Synthetic DNA template for in vitro mRNA transcription of antigen receptors

Abstract

The present invention relates to a plasmid-free modular synthetic DNA templates (MSDT) and the manufacturing thereof. In particular, the invention relates to an MSDT to be used for in vitro mRNA transcription of antigen receptors and uses thereof in immunotherapy or immunotherapy screening and validation of candidate TCR pairs or CARs. Compared to existing constructs and methods, the present approach is plasmid-free, fast and inexpensive, allowing high throughput screening and validation of potential antigen receptor candidates in immunotherapy assays.

Description

[0001] SYNTHETIC DNA TEMPLATE FOR IN VITRO mRNA TRANSCRIPTION OF ANTIGEN RECEPTORS

[0002] FIELD OF THE INVENTION

[0003] The present invention relates to a plasmid-free modular synthetic DNA template (MSDT) and the manufacturing thereof. In particular, the invention relates to an MSDT to be used for in vitro mRNA transcription of antigen receptors and uses thereof in immunotherapy or immunotherapy screening and validation of candidate TOR pairs or CARs. Compared to existing constructs and methods, the present approach is plasmid-free, fast and inexpensive, allowing high throughput screening and validation of potential antigen receptor candidates in immunotherapy assays.

[0004] BACKGROUND TO THE INVENTION

[0005] The favorable role of anti-cancer T cell immune responses has been heavily investigated in the field of immune-oncology and is associated with high tumor mutation burden (TMB). This, resulting in a high neoepitope load, creates an opportunity for personalized immunotherapies such as therapeutic vaccination and adoptive cell transfer (ACT) of neoantigen cognate T cell receptor (TCR) expressing T cells. Prior research supports that the response to immunotherapy is partially because of the recognition of patient-specific neoepitopes by autologous tumor infiltrating T cells (TIL), indicating that identification of clinically relevant neoepitope and cognate TCR pairs forms the foundation of such therapies. This is potentiated by the increased availability of sequencing methods as next generation sequencing (NGS) and whole exome sequencing (WES) making in silico prediction of neoepitopes more attainable. This, together with a multitude of prediction algorithms, has resulted in a large pool of neoepitopes, which amplifies the unmet need for a quick, and versatile method that allows not only for validation of neoepitopes, but also confirms cognate TCR for personalized cell-based therapies directed towards solid tumors.

[0006] The TCR pair comprises a molecular set, including an alpha and beta chain expressed as separate proteins, forming one united structure once exhibited on the T cell membrane. Each chain is produced through combinatorial somatic rearrangement of multiple receptor features, including the variable (V), diversity (V, for only beta chains), joining (J) and constant I gene segments, which result in 2*E19 unique TCR pairs. Although this estimation is probably lower in vivo due to a functional selection process, which combined with the variability of the complementary-determining region 3 (CDR3) allows recognition of a vast number of major histocompatibility complex (MHC) molecules presenting self- and foreign epitopes.

[0007] With the fast progress of high throughput neoepitope identification, TCR sequencing was enabled with the development of sequencing methods, improving upon the sensitivity of TCR detection and discovery. As novel and more accurate single cell TCR sequencing methods result in larger database archives, recent research has focused on identifying characteristics of neoantigen cognate T cell populations. Yet, one of the main challenges in TCR delivery remains the fact that the corresponding constructs are rather large in size, and accordingly difficult to produce in vitro.

[0008] Alternatively, chimeric antigen receptor (CAR)-T cells can be used as an adoptive cell therapy for treating various cancers. This approach involves modifying patient-derived T cells with a CAR that specifically recognizes a target antigen. Upon target recognition, the CAR-T cells activate and expand, triggering a target-specific immune response against tumor cells. While CAR-T therapy has shown curative success in hematological malignancies, challenges remain in addressing solid tumors. The complex and immunosuppressive tumor microenvironment (TME), along with physical barriers, limits CAR-T cell access and penetration into tumors. Furthermore, the heterogeneous antigen expression in solid tumors complicates the identification of tumor-specific targets, increasing the risk of on-target, off-tumor toxicity. To address these challenges, new CAR designs and strategies are being developed, emphasizing the need for fast and versatile methods to test CAR-T cell products.

[0009] The CAR structure consists of three main domains: an extracellular domain that includes the antigen-binding moiety and hinge region, a transmembrane domain necessary to anchor the receptor to the cell membrane and an intracellular domain, comprising costimulatory (e.g., 4-1 BB, CD28) and activation domains (e.g., CD3Q. Target recognition through the antigen-binding domain initiates a signaling cascade that activates the T cell. This activation leads to the release of granzyme B, perforin, cytokines (e.g., IFNy, TNFa), and expression of death-inducing ligands (e.g., Fas ligand), resulting in a cytotoxic effect on tumor cells expressing the target antigen. Each domain in the CAR can be varied, impacting on CAR and CAR-T functionality. This is exemplified by the antigen-binding domain that can consist of e.g., single-chain variable fragments (scFv) and singledomain antibodies (nanobodies, Nbs) with a variety of nanobodies often available to target the antigen of choice, necessitating a method to screen the best functioning nanobody.

[0010] In this work, we developed a versatile platform for the delivery of a modular synthetic DNA template (MSDT) encoding an antigen receptor such as a TCR (T-cell receptor) single chain (alpha and beta) or a CAR, which overcomes difficulties in adoptive cell therapy development. MSDT can be exploited for the high throughout in vitro transcription (IVT) of mRNA molecules encoding targeted antigen receptors. For example, MSDT TCR / CAR-mRNA can be quickly manufactured and due to the sequence engineering of the encoding TCR / CAR chain the derived translated protein can be easily detected in in vitro immunoassays for screening and validation of the cNEOs TCR or CAR.

[0011] Synthetic DNA templates (SDT) have been described as a flexible, cost-efficient, and time-efficient tool for manufacturing of mRNA molecules, compared with classical plasmid DNA templates (De Mey et al., 2022). Herein, a combination of 3 synthetic short (< 200bp) single-stranded DNA molecules is designed to hybridize together via PCR, resulting in a synthetic DNA template that can be used forthe in vitro transcription into mRNA. In particular, the SDT is formed by hybridization of three ssDNA molecules by assembly PCR: oligo 1 contains the T7 promoter, Kozak, and 5' UTR; oligo 2 encodes the cDNA to the mRNA of interest; and oligo 3 contains the 3' UTR and a short poly(A) sequence. However, this method is limited to the generation of short synthetic DNA templates, and not readily suitable for the generation of long modular synthetic DNA templates (MSDT) of 1000 kb and more. Such long modular synthetic DNA templates are, however, needed in the generation of complex antigen receptor structures such as for example TCRs, CARs and 13- cell receptors.

[0012] When using such short DNA molecules for the generation of a long synthetic DNA template, a multitude of assembly PCR reactions would be required. The inventors have found, however, that this method is not feasible for generating long modular synthetic DNA templates as the method was found to only result in short fragments of DNA templates rather than the expected long synthetic DNA template (see examples part).

[0013] Accordingly, there is a need in the art for novel plasmid-free modular synthetic DNA templates for in vitro mRNA transcription encoding for a large antigen receptor having a variable and constant region wherein the variable region is interchangeable for any other antigen receptor variable region, without needing multi-step cloning. Thereto, the inventors have developed a method which is based on an assembly PCR reaction comprising only 2 synthetic oligonucleotides having an engineered hybridizing overlap amongst each other. In particular, the MSDT is formed by hybridization of two ssDNA molecules by assembly PCR: oligo 1 encodes the RNA promoter, a 5' UTR, and the variable region of the antigen receptor; and oligo 2 encodes the constant region of the antigen receptor and the 3' UTR. Preferentially, these oligonucleotides are at least 600 bp in length. The main advantage of the long modular synthetic DNA template according to the invention and the method to produce such a template is that the construct is plasmid-free (i.e. does not need the process of cloning), and it allows to easily modify the variable region of the targeted antigen (while keeping the constant region unchanged), leading to a more versatile, flexible and patient-specific antigen receptor template compared to constructs known in the prior art.

[0014] SUMMARY OF THE INVENTION

[0015] In a first aspect, the present invention provides a plasmid-free modular synthetic DNA template (MSDT) for in vitro mRNA transcription of an antigen receptor, obtainable by an assembly PCR of 2 synthetic oligonucleotides wherein:

[0016] - a first synthetic oligonucleotide sequence (oligo 1) encodes an RNA polymerase promotor, a 5’ untranslated region (5’ UTR), and a variable region (VR) of the antigen receptor; and

[0017] - a second synthetic oligonucleotide sequence (oligo 2) encodes a constant region (CR) of the antigen receptor, and a 3’ untranslated region (3’ UTR); wherein said oligo 1 comprises a hybridizing overlap sequence with oligo 2, wherein the sequence of said hybridizing overlap of oligo 1 is part of the constant region (CR) sequence of oligo 2.

[0018] In a specific embodiment, said oligo 1 or oligo 2 is at least 600 bp in length, preferably at least 650 bp in length, more preferably at least 700 bp in length, even more preferably at least 800 bp in length.

[0019] In a specific embodiment, the hybridizing overlap sequence of oligo 1 is the reverse complement sequence of a part of the constant region (CR) sequence of oligo 2, in particular the 3’ end of the constant region (CR) sequence of oligo 2.

[0020] In another embodiment, the hybridizing overlap sequence is about and between 10 to about 200 nucleotides, in particular about and between 15 to about 100 nucleotides, more in particular about and between 20 to about 40 nucleotides.

