Aptamers and riboswitches of luteolin and other naringenin derived flavonoids for in vitro and in VIVO sensing
Synthetic riboswitches and aptamers for luteolin and other flavonoids address the inefficiencies in production and detection, enabling high-throughput screening and gene regulation with sensitive and specific detection capabilities.
Patent Information
- Application Number
- PCT/SG2025/050171
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-15
- Filing Date
- 2025-03-12
- Publication Date
- 2025-09-18
AI Technical Summary
Current methods for producing flavonoids like luteolin are inefficient and unsustainable, and there is a lack of sensitive and specific biosensors for high-throughput screening and regulation of gene expression in response to luteolin and other naringenin derived flavonoids.
Development of synthetic riboswitches and aptamers that specifically bind to luteolin and other naringenin derived flavonoids, enabling high-throughput screening and regulation of gene expression, with a detection range from 1.75 to 105 pM and a maximum fold activation of 9.6.
The developed biosensors enable precise detection and regulation of luteolin and other flavonoids, facilitating high-throughput screening and metabolic pathway optimization, with robust performance under various conditions and a strong correlation with HPLC measurements.
Smart Images

Figure SG2025050171_18092025_PF_FP_ABST
Abstract
Description
APTAMERS AND RIBOSWITCHES OF LUTEOLIN AND OTHER NARINGENIN DERIVED FLAVONOIDS FOR IN VITRO AND IN VIVO SENSINGFIELD OF THE INVENTION
[0001] The present invention generally relates to an aptamer and a riboswitch comprising the aptamer. In particular, the present invention relates to an aptamer and a riboswitch comprising the aptamer for detecting luteohn and other naringenin derived flavonoids.BACKGROUND
[0002] There is an increasing demand for sustainable and environmentally friendly solutions to produce essential chemicals, leading to the use of microbes / enzymes that have been engineered to produce high-value chemicals from renewable feedstocks through synthetic biology / metabolic engineering. The global synthetic biology market is forecasted to grow from US$5.3 billion in 2019 to US$18.9 billion by 2024 (BCC Research). Flavonoids are a family of secondary metabolites found naturally in plants and fungi [1]. Among them, luteolin is gaining attention due to its numerous health benefits, including antioxidant, anti-inflammatory, anticancer, neuroprotective, analgesic, and cardiovascular protective effects [2-4]. However, traditional methods of producing flavonoids, including luteolin, rely heavily on plant extraction, which is inefficient and unsustainable [5]. As a result, there is a growing interest in microbial production, sustainable and environmentally friendly solutions that arc characterized by rapid growth rates and cost-effective scalability [6-8]. Although earlier studies have engineered microbes / enzymes to produce flavonoids from renewable feedstocks using synthetic biology and metabolic engineering approaches [5,9-1 1 ], further improvement is required to achieve industrial-scale production. Specifically, microbial production of valuable flavonoid luteolin remains underexplored, with low titer highlighting the need for further strain and enzyme engineering [12,13].
[0003] Despite the recent advancement in synthetic biology and computational tools, predictively designing microbial strains remains challenging due to the complexity of biological systems. Consequently, large-scale screening is often necessary to identify high-performance strains. Analytical techniques such as high-performance liquidchromatography (HPLC) are commonly used to quantify flavonoids. While these methods are precise and accurate, they suffer from timeconsuming, resource intensive, and complex procedures, significantly limiting their application in high throughput screening.
[0004] Different methods have been used to screen for the desired strains, including traditional manual screening, with the assistance of automated colony picker, and modern cell analysis technique fluorescent-activated cell sorting (FACS). Conventional method for screening largely relies on manual work and using precise but low throughput titration equipment such as High-performance liquid chromatography (HPLC) and Liquid Chromatography Mass Spectrometry (LCMS). While HPLC or LCMS instruments are sensitive, they arc bulky, expensive, and difficult to use, as well as requiring regular maintenance. More importantly, they are low throughput, as each sample requires around 30 minutes to process, in addition to tedious sample preparation steps. The process for HPLC or LCMS is laborious, costly, and, more importantly, very inefficient (—30 strains per week). Electrochemical sensors for the detection of flavonoids such as luteolin based on the changes in electrical properties of electrode have been recently developed for food quality testing application. While electrochemical sensors would allow easier detection of the molecules, they are limited to in vitro (i.e. outside live cells) detection and can be difficult to fabricate. More advanced approaches, such as microfluidic systems or flow cytometry can enable ultra-high throughput screening (millions of cells). The comparison of different sensing technologies is shown in Table 1.
[0005] Table 1: A comparison of the different sensing / detection methods
[0006] To overcome these limitations, genetically encoded biosensors have been developed. These biosensors enable high throughput screening of engineered strains, realtime monitoring of product concentration, and regulation of the metabolic pathways to enhance production performance [14-18]. Riboswitches offer several advantages over protein-based transcriptional factor biosensors [19,20], including lower metabolic burden [21,22], faster responses time, and reduced off-target effects
[0023] . Although riboswitches usually exhibit relatively lower sensitivity compared to aptamer-based biosensor [24,25] (also refer to Table 2), they offer distinct advantages, such as the reporter fluorescence proteins (c.g., GFP) expressed by riboswitch arc more stable than fluorogcnic RNA in bacterial cells
[0026] . Besides, riboswitches eliminate the need for external dyes. In addition, aptamer-based sensors arc not suitable for regulating gene expression, whereas riboswitches can modulate gene expression in response to specific ligand binding. A typical riboswitch consist two components: an aptamer domain allows binding of target molecule and an gene regulatory expression domain generates readout or regulates the downstream genes
[0027] . Ligand binding triggers structural rearrangements in the RNA, altering accessibility to regulatory elements and enabling control over translation [28,29]. Since riboswitches can be used in the bacteria cells to measure intracellular metabolite concentrations, they have been used to screen for highly productive strains or enzymes [30-33]. Synthetic riboswitches have been developed for a variety of ligands [34-52]. However, in the flavonoid family, synthetic riboswitches have only been developed for naringenin
[0051] . Currently, no riboswitch has been developed for detecting or regulating gene expressions in response to other flavonoids, such as luteolin.
[0007] Table 2, Sensitivity comparison of different types of biosensors.
[0008] To fill this gap, synthetic riboswitches that sensitively and specifically respond to luteolin have been developed. The present invention discloses novel RNA-based biosensors (synthetic riboswitches) for the detection of flavonoids such as luteolin. The luteolin-binding aptamers were first found using systematic evolution of ligands by exponential enrichment (SELEX)
[0053] . These aptamers were integrated into a green fluorescence protein (GFP) expression module to construct the riboswitches. Functional riboswitches were selected using replica plating approach
[0054] . This method involves comparing the fluorescence of the colonies in the absence and presence of luteolin. Two functional riboswitchcs were successfully developed, exhibiting operational range of 1.75-105 pM concentration of luteolin, with a maximum fold activation of 9.6. In addition, the specificity of the riboswitchcs to lutcolin was evaluated to ascertain their utility for monitoring flavonoid biosynthesis pathways. To assess their stability and reproducibility, the biosensors were tested under varying conditions, including different host strains, temperatures, and culture medium. The results showed their robust performance and reliability. Moreover, the sensing of intracellular luteolin produced by engineered E. coli was demonstrated. The biosensor output achieved a good correlation (R2 = 0.93) with luteolin concentrations measured by HPLC. To demonstrate the versatility of the biosensors, the intracellular application was extended to apigenin, where the biosensor effectively distinguished intracellular apigenin concentrations produced by E. coli. This is the first work that developed functional synthetic aptamers and riboswitches for luteolin. These tools enable precise detection of luteolin and regulation of gene expression, offering potential for screening and engineering flavonoid-producing strains and enzymes. Overall, the aptamers and riboswitchcs developed here represent a valuable toolkit for flavonoids research and applications.SUMMARY
[0009] To fill the gap that no RNA-based biosensor for the detection of luteolin and other naringenin derived flavonoids is available, novel synthetic riboswitches that respond to luteolin and other naringenin derived flavonoids, as well as the aptamers that specifically bind to luteolin and other naringenin derived flavonoids, have been developed. Novel RNA sequences that bind with luteolin and other naringenin derived flavonoids and function as riboswitches were determined. The responses of the riboswitches to different luteolin concentrations have been characterized and criticalparameters, such as sensitivity, specificity, dynamic range and detection limit have been determined (see results section). This is the first time that functional luteolin riboswitches for in vivo sensing are developed. The ability to regulate gene expression and detect luteolin and other naringenin derived flavonoids in vivo will be extremely useful in the screening and engineering of luteolin-producing strains / enzymes. Furthermore, the luteolin aptamers and riboswitches disclosed herein have the versatility to be used for other applications, such as in vitro luteolin and other naringenin derived flavonoids detection. Overall, the disclosed aptamers and riboswitches solve an important problem in the production and detection of lutcolin and other naringenin derived flavonoids. Very importantly, the riboswitches also enable ultra-high throughput screening. As such, the disclosed aptamers and riboswitchcs of lutcolin and other naringenin derived flavonoids would have significant impact in both laboratory and industrial settings.
[0010] In one aspect, the present disclosure refers to an aptamer capable of binding to luteolin and other naringenin derived flavonoids, wherein the aptamer is: an RNA aptamer having a nucleotide sequence selected from the group consisting of: GUCCNNNNUCAGUCNNNNGACUGAGGAU (SEQ ID NO: 1), and AUGCUGGNNNNNCUAGUAUNNNNACAUNNNNAUGU (SEQ ID NO: 2); or a DNA aptamer having a nucleotide sequence selected from the group consisting of: GTCCNNNNTCAGTCNNNNGACTGAGGAT (SEQ ID NO: 3), and ATGCTGGNNNNNCTAGTAT (SEQ ID NO: 4); wherein for SEQ ID NO: 1 and 2, N is one nucleotide selected from the group consisting of A, G, C and U, and wherein for SEQ ID NO: 3 and 4, N is one nucleotide selected from the group consisting of A, G, C and T.
[0011] In another aspect, the present disclosure refers to a riboswitch comprising the RNA aptamer as disclosed herein, a ribosomal binding site (RBS) and a reporter; wherein the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
[0012] In another aspect, the present disclosure refers to a DNA expression cassette for the regulation of the expression of the reporter as disclosed herein, comprising a promoter, a DNA aptamer as disclosed herein, a DNA sequence encoding the RBS and a DNA sequence encoding the reporter of the riboswitch as disclosed herein.
[0013] In another aspect, the present disclosure refers to a composition for detecting luteolin and other naringenin derived flavonoids, comprising the riboswitch as disclosed herein, and a translation mixture.
[0014] In another aspect, the present disclosure refers to a composition for detecting luteolin and other naringenin derived flavonoids, comprising the DNA expression cassette as disclosed herein, a transcription mixture and a translation mixture.
[0015] In another aspect, the present disclosure refers to a microbe containing the riboswitch as disclosed herein or the DNA expression cassette as disclosed herein.
[0016] In another aspect, the present disclosure refers to a method of detecting lutcolin and other naringenin derived flavonoids produced in a microbe, comprising (a) introducing the riboswitch as disclosed herein or the DNA expression cassette as disclosed herein into the microbe, wherein when the microbe produces the luteolin and the other naringenin derived flavonoids in an effective amount, the luteolin and the other naringenin derived flavonoids specifically bind the aptamer to induce a conformational change in the riboswitch that allows translation of the reporter into a reporter protein; and (b) detecting the reporter protein, wherein the presence of the reporter protein is indicative of detection of the luteolin and other naringenin derived flavonoids.
[0017] In another aspect, the present disclosure refers to a method of detecting luteolin and other naringenin derived flavonoids produced by a microbe, comprising (a) incubating the microbe with the composition as disclosed herein in a medium, wherein when the microbe produces and releases the luteolin and the other naringenin derived flavonoids in an effective amount into the medium, the luteolin and the other naringenin derived flavonoids specifically bind the aptamer of the riboswitch to induce a conformational change in the riboswitch that allows translation of the reporter into a reporter protein; and (b) detecting the reporter protein, wherein the presence of the reporter protein is indicative of detection of the luteolin and other naringenin derived flavonoids.
[0018] In another aspect, the present disclosure refers to a method of detecting luteolin and other naringenin derived flavonoids produced by a first microbe, comprising (a) incubating the first microbe and the microbe as disclosed herein in a medium; wherein when the first microbe produces and releases the luteolin and the other naringenin derived flavonoids in an effective amount into the medium, the luteolin and the other naringenin derived flavonoids specifically bind the aptamer of the riboswitch produced by themicrobe as disclosed herein to induce a conformational change in the riboswitch that allows translation of the reporter into a reporter protein; and (b) detecting the reporter protein, wherein the presence of the reporter protein is indicative of detection of the luteolin and the other naringenin derived flavonoids.
