LuxB. Alternatively, the method of this embodiment may include a step of separately preparing an expression vector containing a nucleic acid having a nucleotide sequence encoding a fusion of bacterial luciferase LuxA and a fluorescent protein, and an expression vector containing a nucleic acid having a nucleotide sequence encoding LuxB. Furthermore, the method of this embodiment may include a step of preparing one or more expression vectors containing luxC, luxD, luxE, and / or luxG.

[0043] The method of this embodiment may include a step of introducing the expression vector prepared above into cells. The cells used here are not particularly limited and may be, for example, bacteria, fungal cells, plant cells, or animal cells. Furthermore, the method of this embodiment may include a step of culturing the cells into which the expression vector has been introduced. This step produces a photoprotein within the cells, and luminescence is observed within the cells due to the supply of a luminescent substrate (luciferin) into the cells or the production of the luminescent substrate within the cells. Alternatively, a photoprotein that emits light in the presence of a luminescent substrate can be obtained from the cultured cells through cell collection, cell disruption, and protein purification.

[0044] EXAMPLES Hereinafter, examples are presented to explain the present invention in detail, but are not intended to limit the scope of the examples.

[0045] Example 1: Preparation of self-luminescent Escherichia coli (1) Preparation of luxAB insertion vector The Lux gene was cloned from the plasmid pAKlux1 (plasmid #14073, Addgene) incorporating luxCDABE from Photorhabdus luminescens. Using pAKlux1 as a template, luxAB was amplified using the following primer set (SEQ ID NOs: 21 and 22) such that the ribosome binding sequence CTAAGGAGAAAGAA (SEQ ID NO: 8) was inserted between luxA and luxB. Forward primer (BamHI-G-luxA) CACCGGATCCGATGAAATTTGGAAACTTTTTG (SEQ ID NO: 21) Reverse primer (EcoRI-LuxB) CACCGAATTCTTAGGTATATTCCATGTGGTAC (SEQ ID NO: 22) To enable bicistronic expression of the luxAB operon in E. coli, the PCR-amplified luxAB fragment was digested with BamHI and EcoRI, and the fragment was inserted into pRSET. Ｂ (Thermo Fisher Scientific) to obtain pRSETB-luxAB.

[0046] (2) Preparation of Various Photoprotein Expression Vectors To biosynthesize the photoproteins CNLX, GNLX, YNLX, ONLX, and RNLX, photoprotein expression vectors were prepared using the genes for the fluorescent proteins mTurquoise2, sfGFP, Venus, mKOκ, and mScarlet-I. However, mTurquoise2, sfGFP, Venus, and mScarlet-I were genes encoding an amino acid sequence (ΔC10) in which 10 amino acids were deleted from the C-terminus of the known amino acid sequence. The amino acid sequences of Turquoise2ΔC10, sfGFPΔC10, VenusΔC10, mKOκ, and mScarlet-IΔC10 are shown as SEQ ID NOs: 3, 4, 5, 6, and 7, respectively. The DNAs encoding these genes are shown as SEQ ID NOs: 13, 14, 15, 16, and 17, respectively. Each gene was amplified using gene-specific primers and PCR amplification reagents (KOD-Plus-Neo, manufactured by Toyobo Co., Ltd.). The amplified DNA was transformed into pRSET using the TEDA method (see Xia, Y., et al., Nucleic Acids Research, 47(3), e15 (2019)). Ｂ The vector was inserted upstream of luxA in mTurquoise2ΔC10-luxAB. Cloning was performed using the E. coli strain XL10-GOLD, and the gene sequence was confirmed to obtain various photoprotein expression vectors (pCNLX (mTurquoise2ΔC10:luxA+luxB), pGNLX (sfGFPΔC10:luxA+luxB), pYNLX (VenusΔC10:luxA+luxB, pONLX (mKOκ:luxA+luxB), and pRNLX (mScarlet-IΔC10:luxA+luxB)).

[0047] FIG. 5 shows a schematic diagram of the structures of fusion proteins constituting various photoproteins (CNLX, GNLX, YNLX, ONLX, and RNLX). CNLX has a structure in which the amino acid sequence of positions 1 to 229 of SEQ ID NO: 3 is linked to the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1, with two amino acids of EL (glutamic acid-leucine) sandwiched between them. GNLX has a structure in which the amino acid sequence of positions 1 to 229 of SEQ ID NO: 4 is linked to the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1, with two amino acids of EL sandwiched between them. YNLX has a structure in which the amino acid sequence of positions 1 to 229 of SEQ ID NO: 5 is linked to the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1, with two amino acids of EL sandwiched between them. ONLX has a structure in which the amino acid sequence of positions 1 to 218 of SEQ ID NO: 6 is linked to the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1, with two amino acids of EL sandwiched between them. RNLX has a structure in which the amino acid sequence of positions 1 to 222 of SEQ ID NO: 7 and the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1 are linked with two amino acids of EL sandwiched between them.