[0021] In further specific embodiment, the hybridizing overlap sequence comprises a nucleic acid sequence as set forth in SEQ ID NO: 41-44, 60-61 or a sequence having at least 85% sequence identity thereto. In a particular embodiment, the hybridizing overlap sequence of oligo 1 is not a native variable region sequence, more in particular, the hybridizing overlap sequence has been engineered from a CR of another species such as for example a mouse and after codon optimization, this sequence has been added at the 3’ end of the variable region sequence of oligo 1.

[0022] In even a further specific embodiment, the variable region (VR) of the antigen receptor is in the form of a variable domain derived from an antibody, a Camelidae antibody, or an antigen binding fragment (Fab); or in the form of one or more single chain variable fragments (scFv), or one or more single domain antibodies (VHH). In another specific embodiment of the present invention, said hybridizing overlap comprises an overlap or partial overlap of the sequence encoding the variable region of oligo 1 and the sequence encoding the constant region of oligo 2, in particular an overlap or partial overlap of the 3’ sequence encoding the variable region of oligo 1 and the 5’ sequence encoding the constant region of oligo 2.

[0023] In yet a further embodiment wherein the antigen receptor is a T-cell antigen receptor, said oligo 1 sequence encodes for both the alpha and beta chain of the variable region of said antigen receptor and wherein said oligo 2 sequence encodes for both the alpha and beta chain of the constant region of said antigen receptor. In a further embodiment, said oligo 1 sequence encodes for the alpha and / or beta chain of the variable region of said antigen receptor and wherein said oligo 2 sequence encodes for the alpha and / or beta chain of the constant region of said antigen receptor.

[0024] In another embodiment, said antigen receptor is a T-cell antigen receptor, a chimeric antigen receptor, a B-cell antigen receptor, a B-cell antigen receptor derivative, or an antibody receptor, in particular a T-cell antigen receptor.

[0025] In a further embodiment, the antigen receptor is a chimeric antigen receptor, in particular a chimeric antigen receptor wherein the variable domain is in the form of one or more single chain variable fragments (scFv), or one or more single domain antibodies (VHH).

[0026] In a specific embodiment, the length of said MSDT is at least 1400 bp, preferably at least 1500 bp, more preferably at least 1600 bp, even more preferably at least 1700 bp, most preferably at least 1800 bp.

[0027] In yet a further embodiment, the sequence encoding the variable region in oligo 1 or the constant region in oligo 2 is an engineered sequence, in particular a human or murine engineered sequence.

[0028] In a specific embodiment, oligo 1 or oligo 2 further comprises a sequence as set forth in SEQ ID NO: 62, or having at least 85% sequence identity thereto, in particular wherein said sequence is located upstream (5’ end) of the RNA polymerase promotor sequence of oligo 1.

[0029] In another embodiment, the RNA polymerase promotor is an RNA polymerase promotor selected from the list comprising: T7 promotor, SP6 promotor and T3 promotor; more in particular a T7 promotor; even more in particular a modified RNA polymerase T7 AG promoter, most in particular a T7 promotor with nucleic acid sequence as set forth in SEQ ID NO: 1 , or a sequence having at least 95% sequence identity thereto.

[0030] In another embodiment, said 5’UTR encodes for a translation enhancer, in particular a beta globulin enhancer promoter, more in particular a beta globulin enhancer with nucleic acid sequence as set forth in SEQ ID NO: 2, or a sequence having at least 95% sequence identity thereto ; and / or wherein said 3’UTR encodes for a RNA stabilizer sequence, in particular a 3’ UTR from goat beta globin, more in particular a beta globulin with nucleic acid sequence as set forth in SEQ ID NO: 3, or a sequence having at least 95% sequence identity thereto

[0031] In a specific embodiment, said oligo 1 further comprises a KOZAK sequence, more in particular a KOZAK sequence with nucleic acid sequence (ACCACC), or a sequence having at least 95% sequence identity thereto.

[0032] In a further embodiment, said oligo 2 further comprises one or more elements selected from the list comprising: a sequence encoding for a 3’ poly-A tail, miRNA binding sites, glycosylation sites, AU- rich elements (ARE), and G-rich elements (GRE).

[0033] The present invention further provides the MSDT as defined herein for use in immunotherapy or for use in immunotherapy screening, in particular for neo-epitope and antigen receptor screening and validation.

[0034] The present invention also provides the use of the MSDT as defined herein, in plasmid-free manufacturing of mRNA.

[0035] In a further aspect, the present invention provides a method of manufacturing a plasmid-free modular synthetic DNA template (MSDT) for in vitro mRNA transcription for an antigen receptor, said method comprising:

[0036] - contacting a synthetic oligonucleotide sequence (oligo 1) encoding an RNA polymerase promotor, a 5’ untranslated region (5’ UTR), and a variable region (VR) of the antigen receptor, with a synthetic oligonucleotide sequence (oligo 2) encoding a constant region (CR) of the antigen receptor, and a 3’ untranslated region (3’ UTR), wherein said oligo 1 comprises a hybridizing overlap sequence with oligo 2, wherein the sequence of said hybridizing overlap of oligo 1 is part of the constant region (CR) sequence of oligo 2;

[0037] - performing an assembly PCR;

[0038] - optionally purifying said formed MSDT PCR product.

[0039] The present invention further provides an in vitro method of plasmid-free manufacturing of mRNA for use in immunotherapy, in immunotherapy screening, or mRNA-based therapeutic evaluation, said method comprising:

[0040] - performing an assembly PCR of the 2 synthetic oligos as defined in the preceding claims, yielding a plasmid-free modular synthetic dsDNA template (MSDT);

[0041] - amplification of said MSDT, yielding a plurality of plasmid-free MSDT amplification products; and - performing a plasmid-free in vitro transcription (IVT) reaction of said MSDT amplification products.

[0042] BRIEF DESCRIPTION OF THE DRAWINGS

[0043] With specific reference now to the figures, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of the different embodiments of the present invention only. They are presented in the cause of providing what is believed to be the most useful and readily description of the principles and conceptual aspects of the invention. In this regard no attempt is made to show structural details of the invention in more detail than is necessary for a fundamental understanding of the invention. The description taken with the drawings making apparent to those skilled in the art how the several forms of the invention may be embodied in practice.

[0044] Figure 1 : MSDT for in vitro manufacturing of TCR encoding mRNA. (A) Schematic of MSDT assembly PCR and IVT-mRNA synthesis. The Forward oligo consists of a T7 promotor, Kozak sequence, 5' UTR and the part of the ORF coding for the TCR chain variable region. The Reverse oligo consist of the 3’ UTR and the part of the ORF coding for the constant region of the same TCR. (B) Schematic of the workflow for mRNA production using MSDT. The right diagram also shows that the hybridization sequence of oligo 1 (encoding the variable region) corresponds to a part of the constant region encoded by oligo 2. (C) Bar graph showing the concentration of MSDT after assembly and amplification PCR. (D) Bar graph showing the concentration of the reverse oligo for TCR alpha and beta chains respectively, after multiple amplifications PCR. (F) Electropherogram of a PCR amplified constant region of a MSDT (G) Electropherograms showing the length of the oligos before, and the PCR product after assembly, for a TCR alpha chain (top row) and TCR beta chain (bottom row).

[0045] Figure 2: MSDT poly-A tailing strategies. Schematic of co-transcriptional and enzymatic poly-A tailing strategy (A). Electropherograms of TCR encoding mRNA generated using different poly-A tailing strategies (B). Bar charts showing IFN-y secretion of human CD8+T cells electroporated with p53 cognate TCR mRNA, generated using the beforementioned production strategies, after overnight coculture with K562 expressing the LLGRNSFEV epitope (C). Data are a representative of three independent repeated, showed as mean ± SD. Significance determined using Kruskal- Wallis test. * P<0,05.

[0046] Figure 3: Characterization of HLA-ABC encoding mRNA expression and functionality. (A) Schematic overview of the experimental set-up of validation of HLA-, TCR and SNA encoding mRNA. Starting from PBMC, CD8+T cells are MACS sorted and electroporated with MSDT generated TCR encoding mRNA. Derived T cells are cocultured overnight with K562 cells electroporated with antigen, and corresponding HLA encoding mRNA. (B) Scatter plot showing HLA A02:01 expression in percentage (left) and MFI (right) until 18 hours after electroporation. (C) Bar graph showing the comparison of IFN gamma secretion of TCR p53 modified T cells co-cultured with either HLA A02:01+K562 cells or HLA A02:01 modified K562 cells.

[0047] Figure 4: Validation of expression and functionality of MSDT generated TCR encoding IVT-mRNA. (B) Flow cytometry plots showing a shift in HLA A2 expression upon electroporation with HLA A2 encoding mRNA compared with MOCK electroporated cells (black graph). The shift is maintained for more than 24h after electroporation. (C) Scatter (XY) plot showing TCR expression upon TCR mRNA electroporation. Expression is maintained for more than 24h after expression. (D) Bar graph showing IFN-y secretion of hu CD8 T cells after coculture with K562 cells expressing a cognate or non-cognate antigens. IFN-y secretion is only observed when TCR expressing hu CD8+T cells are cocultured with K562 cells expressing a cognate antigen. (E) Bar graphs showing flow cytometry determined upregulation of activation markers CD25 and CD137 of T cells derived from (D).

[0048] Figure 5: TCR mRNA electroporated T cells are capable of killing cancer cells. Bar graphs showing CD69, CD25, CD137 and PD-1 expression on TCR electroporated CD8+ T cells after three-day coculture with target cells (n-3). Data shown as mean ±SD.