[0019] The biosensor disclosed herein offers several significant advantages. In addition to being cheaper to fabricate and simpler to use, this invention can detect the luteolin both inside (in vivo) and outside (in vitro) the cells. Moreover, the biosensor is capable of high throughput screening at single cells level, which is not possible / extremely challenging with most other lutcolin detection methods (HPLC, LCMS, electrochemical based biosensor). In addition, the biosensor as disclosed herein can be easily fabricated at low cost (about SGD 0.0035 per sensing reaction), and it is possible to grow the cell to expand the biosensor for larger quantity measurement. Further, the biosensor as disclosed herein has a wide dynamic sensing range of 1.75-120 pM, that is sufficient to cover the working concentration for luteolin detection and relevant strain / enzyme screening. Finally, the biosensor as disclosed herein enables ultra-high throughput screening for strain / enzymes that produce luteolin and the other naringenin derived flavonoids.BRIEF DESCRIPTION OF THE DRAWINGS
[0020] The invention will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and the accompanying drawings, in which:
[0021] Figure 1 shows In vitro selection of luteolin aptamer. A) SELEX workflow to identify lutcolin aptamer. The ssDNA oligos were incubated with lutcolin conjugated beads for binding. After the unbound oligos were washed away, the bound oligos were amplified using PCR. The amplified oligos were then purified via gel electrophoresis and used for the next round of SELEX. B) Luteolin conjugation onto the beads - luteolin concentration before and after binding. After conjugation, about 90% of the luteolin was bound to the beads. C) PCR yield of SELEX at different rounds. The PCR yield increased with more rounds of SELEX, and saturated at round 13. Data information: The experimental data were represented as mean ± S.D. (n = 3). Error bars indicate the standard deviations of three technical replicates. Statistical significances of ***P < 0.001 were calculated based on two-sample unpaired t-test.
[0022] Figure 2 illustrates Luteolin biosensor development. A) An illustration of luteolin biosensor’s sensing mechanism. In the absence of luteolin, riboswitch forms a hairpin structure and blocks the RBS, inhibiting translation. In the presence of luteolin, it binds to the riboswitch and causing conformation change that exposes the RBS, enabling translation. B) Selected biosensors’ fluorescence activation at 35 uM luteolin, measured after 16 hours of incubation. Both LB 1 and LB2 showed significant GFP expression when exposing to 35 pM luteolin. Data information: The experimental data were represented as mean ± S.D. (n = 3). Error bars indicate the standard deviations of three technical replicates. Statistical significances of ***? < 0.001 were calculated based on two-sample unpaired t-test.
[0023] Figure 3 illustrates the characterization of the lutcolin biosensors. (A) Dose response of LB1 to different luteolin concentration, represented by the GFP / OD at 16 hours. (B) Dose response of LB2 to different luteolin concentration, represented by the GFP / OD at 16 hours. Overall, LB 1 exhibits greater sensitivity compared to LB2, while LB2 achieved higher fold activation than LB 1. Both LB 1 and BL2 demonstrated good curve fitting with Hill equation. GFP / OD = ECso, and Lutrefer to maximum GFP / OD, luteolin concentration to achieve half-maximum GFP / OD, and concentration of luteolin. Data information: The experimental data were represented as mean ± S.D. (n = 3). Error bars indicate the standard deviations of three technical replicates.
[0024] Figure 4 illustrates the response of the developed biosensors to other flavonoids. (A) The fold activation of LB1 to different flavonoids at different concentrations. (B) The fold activation of LB2 to different flavonoids at different concentrations. Both LB1 and LB2 showed significantly higher fold activation towards luteolin than other flavonoids. (C) Specificity of luteolin LB1 and LB2 in the presence of luteolin, apigenin, eriodictyol, and naringenin. Both LB1 and LB2 showed significantly higher specificity towards luteolin than other flavonoids. Data information: The experimental data were represented as mean ± S.D. (n = 3). Error bars indicate the standard deviations of three technical replicates. Statistical significances of ***P < 0.001 were calculated based on two-sample unpaired t-test.
[0025] Figure 5 illustrates luteolin biosensor for intracellular sensing. (A) Illustration of the luteolin producing genetic circuits and biosensor sensing mechanism. The E. coli harbouring both luteolin-producing plasmid and biosensor. FNS will be expressed whenadding IPTG and converts the eriodyctiol to luteolin. Luteolin further binds to the biosensor and triggers GFP translation. B) Sensor response when different IPTG concentration was added. Increasing IPTG concentrations leads to higher GFP expression levels. C) Luteolin produced by the E. coli at different IPTG induction concentrations, measured by HPLC. Increasing IPTG concentrations leads to higher luteolin production. D) The correlation between luteolin biosensor response and luteolin produced by E. coli. The biosensor’s signal showed strong linear correlation with the luteolin concentration measured by HPLC. Data information: The experimental data were represented as mean ± S.D. (n = 3). Error bars indicate the standard deviations of three technical replicates. Statistical significances of ***P < 0.001 were calculated based on two-sample unpaired t-test.
[0026] Figure 6 illustrates HPLC standard curve for naringenin and luteolin. A) Strong linear correlation between HPLC reading and luteolin concentration. B) Strong linear correlation between HPLC reading and apigenin concentration.
[0027] Figure 7 illustrates the absorption spectrum of luteolin, measured by spectrophotometer. The peak absorption wavelength appeared at around 350 nm.
[0028] Figure 8 illustrates the luteolin absorption standard curve, measured by spectrophotometer. Data information: The experimental data were represented as mean ± S.D. (n = 3). Error bars indicate the standard deviations of three technical replicates.
[0029] Figure 9 illustrates the results of testing the stability of the luteolin-beads conjugation. After the luteolin- beads binding reaction using 140 pM, there was about 15 pM luteolin left in the supernatant. The beads were washed with PBS to remove the unbound lutcolin. The supernatant of the conjugation beads was measured before starting subsequent SELEX round 4 and round 10, as well as the after 3 months storage at 4 °C. The results showed that minimal luteolin was released to the supernatant, confirming the long-term stability of the conjugation. Error bars indicate the standard deviations of three technical replicates.
[0030] Figure 10 illustrates the auto-fluorescence of flavonoids. The autofluorescence of flavonoids were measured at concentration of 105 pM, which was the maximum concentration used in this study. The GFP was expressed by the E. coli at OD of 1. The excitation wavelength was set at 470 nm. The emission wavelengths of flavonoids do not overlap with GFP. Further, the fluorescence of the flavonoids was much lower as compared to GFP.
[0031] Figure 11 illustrates the replica plate approach. Grid was drawn onto the petri dishes. The satellite colonies were scraped up from the parental plate without luteolin. The satellite colonies were transferred onto the daughter plate with 35 pM luteolin. The colonies which had increased fluorescence were selected for further characterization.
[0032] Figure 12 illustrates the time response of the selected biosensors, characterized in liquid LB broth medium. 16 hours was sufficient to see the GFP difference in the absence and presence of luteolin.
[0033] Figure 13 illustrates the aptamer structure of LB 1 and LB2. A) Aptamer of LB 1 in DNA form. B) Aptamer of LB 1 in RNA form. C) Aptamer of LB2 in DNA form. D) Aptamer of LB2 in RNA form. The aptamer secondary structures of LB1 and LB2 were visualized in DNA and RNA forms using RNAfold
[0061] . Both aptamers retained similar structures when converting from DNA to RNA.
[0034] Figure 14 illustrates the fold activation of luteolin biosensors. Both LB1 and LB2 showed responsiveness at a low concentration of 1.75 pM and exhibited increasing GFP expression with raising luteolin concentrations. Data information: The experimental data were represented as mean ± S.D. (n = 3). Error bars indicate the standard deviations of three technical replicates.
[0035] Figure 15 illustrates the time response of LB1 and LB2 to different luteolin concentrations. Both LB1 and LB2 started to show responsiveness within 50-60 min, and the difference in GFP expression levels maintained for over 16 hours.
[0036] Figure 16 illustrates the dose-response of the biosensors in E. coli 10-beta (C3019, NEB). Both LB 1 and LB2 exhibited responsiveness at a low concentration of 1.75 pM, and GFP expression increased at higher lutcolin concentration, with lower fold activation than in E. coli Acella. These results demonstrated that both LB 1 and LB2 in E. coli 10-beta hold their ability to detect the luteolin concentrations. Data information: The experimental data were represented as mean ± S.D. (n = 3). Error bars indicate the standard deviations of three technical replicates.
[0037] Figure 17 illustrates the performance of LB 1 and LB2 in M9 culture medium. This work primarily focused on the utility of the biosensors in LB medium, given its relevance to microbial production conditions. To further evaluate their stability and reproducibility, LB1 and LB2 were also characterized in M9 culture. Both biosensors demonstrated the capability to distinguish between different luteolin concentrations. The GFP / OD signal dropped after around 4 hours, likely due to the limited nutrition in M9.Regardless, the differences in GFP expression levels maintained for over 30 hours, showcasing the biosensors’ robust long-term performance.
[0038] Figure 18 illustrates the biosensors specificity. A) Luteolin biosynthesis pathways related to flavonoids. B) Specificity of LB 1. C) Specificity of LB2. Both LB1 and LB2 showed much higher responsiveness to luteolin as compared to other flavonoids.
[0039] Figure 19 illustrates the the applications of biosensors on other flavonoids. A) In the flavonoid biosynthesis pathway as seen in Figure 18A, in the presence of enzyme FNS, adding naringenin as substrate will lead to the production of apigenin. B) Biosensor response when different IPTG concentration was added. C) Apigenin produced by the E. coli at different IPTG induction concentrations, measured by HPLC. D) The correlation between biosensor response and apigenin produced by E. coli. Data information: The experimental data were represented as mean ± S.D. (n = 3). Statistical significances of ***P < 0.001 and **P < 0.01 were calculated based on two-sample unpaired t-test.
[0040] Figure 20 illustrates the establishment of correlation between biosensor fluorescence output and HPLC analysis. First, cell culture was continuously incubated and monitored using a microplate reader. At the end point, the cell culture was extract for HPLC analysis.
[0041] Figure 21 are bar graphs illustrating the biosensor performance for detecting luteolin at (A) 18 °C, (B) 25 °C, (C) 30 °C, (D) 37 °C, and (E) 40 °C. The biosensor showed good performance at 18 °C, 25°C, 30 °C, 37 °C, but the performance declined at 40 °C.DETAILED DESCRIPTION
[0042] There is a growing interest in engineering microbes to produce health- beneficial flavonoids such as luteolin, which has anti-oxidative, anti-tumor, and cardiac protective effects. However, it remains challenging to engineer strains or enzymes (producer) to achieve high yields, largely due to the inherent complexity of biological systems. To address this challenge, genetically encoded biosensors offer a promising solution by enabling high throughput screening and pathway optimization to enhance producer performance. However, there is a lack of sensitive and specific biosensors for the detection of luteolin. To fill this gap, this disclosure describes the development of synthetic riboswitches as genetically encoded biosensors that can activate gene expression in response to luteolin. Using SELEX and replica plating approaches, twofunctional synthetic riboswitches were developed with detection range from 1.75 to 105 pM. The biosensors showed good sensitivity with half-maximal effective concentrations (EC50) of 11.71 pM and 17.62 pM, respectively. The riboswitches responded specifically to luteolin and exhibited a robust activation dynamic, achieving up to a 9.6-fold change. Further, the application of the riboswitches in detecting intracellular luteolin produced by engineered E. coli has been demonstrated, with fluorescence output showing a strong correlation (R2 = 0.93) with luteolin concentrations measured by HPLC. The stability and reproducibility of the biosensors were evaluated, showing their reliability under various conditions. Additionally, the application of the biosensors was extended to another flavonoid, apigenin, showcasing their versatility. Overall, these luteolin biosensors addressed a critical limitation in flavonoid. Their demonstrated properties hold promise for diverse applications in the food, pharmaceutical, and cosmetic industries, including large-scale screening of luteolin samples, detection of luteolin and other naringenin derived flavonoids for food quality control, high throughput screening for the strains with high performance, real-time pathway monitoring and regulation, and the metabolic engineering of flavonoid-producing microbes, and so on.
[0043] In one aspect, the present disclosure refers to an aptamer capable of binding to luteolin and other naringenin derived flavonoids, wherein the aptamer is: an RNA aptamer having a nucleotide sequence selected from the group consisting of: GUCCNNNNUCAGUCNNNNGACUGAGGAU (SEQ ID NO: 1), and AUGCUGGNNNNNCUAGUAUNNNNACAUNNNNAUGU (SEQ ID NO: 2); or a DNA aptamer having a nucleotide sequence selected from the group consisting of: GTCCNNNNTCAGTCNNNNGACTGAGGAT (SEQ ID NO: 3), and ATGCTGGNNNNNCTAGTAT (SEQ ID NO: 4); wherein for SEQ ID NO: 1 and 2, N is one nucleotide selected from the group consisting of A, G, C and U, and wherein for SEQ ID NO: 3 and 4, N is one nucleotide selected from the group consisting of A, G, C and T.
[0044] As used herein, the term "aptamer" refers to a nucleic acid or oligonucleotide molecule that binds to a ligand such as luteolin. Aptamers are derived from an in vitro evolutionary process (e.g., SELEX, (Systematic Evolution of Ligands by Exponential Enrichment), described in U.S. Patent No.5,270,163), which selects for target- specific aptamer sequences from large combinatorial libraries. Generally, generation of aptamers by SELEX involves the following steps: (1 )Aptamer (nucleic acid, DNA / RNA) pools are incubated with target ligand (such as luteolin) for binding. (2) Target ligand (such as iuteolin) are thoroughly washed to remove non-binding species. (3) Target ligand (such as luteolin)-bound aptamers are eluted from the target. (4) Amplification of candidate aptamers by PCR (DNA) or RT-PCR and transcription (RNA). Steps (1 )-(4) is repeated for multiple rounds to deplete non-binders and enrich for target-binders. Following the final round of selection, binding nucleotides are cloned and sequenced to determine the specific nucleotide composition. Aptamer compositions may be double-stranded or single- stranded, and may include dcoxyribonuclcotidcs, ribonucleotides, nucleotide derivatives, or other nuclcotidc-likc molecules.