[0048] (3) Preparation of luxCDE Vector The genes for LuxC (amino acid sequence SEQ ID NO: 23 / nucleotide sequence SEQ ID NO: 26), LuxD (amino acid sequence SEQ ID NO: 24 / nucleotide sequence SEQ ID NO: 27), and LuxE (amino acid sequence SEQ ID NO: 25 / nucleotide sequence SEQ ID NO: 28) were cloned from the plasmid pAKlux1. LuxCDE was amplified by PCR using the following primer sets (SEQ ID NOs: 30 and 31), with the ribosome binding sequences TAGGTAAAGT (SEQ ID NO: 18) and AATCTATTGAGATATTCTATCACTCAAATAGCAATATAAGGACTCTCT (SEQ ID NO: 29) inserted between luxC and luxD and between luxD and luxE, respectively. Forward primer (Fwd-BamHI-luxC) TAGGATCCATGACTAAAAAAATTTCATTCATTATTAACG (SEQ ID NO: 30) Reverse primer (Rev-EcoRI-luxE) CACCGAATTCAACTATCAAACGCTTCG (SEQ ID NO: 31) The PCR-amplified luxC-luxD-luxE fragment was digested with BamHI and EcoRI, and the fragment was inserted into pRSET. Ｂ(Thermo Fisher Scientific) to obtain the luxCDE vector.

[0049] (4) Preparation and cultivation of E. coli expressing luminescent proteins The luminescent protein expression vectors prepared in (2) and the luxCDE vector were combined to transform the E. coli strain JM109 (DE3) to construct a co-expression system of luminescent proteins and LuxCDE. As a control, pRSET vector without a fluorescent protein gene was used. Ｂ E. coli was transformed in the same manner using the luxAB and luxCDE vectors. The transformed E. coli was cultured in 200 mL of LB liquid medium containing 100 μg / mL carbenicillin at 23°C and 130 rpm for 60 hours with shaking. After culturing, 150 μL of each culture was dispensed into PCR PP tubes and photographed under light-blocking conditions using a digital single-lens camera (Sony α7S) with an exposure time of 8 seconds. The photographs are shown in Figure 6. It was confirmed that the luminescence intensity of all fluorescent protein-LuxA fusion proteins was higher than that of Lux alone (control). Furthermore, it was shown that changing the type of fluorescent protein combined resulted in high luminescence intensity over a wide wavelength range.

[0050] Example 2: Preparation of photoproteins (1) Preparation and extraction of photoproteins E. coli strain JM109 (DE3) was transformed with each of the photoprotein expression vectors prepared in Example 1 (2) and cultured in LB liquid medium at 23°C for 60 hours with shaking. E. coli was recovered from the culture medium and cytoplasmic proteins were extracted using a French press. The target proteins were isolated using a Ni-NTA agarose column (manufactured by QIAGEN) and dissolved in 20 mM HEPES buffer (pH 7.4) to obtain various photoproteins (CNLX, GNLX, YNLX, ONLX, and RNLX). As a control, pRSET containing no fluorescent protein gene was used. Ｂ Similarly, an Escherichia coli strain was transformed with -luxAB, and cultured, followed by protein extraction to obtain a photoprotein (LuxA+LuxB) solution.