[0049] Figure 6: MSDT for in vitro manufacturing of mRNA encoding Nb-based chimeric antigen receptors. A) Schematic representation of the MSDT assembly PCR and IVT-mRNA synthesis. The dsDNA template encoding the NanoCAR is generated by PCR assembly and amplification and used to produce mRNA by IVT. The mRNA is subsequently electroporated in human T cells and the generated NanoCAR T cells are tested in coculture with target tumor cells. B) Graph showing the concentration of NanoCAR-SDT after assembly and amplification for the 4 NanoCAR constructs. C) Graph showing the mRNA yield obtained by in vitro transcription of the NanoCAR- SDT. D) Electropherograms of the mRNA encoding for the 4 NanoCAR constructs.

[0050] Figure 7: Evaluation of NanoCAR T cells functionality in the presence of target cells. Upon electroporation with NanoCAR-SDT mRNA, human CD8+T cells are tested in coculture with LN229 tumor cells in effector-to-target ratio 2:1 for 24h. A) Graph showing the percentage of viable NanoCAR T cells after 24h of coculture. B) Graph showing the percentage of CD8+T cells expressing the NanoCAR. C) Concentration of IFNy produced by NanoCAR T cells after 24h coculture. D) Graphs showing the expression of CD69, CD137 (41 BB) and CD25 activation markers obtained by flow cytometry analysis.

[0051] Figure 8: Comparison between the MSDT method of the invention and the SDT method of the prior art. Schematic representation of the approach, DNA template is cut in six separate pieces compared to two oligonucleotides with the MSDT method (A). The integrity of the generated DNA template shows a sharp peak at approximately 400 bp (B). Impure PCR product (containing DNA templates of different lengths) with only a small fraction of theoretical expected template (C). Electropherograms shows an impure PCR product, not suitable for in vitro transcription, and a main peak at 300 bp (D), which does not match the expected theoretical peak of approximately 1000 bp, as observed with the MSDT method (E). Smear across the electrogram (F), which is highly contrasted by the MSDT method, where a clean peak at the expected reference size (G), and a high yield is observed.

[0052] Figure 9: Evaluation of TCR SDT generation strategies. DNA electropherograms of the PCR products after PCR assembly 1 , 2 and 3. The peak at 25bp is an internal control added to the sample, as a reference for the Agilent Bioanalyzer.

[0053] DETAILED DESCRIPTION OF THE INVENTION

[0054] The description and drawings merely illustrate the principles of the present invention. It will thus be appreciated that those skilled in the art will be able to devise various arrangements that, although not explicitly described or shown herein, embody the principles of the present invention and are included within its scope. Furthermore, all examples recited herein are principally intended expressly to be only for pedagogical purposes to aid the reader in understanding the principles of the present invention and the concepts contributed by the inventor(s) to furthering the art, and are to be construed as being without limitation to such specifically recited examples and conditions. Moreover, all statements herein reciting principles, aspects, and embodiments of the present invention, as well as specific examples thereof, are intended to encompass equivalents thereof.

[0055] In the present invention, expressions such as “comprise”, “include”, “have”, “may comprise”, “may include”, or “may have” indicate existence of corresponding features but do not exclude existence of additional features.

[0056] As already defined herein above, in this work we developed a versatile platform for cNEOs TCR validation using in vitro transcribed (IVT) mRNA. The synthetic plasmid-free modular DNA template (MSDT) according to the invention allows to efficiently and cost-effectively manufacture a large repository of mRNA molecules encoding full antigen receptors comprising a variable and constant region. To generate such modular DNA template transcribing mRNA encoding complex antigen receptors, 2 separate synthetic oligonucleotides, encoding at least resp. a constant and a variable region of the antigen receptor, are required to hybridize using an hybridizing overlap between the oligonucleotides. The main advantage is that it does not need the process of cloning, and it allows to easily modify the variable region of the antigen (while keeping the constant region unchanged), leading to a more versatile, flexible and patient-specific antigen receptor template compared to constructs known in the prior art.

[0057] For example, in expression vector- or plasmid-based methods, traditional cloning is performed including the steps of vector preparation, insert preparation, ligation, transformation in e.g. bacteria, and colony screening to identify the correct clone expressing the DNA template of interest without having a guarantee that the correct clone is identified. This is a time consuming, expensive process to obtain an increase of the yield of a pool of DNA templates. Thus, the synthetic DNA template obtainable by assembly PCR according to claim 1 differs from constructs in the prior art in that it is a plasmid-free DNA template which does not comprise traces of plasmids produced by means of plasmid-based technology such as bacterial or yeast-based approaches.

[0058] Accordingly, in a first aspect, the present invention provides a plasmid-free modular synthetic DNA template (MSDT) for in vitro mRNA transcription of an antigen receptor, prepared in or obtainable by an assembly PCR of 2 synthetic oligonucleotides wherein

[0059] - a first synthetic oligonucleotide sequence (oligo 1) encodes an RNA polymerase promotor, a 5’ untranslated region (5’ UTR), and a variable region (VR) of the antigen receptor; and

[0060] - a second synthetic oligonucleotide sequence (oligo 2) encodes a constant region (CR) of the antigen receptor, and a 3’ untranslated region (3’ UTR); wherein said oligo 1 comprises a hybridizing overlap sequence with oligo 2, wherein the sequence of said hybridizing overlap of oligo 1 is part of the constant region (CR) sequence of oligo 2.

[0061] Throughout the text, when reference is made to the term “oligo” it is meant to be the term “oligonucleotide”. mRNA has been robustly demonstrated as being able to be designed and translated for any relevant proteins. Moreover, synthetic mRNA molecules can be designed quickly and at low-cost and have been optimized pharmacologically, making them suitable for drug-like applications. mRNA is transcribed from a DNA template comprising an open reading frame (ORF) encoding the TCR chain of interest, including a promotor sequence for a polymerase-dependent in vitro transcription reaction (T7 AG modified Clean-Cap promoter), followed by a standard Kozak sequence for eukaryotic translation initiation, 5’ and 3’ untranslated regions (UTR) framing the ORF sequence. The 3’ poly-A tail comprising up to 150 consecutive adenosine monophosphate bases is added enzymatically after IVT reaction. The two latter features are key for enhanced mRNA stability and translatability, resulting in increased protein expression. The DNA template of the present invention is in particular suitable for the production of any mRNA encoding antigen receptors having a variable region such as a T-cell antigen receptor, a chimeric antigen receptor (CAR), a B-cell antigen receptor, a B-cell antigen receptor derivative, or an antibody receptor; in particular a T-cell antigen receptor or a CAR.

[0062] Antigen receptor

[0063] A T-cell antigen receptor (TCR) is a protein complex found on the surface of T cells, which are a type of white blood cell involved in the immune system. T cells play a crucial role in recognizing and responding to specific antigens, such as those derived from pathogens (like bacteria or viruses) or abnormal cells (like cancer cells). The TCR is responsible for recognizing antigens presented by major histocompatibility complex (MHC) molecules on the surface of other cells. The majority of T cells express TCRs composed of alpha and beta protein chains. T cells expressing this receptor are referred to as a:p (or ap) T cells, though a minority of T cells express an alternate receptor, formed by variable gamma (y) and delta (6) chains, referred as y6 T cells. Each chain is composed of two extracellular domains: Variable region (VR) and a Constant region (CR). The Constant region is proximal to the cell membrane, followed by a transmembrane region and a short cytoplasmic tail, while the Variable region binds to the peptide / MHC complex. The variable domain of both the TCR a-chain and p-chain each have three hypervariable or complementarity-determining regions (CDRs). These TCRs recognize peptide antigens presented by MHC class I or II molecules. When a TCR binds to a specific antigen-MHC complex, it triggers a series of events within the T cell, leading to activation and the initiation of an immune response.

[0064] In the context of the present invention, the term “chimeric antigen receptors (CARs)” is interchangeably used with chimeric immunoreceptors, chimeric T cell receptors or artificial T cell receptors and needs to be understood as receptor proteins that have been engineered to give T cells the new ability to target a specific antigen. The receptors are chimeric in that they combine both antigen-binding and T cell activating functions into a single receptor. Typically, a CAR is composed of an extracellular antigen recognition variable domain, an optional hinge domain, a transmembrane domain, and intracellular signaling domain.

[0065] The intracellular domain may include costimulatory molecules and a zeta chain. The hinge, also called a spacer, is a small structural domain that sits between the antigen recognition region and the cell's outer membrane. An ideal hinge enhances the flexibility of the scFv receptor head, reducing the spatial constraints between the CAR and its target antigen. The transmembrane domain is a structural component, consisting of a hydrophobic alpha helix that spans the cell membrane. It anchors the CAR to the plasma membrane, bridging the extracellular hinge and antigen recognition domains with the intracellular signaling region.

[0066] The antigen recognition variable domain is typically derived from the variable regions of a monoclonal antibody linked together as a single-chain variable fragment (scFv) or single-domain antibodies (Nb-CAR). As used herein, an scFv is a chimeric protein consisting of two variable domains (VH and VL) connect with by a flexible linker wherein the VL and VH regions are selected for their binding ability to the target antigen. The length and amino acid composition of this linker play an important role in correct folding of the protein, and it is typically 10-25 amino acid long with Glu Lys stretches to increase the solubility and Gly Ser stretches for the flexibility of the final protein. In some embodiments, within each of the two variable domains of the scFv, there are three hyper variable domains or complementary determining regions (CDRs) that are linked together with framework regions (FRs). While the CDRs are responsible for antigen binding, and their structure is complementary to the epitope, the remainder of the variable domains (FRs) acts as a scaffold and has inconsiderable variability compared to CDRs.