[0045] Illustrative ligands that bind to an aptamer include, without limitation, small molecules, such as drugs, metabolites, intermediates, cofactors, transition state analogs, ions, metals, nucleic acids, and toxins. Aptamers may also bind natural and synthetic polymers, including proteins, peptides, nucleic acids, polysaccharides, glycoproteins, hormones, receptors and cell surfaces such as cell walls and cell membranes. The binding of a ligand to an aptamer, which may be DNA or RNA, causes a conformational change and alters its ability to modulate the activity of another part such as an expression platform of a riboswitch that the aptamer is part of. In one example, the conformational change inhibits translation of an mRNA in which the aptamer is located. In another example, the conformational change removes the inhibition and allows translation of an mRNA in which the aptamer is located. Aptamers may also be composed of DNA or may comprise nonnatural nucleotides and nucleotide analogs. An aptamer will most typically have been obtained by in vitro selection for binding of a target molecule. However, in vivo selection of an aptamer is also possible.
[0046] An aptamer will typically be between about 10 and about 300 nucleotides in length. More commonly, an aptamer will be between about 30 and about 100 nucleotides in length.
[0047] As used herein, the term "riboswitch", or "biosensor" refers to regulatory RNA- based biosensor that control gene expression in response to a ligand (such as luteolin), and the synthetic riboswitches developed in this disclosure can activate gene expression in response to luteolin and other naringenin derived flavonoids with high specificity. A typical riboswitch is composed of an aptamer domain and an expression platform. The term “riboswitch” reflects the ability of these noncoding RNAs to function as geneticswitches. When the abundance of a ligand (such as luteolin) exceeds a threshold level, binding of the ligand to a sensor of the riboswitch (such as the aptamer as disclosed herein) induces a conformational change of the riboswitch, leading to modulation of downstream events (e.g. in the expression platform). In one example, the RNA aptamers disclosed herein comprise a sequence that folds into a particular structure (e.g., a hairpin), which can specifically bind a ligand (such as luteolin). Binding of the ligand causes a structural change in the folding of the RNA, which induces unfolding of the hairpin and expression of the reporter gene of the expression platform.
[0048] The aptamer and the riboswitch as disclosed herein can have at least two conformational states or configurations, an “off’ state and an “on” state, defined by the aptamer's ability or availability to interact with a specific ligand (such as lutcolin and other naringenin derived flavonoids). For example, the aptamer can adopt a hairpin loop configuration in which the expression platform of the riboswitch is rendered unavailable to be translated, and therefore, the hairpin loop conformation can be considered as at an “off’ state and the corresponding riboswitch is “off.” On the other hand, a riboswitch that is “on” may have the aptamer in an “on” configuration that allows it to interact with a specific ligand (such as luteolin and other naringenin derived flavonoids). Tire riboswitch may switch from “off’ to “on” in response to the presence of the ligand that interacts with the aptamer of the riboswitch, thereby causing a conformational change of the riboswitch that leads to the “on” configuration.
[0049] In one example, the specific ligand binding to the aptamer and riboswitch as disclosed herein is luteolin. In another example, the specific ligand binding to the aptamer and riboswitch as disclosed herein arc other naringenin derived flavonoids. In one example, other naringenin derived flavonoids include apigenin. In another example, other naringenin derived flavonoids include eriodictyol.
[0050] In one example, the aptamer is a DNA aptamer. A DNA aptamer can be part of a DNA expression cassette. In another example, the aptamer is an RNA aptamer. An RNA aptamer can be part of a riboswitch.
[0051] In one example, the RNA aptamer capable of binding to luteolin and other naringenin derived flavonoids as disclosed herein comprises a nucleotide sequence of GUCCNNNNUCAGUCNNNNGACUGAGGAU (SEQ ID NO: 1). In another example, the RNA aptamer capable of binding to luteolin and other naringenin derived flavonoids as disclosed herein comprises a nucleotide sequence ofAUGCUGGNNNNNCUAGUAUNNNNACAUNNNNAUGU (SEQ ID NO: 2). In another example, the RNA aptamer capable of binding to luteolin and other naringenin derived flavonoids as disclosed herein comprises a nucleotide sequence of AAUGUUUGCAGUCCNNNNUCAGUCNNNNGACUGAGGAUAG (SEQ ID NO: 5). In another example, the RNA aptamer capable of binding to luteolin and other naringenin derived flavonoids as disclosed herein comprises a nucleotide sequence of AAUGCUGGNNNNNCUAGUAUNNNNACAUNNNNAUGUUUG (SEQ ID NO: 6). SEQ ID NO: 1 and SEQ ID NO: 5 are RNA aptamer sequence of the first biosensor of lutcolin and other naringenin derived flavonoids disclosed herein (termed "luteolin biosensor 1" or "LB1"). SEQ ID NO: 1 is the consensus sequence, while SEQ ID NO: 5 is the full sequence of the RNA aptamer of lutcolin biosensor 1. SEQ ID NO: 2 and SEQ ID NO: 6 are RNA aptamer sequence of the second biosensor of luteolin and other naringenin derived flavonoids disclosed herein (termed "luteolin biosensor 2" or "LB2"). SEQ ID NO: 2 is the consensus sequence, while SEQ ID NO: 6 is the full sequence of the RNA aptamer of luteolin biosensor 2. For SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5 and SEQ ID NO: 6, N is one nucleotide selected from the group consisting of A, G, C and U.
[0052] In another example, the DNA aptamer capable of binding to luteolin and other naringenin derived flavonoids as disclosed herein comprises a nucleotide sequence of GTCCNNNNTCAGTCNNNNGACTGAGGAT (SEQ ID NO: 3). In another example, the DNA aptamer capable of binding to luteolin and other naringenin derived flavonoids as disclosed herein comprises a nucleotide sequence of ATGCTGGNNNNNCTAGTAT (SEQ ID NO: 4). In another example, the DNA aptamer capable of binding to lutcolin and other naringenin derived flavonoids as disclosed herein comprises a nucleotide sequence of AATGTTTGCAGTCCNNNNTCAGTCNNNNGACTGAGGATAG (SEQ ID NO: 7). In another example, the DNA aptamer capable of binding to luteolin and other naringenin derived flavonoids as disclosed herein comprises a nucleotide sequence of AATGCTGGNNNNNCTAGTATAATCACATAACACATGTTTG (SEQ ID NO: 8). SEQ ID NO: 3 and SEQ ID NO: 7 are DNA aptamer sequence of the first biosensor of luteolin and other naringenin derived flavonoids disclosed herein (termed "luteolin biosensor 1" or "LB1"). SEQ ID NO: 3 is the consensus sequence, while SEQ ID NO: 7 is the full sequence of the DNA aptamer of luteolin biosensor 1. SEQ ID NO: 4 and SEQ ID NO: 8 are DNA aptamer sequence of the second biosensor of luteolin and othernaringenin derived flavonoids disclosed herein (termed "luteolin biosensor!" or "LB2"). SEQ ID NO: 4 is the consensus sequence, while SEQ ID NO: 8 is the full sequence of the RNA aptamer of luteolin biosensor 2. For SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 7 and SEQ ID NO: 8, N is one nucleotide selected from the group consisting of A, G, C and T.
[0053] The luteolin biosensor 1 as disclosed herein comprising an RNA aptamer sequence of SEQ ID NO: 1 and SEQ ID NO: 5, or a DNA aptamer sequence of SEQ ID NO: 3 and SEQ ID NO: 7 is capable of binding to luteolin or eriodictyol. The luteolin biosensor 2 as disclosed herein comprising an RNA aptamer sequence of SEQ ID NO: 2 and SEQ ID NO: 6, or a DNA aptamer sequence of SEQ ID NO: 4 and SEQ ID NO: 8 is capable of binding to lutcolin or apigcnin.
[0054] Various sequences of the luteolin aptamers of the present invention are summarized in Table 3 below:
[0055] Table 3. Sequence listing of the present disclosure
[0056] In another aspect, the present disclosure refers to a riboswitch comprising the RNA aptamer as disclosed herein, a ribosomal binding site (RBS) and a reporter; wherein the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
[0057] In one example, the riboswitch comprises an RNA aptamer comprising the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 being the consensus sequence of the aptamer. In another example, the riboswitch comprises an RNA aptamer comprising the nucleotide sequence of SEQ ID NO: 5 or SEQ ID NO: 6 being the full sequence of aptamer.
[0058] The RBS is selected from the group consisting of E.coli RBS having a consensus sequence of AGGA, a default RBS having a sequence of tttaagaaggagatatacat, and RBS34 having a sequence of tctagagaaagaggagaaatactag. In one example, the RBS is any RBS having an "AGGA" sequence.
[0059] The reporter can be any suitable reporter capable of generating a detectable signal upon conformational change of the aptamer after binding to its ligand such as luteolin and the other naringenin derived flavonoids. In one example, the reporter is a fluorescence protein. In another example, the reporter is a fluorophore. In another example, the reporter is a colour dye. In another example, the reporter is a luminophore. In another example, the reporter is luciferase.
[0060] Commonly used reporter genes arc - GFP (green fluorescent protein gene), lacZ (p- galactosidase gene), RFP (red fluorescent protein gene), and Luc (luciferase gene). The cells expressing GFP glow green when excited by wavelengths of blue to the ultraviolet range, while those expressing RFP glow red when excited by wavelengths of 488 nm or 532 nm. The cells expressing the Luc gene produce luciferase enzymes that catalyze a reaction with luciferin to produce light. The lacZ gene is the most commonreporter gene used in E.coli. It produces an enzyme P-galactosidase that causes the bacteria to appear blue when grown in a media containing X-gal substrate.
[0061] Examples of the fluorescence protein include a green fluorescence protein selected from the group consisting of EGFP, Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen and T-Sapphire; a blue fluoresce protein selected from the group consisting of EBFP, EBFP2, Azurite and mTagBFP; a cyan fluoresce protein selected from the group consisting of ECFP, mECFP, Cerulean, mTurquoise, CyPet, AmCyanl, Midori-Ishi Cyan, TagCFP and mTFPl (Teal); a yellow fluorescence protein selected from the group consisting of EYFP, Topaz, Venus, mCitrine, YPet, TagYFP, PhiYFP, ZsYellowl and mBanana; an orange fluorescence protein selected from the group consisting of Kusabira Orange, Kusabira Orangc2, mOrange, mOrange2, dTomato, dToma to -Tandem, TagRFP, TagRFP-T, DsRed, DsRed2, DsRed-Express (Tl), DsRed-Monomer and mTangerine; and a red fluorescence protein selected from the group consisting of mRuby, mApple, mStrawberry, AsRed2, mRFPl, JRed, mCherry, HcRedl, inRaspbcrry. dKeima-Tandem, HcRed-Tandem, mPlum, and AQ143. Typical fluorescence protein reporters are hsted in Table 4.
[0062] Table 4. Examples of fluorescence protein reporters[0063 J In another aspect, the present disclosure refers to a DNA expression cassette for the regulation of the expression of the reporter as disclosed herein, comprising a promoter, a DNA aptamer as disclosed herein, a DNA sequence encoding the RBS and a DNA sequence encoding the reporter of the riboswitch as disclosed herein.
[0064] As used herein, an “DNA expression cassette” is a nucleic acid construct, generated recombinantly or synthetically, with nucleic acid elements that are capable ofeffecting expression of a gene in hosts compatible with such sequences. DNA expression cassettes include at least promoters, ribosome binding site (RBS), coding sequence (CDS), and optionally, transcription termination signals. Typically, the recombinant expression cassette includes a nucleic acid to be transcribed (e.g., a nucleic acid encoding a reporter, or other protein), RBS, and a promoter. Additional factors necessary or helpful in effecting expression may also be used as described herein. For example, an expression cassette can also include DNA aptamers that modulate the expression of the reporter protein. Transcription termination signals, enhancers, and other nucleic acid sequences that influence gene expression, can also be included in an expression cassette.
[0065] Specifically, in this disclosure, the DNA expression cassette comprises the DNA aptamer as disclosed herein. In one example, the DNA expression cassette comprises the DNA aptamer comprising the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 4 being the consensus sequence of the aptamer. In another example, the DNA expression cassette comprises the DNA aptamer comprising the nucleotide sequence of SEQ ID NO: 7 or SEQ ID NO: 8 being the full sequence of the aptamer.
[0066] As used herein, "promoter” refers to a region of the DNA expression cassette as disclosed herein involved in binding to proteins such as RNA polymerase to initiate transcription of DNA (e.g. the reporter gene) downstream of the promoter. Promoters are located near the transcription start sites of genes, upstream on the DNA (towards the 5' region of the sense strand). Promoters can be about 30-1000 base pairs long, the sequence of which is highly dependent on the gene and product of transcription, type or class of RNA polymerase recruited to the site, and species of organism. In one example, the promoter is inducible, i.c. the promoter directs expression of a reporter gene only when receiving a specific stimulus, such as chemical, protein, light, heat, etc. In another example, the promoter is constantly on, i.e. it is always able to direct expression of a reporter gene but it is only accessible to the RNA polymerase and transcriptional factors. Subsequent translation will only be enabled when the hairpin structure of the aptamer is unfolded by binding of the ligand such as luteolin or other naringenin derived flavonoids. Promoter used herein is to enable the transcription of the DNA expression cassette, which includes the aptamer, RBS, and coding sequence (CDS). In a riboswitch, promoter controls transcription, and aptamer controls translation.