[0051] (2) Extracellular Luminescence Test Each photoprotein was added to a final concentration of 0.8 μM in 20 mM HEPES buffer (pH 7.4, 37°C) containing 10 μM FMN, 40 μM decanal, and 200 μM 1-benzyl-1,4-dihydronicotinamide (BNAH). Immediately after addition, the emission spectrum of each photoprotein solution was measured using a PMA-12 multichannel spectrometer (Hamamatsu Photonics) with an exposure time of 30 seconds. Simultaneously, 100 μL of each solution was dispensed into a 96-well microwell plate (n=3), and luminescence across all wavelengths was measured using a microplate reader (Corona Multigrating Microplate Reader SH-9000Lab, Hitachi High-Tech). Figure 7 shows the emission spectrum of each photoprotein. The vertical axis of the graph indicates the relative emission intensity, with the emission intensity at the maximum wavelength of each photoprotein set to 1. Figure 8 shows the emission intensity of each photoprotein. Error bars in the figures indicate standard errors. As shown in Figure 7, it was found that changing the type of fluorescent protein combined with LuxA enables emission over a wide wavelength range. Furthermore, as shown in Figure 8, it was found that LuxA fused to any fluorescent protein exhibited significantly higher luminescence intensity compared to Lux alone (control). The present invention encompasses the following embodiments. [1] A photoprotein comprising a complex of bacterial luciferase and a fluorescent protein, wherein the bacterial luciferase has a LuxA subunit and a LuxB subunit, and the fluorescent protein is fused to the LuxA subunit. [2] The photoprotein according to [1], wherein the LuxA subunit is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 1 or a polypeptide consisting of an amino acid sequence having 50% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 1. [3] The photoprotein according to [1] or [2], wherein the LuxB subunit is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 2 or a polypeptide consisting of an amino acid sequence having 50% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 2.[4] The photoprotein according to any one of [1] to [3], wherein the fluorescent protein is selected from cyan fluorescent protein, green fluorescent protein, yellow fluorescent protein, orange fluorescent protein, and red fluorescent protein. [5] The cyan fluorescent protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 3, or a polypeptide having 60% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 3 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 450 to 500 nm, or a circular permutation of any of these polypeptides; the green fluorescent protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 4, or a polypeptide having 60% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 4 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 500 to 520 nm, or a circular permutation of any of these polypeptides; the yellow fluorescent protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 5, or a polypeptide having 60% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 5, and The photoprotein according to [4], wherein the orange fluorescent protein is a polypeptide having the function of emitting fluorescence with a maximum fluorescence wavelength of 520 to 550 nm, or a circular permutation of any of these polypeptides; the orange fluorescent protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 6, or a polypeptide having 60% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 6 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 550 to 580 nm, or a circular permutation of any of these polypeptides; or the red fluorescent protein is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 7, or a polypeptide having 60% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 7 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 580 to 620 nm, or a circular permutation of any of these polypeptides. [6] A nucleic acid comprising a nucleotide sequence encoding a fusion of LuxA of bacterial luciferase and a fluorescent protein. [7] The nucleic acid according to [6], further comprising a nucleotide sequence encoding LuxB of bacterial luciferase. [8] An expression vector incorporating the nucleic acid according to [6] or [7].[9] A cell into which a nucleic acid having a nucleotide sequence encoding a fusion of bacterial luciferase LuxA and a fluorescent protein, and a nucleic acid having a nucleotide sequence encoding LuxB have been introduced.

[10] The cell according to [9], which is a bacterium, a fungal cell, a plant cell, or an animal cell.

[11] A method for producing a photoprotein, which comprises expressing a nucleic acid having a nucleotide sequence encoding a fusion of bacterial luciferase LuxA and a fluorescent protein, and a nucleic acid having a nucleotide sequence encoding LuxB. All publications, patents, and patent applications cited in this specification are incorporated herein by reference in their entirety.

Claims

1. A luminescent protein comprising a complex of bacterial luciferase and a fluorescent protein, the bacterial luciferase having a LuxA subunit and a LuxB subunit, and the fluorescent protein fused to the LuxA subunit; the LuxA subunit is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO:1 or a polypeptide consisting of an amino acid sequence having 90% or more sequence identity with the amino acid sequence represented by SEQ ID NO:1; the LuxB subunit is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO:2 or a polypeptide consisting of an amino acid sequence having 90% or more sequence identity with the amino acid sequence represented by SEQ ID NO:2; the fluorescent protein is selected from cyan fluorescent protein, green fluorescent protein, yellow fluorescent protein, orange fluorescent protein and red fluorescent protein; the cyan fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO:3 or a polypeptide having 97% or more sequence identity with the amino acid sequence represented by SEQ ID NO:3 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 450 to 500 nm, or a circular permutation of any of these polypeptides; the green fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 4, or a polypeptide having 97% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 4 and having the function of emitting fluorescence at a maximum fluorescence wavelength of 500 to 520 nm, or a circular permutation of any of these polypeptides; the yellow fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 5, and when fused with the LuxA subunit, a structure is formed in which the amino acid sequence of positions 1 to 229 of SEQ ID NO: 5 and the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1 are linked with two amino acids of EL sandwiched therebetween; the orange fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 6, and when fused with the LuxA subunit, a structure is formed in which the amino acid sequence of positions 1 to 218 of SEQ ID NO: 6 and the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1 are linked with two amino acids of EL sandwiched therebetween;or a photoprotein, wherein the red fluorescent protein is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 7, or a polypeptide having 97% or more sequence identity with the amino acid sequence shown in SEQ ID NO: 7 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 580 to 620 nm, or a circular permutation product of any of these polypeptides; 2. A nucleic acid comprising a base sequence encoding a fusion of a LuxA subunit of bacterial luciferase and a fluorescent protein; the LuxA subunit is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 1 or a polypeptide consisting of an amino acid sequence having 90% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 1; the fluorescent protein is selected from cyan fluorescent protein, green fluorescent protein, yellow fluorescent protein, orange fluorescent protein and red fluorescent protein; the cyan fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 3 or a polypeptide having 97% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 3 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 450 to 500 nm, or a circular permutation of any of these polypeptides; the green fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 4 or a polypeptide having 97% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 4 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 500 to 520 nm, or a circular permutation of any of these polypeptides; a nucleic acid in which the yellow fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO:5, and when fused with the LuxA subunit, the amino acid sequence of positions 1 to 229 of SEQ ID NO:5 is linked to the amino acid sequence of positions 2 to 359 of SEQ ID NO:1 with two amino acids of EL sandwiched between them; the orange fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO:6, and when fused with the LuxA subunit, the amino acid sequence of positions 1 to 218 of SEQ ID NO:6 is linked to the amino acid sequence of positions 2 to 359 of SEQ ID NO:1 with two amino acids of EL sandwiched between them; or the red fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO:7, or a polypeptide having 97% or more sequence identity with the amino acid sequence represented by SEQ ID NO:7 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 580 to 620 nm, or a circular permutation of any of these polypeptides.