[0067] As used herein, the terms “sdAbs” or “nanobody” or“VHH antibody” or “single domain-based VHHs” used interchangeably and are to be understood as an antigen-binding fragment of only one heavy chain variable region. Thus, the antigen-binding domain of these specific immunoglobulins (VHH) is a high affinity single V-like domain. It is noted that the terms nanobody® or nanobodies® are registered trademarks of Ablynx N.V. but the terms are used herein merely to make reference to single domain antibodies. Nanobodies have additional advantages over the classic scFvs in a CAR context, owing to their single-domain nature and high sequence homology with human VH3 genes, which makes them less immunogenic, allowing easy cloning and avoiding the need for humanization or linker sequence optimization steps.

[0068] A B-cell receptor (BCR) is a transmembrane protein complex found on the surface of B cells, which are a type of white blood cell involved in the immune system. A B-cell receptor is composed of a membrane-bound immunoglobulin molecule of one isotype (IgD, IgM, IgA, IgG, or lgE) and a signal transduction moiety (a heterodimer called Ig-a / lg-p (CD79), bound together by disulfide bridges). The former forms a type 1 transmembrane receptor protein and is typically located on the outer surface of these lymphocyte cells. The receptor binding moiety is composed of a membrane-bound antibody that, like all antibodies, has two identical paratopes that are unique and randomly determined. The BCR plays a key role in the recognition of antigens, which are molecules that can trigger an immune response. B cells are responsible for the production of antibodies, and the BCR is crucial for initiating the antibody-mediated immune response. Upon activation, B cells can undergo various processes, including proliferation and differentiation into plasma cells, which are specialized cells that produce antibodies. These antibodies are then released into the bloodstream to help neutralize or eliminate the antigens.

[0069] As used herein, the term “constant region (CR) of an antigen receptor” refers to the region of nucleic acid sequence of an antigen receptors which show very little variation and are preferably located at the antigen receptor’s tail, on both the light and the heavy chains. Non-limiting examples of nucleic sequences of a constant region are set out in SEQ ID NO: 12-13 (murine alpha and beta chain), SEQ ID NO: 53 (CR TCR alpha chain), SEQ ID NO: 54 (CR TOR beta chain), or SEQ ID NO: 59 (CR nanoCAR).

[0070] In the context of the present invention, when reference is made to the term “the variable region (VR) of an antigen receptor” it needs to be understood as any variable domain which has a particular binding affinity and specificity to a target molecule. In some embodiments, the variable region of an antigen receptor comprises or consists of any variable region comprising a targetspecific binding element such as the variable region of a T-cell receptor, the variable region of an alpha and / or beta chain of a T-cell receptor, one or both variable domains (VH and VL) of an scFv, a VHH domain, or a variable domain of a B-cell receptor.

[0071] In a specific embodiment, the variable region (VR) of the antigen receptor is in the form of a variable domain derived from an antibody, a Camelidae antibody, or an antigen binding fragment (Fab); or in the form of one or more single chain variable fragments (scFv), or one or more single domain antibodies (VHH). Non-limiting examples of nucleic acid sequences of a variable region are set out in SEQ ID NO: 45-52 (for TCRs) or SEQ ID NO: 55-58 (for nanoCARs).

[0072] In some embodiments, the term the variable region may also encompass a flexible linker connecting the VL and VH regions, or the term may also encompass a hinge region, or a part thereof, which connects the variable region with the constant region of an antigen receptor.

[0073] In a particular embodiment wherein the antigen receptor is a CAR, the variable domain of said CAR may comprise or consists of one or more single-chain variable fragments (scFv) or part thereof, or one or more single-domain antibodies (Nb-CAR). In another embodiment, wherein the antigen receptor is a TCR, the variable domain of said TCR may comprise or consists of the variable domain of an alpha chain, of the variable domain of a beta chain, or a combination thereof.

[0074] In a specific embodiment, the variable region of the antigen receptor encoded by oligo 1 may be selected from any one of the nucleic acid sequences as set forth in SEQ ID NO: 45-52 or SEQ ID NO: 55-58, or a sequence having at least 85%, such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity thereto. In another embodiment, the constant region of the antigen receptor encoded by oligo 2 may be selected from any one of the nucleic acid sequences as set forth in SEQ ID NO: 53, 54, 59 or a sequence having at least 85%, such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity thereto.

[0075] In a further embodiment wherein the antigen receptor is a T-cell antigen receptor, said oligo 1 sequence encodes for the alpha and / or beta chain of the variable region of said antigen receptor and wherein said oligo 2 sequence encodes for the alpha and / or beta chain of the constant region of said antigen receptor, preferably oligo 1 encodes for both the alpha and beta chain of the variable region and oligo 2 encodes for both the alpha and beta chain of the constant region. For example, the manufacturing of the MSDT coding for a TCR alpha or beta chain starts with the assembly PCR (aPCR) hybridizing of two singe stranded DNA (ssDNA) gene fragments encoding at least for respectively the constant region (CR alpha / beta) and the variable region (VR alpha / beta) of a TCR. Analogously, the manufacturing of the MSDT coding for a CAR starts with the assembly PCR (aPCR) hybridizing of two singe stranded DNA (ssDNA) gene fragments encoding at least for respectively i) the variable region (VR) comprising the open reading frame (ORF) encoding either one or both VL and VH regions of an scFv, or one heavy chain variable region (VHH), and (ii) the constant region (CR) comprising the ORF of a hinge region, the transmembrane domain, and the intracellular part.

[0076] In another embodiment, the ORF of the hinge region can be encoded by oligo 1 .

[0077] In a further embodiment, the ORF of the hinge region can be encoded partially by both oligos.

[0078] In the case of TCRs, both CR alpha / beta oligonucleotides can be amplified by PCR and are compatible to multiple VR alpha / beta oligonucleotides, further lowering the cost of this platform. Moreover, in this work it has been shown that MSDT generated TCR and CARs are presented on the membrane of T cells and are functional for neo-epitope screening. Each TCR chain constant region sequence may be engineered with a murine CR sequence, respectively for the alpha and beta chain. Alternatively, each CAR and BCR constant region sequence may be engineered with a murine CR sequence.

[0079] In some embodiments, both oligonucleotides encoding for the VR and CR and / or CR alpha / beta are synthetized and purified as high fidelity megamers and further amplified via PCR into the dsDNA product needed for the TCR, CAR or BCR assembly PCR.

[0080] Plasmid-free

[0081] In the context of the present invention, the term ‘plasmid-free’ refers to DNA templates which are not produced by means of plasmid-based technology, but by means of assembly PCR, upon which they typically do not contain traces of plasmids. A disadvantage of expression vector- or plasmidbased technologies is that traditional cloning steps need to be performed including the steps of vector preparation, insert preparation, ligation, transformation in e.g. bacteria, and colony screening to identify the correct clone expressing the DNA construct of interest without having a guarantee that the correct clone is identified. Accordingly, inserts from clones with the correct sequences need to be isolated and verified before obtaining the final construct. The inventive aspect of the construct and method of the invention is that exactly such time consuming and expensive steps are not required and can be omitted.

[0082] In the context of the present invention, the term ‘modular synthetic DNA template’ refers to a long synthetic DNA templates, which are produced synthetically, accordingly not by means of bacterial or yeast-based fermentation. The DNA templates of the present invention are particularly characterized by their plasmid-free format and their length of at least about 1400 bp, typically at least about 1500 bp, such as at least about 1700 bp, at least about 1800 bp, of at least about 2000 bp in length. In a particular embodiment, the DNA templates of the present invention are characterized by a length of about and between 1200 bp to 10 000 bp, in particular about and between 1300 bp to 5000 bp, more in particular about and between 1500 bp and 4000 bp.

[0083] More in particular, the DNA templates according to the invention which encode for a large antigen receptor having a variable and constant region is characterized by its modular design wherein the variable region is interchangeable for any other antigen receptor variable region leading to a more versatile, flexible and patient-specific antigen receptor template compared to constructs known in the art. Such long and modular templates are particularly suitable in the production of TCRs comprising both variable and constant antigen receptor regions.

[0084] In the context of the present invention, the term ‘assembly PCR’ or Polymerase Chain Reaction, is a technique used in molecular biology to amplify and construct large DNA molecules from smaller fragments. The basic principle of assembly PCR involves designing overlapping primers for the DNA fragments you want to assemble. These primers have sequences that overlap at their 3' ends, i.e. comprising a hybridizing overlap, allowing them to anneal to each other during the PCR reaction. By using these primers in a series of PCR reactions, the fragments are amplified and overlap with neighboring fragments, creating longer DNA molecules.

[0085] Assembly PCR

[0086] The assembly PCR process typically involves several steps:

[0087] Design Primers: Design primers for each DNA fragment with overlapping regions.

[0088] First Round of PCR: Perform separate PCR reactions for each DNA fragment using the designed primers.

[0089] Purification: Purify the PCR products to remove unincorporated primers and other contaminants.

[0090] Second Round of PCR (Assembly PCR): Use the purified PCR products as templates in a second round of PCR. The overlapping regions on adjacent fragments promote the annealing of the fragments, and the DNA polymerase extends the primers, resulting in the amplification of the entire assembled sequence.

[0091] In the context of the invention, an oligonucleotide or ‘oligo’ is a single-stranded sequence of nucleotides, typically composed of DNA or RNA building blocks. In the present context, the oligonucleotides are composed of DNA building blocks, which typically comprise a series of nucleotides selected from adenine (A), thymine (T), cytosine (C), and guanine (G). For the assembly PCR used in the present invention, 2 oligonucleotides are used, i.e. oligo 1 and oligo 2. The oligonucleotides as used in the present invention typically have a length of at least about 600 bp, preferably at least about 650 bp, more preferably at least about 700 bp, even more preferably at least about 800 bp.