[0067] The promoter can be any promoter suitable to initiate transcription. In one example, the promoter is a E. coli c70promoter. In another example, the promoter is a E.coll a19promoter. In another example, the promoter is a E. coll o24promoter. In another example, the promoter is a E. coli G2Spromoter. In another example, the promoter is a E. coli c32promoter. In another example, the promoter is a E. coli o38promoter. In another example, the promoter is a E. coli o54promoter. Non-exhaustive examples of the promoter are listed in Table 5. In bacteria such as E. coli, the promoter contains two short sequence elements approximately 10 (Pribnow Box) and 35 nucleotides upstream from the transcription start site. Sigma70 (a70) promoter comprises two well-defined short sequences located at- 10 and-35 base pairs upstream of genes' transcription staid sites (TSS), respectively. The sequence of the promoter at -10 (the -10 clement, relative to the transcription start site) has the consensus sequence TATAAT. The sequence of the promoter at -35 (the -35 clement, relative to the transcription start site) has the consensus sequence TTGACA. Optimal inter-base distance between the -10 element and the -35 element is 17(±1) bp.[0068 J Table 5. Examples of promoter.[0069 J In another aspect, the present disclosure refers to a composition for detecting luteolin and other naringenin derived flavonoids, comprising the riboswitch as disclosed herein, and a translation mixture.
[0070] In another aspect, the present disclosure refers to a composition for detecting luteolin and other naringenin derived flavonoids, comprising the DNA expression cassette as disclosed herein, a transcription mixture and a translation mixture.
[0071] As used herein, "transcription mixture" and "translation mixture" refer to cell- free protein synthesis systems which are generally constructed with cell extract prepared from E. coli. wheat germ, insect cells, or rabbit reticulocytes. The E. coli extract-based cell-free expression system is the most popular, and broad varieties of in vitro protein synthesis systems are commercialized by various companies (e.g., Arbor Biosciences, Biotechrabbit, Invitrogen, Qiagen, Promega). The cell-free protein synthesis system has several advantages over in vivo processes. Firstly, since there is no need to support cellular metabolism; all of the cellular resources can be efficiently directed toward the production of an encoded protein. Although the coupled (i.e., combining both transcription and translation processes) cell-free system has been proven to be more efficient than the uncoupled one, it is possible to use mRNA or PCR fragments as the matrices escaping genetic engineering and cloning procedures. Taken together, this makes cell-freetechnology a reliable and fast way to obtain a high yield of the desired protein. Secondly, the reaction environment can be directly controlled and easily manipulated, since there is no cell barrier. In addition, the cell-fee reaction mixture can be supplemented with the required additives. These additives include chaperones and reducing agents, stabilizing mRNA or promoting complex protein folding, hydrophobic compounds required for soluble expression of membrane proteins (MPs), rare tRNA molecular species for codon usage bias compensation, and orthogonal aminoacyl-tRNA synthetase (aaRS)ZtRNA pairs (orthogonal translation system, OTS) for site-specific non-canonical amino acids (NAAs) incorporation in response to unique codon.
[0072] Any E. coli cell-free transcription or translation mixture (lab-made or commercially available mixture, including but not limited to Promcga, NEB, myTXTL Sigma 70 Master Mix, Arbor Science, can be used in the composition as disclosed herein. The composition as disclosed herein facilitates the functioning of the riboswitch as disclosed herein or the DNA expression cassette as disclosed herein for the detection of luteolin and the other naringenin derived flavonoids in vitro.
[0073] As used herein, "in vitro" detection of luteolin and the other naringenin derived flavonoids refers to detecting luteolin and the other naringenin derived flavonoids outside a host cell (such as a microbe) producing the luteolin and the other naringenin derived flavonoids.
[0074] In another aspect, the present disclosure refers to a microbe containing the riboswitch as disclosed herein or the DNA expression cassette as disclosed herein.
[0075] In one example, the microbe is a prokaryote. The prokaryote can be a bacterium, or an archacon. The prokaryote is selected from the group consisting of E. coli, B. subtilis, Pseudomonas, Lactobacillus, Spirilla, Vibrio, Salmonella, Acetobacter, Cyanobacteria, Spirochetes, Chlamydias, Caulobacter, Mycoplasma, Aliivibrio, Bacteroides, Synechocystis, Azotobacter, Streptomyces, Thermococcus, Sulfolobus, Streptococcus, Methanococcus, Halobacterium, other proteobacteria, and a gram-positive bacterium. In another example, the microbe is E. coli 10-beta.
[0076] In another aspect, the present disclosure refers to a method of detecting luteolin and other naringenin derived flavonoids produced in a microbe, comprising (a) introducing the riboswitch as disclosed herein or the DNA expression cassette as disclosed herein into the microbe, wherein when the microbe produces the luteolin and the other naringenin derived flavonoids in an effective amount, the luteolin and the othernaringenin derived flavonoids specifically bind the aptamer to induce a conformational change in the riboswitch that allows translation of the reporter into a reporter protein; and (b) detecting the reporter protein, wherein the presence of the reporter protein is indicative of detection of the luteolin and other naringenin derived flavonoids.
[0077] The method as disclosed above refers to "in vivo" detection of luteolin and the other naringenin derived flavonoids produced inside a host cell (such as a microbe as disclosed herein). As used herein, "in vivo" detection refers to detecting luteolin and the other naringenin derived flavonoids inside a host cell (such as a microbe) that produces the lutcolin and the other naringenin derived flavonoids.
[0078] For step (a) of the above "in vivo" detection method, the riboswitch as disclosed herein or the DNA expression cassette as disclosed herein can be introduced (or transfected) into the microbe producing luteolin and other naringenin derived flavonoids. In one example, other naringenin derived flavonoids include apigenin. In another example, other naringenin derived flavonoids include eriodictyol. Transfection may occur under natural or artificial conditions according to various methods well known in the art, and may rely on any known method for the insertion of the riboswitch as disclosed herein or the DNA expression cassette as disclosed herein into a prokaryotic microbe disclosed herein. The method for transfection is selected based on the type of prokaryotic microbe being transfected and may include, but is not limited to, bacteriophage or viral infection, electroporation, heat shock, lipofection, nanoparticle delivery, and particle bombardment. The term "transfected cells / transformed cells" includes stably transfected / transformed cells in which the riboswitch as disclosed herein or the DNA expression cassette as disclosed herein is capable of replication cither as an autonomously replicating plasmid or as part of the host chromosome, as well as transiently transformed cells which express the introduced riboswitch as disclosed herein or the DNA expression cassette as disclosed herein for limited periods of time.
[0079] In the above "in vivo" detection method, once the riboswitch as disclosed herein or the DNA expression cassette as disclosed herein is introduced into the microbe, the DNA expression cassette is transcribed into the riboswitch containing the aptamer disclosed herein. When the microbe produces the luteolin and the other naringenin derived flavonoids in an effective amount, the luteolin and the other naringenin derived flavonoids specifically bind the aptamer of the riboswitch as disclosed herein or the DNAexpression cassette as disclosed herein, and this binding induces a conformational change in the riboswitch that allows translation of the reporter into a reporter protein.
[0080] The presence of the reporter protein is indicative of detection of the luteolin and other naringenin derived flavonoids. Detecting the reporter protein is done by a method selected from the group consisting of fluorescent detection, colorimetric detection, bioluminescence detection, spectrophotometry, and DNA microarray.
[0081] In another aspect, the present disclosure refers to a method of detecting luteolin and other naringenin derived flavonoids produced by a microbe, comprising (a) incubating the microbe with the composition as disclosed herein in a medium, wherein when the microbe produces and releases the luteolin and the other naringenin derived flavonoids in an effective amount into the medium, the lutcolin and the other naringenin derived flavonoids specifically bind the aptamer of the riboswitch to induce a conformational change in the riboswitch that allows translation of the reporter into a reporter protein; and (b) detecting the reporter protein, wherein the presence of the reporter protein is indicative of detection of the luteolin and other naringenin derived flavonoids.
[0082] The method as disclosed above is the first embodiment of "in vitro" detection of luteolin and the other naringenin derived flavonoids produced by a host cell (such as a microbe as disclosed herein). As used herein, "in vitro" detection of luteolin and the other naringenin derived flavonoids refers to detecting luteolin and the other naringenin derived flavonoids outside a host cell (such as a microbe) which produces the luteolin and the other naringenin derived flavonoids.
[0083] For step (a) of the first embodiment of "in vitro" detection method as disclosed above, (i) the composition comprising the riboswitch as disclosed herein and a translation mixture; or (ii) the composition comprising the DNA expression cassette as disclosed herein, a transcription mixture and a translation mixture, is incubated in a medium, in which the microbe producing the luteolin and the other naringenin derived flavonoids is also incubated. When the microbe produces and releases the luteolin and the other naringenin derived flavonoids in an effective amount into the medium, the luteolin and the other naringenin derived flavonoids specifically bind the aptamer of the riboswitch (the DNA expression cassette can be transcribed into the riboswitch containing the aptamer disclosed herein, by the transcription mixture included in the composition), to induce a conformational change in the riboswitch that allows translation of the reporterinto a reporter protein, using the translation mixture included in the composition disclosed herein. In one example, other naringenin derived flavonoids include apigenin. In another example, other naringenin derived flavonoids include eriodictyol.
[0084] Any E. coli cell-free transcription or translation mixture (lab-made or commercially available mixture, including but not limited to Promega, NEB, myTXTL Sigma 70 Master Mix, Arbor Science, can be used in the composition as disclosed herein. The composition as disclosed herein facilitates the functioning of the riboswitch as disclosed herein or the DNA expression cassette as disclosed herein for the detection of lutcolin and the other naringenin derived flavonoids in vitro.
[0085] The presence of the reporter protein is indicative of detection of the luteolin and other naringenin derived flavonoids. Detecting the reporter protein is done by a method selected from the group consisting of fluorescent detection, colorimetric detection, bioluminescence detection, spectrophotometry, and DNA microarray.
[0086] In another aspect, the present disclosure refers to a method of detecting luteohn and other naringenin derived flavonoids produced by a first microbe, comprising (a) incubating the first microbe and the microbe as disclosed herein (containing the riboswitch or DNA expression cassette) in a medium; wherein when the first microbe produces and releases the luteolin and the other naringenin derived flavonoids in an effective amount into the medium, the luteolin and the other naringenin derived flavonoids specifically bind the aptamer of the riboswitch produced by the microbe as disclosed herein to induce a conformational change in the riboswitch that allows translation of the reporter into a reporter protein; and (b) detecting the reporter protein, wherein the presence of the reporter protein is indicative of detection of the lutcolin and the other naringenin derived flavonoids.
[0087] The method as disclosed above is the second embodiment of "in vitro" detection of luteolin and the other naringenin derived flavonoids produced by a host cell (such as a microbe as disclosed herein). As used herein, "in vitro" detection of luteolin and the other naringenin derived flavonoids refers to detecting luteolin and the other naringenin derived flavonoids outside a host cell (such as a microbe) which produces the luteolin and the other naringenin derived flavonoids.
[0088] For step (a) of the second embodiment of "in vitro" detection method as disclosed above, a first microbe producing the luteolin and the other naringenin derived flavonoids is co-cultured with a second microbe which has been transformed / transfectedwith riboswitch as disclosed herein or the DNA expression cassette as disclosed herein. When the first microbe produces and releases the luteolin and the other naringenin derived flavonoids in an effective amount into the medium, tire luteolin and the other naringenin derived flavonoids specifically binds the aptamer of the riboswitch produced by the transformed / transfected second microbe to induce a conformational change in the riboswitch that allow s translation of the reporter into a reporter protein. In one example, other naringenin derived flavonoids include apigenin. In another example, other naringenin derived flavonoids include eriodictyol.
[0089] The presence of the reporter protein is indicative of detection of the lutcolin and other naringenin derived flavonoids. Detecting the reporter protein is done by a method selected from the group consisting of fluorescent detection, colorimetric detection, bioluminescence detection, spectrophotometry, and DNA microarray.
[0090] In the "in vitro" detection method or "in vivo" detection method as disclosed herein, the microbe producing the luteolin and the other naringenin derived flavonoids, or the microbe which has been transformed / transfected with riboswitch as disclosed herein or the DNA expression cassette as disclosed herein, is a prokaryote. The prokaryote can be a bacterium, or an archaeon. The prokaryote is selected from the group consisting of E. coli, B. subtilis, Pseudomonas, Lactobacillus, Spirilla, Vibrio, Salmonella, Acetobacter, Cyanobacteria, Spirochetes, Chlamydias, Caulobacter, Mycoplasma, Aliivibrio, Bacteroides, Synechocystis, Azotobacter, Streptomyces, Thermococcus, Sulfolobus, Streptococcus, Methanococcus, Halobacterium, other proteobacteria, and a gram-positive bacterium. In another example, the microbe is E. coli 10-beta. The biosensors as disclosed herein maintain their stability and reproducibility in detecting luteolin and other naringenin derived flavonoids when transfected / transformed in various microbes as disclosed herein.