3. A nucleic acid according to claim 2, further comprising a base sequence encoding the LuxB subunit of bacterial luciferase; the LuxB subunit being a polypeptide consisting of the amino acid sequence represented by SEQ ID NO:2 or a polypeptide consisting of an amino acid sequence having 90% or more sequence identity with the amino acid sequence represented by SEQ ID NO:

2.

4. An expression vector incorporating the nucleic acid according to claim 2.

5. A cell into which a nucleic acid having a base sequence encoding a fusion of a LuxA subunit of bacterial luciferase and a fluorescent protein and a nucleic acid having a base sequence encoding a LuxB subunit have been introduced; the LuxA subunit is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO:1 or a polypeptide consisting of an amino acid sequence having 90% or more sequence identity with the amino acid sequence represented by SEQ ID NO:1; the LuxB subunit is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO:2 or a polypeptide consisting of an amino acid sequence having 90% or more sequence identity with the amino acid sequence represented by SEQ ID NO:2; the fluorescent protein is selected from cyan fluorescent protein, green fluorescent protein, yellow fluorescent protein, orange fluorescent protein and red fluorescent protein, and the cyan fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO:3 or a polypeptide having 97% or more sequence identity with the amino acid sequence represented by SEQ ID NO:3 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 450 to 500 nm, or a circular permutation of any of these polypeptides; the green fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 4, or a polypeptide having 97% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 4 and having the function of emitting fluorescence at a maximum fluorescence wavelength of 500 to 520 nm, or a circular permutation of any of these polypeptides; the yellow fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 5, and when fused with the LuxA subunit, a structure is formed in which the amino acid sequence of positions 1 to 229 of SEQ ID NO: 5 and the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1 are linked with two amino acids of EL sandwiched therebetween; the orange fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 6, and when fused with the LuxA subunit, a structure is formed in which the amino acid sequence of positions 1 to 218 of SEQ ID NO: 6 and the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1 are linked with two amino acids of EL sandwiched therebetween;or a cell, wherein the red fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 7, or a polypeptide having 97% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 7 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 580 to 620 nm, or a circular permutation of any of these polypeptides; 6. The cell of claim 5, which is a bacterium, a fungal cell, a plant cell or an animal cell.

7. A method for producing a luminescent protein, comprising expressing a nucleic acid having a base sequence encoding a fusion of a LuxA subunit of bacterial luciferase and a fluorescent protein, and a nucleic acid having a base sequence encoding a LuxB subunit; the LuxA subunit is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO:1 or a polypeptide consisting of an amino acid sequence having 90% or more sequence identity with the amino acid sequence represented by SEQ ID NO:1; the LuxB subunit is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO:2 or a polypeptide consisting of an amino acid sequence having 90% or more sequence identity with the amino acid sequence represented by SEQ ID NO:2; the fluorescent protein is selected from cyan fluorescent protein, green fluorescent protein, yellow fluorescent protein, orange fluorescent protein and red fluorescent protein, and the cyan fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO:3 or a polypeptide having 97% or more sequence identity with the amino acid sequence represented by SEQ ID NO:3 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 450 to 500 nm, or a circular permutation of any of these polypeptides; the green fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 4, or a polypeptide having 97% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 4 and having the function of emitting fluorescence at a maximum fluorescence wavelength of 500 to 520 nm, or a circular permutation of any of these polypeptides; the yellow fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 5, and when fused with the LuxA subunit, a structure is formed in which the amino acid sequence of positions 1 to 229 of SEQ ID NO: 5 and the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1 are linked with two amino acids of EL sandwiched therebetween; the orange fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 6, and when fused with the LuxA subunit, a structure is formed in which the amino acid sequence of positions 1 to 218 of SEQ ID NO: 6 and the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1 are linked with two amino acids of EL sandwiched therebetween;or the method for producing a photoprotein, wherein the red fluorescent protein is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 7, or a polypeptide having 97% or more sequence identity with the amino acid sequence shown in SEQ ID NO: 7 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 580 to 620 nm, or a circular permutation product of any of these polypeptides;

Images