[0092] Oligo 1 as used in the present invention, typically encodes an RNA polymerase promotor, a 5’ untranslated region (5’ UTR), and a variable region (VR) of the antigen receptor. Whereas oligo 2 as used in the present invention, typically encodes a constant region (CR) of the antigen receptor, and a 3’ untranslated region (3’ UTR). After assembly PCR, accordingly, the resulting assembled MSDT template will comprise at least a 5’ untranslated region (5’ UTR), a variable region (VR) of the antigen receptor, a constant region (CR) of the antigen receptor, and a 3’ untranslated region (3’ UTR).

[0093] The RNA polymerase promotor as used in the present invention is a specific DNA sequence that plays a crucial role in the initiation of transcription, a process where RNA is synthesized from a DNA template. These promoters are recognized by an RNA polymerase, the enzyme responsible for catalyzing the synthesis of RNA. The promoter region is a regulatory element because it helps determine when and how much RNA is produced. RNA polymerase promotors have various functions, including recognition by RNA polymerase, initiation of transcription, and regulation of gene expression. Promoters are typically found upstream of the transcription start site (the point where RNA synthesis begins), and they provide the necessary signals for the recruitment and binding of RNA polymerase to the DNA. The specific promoter sequences can vary between different genes and organisms, contributing to the diversity and complexity of gene regulation in living organisms.

[0094] Components of oligo

[0095] In the present invention, the RNA polymerase promotor is preferably selected from the list comprising: T7 promotor, SP6 promotor and T3 promotor; more in particular a T7 promotor; even more in particular a modified RNA polymerase T7 AG promoter, most in particular a T7 promotor with nucleic acid sequence as set forth in SEQ ID NO: 1 , or a sequence having at least 95% sequence identity thereto.

[0096] The 5’ UTR, or 5' untranslated region, is a segment of nucleotides at the 5' end of an mRNA (messenger RNA) molecule. This region is located upstream of the protein-coding sequence, which is called the open reading frame (ORF). The 5' UTR is a non-coding region, meaning it does not contain the information to encode the amino acids that make up a protein. The 5’ UTR has various functions, including regulation of gene expression, initiation of translation (it typically contains the AUG start codon), and regulation of certain post-transcriptional modifications.

[0097] The 5’ UTR of the present invention typically encodes for a translation enhancer, in particular a beta globulin enhancer promoter, more in particular a beta globulin enhancer with nucleic acid sequence as set forth in SEQ ID NO: 2, or a sequence having at least 95% sequence identity thereto.

[0098] The 3' UTR is the region at the 3' end of an mRNA molecule, downstream of the coding sequence or the stop codon. Similar to the 5' UTR, the 3' UTR is also untranslated, meaning it does not encode amino acids. The 3' UTR contains regulatory elements that can influence mRNA stability, localization, and the rate of translation termination. It often harbors sequences that interact with regulatory proteins, microRNAs, and other molecules that affect post-transcriptional gene regulation.

[0099] The 3’UTR of the present invention typically encodes for a RNA stabilizer sequence, in particular a 3’ UTR from goat beta globin, more in particular a beta globulin with nucleic acid sequence as set forth in SEQ ID NO: 3, or a sequence having at least 95% sequence identity thereto.

[0100] While the oligonucleotides of the present invention, encode the minimally required sequences such as the RNA polymerase promotor, the 5’ and 3’ UTRs and the variable and constant regions of the antigen receptors, these oligonucleotides may further encode additional elements, such as:

[0101] For oligo 1 : a KOZAK sequence, more in particular a KOZAK sequence with nucleic acid sequence (ACCACC), or a sequence having at least 95% sequence identity thereto.

[0102] For oligo 2: one or more elements selected from the list comprising: a sequence encoding for a 3’ poly-A tail, miRNA binding sites, glycosylation sites, AU-rich elements (ARE), and G-rich elements (GRE).

[0103] Hybridizing overlap

[0104] The hybridizing overlap sequence as used in the context of the invention typically comprises an overlap or partial overlap of the sequence encoding the variable region of oligo 1 and the sequence encoding the constant region of oligo 2, in particular an overlap or partial overlap of the 3’ sequence encoding the variable region of oligo 1 and the 5’ sequence encoding the constant region of oligo 2.

[0105] In other words, oligo 1 - encoding the RNA polymerase promotor, a 5’ UTR and a variable region (VR) of the antigen receptor - comprises an hybridizing overlap with oligo 2, wherein the sequence of said overlap of oligo 1 is part of the constant region sequence of oligo 2. The hybridizing overlap between said oligos serves the purpose that a modular DNA template is formed during for example an assembly PCR. Typically, such a hybridizing overlap is formed by using reverse complementary sequences.

[0106] In one embodiment, the hybridizing overlap sequence of oligo 1 is the reverse complement sequence of a part of the constant region sequence of oligo 2. In a particular embodiment, the hybridizing overlap sequence of oligo 1 is the reverse complement sequence of the 3’ end of the constant region sequence of oligo 2. Accordingly, it is understood herein that the hybridizing overlap sequence of oligo 1 - which encodes for the VR of an antigen receptor - is an engineered VR sequence comprising an additional reverse complementary sequence which corresponds to part of the CR sequence of oligo 2 or in other words which is derived from the CR sequence of oligo 2. Non-limiting examples of such oligonucleotide constructs may be:

[0107] For TCR alpha:

[0108] Oligol (5’-3’): promotor - 5’ UTR - VR seq. + ATCCAGAACCCAGAGCCTGCTGTGTACCAG Oligo2 (3’-5’): 3’ UTR - CR sequence = xxxxCTGGTACACAGCAGGCTCTGGGTTCTGGAT wherein the underlined sequence of oligo 1 is the reverse complement sequence of a part of the constant region sequence of oligo 2.

[0109] For TCR beta:

[0110] Oligol (5’-3’): promotor - 5’ UTR - VR seq. + GTGTGTCTGGCGAGGGGCTTTTTCCCTGAC Oligo2 (3’-5’): 3’ UTR - CR sequence = xxxGTCAGGGAAAAAGCCCCTCGCCAGACACAC wherein the underlined sequence of oligo 1 is the reverse complement sequence of a part of the constant region sequence of oligo 2.

[0111] For CAR:

[0112] Oligol (5’-3’): promotor - 5’ UTR - VR + ACCACAACACCCGCACCGAGACCGCCAACGCCCGCCCC Oligo2 (3’-5’): 3’UTR- CR sequence = xxxGGGGCGGGCGTTGGCGGTCTCGGTGCGGGTGTTGTGGT wherein the underlined sequence of oligo 1 is the reverse complement sequence of a part of the constant region sequence of oligo 2.

[0113] In a specific embodiment, the hybridizing overlap sequence of oligo 1 is the reverse complement sequence of the 3’ end of the constant region sequence of oligo 2 comprising at least 10 nucleotides such as at least 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or at least 30 nucleotides, and preferably less than 100 nucleotides such as less than 90, 80, 70, 60, 50 nucleotides. In a particular embodiment, the hybridizing overlap sequence of oligo 1 is the reverse complement sequence of the 3’ end of the constant region sequence of oligo 2 comprising about and between 10 to about 300 nucleotides, more in particular about and between 15 to about 200 nucleotides, even more in particular about and between 20 to about 100 nucleotides, most in particular about and between 30 to about 40 nucleotides.

[0114] In some embodiments, wherein a hinge region is encoded by both oligo 1 and oligo 2, the hybridizing overlap sequence is within the hinge region. This can be for example the case for a CAR which is exemplified in Example 2. The hinge region, present in both oligonucleotides, enables their hybridizing during the assembly PCR.

[0115] In a very specific embodiment, the hybridizing overlap sequence of oligo 1 comprises or consists of a nucleic acid sequence as set forth in any one of SEQ ID NO: 41-44, 60, 61 or a sequence having at least 85%, such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity thereto.

[0116] In another embodiment, said antigen receptor is a T cell antigen receptor, a chimeric antigen receptor, a B cell antigen receptor, a B cell antigen receptor derivative, or an antibody receptor, in particular a T cell antigen receptor, or a CAR, more in particular a nanobody-based CAR.

[0117] In a specific embodiment, said oligo 1 sequence encodes for both the alpha and beta chain of the variable region of said antigen receptor and / or said oligo 2 sequence encodes for both the alpha and beta chain of the constant region of said antigen receptor. In another specific embodiment, said oligo 1 sequence encodes for the alpha or beta chain of the variable region of said antigen receptor and said oligo 2 sequence encodes for the alpha or beta chain of the constant region of said antigen receptor.

[0118] In a specific embodiment, the antigen receptor is a T-cell antigen receptor and oligo 1 (encoding the RNA polymerase promotor, a 5’ UTR and a variable region (VR) comprises or consists of a nucleic acid sequence as set forth in any one of SEQ ID NO: 14-17, 19-22 or a sequence having at least 85%, such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity thereto, and oligo 2 (encoding the 3 ’UTR and a constant region (CR)) comprises or consists of a nucleic acid sequence as set forth in any one of SEQ ID NO: 18, 23 or a sequence having at least 85%, such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity thereto.

[0119] In even a further embodiment, the antigen receptor is a T-cell antigen receptor and oligo 1 and oligo 2 produce a DNA template comprising a sequence as set forth in any one of SEQ ID NO: 4, 5, 6, 7, 8, 9, 10, 11 , 24-31 or a sequence having at least 85%, such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity thereto.