[0091] In the "in vitro" detection method or "in vivo" detection method as disclosed herein, a range of suitable media are available for incubating the microbe as disclosed herein, the types and compositions of which are well known to those of skill in the art. Preferably the culture medium contains at least water, salts, nutrients, essential amino acids, vitamins and hormones, and may also include one or more growth factors. A variety of suitable culture media is commercially available, for example LB broth, LB Agar, Terrific Broth, M9, M63, SOC Medium, ImMedia Medium, MagicMedia Medium. In one example, the culture medium is LB broth medium. In another example, the culturemedium is M9 medium. The biosensors as disclosed herein maintain their stability and reproducibility in detecting luteolin and other naringenin derived flavonoids, in various culture media as disclosed herein, such as LB broth medium, or M9 medium.
[0092] The biosensors as disclosed herein maintain their stability and reproducibility in detecting luteolin and other naringenin derived flavonoids at different temperatures, from 18-37 °C, for example, 18-25 °C, 25-30 °C, 30-37 °C, about 18 °C, about 19 °C, about 20 °C, about 21 °C, about 22 °C, about 23 °C, about 24 °C, about 25 °C, about 26 °C, about 27 °C, about 28 °C, about 29 °C, about 30 °C, about 31 °C, about 32 °C, about 33 °C, about 34 °C, about 35 °C, about 36 °C, and about 37 °C.
[0093] Using the "in vitro" detection method or "in vivo" detection method as disclosed herein, lutcolin and the other naringenin derived flavonoids can be detected at a concentration of at least 1 pM, at least 1.75 pM, at least 2 pM, at least 2.25 pM, at least 5 pM, at least 7.5 pM, at least 10 pM, at least 15 pM, at least 17.5 pM, at least 20 pM, at least 25 pM, at least 27.5 pM, at least 30 pM, at least 35 pM, at least 70 pM, at least 105 pM, at least 110 pM, at least 115 pM, at least 120 pM, or a higher concentration. In some examples, using the "in vitro" detection method or "in vivo" detection method as disclosed herein, luteolin and the other naringenin derived flavonoids can be detected at a concentration of about 1 pM, about 1.75 pM, about 2 pM, about 2.25 pM, about 5 pM, about 7.5 pM, about 10 pM, about 15 pM, about 17.5 pM, about 20 pM, about 25 pM, about 27.5 pM, about 30 pM, about 35 pM, about 70 pM, about 105 pM, about 110 pM, about 115 pM, about 120 pM, or a higher concentration. The level of the reporter protein translated is at least about 1.24-fold higher when luteolin and the other naringenin derived flavonoid is present than the level when lutcolin and the other naringenin derived flavonoid is absent. In some examples, the level of the reporter protein translated is at least about 1.24-fold, about 2-fold, about 2.8-fold, about 3-fold, about 3.1-fold, about 4- fold, about 4.46-fold, about 5-fold, about 5.12-fold, about 5.4-fold, about 6-fold, about 6.56-fold, about 7-fold, about 7.4-fold, about 7.55-fold, about 7.72-fold, about 8-fold, about 8.11 -fold, about 8.18 -fold, about 9-fold, and about 9.6-fold higher when luteolin and the other naringenin derived flavonoid is present than the level when luteolin and the other naringenin derived flavonoid is absent.
[0094] As such, the aptamers and riboswitches in the present disclosure enable ultra- high throughput and highly sensitive, specific, and effective screening of producer strains of luteolin and the other naringenin derived flavonoids.
[0095] In certain embodiments, the disclosure provides a method of co-detecting eriodictyol and apigenin produced by a microbe or microbes. The luteolin biosensor 1 as disclosed herein comprising a RNA aptamer sequence of SEQ ID NO: 1 and SEQ ID NO: 5, or a DNA aptamer sequence of SEQ ID NO: 3 and SEQ ID NO: 7 is capable of binding to luteolin or eriodictyol. The luteolin biosensor 2 as disclosed herein comprising a RNA aptamer sequence of SEQ ID NO: 2 and SEQ ID NO: 6, or a DNA aptamer sequence of SEQ ID NO: 4 and SEQ ID NO: 8 is capable of binding to luteolin or apigenin. Both luteolin biosensor 1 and luteolin biosensor 2 can be used to detect eriodictyol and apigenin together. To co-dctcct eriodictyol and apigenin, the luteolin biosensor 1 comprises a first reporter for detecting eriodictyol, and the luteolin biosensor 2 comprises a second reporter different from the first reporter for detecting apigenin.
[0096] As used in this application, the singular form “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a primer” includes a plurality of primers, including mixtures and combinations thereof.
[0097] As used herein, the term “comprising” means “including.” Variations of the word "comprising", such as “comprise” and “comprises,” have correspondingly varied meanings. Thus, for example, a composition “comprising” X may consist exclusively of X or may include one or more additional unrecited components.
[0098] As used herein, the term “about” in the context of concentration of a substance, size of a substance, length of time, or other stated values means + / - 5% of the stated value, or + / - 4% of the stated value, or + / - 3% of the stated value, or + / - 2% of the stated value, or + / - 1% of the stated value, or + / - 0.5% of the stated value.
[0099] Throughout this disclosure, certain embodiments may be disclosed in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosed ranges. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
[0100] The invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms "comprising", "including", "containing", etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications axe possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the inventions embodied herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.
[0101] The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.
[0102] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which the invention belongs.
[0103] Other embodiments are within the following claims and non-limiting examples.EXAMPLES
[0104] Non-limiting examples of the disclosure will be further described in greater detail by reference to specific Examples, which should not be construed as in any way limiting the scope of the disclosure.
[0105] Example 1 - Material and Methods
[0106] 1.1 Preparation of luteolin-beads conjugation
[0107] First 1 L dilute H2SO4 was diluted to pEI 6 in DI water. Add 50 pl of well- mixed BcMag Long-Arm Amine Terminated Magnetic Beads (Bioclone, USA) to an Eppendorf tube. Then 4 pl of 35 pM luteolin ( -A98 %, Sigma, USA), was added (or appropriate ketone-containing target compound) to 996 pl of dilute H2SO4 (pH 6) (Sigma,USA) to make a solution of 140 nM luteolin in diluted acid. The luteolin-acid solution was dispensed to 96-well plate, with 300 pl in each well, and the samples were prepared in triplicates. After which, the absorbance of the samples was read at 355 nm. After reading the absorbance, 300 pl samples were recovered and added to the magnetic beads. The beads and solution were mixed and incubated for 3 h, with shaking (250 rpm) for 1 h. After incubation, the absorbance of the supernatant was measured at 355 nm to confirm that the concentration of free luteolin has decreased. The beads were then washed with 1 ml PBS (phosphate-buffered saline) solution (1st Base, Singapore) to remove all unbound lutcolin from the beads. A magnet was used to aggregate and separate the beads before aspirating the wash solution for discarding. After discarding the third wash solution, the beads were resuspended in 1 ml PBS and stored at 4 °C.
[0108] 1.2. In vitro selection of the aptamers
[0109] In this work, luteolin aptamers were selected and amplified using SELEX workflow
[0055] . The single-stranded oligos library was prepared by heating at 95 °C for 10 min, and subsequently added to the luteolin-bound magnetic beads. After incubating for an hour at 37 °C with gentle shaking, the mixture was exposed to a magnet to isolate the beads from the unbound oligos. The beads were washed using PBS, and the bound oligos on the beads were then amplified through PCR (KOD One™ PCR Master Mix, TOYOBO, Japan) for 30 cycles. Tn this study, 30 cycles of PCR at initial rounds provided an adequate amount of aptamers for subsequent rounds of SELEX. The PCR product was run through gel electrophoresis to confirm the size of the oligos. Gel extraction was then performed to extract and purify the oligos. PCR product was heated to form singlestranded oligos for next round of SELEX. Fifteen rounds of SELEX were conducted before terminating the selection.
[0110] 1.3. Development of riboswitches[001 1 1 ] The selected and enriched PCR product was cloned into the vector pBbE6k, a gift from Jay Keasling (Addgene plasmid #35288; http: / / n2t.net / addgene:35288; RRID:Addgene_35288
[0056] ). The vector was replaced with chloramphenicol resistance gene. The pLac promoter was replaced by Anderson promoter J23114 to drive the transcription. The amplified oligos were cloned onto upstream of GFP gene, which served as reporter. Tire constructed riboswitches were transformed into E. coli Acella. The transformants were spread onto the LB agar (Thermo Fisher Scientific, USA) plate without luteolin. Subsequently, the colonies formed on the plate were replicated onto anew LB agar plate with 35 LIM luteolin
[0057] , After overnight incubation, the fluorescence of the colonies on both plates were compared under an illuminator, and the colonies with more significant fluorescence intensity change were selected for characterization.
[0112] 1.4. Characterization of dose-response of the developed riboswitches[001 13] Cells were inoculated from glycerol stock and incubated overnight in LB (Lysogeny broth) supplemented with 25 pg / ml chloramphenicol at 37 °C with shaking at 225 rpm. Subsequently, 50 pl of the overnight culture was transferred into 5 ml fresh LB (Thermo Fisher Scientific, USA) containing 25 pg / ml chloramphenicol (Sigma, USA) and incubated for 2 h. The optical density at 600 nm (OD600) was measured, and the culture was then diluted to an OD600 of 0.1 using fresh LB supplemented with 25 pg / ml chloramphenicol. Based on the usual concentrations in microbial production systems
[0058] , flavonoids were added to final concentrations of 17.5, 35, 70, and 105 pM, respectively. The mixtures were dispensed into a 96- well plate (Greiner Bio-One, Austria) with 300 pl in each well. Samples without flavonoids served as controls. Each sample was prepared in triplicate. Cell growth (measured as absorbance at 600 nm) and biosensor response (quantified by GFP fluorescence with excitation and emission wavelengths of 470 nm and 520 nm, respectively, using a gain of 75) were monitored using a microplate reader (Hl, Biotek, USA). The 96-well plate was shaken kinetically, and readings were taken every 10 min over a period of 24 h. All data were baseline-corrected using the reading of LB supplemented with 25 pg / ml chloramphenicol.
[0114] 1.5. HPLCfor luteolin and other flavonoids measurement
[0115] Naringenin (^98 %, Sigma), apigenin (^97 %, Sigma), eridictyol (^98 %, Sigma), and luteolin were detected and quantified using high performance liquid chromatography (HPLC) (Hitachi, Japan). First, the standard curve for the flavonoids were established and shown in Fig. 6. As for sample preparation, 1 ml of E. coli cultures were mixed with 1 ml of ethanol ( ^99.5 %, Sigma, USA) and mixed gently with pipetting. Mixture was filtered through a Acrodisc 25 mm w / 0.2pm filter (PALL, USA) using a syringe. Filtrate was anal sed with a Chromaster HPLC (Hitachi, Japan) equipped with a Hitachi C18 column (4.5 mml.D x 150 mmL, 5 pM), with an injection volume of 10 pl, column temperature of 40 °C and a flow rate of 1.5 ml / min for 30 min. Mobile phase of HPLC consists of 40 % methanol (53=99.9 %, Sigma) and 6 % acetic acid (53= 99.7 %, Sigma- Aldrich) solution dissolved in water. Signals for all compounds were detected at 300 nm.
[0116] 1.6. Construction of the luteolin-producing E. coli strain
[0117] Plasmid pE6k-FNS to produce luteolin from eridictyol catalysed by the enzyme flavone synthase I (Accession number: Q7XZQ8.1) was assembled with Hi-Fi Gibson Assembly (NEB, UK). DNA sequence for FNS I was synthesized by IDT (Integrated DNA Technologies, USA). The FNS gene was cloned onto downstream of the IPTG-inducible promoter in the plasmid vector pBbE6k-RFP, and the RFP gene was removed. pBbE6k-RFP was a gift from Jay Keasling (Addgene, plasmid #35288;). Assembled plasmids were transformed via heat shock into Acella E. coli strain and recovered in LB media. Primers used in the study is shown in Table 6.
[0118] Table 6. Primers used in the present work
[0119] 1.7. Sensing of intracellular luteolin produced by E. coli
[0120] The luteolin-producing plasmid pE6K-FNS and luteolin biosensor were cotransformed into E. coli Acella. Cells were inoculated from glycerol stock and incubated overnight in LB supplemented with 50 pg / ml kanamycin (Sigma, USA) and 25 pg / rnl chloramphenicol at 37 °C with shaking at 225 rpm. Following this, 50 pl of the overnight culture was transferred into 5 ml fresh LB and incubated for 2 h. The cell density was measured, and the culture was then diluted to an OD600 of 0.1 using fresh LB. A gradient of IPTG (Sigma, USA) concentrations of 0, 50, 100, 200, 300 pM was set, while the eriodictyol concentration was fixed at 105 pM. The mixtures were dispensed into a 96- well plate (Greiner Bio-One, Austria) with 300 pl in each well, and each sample was prepared in triplicate. Cell growth and GFP fluorescence were measured over 24 h usingthe microplate reader. At the endpoint, the cell culture in the well plate was collected directly for HPLC analysis to determine the concentration of luteolin produced. The correlation between GFP reading and luteolin produced by E. coli was analysed.