[0120] In a particular embodiment, the antigen receptor is a T-cell antigen receptor and oligo 1 comprises a hybridizing overlap with oligo 2, wherein the sequence of said overlap is part of the 3’ end of the constant region of an alpha chain or a beta chain, in particular a nucleic acid sequence as set forth in SEQ ID NO: 41-44 or a sequence having at least 85%, such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity thereto.

[0121] In a specific embodiment, the antigen receptor is a chimeric antigen receptor and oligo 1 comprises or consists of a nucleic acid sequence as set forth in any one of SEQ ID NO: 55-58 or a sequence having at least 85%, such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity thereto, and oligo 2 comprises or consists of a nucleic acid sequence as set forth in any one of SEQ ID NO: 59 or a sequence having at least 85%, such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity thereto.

[0122] In even a further embodiment, the antigen receptor is a chimeric antigen receptor and oligo 1 and oligo 2 produce a DNA template comprising a sequence as set forth in any one of SEQ ID NO: 37- 40 or a sequence having at least 85%, such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity thereto.

[0123] In another particular embodiment, the antigen receptor is a chimeric antigen receptor and oligo 1 comprises a hybridizing overlap sequence with oligo 2, wherein the sequence of said overlap of oligo 1 is part of the 3’ end of the constant region sequence of said chimeric antigen receptor, in particular a nucleic acid sequence as set forth in SEQ ID NO: 60-61 or a sequence having at least 85%, such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity thereto.

[0124] In a particular embodiment, the antigen receptor is a B cell antigen receptor and oligo 1 comprises a hybridizing overlap with oligo 2, wherein the sequence of said overlap is part of the 3’ end of the constant region of said B cell receptor.

[0125] It should be clear to a skilled person that the sequence blocks of the RNA polymerase promotor, 5’UTR of oligo 1 and the 3’ UTR of oligo 2 can be varied as described herein and thus be replaced by any other known sequence complying to the purpose within the application of screening and validation of T cell receptors. It should further also be clear that the reverse complement of the sequences described herein can be used, in particular for the hybridizing sequence of any sequence of SEQ ID NO: 41-44, 60, 61.

[0126] The sequences as used in the various oligonucleotides may be naturally occurring sequences, or they may be engineered sequences such as human or murine engineered sequences. In another embodiment, oligo 1 and / or oligo 2 as used herein may be naturally occurring antigen receptor sequences, or they may be engineered sequences such as human or murine engineered sequences. In yet another embodiment, the sequence encoding the variable region (oligo 1) and the sequence encoding the constant region (oligo 2) of the antigen receptor may be a wild-type sequences or engineered sequences such as human or murine engineered sequences. In a particular embodiment, the hybridizing overlap sequence of oligo 1 is not a native variable region sequence, more on particular, the hybridizing overlap sequence has been engineered from a CR of another species such as a mouse and after codon optimization, this sequence has been added at the 3’ end of the variable region sequence of oligo 1 . Thus, in the context of the present invention, an engineered sequence needs to be understood that modifications such as additions or deletions of nucleotides can be made in the sequence to optimize the construct further. Another example of such a modification is the addition of a piece of non-encoding sequence that may be introduced in one or both oligos to improve IVT mRNA yield. In a particular embodiment, oligo 1 or oligo 2 further comprises a non-encoding sequence located at the 5’ end of oligo 1 or at the 5’ end of oligo 2.

[0127] In a preferred embodiment, such non-encoding sequence is located upstream the RNA polymerase promotor of oligo 1 . In another embodiment, such non-encoding sequence may have a sequence as set forth in SEQ ID NO: 62, or having at least 85%, such as at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity thereto. It has been observed that the addition of such a non-encoding sequence located at the 5’ end of oligo 1 is particularly useful to improve IVT mRNA yield.

[0128] Accordingly, a non-liming example may be that oligo 1 comprises (in following order) a nucleic acid sequence as set forth in SEQ ID NO: 62, or having at least 85% sequence identity thereto, a nucleic acid sequence encoding the RNA polymerase promotor, a 5’ UTR and a variable region (VR) of the antigen receptor as set forth in any one of SEQ ID NO: 45-52, 55-58 or a nucleic acid sequence having at least 85% sequence identity thereto, and that oligo 2 comprises a nucleic acid sequence encoding the 3’ UTR and a constant region (CR) of the antigen receptor as set forth in any one of SEQ ID NO: 53-54, 59 or a nucleic acid sequence having at least 85% sequence identity thereto. In some embodiments, MSDTs are provided comprising a nucleic acid sequence as set forth in any one of SEQ ID NO: 4, 5, 6, 7, 8, 9, 10, 11 , 24-31 or a sequence having at least 85% sequence identity thereto, the MSDTs further comprising a nucleic acid sequence as set forth in SEQ ID NO: 62, or a sequence having at least 85% sequence identity thereto, located at the 5’ end of the template.

[0129] In the context of the present invention, it is understood that the variable domain of the antigen receptors can take many forms. For example, the variable domain of both the TOR a-chain and p- chain each have three hypervariable or complementarity-determining regions (CDRs) allowing recognition of a vast number of major histocompatibility complex (MHC) molecules presenting self- and foreign epitopes. Accordingly, the sequence of the variable region can be tailored according to the patients’ needs leading to a patient-specific antigen receptor. In this context, the present invention also provides chimeric antigen receptors.

[0130] The MSDT of the present invention is particularly suitable for use in for use in immunotherapy or for use in immunotherapy screening, in particular for neo-epitope and antigen receptor screening and validation. Accordingly, the present invention provides the MSDT as defined herein for use in immunotherapy and immunotherapy screening. The MSDTs according to the invention and method to generate such MSDTs creates an opportunity for personalized immunotherapies such as therapeutic vaccination and adoptive cell transfer (ACT) of neoantigen cognate T cell receptor (TCR) expressing T cells. It further provides the use of the MSDT as defined herein for use in the manufacture of a medicament for immunotherapy, as well as the use of the MSDT as defined herein for immunotherapy screening. The present invention also provides a method for the diagnosis, prevention or treatment of a subject, said method including the step of providing the MSDT as defined herein to a subject in need thereof; in particular for immunotherapy. The present invention further also provides the use of the MSDT as defined herein in plasmid-free manufacturing of mRNA.

[0131] In a further aspect, the present invention provides a method of manufacturing a plasmid-free modular synthetic DNA template (MSDT) for in vitro mRNA transcription, said method comprising:

[0132] - contacting a synthetic oligonucleotide sequence (oligo 1) encoding an RNA polymerase promotor, a 5’ untranslated region (5’ UTR), and a variable region (VR) of the antigen receptor, with a synthetic oligonucleotide sequence (oligo 2) encoding a constant region (CR) of the antigen receptor, and a 3’ untranslated region (3’ UTR), wherein said oligo 1 comprises a hybridizing overlap sequence with oligo 2, wherein the sequence of said hybridizing overlap of oligo 1 is part of the constant region (CR) sequence of oligo 2;

[0133] - performing an assembly PCR;

[0134] - optionally purifying said formed MSDT PCR product.

[0135] The method according to the invention is particularly useful to generate a DNA template encoding an entire and complex antigen receptor such as TCRs, CARs, and BCRs without needing multi- step cloning. The fact that target of interest (in this case the antigen receptor), is divided on two oligonucleotides makes it possible to generate a modular DNA template which is more versatile, flexible and patient-specific in terms of interchangeability of the variable region of the antigen receptor.

[0136] The method according to the invention provides an assembling strategy wherein a homogenic or pure mix of synthetic DNA templates is formed which are particularly suitable to generate mRNA in an in vitro transcription reaction. The method according to the invention achieves this by avoiding aspecific interaction of the oligonucleotides and limiting undesired fragment formation.

[0137] The present invention further provides an in vitro method of plasmid-free manufacturing of mRNA for use in immunotherapy, in immunotherapy screening, or mRNA-based therapeutic evaluation, said method comprising:

[0138] - performing an assembly PCR of the 2 synthetic oligos as defined in the preceding claims, yielding a plasmid-free modular synthetic dsDNA template (MSDT);

[0139] - amplification of said MSDT, yielding a plurality of plasmid-free MSDT amplification products; and

[0140] - performing a plasmid-free in vitro transcription (IVT) reaction of said MSDT amplification products. Further details on the MSDTs of the invention and the assembly PCR methods used in preparing such MSDTs may be found in the examples part herein after.

[0141] EXAMPLES

[0142] EXAMPLE 1 : T-cell antigen receptor

[0143] METHODS

[0144] Cell lines

[0145] K562 and Jurkat cell lines were cultured in IMDM, supplemented with 10% FBS (Pan-Biotech, Cat. No. P30-3306, Lot. No. P210405) and 2,5% of PS / L-Glu (50 U / mL penicillin, 50 ug / mL streptomycin, and 2 mM L-glutamine). Peripheral blood mononucleated cells were cultured in IMDM supplemented with 1 % human AB serum and 5% supplements (PS / L-Glu with additional 1 mM Sodium pyruvate and non-essential amino acids).

[0146] Generation of plasmid DNA templates

[0147] Plasmid DNA was generated using the in-house developed plasmid pLMCT. gBIocks coding for HLA A*0201 and TCR alpha or beta chains were purchased from Integrated DNA Technologies (IDT). These were cloned using the Gibson assembly kit™ (New England Biolabs, NEB) into the pLMCT following restriction digestion with Ncol / Xhol (NEB). The resulting pLMCT plasmids were transformed in XL2-Blue Ultracompetent Cells (Agilent) and selected on ampicillin containing agar plates. Cloned pLMCT plasmids were screened based on the sequence specific restriction digestion pattern and were sequence verified (Eurofins Genomics). Following amplification of selected bacterial clones, pLMCT plasmids were isolated (Qiagen Midi Plasmid Kits) and linearized over night by restriction enzyme digestion with BfuAI (NEB).

[0148] Generation of synthetic DNA templates

[0149] SDT encoding single epitope sequences (SDT SNA-mRNA) were manufactured as previously described (De Mey et al., 2022). MSDT encoding for the TCR alpha and beta chain respectively were generated using two synthetic oligonucleotides (Megamers, Integrated DNA Technologies [IDT]), that were designed to hybridize together during assembly PCR (KAPA HiFi HotStart ReadyMix; Roche) forming the DNA template (MSDT), which was further amplified by PCR. After each PCR, the formed MSDT was purified (GeneJet PCR Purification Kit; Thermo Fisher Scientific). As quality controls, the yield (absorbance at 260 / 280 nm), integrity (BioAnalyzer 2100, DNA 7500chip), and sequence (Eurofins Genomics) of each MSDT manufactured was verified.

[0150] Four types of TCR constructs were tested (TCR p53, TCR gp100, TCR NY-ESO, TCR M1). An example of the oligo structure forming TCR p53 (both alpha and beta chain) is given in Table 1 below. While oligo 1 (Fw1) - which encodes the variable region (VR) - will be different for each construct, it is evident that oligo 2 (Rv1), which encodes the constant region (CR) of resp. the alpha chain (SEQ ID NO: 18) or beta chain (SEQ ID NO: 23), will be the same for resp. the alpha and beta chain of the remainer of TCR constructs (TCR gp100, TCR NY-ESO, TCR M1). Accordingly, oligo 1 encoding the variable region of the alpha chain of TCR gp100, TCR NY-ESO, TCR M1 may be defined by resp. SEQ ID NO: 14, 15, 16, 17, and oligo 2 encoding the constant region of the alpha chain may be defined by SEQ ID NO: 18. Alternatively, oligo 1 encoding the variable region of the beta chain of TOR gp100, TOR NY-ESO, TOR M1 may be defined by resp. SEQ ID NO: 19, 20, 21 , 22 and oligo 2 encoding the constant region of the beta chain may be defined by SEQ ID NO: 23.

[0151] Table 1. Example of oligo sequences for TCR p53 alpha and beta chain. The underlined part represents the T7 promotor, the bold italic represents the 5’UTR (Fw oligo 1), or the 3’UTR (Rv oligo 2), the capitalized letters represent the VARIABLE REGION, and the lowercase letter marked on grey represent the hybridizing overlap

[0152] In vitro transcription

[0153] The IVT reaction was performed starting from a dsDNA template (MSDT) using a T7 enzyme mix containing: T7 RNA polymerase (ThermoFisher Scientific), RNase inhibitor (Promega), and inorganic pyro-phosphatase (ThermoFisher Scientific). The reaction buffer mix included 10 mM Clean CAP AG reagent (TriLink Biotech) and 10 mM of each dNTP (adenosine-, guanosine-, cytidine- and uridine-triphosphate; Promega). The reaction was incubated at 37°C. for 2 h. After incubation, 10U DNase I exonuclease (ThermoFisher Scientific) was added to the reaction mix and incubated for 15 min at 37°C for the removal of residual dsDNA template. All enzymes added to the reaction were deactivated at 70°C for 10 min. For IVT-mRNA of synthetic DNA templates, polymerase-A enzyme was added to the reaction mix for RNA poly-adenylation of the translated RNA molecules (TebuBio poly(A) tailing kit). The reaction mix is incubated for 60 min at 37°C, after which 1 .5 volumes of 40 mM EDTA solution were added to the mix to stop any further enzymatic activity. For LiCI-mediated precipitation, half the reaction volume of 8 M LiCI (Sigma-Aldrich) was added to the mRNA solution and stored at -20°C overnight. The mRNA sample was centrifuged (15 min at 16,000g), and the obtained pellet was washed with 70% ethanol (Sigma-Aldrich) and subsequently dissolved in RNase-free water (Gibco). The resulting MSDT-mRNA was subjected to quality controls, including spectrophotometric reading of optical density for the yield determination and purity (absorbance ratio at 260 / 280 nm), integrity (BioAnalyzer 2100, RNA 6500 chip), and cDNA sequence verification (cDNA kit; NEB and Eurofins Genomics).

[0154] Cellulose purification

[0155] 2 mg cellulose was prepared by washing twice with 10 mL of STE buffer (100 mM NaCI; 10 mM Tris-CI, pH 8.0; 1 mM EDTA, 16% EtOH), for 10 minutes while agitated. The cellulose - STE mixture was centrifuged at 9000 RPM for 10 minutes and supernatant was removed. After IVT, mRNA is added to STE buffer in a total volume of 10 mL. The mRNA - STE mix is added to the washed cellulose and incubated, while agitated, at RT for 30 minutes. After incubation, the cellulose - mRNA- STE mixture is filtered over a 0,45 urn filter. The eluate was collected, and mRNA was precipitated with LiCI.

[0156] Flow cytometry

[0157] Cells were harvested and washed twice with PBS containing 1 % BSA (flow cytometry buffer). The following antibody cocktail was used to phenotype cells. HLA A2, HLA ABC, TCRa / b, Dextramer, CD25, CD69, CD137, CD3, Fix-Viability-eFluor 506. T cell activation assay

[0158] Electroporations were performed using the Gene PulserXCell Electroporation System (Biorad). For every condition, 2*10A6 K562 cells were washed with Opti-MEM twice and electroporated with 5ug of single antigen encoding, SDT generated IVT-mRNA (ref Wout) using the Exponential Decay protocol set at 300V, 125 uF capacitance, co fl resistance using 4mm cuvettes in 200 uL Opti- MEM. Similarly, 4*10A6 human CD8 T cells were electroporated with 5ug of TCR alpha chain and 5ug of TCR beta chain using the Square Wave protocol set at 500V, 1 pulse, 5 ms using 4mm cuvettes. After electroporation, cells were transferred to their culture medium for 1 hour, followed by overnight coculture in a 1 :1 ratio, 10A4 cells of each cell type. After overnight incubation, the culture plate was centrifuged for 5 minutes at 1500 RPM. Coculture supernatant was collected, and IFN-gamma ELISA (ThermoFisher) was performed according to the supplier’s protocol.

[0159] Killing assay

[0160] H1650 eGFP+ MAGE A1 + cells were seeded in a flat bottom 96 well plate. After overnight incubation, CD8+ T cells, sorted from healthy donor PBMC, were electroporated with MAGE A1 TCR alpha and beta chain encoding mRNA. One hour after electroporation, CD8+ T cells were added to the seeded H1650 cells in a target-to-effector ratio of 1 :3. No additional cytokines were added to the cultures. Cocultures were monitored for 3 days using IncuCyte (Essen bio). Antigen specific T cell activation was characterized using flow cytometry.

[0161] RESULTS

[0162] Synthetic DNA templates encoding for T cell receptor alpha or beta chains for IVT mRNA production.

[0163] A general scheme forthe assembly PCR of the present invention is illustrated in Figure 1 .A. Herein, one single stranded DNA ultramer oligo (or derived dsDNA PCR) and one double stranded g-block of each approximately 550 base pairs are designed to hybridize together via assembly PCR, resulting in a double stranded DNA template containing a T7 promotor, kozak sequence and 5’- and 3’ UTR framing the open reading frame (ORF) encoding for the TCR alpha or beta chain.

[0164] Here, the oligo comprising the T7 promotor, 5’ UTR and part of the ORF encodes the variable region (VR) of the TCR which is interchangeable for any other antigen receptor variable region. This results in a method for modular synthetic DNA template (MSDT) production allowing fast, flexible, and up scalable production of TCR for the validation of neo-antigen peptide-MHC complexes (pMHC) and cognate TCR pairs. Figure 1.B illustrates that during DNA template production, the products are subjected to multiple quality controls, assessing the yield, purity, integrity (Figure 1.E) of the DNA (table 2) and mRNA (table 3) and are aligned with the reference sequence. Table 2: Release criteria for MSDT

[0165] LSDT DNA p53-A2 gpl00-A2 NYESO-A2 Magel-A2 alpha beta alpha beta alpha beta alpha beta chain chain chain chain chain chain chain chain

[0166] Test Method Release Criteria Template after amplification PCR

[0167] A .ppearance . V..isua .l . inspect ..ion clear, colorless V V V V V V V V so ,lut ..ion peak matching Integrity CGE-DNA theoretical 1149bp 1263bp 1 168bp 1260bp 1152bp 1272bp 1 158bp 1257bp length

[0168] 100% 100% 100% 100% 100% 100% 100% 100% complete

[0169] Identity DNA sequencing alignment with ref ,erence sequence

[0170] Table 3: Release criteria of MSDT-derived IVT mRNA

[0171] LSDTRNA p53-A2 gpl00-A2 NYESO-A2 Magel-A2 alpha beta alpha beta alpha beta alpha beta chain chain chain chain chain chain chain chain To achieve favorable mRNA yield, the DNA template is PCR amplified to a concentration of 100ng / uL, before IVT as evidenced in Figure 1 C. After IVT, a poly-A tail is enzymatically added to the 3’UTR of the mRNA strand. The DNA fragments coding for the constant region of the TCR are designed to be PCR amplified for replenishment of the reagent while maintaining the integrity. This furthers lowers the cost of template production, allowing cost-effective production of a large pool of candidate TCR. The constant regions are amplified to a concentration of 100 ng / uL, like the concentration of the stock, to ensure similar yields. Figure 1 D shows the concentration of the reverse oligo for TCR alpha and beta chains respectively, after multiple amplifications PCR. MSDT production with the amplified constant region (via PCR) are submitted to the same QC as the stock productions and show similar results on electropherograms (Figure 1 F). Electrophoretic analysis of the PCR products confirms integral assembly of the constant and variable region oligonucleotide (Figure 1.G). poly-A tailing of IVT mRNA

[0172] Before IVT, assembled DNA template are further amplified to a concentration of 100 ng / uL, as per IVT a total amount of 5 ug of DNA template is required, resulting in 125 to 150 ng / uL of mRNA, in a reaction volume of 200 uL. For poly-A tailing of IVT mRNA, two different approaches can be considered, either by an enzymatic approach (A(enz)) or a co-transcriptional approach (A(syn)). For the latter, a sequence of 150-A needs to be incorporated in the DNA template. This was achieved with PCR by changing the reverse primer for a primer containing a 150-A sequence, resulting in a poly-A tail at the 3’ end (Figure 2.A). mRNA constructs were generated encoding a TCR recognizing the p53 antigen, presented in HLA A*0201 , using the different poly-A tailing strategies.