[0121] Example 2 - Results and discussion
[0122] 3.1 Selection of aptamers for luteolin
[0123] SELEX is a well-established method for selecting oligonucleotide sequences that can bind to a target molecule with high affinity and specificity. The process involves multiple rounds of incubation and PCR amplification to isolate and amplify the oligos that bind to lutcolin. In this work, lutcolin aptamers were selected and amplified using SELEX. Luteolin-binding aptamers were first selected and enriched in vitro using SELEX process, as outlined in Fig. 1A. Lutcolin was first conjugated to the beads, and singlestranded oligos library was added for binding. Bound oligos were amplified via PCR, and the purified PCR product was then denatured to generate a single-stranded oligos library for next round of SELEX. This process allowed for the enrichment of luteolin-binding aptamers. To enable luteolin quantification, the absorbance spectrum and the standard curve of luteolin was established (Fig. 7 and Fig. 8). Successful conjugation of luteolin to the beads was confirmed by measuring the absorbance of the supernatant before and after binding. Fig. IB shows that, the majority (90 %) of luteolin was immobilized at room temperature, demonstrating efficient conjugation. Additionally, stability studies showed that the conjugated luteolin exhibit minimal release into the supernatant during the SELEX rounds and after three months of storage at 4 °C (Fig. 9), confirming that luteolin- conjugated beads remained stable. The SELEX process was monitored by evaluating PCR yield across rounds. Fig. 1C shows that the PCR yield increased with additional SELEX rounds, implying enrichment of luteolin-binding aptamers. The yield of PCR saturated between SELEX rounds 13-15, suggesting that most oligos at that stage were able to bind the beads. As a result, SELEX was terminated at round 15.
[0124] 1.2 Development of synthetic luteolin riboswitches
[0125] Next, luteolin riboswitches were constructed and selected using the aptamers enriched through SELEX. The aptamers were assembled into plasmids and cloned into the E. coli cells, with green fluorescence protein (GFP) serves as the reporter for riboswitches activity (experiment was conducted to ensure the GFP signal was not interfered by the flavonoids’ auto-fluorescence, Fig. 10). In the absence of luteolin, the riboswitch would likely form a secondary structure that blocks the Ribosome BindingSite (RBS) and inhibits translation. Upon luteolin binding, the riboswitch undergoes a conformational change that exposes RBS and enables translation of GFP, as illustrated in Fig. 2A. In other words, in the presence of luteolin, the cell harboring luteolin riboswitch would produce GFP as the readout.
[0126] To select functional riboswitches, luteolin concentration of 35 pM was used, as most recombinant E. coli strains produce luteolin below this concentration
[0013] . Chloramphenicol (25 pg / ml) was used to select and maintain cells harboring riboswitch plasmids. Since the biosensors were designed to operate effectively in LB medium, to minimize differences in interfering factors and ensure consistency in the biosensors’ operating conditions, the replica method utilized LB agar that sourced from the same supplier as the LB broth medium. After transformation, colonics were replicated onto another agar plate with 35 pM luteolin. Functional riboswitches were found by comparing the change in GFP between the two plates (illustrated in Fig. 11). In this work, two luteolin riboswitches were identified, named Luteolin Biosensor 1 (LB1) and Luteolin Biosensor 2 (LB2). The sensing element of the LB1 is the aptamer sequence “AATGTTTGCAGTCCNNNNTCAGTCNNNNGACTGAGGATAG” (RNA aptamer: AAUGUUUGCAGUCCNNNNUCAGUCNNNNGACUGAGGAUAG). The sensing element of the LB2 is is“AATGCTGGNNNNNCTAGTATAATCACATAACACATGTTTG’’ (RNA aptamer: AAUGCUGGNNNNNCUAGUAUNNNNAC AUNNNNAUGUUUG) . Their functionality was subsequently assessed in liquid LB culture through continuous incubation and GFP measurement using a spectrophotometer. The results indicated that a 16 h incubation period was sufficient to observe differences in GFP expression levels (Fig. 2B, Fig. 12). When 35 pM luteolin was added, LB1 and LB2 showed ~3.9 and ~4.6- fold activation respectively, confirming their responsiveness to luteolin. Interestingly, structural analysis revealed that the aptamers in both LB1 and LB2 retained similar conformations in both DNA and RNA forms (Fig. 13). This finding suggests that it is possible to use DNA oligos from SELEX for riboswitches development, reducing in vitro transcription and reverse-transcription steps.
[0127] 2.3 Dose-responses of the developed biosensors
[0128] To evaluate the performance of the developed biosensors, dose-response experiments were conducted across various luteolin concentrations. The concentrations gradient was set at 0, 1 .75, 17.5, 35, 70, and 105 pM, by taking together the considerationof luteolin concentration reported in microbial production systems [13, 57], physiologically relevant flavonoid levels
[0058] , and luteolin solubility. The biosensor activity was quantified by GFP intensity measured using a microplate reader.
[0129] Figure 3A and 3B show the dose-response curves for LB 1 and LB 2, respectively, based on GFP / OD reading after 16 hours of incubation. The fold change between 0 and 105 pM for LB1 and LB2 was around eight. The dose-response curves were fitted using Hill equation, with R2> 0.97 for both LB 1 and LB2. Both LB 1 and LB2 showed activation at low luteolin concentration (1.75 pM), with fold changes of 1.48 and 1.24-fold change (p < 0.01), respectively. LB1 showed a lower ECso (11.71 pM) and a greater fold change at 1.75 pM compared to LB2 (Figure 14), indicating higher affinity to lutcolin and faster saturation. In contrast, LB2 exhibited a higher ECso and a more pronounced increase in GFP expression at higher luteolin concentrations, reflecting a broader dynamic range. Besides, LB2 has steeper slope, suggesting LB2 has higher sensitivity than LB1. The time -response profiles of LB1 and LB2 (Figure 15) revealed a sharp increase within the first 50-60 minutes, demonstrating the rapid response of the luteolin biosensors. Further, the stability and reproducibility of the biosensors were validated by characterizing them in a different host, E. coli 10-beta (Figure 16), and in a different culture medium, M9 (Figure 17), where they maintained their ability to detect luteolin. These findings shows that riboswitch-based biosensors performed well under a wide range of conditions.
[0130] 2.4 Characterizing the response of developed biosensors to other flavonoids
[0131] In the process of luteolin production, metabolic pathways involve a range of enzymatic reactions where flavonoids might act as substrates or products (Figure 18 A). It is important for the biosensor to be able to distinguish the target products from the substrates. Therefore, the responses of the biosensors to three other flavonoids, specifically apigenin, eriodictyol, and naringenin, was evaluated. Naringenin usually serves as the substrate for flavonoids synthesis, while apigenin and eriodictyol can also serve as intermediates in luteolin synthesis.
[0132] Fluorescence intensities of the biosensors were measured at flavonoid concentrations of 0, 17.5, 35, 70, and 105 pM. The dose-responses of LB1 to different flavonoids were shown in Figure 4A. The results showed that the GFP fold activation (normalized to GFP expression at 0 pM flavonoid) of LB1 increased with increasing luteolin and eriodictyol concentrations, taking note that the response of LB 1 to luteolinwas 2.4-fold higher (p <0.001) than eriodictyol at 70 pM. More importantly, the response to luteolin was 4 times higher than naringenin at concentration of 70 pM, implying that LB 1 is not sensitive towards naringenin. In addition, while LB 1 showed minimal response to apigenin, with no clear increasing trend, suggesting low sensitivity or saturation at low apigenin concentrations.
[0133] Figure 4B presents the fold activation of LB2 to different flavonoids. Overall, LB2 showed stronger GFP expression, with 3.5-fold higher fold activation at 70 pM luteolin compared to LB 1. LB2 displayed an increasing trend of GFP expression in respond to higher lutcolin and apigenin concentrations. However, the response to lutcolin was much stronger than apigenin (2.2-fold higher GFP expression at 70 pM), implying that LB2 is more specific towards lutcolin. In contrast, LB2 showed no increasing trend for eriodictyol, suggesting the biosensors might have saturated at low concentration, or poorly respond to eridictyol. Moreover, response of LB2 to luteolin was 5.2 times higher than naringenin, suggesting very low specificity to naringenin.
[0134] To further quantify specificity, fluorescence intensities for each flavonoid were normalized against the response to luteolin at the same concentration (Figure 4C). Both LB 1 and LB2 were more responsive to luteolin as compared to apigenin, eriodictyol, and naringenin, despite structural similarities among the flavonoids (illustrated in Figure 4C). While eriodictyol might have some interference with LB2 at lower concentration such as 17.5pM, both LB1 and LB2 maintained stronger response to luteolin than other flavonoids at higher concentrations. Based on the observations, the biosensors’ utility in flavonoid detection extends beyond luteolin. For example, results in Figure 5 demonstrated that the LBl’s readout aligned very well with HPLC measurements of luteolin concentration produced by E. coli, even in the presence of eriodictyol. Furthermore, the biosensors can be applied to monitor other flavonoids by carefully selecting the biosensors and the synthesis pathways. For instance, when converting naringenin to eriodictyol or apigenin (Figure 18 A), LB1 can be used for eriodictyol and LB2 for apigenin, respectively. The application of using LB2 for sensing apigenin production from naringenin was further demonstrated in Figure 19, highlighting versatility of the biosensors in various applications.
[0135] 2.5 Sensing intracellular E. coli-produced luteolin
[0136] In addition to the ability of LB 1 and LB2 to detect extracellular flavonoids, the intracellular sensing capabilities of the developed luteolin biosensors was furtherdemonstrated. To this end, a luteolin-producing E. coll strain was engineered and LB 1 was employed to monitor the intracellular luteolin, as LB2 might be interfered by the eriodictyol when detecting low luteolin concentration (Figure 4B). To enable luteolin production, plasmid pE6K-FNS was constructed, which encodes the Flavonoid Synthase (FNS) enzyme responsible for converting eriodictyol to luteolin. The FNS expression was under the control of an IPTG-inducible promoter. The LB 1 and pE6K-FNS were then cotransformed into E. coli. When eriodictyol and IPTG were added into the cell culture, the FNS enzyme would be expressed, leading to the conversion of eriodictyol to luteolin. The intracellularly produced lutcolin would then activate LB1, enabling the translation of GFP and generating the fluorescence signal, as illustrated in Figure 5A.
[0137] To study the capability of LB 1 in detecting various concentration of intracellular luteolin, IPTG concentration gradient was set at 0, 50, 100, 200, 300 pM to vary FNS expression levels, while substrate eriodictyol concentration was fixed at 105 pM due to the solubility limitation. The cell growth and GFP levels were continuously monitored over 24 hours at 30°C, in which temperature the enzyme would have better stability. Figure 5B showed GFP / OD increased with higher IPTG concentration, with fold changes of 3.1, 5.4, 7.4, and 9.6 at 50, 100, 200, 300 pM IPTG, respectively. At the endpoint of the cell culture, HPLC was used to confirm the luteolin concentrations produced by E. coli (Figure 5C, Figure 20). HPLC measurement results showed that the luteolin concentrations produced by E. coll increased with higher IPTG concentration (Table 6). The HPLC analysis confirmed that BL1 exhibited significant responsiveness to 2.25 pM luteolin that produced by E. coli, demonstrating a low intracellular detection limit. A strong linear correlation (R2= 0.93) was observed between GFP / OD signals and luteolin concentrations measured by HPLC (Figure 5D), validating the biosensor’s accuracy in detecting the intracellular luteolin. Interestingly, although the intracellularly produced luteolin concentration was lower than the externally supplied concentrations tested previously (Figure 3), the biosensor showed stronger GFP expression. This enhanced response is likely due to better accessibility of intracellular luteolin to the biosensor. Despite that the biosensor might also respond to eriodictyol, as seen in Figure 4, the biosensor’s readouts reliably indicated the luteolin concentrations even in the presence of eriodictyol. These results suggest that the biosensor can effectively detect intracellular luteolin production, enabling real-time monitoring of the biosynthesis process, as well as other flavonoid-related in vivo applications.
[0138] Table 6. Direct comparative data between biosensor and HPLC analysis results, in the in vivo luteolin sensing experiment.
[0139] 2.6 Performance of the biosensor at various temperatures
[0140] Testing a biosensor at different temperatures is crucial for microbial engineering, since cell growth, enzymatic activity, protein stability, and biosensor regulatory elements may vary with temperature. To this end, the LB2 was tested at 18, 25, 30, 37, and 40 °C, with luteolin concentrations of 0, 1.75, 17.5, 35, 70, and 105 pM (Figure 21). The sensor showed highest GFP expression at 37 °C in response to different luteolin concentrations (Figure 21D). The GFP expression at 18 and 25 °C (Figure 21A- B) exhibited a lower level as compared to 30 and 37 °C (Figure 21C-D). Regardless, the LB2’s output increased when increasing luteolin concentration in the temperature 18 - 37 °C, demonstrating its robustness across a broad temperature range. Although the sensor’s output showed an increasing trend from luteolin concentrations of 0 - 35 pM at 40 °C, however, a weaker correlation between sensor output and luteolin concentration at 70 and 105 pM were observed (Figure 2 IE).
[0141] Example 3 - Conclusions
[0142] In this work, two novel luteolin-responsive riboswitch biosensors that demonstrate good sensitivity and specificity were developed. These biosensors are capable of both in vitro and in vivo detection of luteolin. They showed significant responses to luteolin within 50-60 minutes and exhibited operational range of 1.75 - 105 pM, with a fold change of up to 9.2. Notably, they exhibited responsiveness at luteolin concentrations as low as 1.75 pM, showcasing a low detection limit. Moreover, the biosensors demonstrated robust performance under various conditions, including different temperatures, culture medium, and host strains, confirming their stability and reproducibility. Importantly, the present biosensors effectively detected intracellular luteolin produced by E. coli, achieving up to 9.6-fold change and displaying consistentresults with HPLC analysis. Additionally, these biosensors also demonstrated applications for detecting other flavonoids (apigenin), further extending their utility.
[0143] Unlike previous riboswitch development studies rely on RNA oligos for SELEX [34, 51], the present approach utilized DNA, which offers greater stability and simplified operational procedures. By integrating DNA-based SELEX with replica methods, a streamlined strategy for riboswitch development was established. This work developed two biosensors with different sensitivity, dynamic range, specificity, and fold activation. Having the two biosensors expands their applications, allowing utility in different flavonoid concentrations, types, and pathways. Overall, these biosensors represent valuable tools for flavonoid-related applications in flavonoid analytics and in vivo sensing, with potential uses in, high-throughput screening
[0059] , real-time monitoring
[0060] , metabolic engineering
[0014] , and biosynthesis pathways regulation
[0016] .
[0144] The disclosed biosensors addressed an important limitation in the sensing of luteolin and other naringenin derived flavonoids and represented a significant step towards achieving efficient and sustainable production of luteolin and other naringenin derived flavonoids. To the best of the inventors’ knowledge, there is no riboswitch of luteolin and other naringenin derived flavonoids available in the market or reported in the literature.
[0145] Commercial applications for these luteolin biosensors include: i) Using this biosensor to develop detection kits of luteolin and other naringenin derived flavonoids for point of use. ii) Using the biosensor for ultra-high throughput screening of the luteolin- and other naringenin derived flavonoids- producing cnzymc / strains. This will greatly reduce the labour and time requirements, accelerating the biomanufacturing of luteolin and other naringenin derived flavonoids for market. iii) Dynamic regulation of biosynthesis pathways to control and optimize bioproduction of luteolin and other naringenin derived flavonoids. iv) Food quality control, for example, determination of luteolin and other naringenin derived flavonoids in Chrysanthemum tea. v) Bioprocess optimization for scaling up, monitoring of luteolin and other naringenin derived flavonoids produced by microbes in bioreactor.
[0146] The biosensor as disclosed herein offers several significant advantages:
[0147] First, the novel biosensor enables the detection of luteolin and other naringenin derived flavonoids both in vitro and in vivo. It is able to measure the concentration of luteolin and other naringenin derived flavonoids in vivo right after it is produced inside the cell, providing a more accurate measurement of the biosynthesis of luteolin and other naringenin derived flavonoids, unlike conventional sensors (e.g., HPLC, electrochemical sensors) that can only measure the target concentration in vitro (outside the cell).
[0148] Second, the disclosed biosensor is a whole cell-based living biosensor, which allows single cell real-time monitoring the concentration of luteolin and other naringenin derived flavonoids at single cell level, avoid the need to do sample preparation and running HPLC which is tedious, time consumption and limited in throughput.
[0149] Third, the biosensor as disclosed herein can be easily fabricated at low cost (about SGD 0.0035 per sensing reaction), and it is possible to grow the cell to expand the biosensor for larger quantity measurement.
[0150] Forth, the biosensor as disclosed herein has a wide dynamic sensing range of 5-120 pM, that is sufficient to cover the working concentration for detection of luteolin and other naringenin derived flavonoids, and relevant strain / enzyme screening.
[0151] Finally, the biosensor as disclosed herein enables ultra-high throughput screening for strain / enzymes.
[0152] Industrial Applicability
[0153] It will be apparent that various other modifications and adaptations of the invention will be apparent to the person skilled in the art after reading the foregoing disclosure without departing from the spirit and scope of the invention and it is intended that all such modifications and adaptations come within the scope of the appended claims.Reference[1] S. Kumar and A. K. Pandey, "Chemistry and Biological Activities of Flavonoids: An Overview," The Scientific World Journal, vol. 2013, p. 162750, 2013 / 12 / 29 2013.[2] L. H. Yao et al., "Flavonoids in food and their health benefits," (in eng), Plant Foods HumNutr, vol. 59, no. 3, pp. 113-22, Summer 2004.[3] F. Ntalouka and A. Tsirivakou, "Luteolin: A promising natural agent in management of pain in chronic conditions," (in eng), Front Pain Res (Lausanne), vol. 4, p. 1 1 14428, 2023.[4] Y. Luo, P. Shang, and D. Li, "Luteolin: A Flavonoid that Has Multiple Cardioprotective Effects and Its Molecular Mechanisms," (in eng), Front Pharmacol, vol. 8, p. 692, 2017.[5 J E. A. Trantas, M. A. Koffas, P. Xu, and F. Ververidis, "When plants produce not enough or at all: metabolic engineering of flavonoids in microbial hosts," (in eng). Front Plant Sci, vol. 6, p. 7, 2015.[6] H. Lou, L. Hu, H. Lu, T. Wei, and Q. Chen, "Metabolic Engineering of Microbial Cell Factories for Biosynthesis of Flavonoids: A Review," Molecules, vol. 26, no. 15. doi: 10.3390 / molecules26154522[7] R. P. Pandey, P. Parajuli, M. A. G. Koffas, and J. K. Sohng, "Microbial production of natural and non-natural flavonoids: Pathway engineering, directed evolution and systems / synthetic biology," Biotechnology Advances, vol. 34, no. 5, pp. 634-662, 2016 / 09 / 01 / 2016.[8] J. Wang, S. Guleria, M. A. G. Koffas, and Y. Yan, "Microbial production of value-added nutraceuticals," Current Opinion in Biotechnology, vol. 37, pp. 97- 104, 2016 / 02 / 01 / 2016.[9] J. Zha, X. Wu, G. Gong, and M. A. G. Koffas, "Pathway enzyme engineering for flavonoid production in recombinant microbes," Metabolic Engineering Communications, vol. 9, p. e00104, 2019 / 12 / 01 / 2019.
[0010] J. E. Kufs et al., "Rational Design of Flavonoid Production Routes Using Combinatorial and Precursor-Directed Biosynthesis," ACS Synthetic Biology, vol. 9, no. 7, pp. 1823-1832, 2020 / 07 / 17 2020.
[0011] S. Tsogai, M. Tominaga, A. Kondo, and J. Tshii, "Plant Flavonoid Production in Bacteria and Yeasts," Frontiers in Chemical Engineering, vol. 4, 2022.
[0012] E. Leonard, Y. Yan, K. H. Lim, and M. A. Koffas, "Investigation of two distinct flavone synthases for plant- specific flavone biosynthesis in Saccharomyccs cerevisiae," (in eng), Appl Environ Microbiol, vol. 71, no. 12, pp. 8241-8, Dec 2005.
[0013] E. Leonard et al., "Strain Improvement of Recombinant Escherichia coli for Efficient Production of Plant Flavonoids," Molecular Pharmaceutics, vol. 5, no. 2, pp. 257-265, 2008 / 04 / 01 2008.
[0014] D. Liu, T. Evans, and F. Zhang, "Applications and advances of metabolite biosensors for metabolic engineering," Metabolic Engineering, vol. 31, pp. 35- 43, 2015 / 09 / 01 / 2015.
[0015] T. C. Williams, I. S. Pretorius, and I. T. Paulsen, "Synthetic Evolution of Metabolic Productivity Using Biosensors," (in eng), Trends Biotechnol, vol. 34, no. 5, pp. 371-381, May 2016.
[0016] Y. Teng, J. Zhang, T. Jiang, Y. Zou, X. Gong, and Y. Yan, "Biosensor-enabled pathway optimization in metabolic engineering," (in eng), Curr Opin Biotechnol, vol. 75, p. 102696, Jun 2022.
[0017] J. Zhang, M. K. Jensen, and J. D. Keasling, "Development of biosensors and their application in metabolic engineering," Current Opinion in Chemical Biology, vol. 28, pp. 1-8, 2015 / 10 / 01 / 2015.
[0018] J. K. Rogers, N. D. Taylor, and G. M. Church, "Biosensor-based engineering of biosynthetic pathways," Current Opinion in Biotechnology, vol. 42, pp. 84-91 , 2016 / 12 / 01 / 2016.
[0019] D. S. Latchman, "Transcription factors: an overview," (in eng), Int J Biochem Cell Biol, vol. 29, no. 12, pp. 1305-12, Dec 1997.
[0020] J. K. Rogers and G. M. Church, "Genetically encoded sensors enable real-time observation of metabolite production," Proceedings of the National Academy of Sciences, vol. 113, no. 9, pp. 2388-2393, 2016.
[0021] A. Scrganov and D. J. Patel, "Ribozymes, riboswitchcs and beyond: regulation of gene expression without proteins," Nature Reviews Genetics, vol. 8, no. 10, pp. 776-790, 2007 / 10 / 01 2007.
[0022] Joe C. Liang, Ryan J. Bloom, and Christina D. Smolke, "Engineering Biological Systems with Synthetic RNA Molecules," Molecular Cell, vol. 43, no. 6, pp. 915-926, 2011 / 09 / 16 / 2011.
[0023] C. Berens and B. Suess, "Riboswitch engineering - making the all-important second and third steps," (in eng), Curr Opin Biotechnol, vol. 31, pp. 10-5, Feb 2015.
[0024] B. Sequeira- Antunes and H. A. Ferreira, "Nucleic Acid Aptamer-Based Biosensors: A Review," (in eng), Biomedicines, vol. 11, no. 12, Dec 1 2023.
[0025] M. McKeague and M. C. DeRosa, "Challenges and Opportunities for Small Molecule Aptamer Development," Journal of Nucleic Acids, vol. 2012, no. 1, p. 748913, 2012.
[0026] R. R. Breaker, "Riboswitches and Translation Control," (in eng), Cold Spring Harb Per sped Biol, vol. 10, no. 11, Nov 1 2018.
[0027] A. Serganov and E. Nudler, "A decade of riboswitches," (in eng), Cell, vol. 152, no. 1-2, pp. 17-24, Jan 17 2013.
[0028] R. R. Breaker, "Riboswitchcs and the RNA world," (in eng), Cold Spring Harb Perspect Biol, vol. 4, no. 2, Feb 1 2012.
[0029] A. D. Garst, A. L. Edwards, and R. T. Batey, "Riboswitches: structures and mechanisms," (in eng), Cold Spring Harb Perspect Biol, vol. 3, no. 6, Jun 1 2011.
[0030] Y. Liu, H. Yuan, D. Ding, H. Dong, Q. Wang, and D. Zhang, "Establishment of a Biosensor-based High-Throughput Screening Platform for Tryptophan Overproduction," ACS Synth Biol, vol. 10, no. 6, pp. 1373-1383, Jun 18 2021.
[0031] J. Yang et al., "Synthetic RNA devices to expedite the evolution of metaboliteproducing microbes," Nature Communications, vol. 4, no. 1, p. 1413, 2013 / 01 / 29 2013.
[0032] Z. F. Hallberg, Y. Su, R. Z. Kitto, and M. C. Hammond, "Engineering and In Vivo Applications of Riboswitches," (in eng), Annu Rev Biochem, vol. 86, pp. 515-539, Jun 202017.
[0033] T. H. T. Chau, D. H. A. Mai, D. N. Pham, H. T. Q. Le, and E. Y. Lee, "Developments of Riboswitches and Toehold Switches for Molecular Detection-Biosensing and Molecular Diagnostics," (in eng), Ini J Mol Sci, vol. 21, no. 9, Apr 30 2020.
[0034] F. Groher and B. Suess, "Synthetic riboswitches — A tool comes of age," Biochimica et Biophy sica Acta (BBA) - Gene Regulatory Mechanisms, vol. 1839, no. 10, pp. 964-973, 2014 / 10 / 01 / 2014.
[0035] N. Sudarsan, S. Cohen-Chalamish, S. Nakamura, G. M. Emilsson, and R. R. Breaker, "Thiamine Pyrophosphate Riboswitches Are Targets for the Antimicrobial Compound Pyrithiamine," Chemistry & Biology, vol. 12, no. 12, pp. 1325-1335, 2005 / 12 / 01 / 2005.
[0036] G. Mirihana Arachchilage, M. E. Sherlock, Z. Weinberg, and R. R. Breaker, "SAM-VI RNAs selectively bind S-adenosylmethionine and exhibit similarities to SAM-111 riboswitches," (in eng), RNA Biol, vol. 15, no. 3, pp. 371-378, Mar 4 2018.
[0037] T. H. T. Chau, D. H. A. Mai, D. N. Pham, H. T. Q. Lc, and E. Y. Lee, "Developments of Riboswitchcs and Toehold Switches for Molecular Dctcction- Bioscnsing and Molecular Diagnostics," (in eng), International journal of molecular sciences, vol. 21, no. 9, p. 3192, 2020.
[0038] J. K. Wickiser, W. C. Winkler, R. R. Breaker, and D. M. Crothers, "The Speed of RNA Transcription and Metabolite Binding Kinetics Operate an FMN Riboswitch," Molecular Cell, vol. 18, no. 1, pp. 49-60, 2005.
[0039] E. M. Sherman, J. Esquiaqui, G. Elsayed, and J. D. Ye, "An energetically beneficial leader-linker interaction abolishes ligand-binding cooperativity in glycine ribo switches," (in eng), Rna, vol. 18, no. 3, pp. 496-507, Mar 2012.
[0040] D. Kelvin and B. Suess, "Tapping the potential of synthetic riboswitches: reviewing the versatility of the tetracycline aptamer," (in eng), RNA Biol, vol.20, no. 1, pp. 457-468, Jan 2023.
[0041] P. Ketzer et al., "Artificial riboswitches for gene expression and replication control of DNA and RNA viruses," Proceedings of the National Academy of Sciences, vol. I l l, no. 5, pp. E554-E562, 2014.
[0042] G. Bauer and B. Suess, "Engineered riboswitches as novel tools in molecular biology," (in eng), J Biotechnol, vol. 124, no. 1, pp. 4-11, Jun 25 2006.
[0043] P. Ketzer et al., "Artificial riboswitches for gene expression and replication control of DNA and RNA viruses," Proceedings of the National Academy of Sciences, vol. I l l, no. 5, pp. E554-E562, 2014.
[0044] R. Kent and N. Dixon, "Systematic Evaluation of Genetic and Environmental Factors Affecting Performance of Translational Ribo switches," ACS Synthetic Biology, vol. 8, no. 4, pp. 884-901, 2019 / 04 / 19 2019.
[0045] M. Etzel and M. Morl, "Synthetic Riboswitches: From Plug and Pray toward Plug and Play," Biochemistry, vol. 56, no. 9, pp. 1181-1198, 2017 / 03 / 07 2017.
[0046] M. E. Sherlock, N. Sudarsan, S. Stav, and R. R. Breaker, "Tandem riboswitches form a natural Boolean logic gate to control purine metabolism in bacteria," eLife, vol. 7, p. e33908, 2018 / 03 / 05 2018.
[0047] C. Lu et al., "Crystal structures of the SAM-UI / SMK riboswitch reveal the SAM-dependent translation inhibition mechanism," Nature Structural & Molecular Biology, vol. 15, no. 10, pp. 1076-1083, 2008 / 10 / 01 2008.
[0048] B. Strobel et al., "A Small-Molecule-Responsive Riboswitch Enables Conditional Induction of Viral Vector-Mediated Gene Expression in Mice," ACS Synthetic Biology, vol. 9, no. 6, pp. 1292-1305, 2020 / 06 / 19 2020.
[0049] J. K. Villa, Y. Su, L. M. Contreras, and M. C. Hammond, "Synthetic Biology of Small RNAs and Riboswitches," (in eng), Microbiol Spectr, vol. 6, no. 3, May 2018.
[0050] M.-C. Wu et al., "Rational Re-engineering of a Transcriptional Silencing PreQi Riboswitch," Journal of the American Chemical Society, vol. 137, no. 28, pp. 9015-9021, 2015 / 07 / 22 2015.
[0051] S. Jang et al., "Development of Artificial Riboswitches for Monitoring of Naringenin Tn Vivo," ACS Synth Biol, vol. 6, no. 1 1 , pp. 2077-2085, Nov 17 2017?
[0052] P. Mehrshahi et al., "Development of Novel Riboswitches for Synthetic Biology in the Green Alga Chlamydomonas," ACS Synthetic Biology, vol. 9, no. 6, pp. 1406-1417, 2020 / 06 / 19 2020.
[0053] L. Gold, "SELEX: How It Happened and Where It will Go," (in eng), J Mol Evol, vol. 81, no. 5-6, pp. 140-3, Dec 2015.
[0054] J. Lcdcrbcrg and E. M. Lcdcrbcrg, "Replica plating and indirect selection of bacterial mutants," (in eng), J Bacterial, vol. 63, no. 3, pp. 399-406, Mar 1952.
[0055] A. D. Ellington and J. W. Szostak, "In vitro selection of RNA molecules that bind specific ligands," Nature, vol. 346, no. 6287, pp. 818-822, 1990 / 08 / 01 1990.
[0056] W. K. D. Chee, J. W. Yeoh, V. L. Dao, and C. L. Poh, "Highly Reversible Tunable Thermal-Repressible Split-T7 RNA Polymerases (Thermal-T7RNAPs) for Dynamic Gene Regulation," ACS Synthetic Biology, vol. 11, no. 2, pp. 921- 937, 2022 / 02 / 18 2022.
[0057] L. Marin, I. Gutierrez-Del-Rio, P. Yague, A. Manteca, C. J. Villar, and F. Lombo, "De Novo Biosynthesis of Apigenin, Luteolin, and Eriodictyol in the Actinomycete Streptomyces albus and Production Improvement by Feeding and Spore Conditioning," Front Microbiol, vol. 8, p. 921, 2017.
[0058] S. Jang, K. W. Kelley, and R. W. Johnson, "Luteolin reduces TL-6 production in microglia by inhibiting JNK phosphorylation and activation of AP-1," Proceedings of the National Academy of Sciences, vol. 105, no. 21, pp. 7534- 7539, 2008.
[0059] Y. Liu, H. Yuan, D. Ding, H. Dong, Q. Wang, and D. Zhang, "Establishment of a Bioscnsor-bascd High-Throughput Screening Platform for Tryptophan Overproduction," ACS Synthetic Biology, vol. 10, no. 6, pp. 1373-1383, 2021 / 06 / 18 2021.
[0060] Z. F. Hallberg, Y. Su, R. Z. Kitto, and M. C. Hammond, "Engineering and In Vivo Applications of Riboswitches," Annual Review of Biochemistry, vol. 86, no. 1, pp. 515-539, 2017 / 06 / 202017.
[0061] I. L. Hofacker and P. F. Stadler, "Memory efficient folding algorithms for circular RNA secondary structures," Bioinformalics, vol. 22, no. 10, pp. 1172- 1176, 2006.
Claims
Claims1. An aptamer capable of binding to luteolin and other naringenin derived flavonoids, wherein the aptamer is: an RNA aptamer having a nucleotide sequence selected from the group consisting of: GUCCNNNNUCAGUCNNNNGACUGAGGAU (SEQ ID NO: 1 ), and AUGCUGGNNNNNCUAGUAUNNNNACAUNNNNAUGU (SEQ ID NO: 2); or a DNA aptamer having a nucleotide sequence selected from the group consisting of: GTCCNNNNTCAGTCNNNNGACTGAGGAT (SEQ ID NO: 3), and ATGCTGGNNNNNCTAGTAT (SEQ ID NO: 4); wherein for SEQ ID NO: 1 and 2, N is one nucleotide selected from the group consisting of A, G, C and U, and wherein for SEQ ID NO: 3 and 4, N is one nucleotide selected from the group consisting of A, G, C and T.
2. The aptamer of claim 1, wherein the other naringenin derived flavonoids is selected from the group consisting of apigenin and eriodictyol.
3. The aptamer of claim 2, wherein the aptamer having a nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 3 is capable of binding to luteolin or eriodictyol, and wherein the aptamer having a nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 4 is capable of binding to luteolin or apigenin.
4. A riboswitch comprising the RNA aptamer of any one of claims 1-3, a ribosomal binding site (RBS) and a reporter; wherein the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
5. The riboswitch of claim 4, wherein the RBS is selected from the group consisting of E.coli RBS having a consensus sequence of AGGA, a default RBS having a sequence of tttaagaaggagatatacat, and RBS34 having a sequence of tctagagaaagaggagaaatactag.
6. The riboswitch of claim 4, wherein the reporter is selected from the group consisting of fluorescence protein, fluorophore, colour dye, luminophore, and luciferase.
7. The riboswitch of claim 6, wherein the fluorescence protein is selected from the group consisting of a green fluorescence protein selected from the group consisting of EGFP, Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen and T-Sapphire; a blue fluoresce protein selected from the group consisting of EBFP, EBFP2, Azurite and mTagBFP; a cyan fluoresce protein selected from the group consisting of ECFP, mECFP, Cerulean, mTurquoise, CyPet,AmCyanl, Midori-Ishi Cyan, TagCFP and mTFPl (Teal); a yellow fluorescence protein selected from the group consisting of EYFP, Topaz, Venus, mCitrine, YPet, TagYFP, PhiYFP, Zs Yellowl and mBanana; an orange fluorescence protein selected from the group consisting of Kusabira Orange, Kusabira Orange2, mOrange, m0range2, dTomato, dTomato-Tandem, TagRFP, TagRFP-T, DsRed, DsRed2, DsRed-Express (Tl), DsRed-Monomer and mTangerine; and a red fluorescence protein selected from the group consisting of mRuby, mApple, mStrawberry, AsRed2, mRFPl, JRed, mCherry, HcRedl, mRaspberry, dKeima-Tandem, He Red-Tandem, mPlum, and AQ143.
8. A DNA expression cassette for the regulation of the expression of the reporter of any one of claims 4-7, comprising a promoter, a DNA aptamer of any one of claims 1-3, a DNA sequence encoding the RBS and a DNA sequence encoding the reporter of the riboswitch of any one of claims 4-7.
9. The DNA expression cassette of claim 8, wherein the promoter is selected from the group consisting of a E. coli o70, o19, o24, o28, o32, o38, and o54promoter.
10. A composition for detecting luteolin and other naringenin derived flavonoids, comprising the riboswitch of any one of claims 4-7, and a translation mixture.
11. A composition for detecting luteolin and other naringenin derived flavonoids, comprising the DNA expression cassette of claim 8 or 9, a transcription mixture and a translation mixture.
12. The composition of claim 10 or 11, wherein the translation mixture is a E. coli cell- free translation mixture.
13. The composition of claim 11, wherein the transcription mixture is E. coli cell-free transcription mixture.
14. A microbe containing the riboswitch of any one of claims 4-7 or the DNA expression cassette of claim 8 or 9.
15. The microbe of claim 14, wherein the microbe is a prokaryote selected from the group consisting of E. coli, B. subtilis, Pseudomonas, Lactobacillus, Spirilla, Vibrio, Salmonella, Acetobacter, Cyanobacteria, Spirochetes, Chlamydias, Caulobacter, Mycoplasma, Aliivibrio, Bacteroides, Synechocystis, Azotobacter, Streptomyces, Thermococcus, Sulfolobus, Streptococcus, Methanococcus, Halobacterium, other proteobacteria and a gram-positive bacterium.
16. A method of detecting luteolin and other naringenin derived flavonoids produced in a microbe, comprising (a) introducing the riboswitch of any one of claims 4-7 or the DNA expression cassette of claim 8 or 9 into the microbe, wherein when the microbe produces the luteolin and the other naringenin derived flavonoids in an effective amount, the luteolin and the other naringenin derived flavonoids specifically bind the aptamer to induce a conformational change in the riboswitch that allows translation of the reporter into a reporter protein; and(b) detecting the reporter protein, wherein the presence of the reporter protein is indicative of detection of the lutcolin and other naringenin derived flavonoids.
17. A method of detecting luteolin and other naringenin derived flavonoids produced by a microbe, comprising(a) incubating the microbe with the composition of claim 10 or the composition of claim 11 in a medium, wherein when the microbe produces and releases the luteolin and the other naringenin derived flavonoids in an effective amount into the medium, the luteolin and the other naringenin derived flavonoids specifically bind the aptamer of the riboswitch to induce a conformational change in the riboswitch that allows translation of the reporter into a reporter protein; and(b) detecting the reporter protein, wherein the presence of the reporter protein is indicative of detection of the luteolin and other naringenin derived flavonoids.
18. A method of detecting luteolin and other naringenin derived flavonoids produced by a first microbe, comprising(a) incubating the first microbe and the microbe of claim 14 or 15 in a medium; wherein when the first microbe produces and releases the lutcolin and the other naringenin derived flavonoids in an effective amount into the medium, the luteolin and the other naringenin derived flavonoids specifically bind the aptamer of the riboswitch produced by the microbe of claim 14 or 15 to induce a conformational change in the riboswitch that allows translation of the reporter into a reporter protein; and(b) detecting the reporter protein, wherein the presence of the reporter protein is indicative of detection of the luteolin and the other naringenin derived flavonoids.
19. The method of any one of claims 16-18, wherein the microbe is a prokaryote selected from the group consisting of E. coli, B. subtilis, Pseudomonas, Lactobacillus, Spirilla, Vibrio, Salmonella, Acetobacter, Cyanobacteria, Spirochetes, Chlamydias,Caulobacter, Mycoplasma, Aliivibrio, Bacteroides, Synechocystis, Azotobacter, Streptomyces, Thermococcus, Sulfolobus, Streptococcus, Methanococcus, Halobacterium, other proteobacteria and a gram-positive bacterium.
20. The method of any one of claims 16-19, wherein the other naringenin derived flavonoids are selected from the group consisting of apigenin and eriodictyol.
21. The method of claim 20, wherein the luteolin or the other naringenin derived flavonoids have a concentration of at least 1 pM, at least 1.75 pM, at least 2 pM, at least 2.25 pM, at least 5 pM, at least 7.5 pM, at least 10 pM, at least 15 pM, at least 17.5 pM, at least 35 pM, at least 70 pM, or at least 105 pM.
22. The method of any one of claims 16-21, wherein the reporter protein is detected by fluorescent detection, colorimetric detection, biolumincsccncc detection, spectrophotometry, and DNA microarray.
23. The method of any one of claims 16-22, wherein the level of the reporter protein translated is at least about 1.24-fold higher when the luteolin and the other naringenin derived flavonoid is present than the level when the luteolin and the other naringenin derived flavonoid is absent.
24. The method of any one of claims 16-23, wherein the method is performed at a temperature of 18-37 °C.