[0173] Electrophoretic analysis of these different mRNA molecules, shows a shift in size compared to non- poly-tailed mRNA, indicating successful tailing for each strategy (Figure 2.B). To validate the functionality of the resulting mRNA, we performed an assay using human CD8+ T cells sorted from peripheral blood mononucleated cells (PBMC), electroporated with the TCR alpha and beta chain, which were cocultured with K562, presenting the beforementioned p53 epitope. After overnight coculture, an IFN-g ELISA was performed on coculture supernatant, showing increased IFN-g levels upon coculture with TCR encoding mRNA electroporated T cells. Comparing the two poly-A tailing strategies, A(syn) resulted in a significant increase in IFN-g concentration compared to A(enz), reaching similar levels to the benchmark, PDT generated mRNA (Figure 2.C).

[0174] K562 allow fast and versatile HLA-I transfection and antigen presentation.

[0175] In order to screen for neo-antigens, a highly flexible screening assay is required to take the high polymorphism of HLA class-l and -II molecules into account. To address this, we propose the use of HLA-I encoding IVT-mRNA that is used for transfection of an antigen presenting cell (APC), as illustrated in Figure 3A. For this work we focus on the validation of HLA-I presented neoantigens and their cognate TCR as, in contrast to HLA-I I molecules, large databases of HLA-I sequences are publicly available, allowing development of HLA-I encoding mRNA libraries containing the most common HLA restrictions. For these screening assays, we opted for the K562 cell line, as these ensure sufficient antigen presentation and K562 were electroporated with a mix of 5 ug HLA-I and 5 ug antigen mRNA. As an example, for longevity of HLA-I expression after electroporation, 2E6 K562 were electroporated with 5 ug of HLA A02:01 mRNA and expression was detected by flowcytometry at different timepoints after electroporation (Figure 3B). Electroporation was considered efficient as approximately 95% of the viable cells presented HLA A2:01 as soon as 4h postelectroporation. HLA presentation peaked after 18h post-electroporation as indicated by the mean fluorescence intensity (MFI). We investigated whether this timeframe of HLA presentation allowed detectible antigen presentation. To do so, K562 were co-electroporated with p53 / A02:01 and HLA A02:01 and cocultured with peripheral blood mononucleated cells (PBMC) sorted CD8 T cells from an HLA A02:01 donor electroporated with the p53 / A02:01 cognate TCR. Here IFN-gamma was detected after overnight cocultured, equivalent to HLA A02:01 transduced K562, indicating sufficient antigen presentation within the timeframe of this assay (Figure 3C). Flow cytometry plots of HLA A02:05, A26:01 , B50:01 and B07:02 showed expression in K562 cells, 18 hours postelectroporation (data not shown).

[0176] Hu CD8 T cells electroporated with MSDT manufactured mRNA encoding tumor associated antigens cognate T cell receptors induce specific T cell responses upon epitope recognition.

[0177] MSDT generated mRNA encoding TCR was validated with the potency assay (Figure 3.A) using the four HLA-A02:01 WT tumor associated antigen (TAA) recognizing TCR: p53, gp100, NY-ESO- 1 and Mage A1. PBMC sorted CD8 T cells were electroporated with 5 ug of TCR alpha chain and 5 ug TCR beta chain mRNA, and cocultured with HLA A2:01 and antigen electroporated K562. After overnight coculture, coculture supernatant was analyzed for cytokine secretion. To validate antigen specificity of the TCR, CD8 T cells electroporated with a certain TCR were cocultured with K562 presenting non cognate antigens. Results from the INF-y (Figure 4.A) and IL-2 (Figure 4.B) ELIZA, show there is only cytokine secretion when CD8 T cells electroporated with TCR encoding mRNA are cocultured with K562 electroporated with a cognate antigen in the correct HLA-I molecule. mRNA engineered CD8 T cells were collected after coculture to investigate costimulatory molecule and activation marker expression. Flow cytometry analysis show an upregulation of CD25, CD69 and CD137, all associated with antigen specific T cells activation (Figure 4.C). Flow cytometry analysis of jurkat cell electroporated with MSDT generated TCR mRNA show TCR expression until at least 72 hours after electroporation (Figure 4.D).

[0178] To evaluate the capacity of mRNA TCR engineered T cells to kill cancer cells, the non-small cell lung cancer (NSCLC) cell line H1650 was engineered to be MAGE A1 / A*0201 and eGFP positive. Equal amounts of target cells were cocultured with CD8 T cells, electroporated with PDT derived Mage A1 TCR mRNA, MSDT Mage A1 TCR mRNA, or non-cognate TCR mRNA, in a 1 to 3 effector-target ratio. We observed that MSDT production of TCR encoding mRNA results in mRNA with a higher dsRNA content compared to PDT produced TCR mRNA. As dsRNA is known to negatively impact mRNA translation and lifetime, cellulose purification (CP) was performed to remove dsRNA and impact on T cell killing capacity, upon electroporation of CP TCR mRNA was evaluated. Live cell imaging shows a reduction of eGFP signal over 3-day follow-up, indicating killing of target cells, only when cocultured with cognate TCR expressing T cells (Figure 5.A). Additionally, flow cytometry analysis was performed evaluating T cell activation and exhaustion markers (figure 5.B), showing upregulation of the activation markers CD25, CD69 and CD137 and the checkpoint PD-1 . EXAMPLE 2: Chimeric Antigen Receptor

[0179] To streamline and accelerate CAR-T cell testing, mRNA-based protocols offer significant advantages over traditional lentiviral vector-based methods. As shown below, the MSDT platform allows CAR-T cell generation within days, leading to a significant advantage over the classical plasmid-based mRNA production that requires weeks. We show that by performing just two PCR steps and an in vitro transcription reaction, high-quality synthetic mRNA-encoding CARs can be rapidly generated. In this example, we focused on the generation of CAR-T cells targeting B7-H3, an antigen expressed in various tumors (e.g., glioblastoma). Provided herein are 4 CAR T cell products that include an anti-B7-H3 nanobody.

[0180] METHODS

[0181] Cell lines

[0182] LN229 cell line was cultured in DMEM, supplemented with 10% FBS (Pan-Biotech, Cat. No. P30- 3306, Lot. No. P210405) and 2,5% of PS / L-Glu (50 U / mL penicillin, 50 ug / mL streptomycin, and 2 mM L-glutamine). Peripheral blood mononucleated cells were cultured in IMDM supplemented with 1 % human AB serum and 5% supplements (PS / L-Glu with additional 1 mM Sodium pyruvate and non-essential amino acids).

[0183] Generation of synthetic DNA templates

[0184] The MSDT encoding for the nanobody-based chimeric antigen receptors (also referred to as NanoCARs) was generated using two synthetic oligonucleotides (Megamers, Integrated DNA Technologies [IDT]), that were designed to hybridize together during assembly PCR (KAPA HiFi HotStart ReadyMix; Roche) forming the MSDT (NanoCAR-SDT), which was further amplified by PCR. After each PCR, the formed MSDT was purified (GeneJet PCR Purification Kit; Thermo Fisher Scientific). As quality controls, the yield (absorbance at 260 / 280 nm), integrity (BioAnalyzer 2100, DNA 7500chip), and sequence (Eurofins Genomics) of each NanoCAR-SDT manufactured was verified.

[0185] Four types of NanoCAR constructs were tested (NbO, Nb2, Nb16, Nb38). An example of the oligo structures forming the nanoCARs is given in Table 4 below. While oligo 1 (Fw1) - which encodes the variable region (VR) - will be different for each construct, it is evident that oligo 2 (Rv1), which encodes the constant region (CR) of the nanoCAR (SEQ ID NO: 36), will be the same for each nanoCAR constructs (NbO, Nb2, Nb16, Nb38). Accordingly, oligo 1 encoding the variable region of the nanoCAR NbO, Nb2, Nb16, Nb38 may be defined by resp. SEQ ID NO: 32, 33, 34, 35, and oligo 2 encoding the constant region of the naoCAR may be defined by SEQ ID NO: 36.

[0186] Table 4: Example of oligo sequences for nanoCARs. The underlined part represents the T7 promotor, the bold italic represents the 5’UTR (Fw oligo 1), orthe 3’UTR Rv oligo 2), the capitalized letters represent the VARIABLE REGION, and the lowercase letter marked on grey represent the hybridizing overlap.

[0187] In vitro transcription

[0188] The IVT reaction was performed starting from a dsDNA template (NanoCAR-SDT) using a T7 enzyme mix containing: T7 RNA polymerase (ThermoFisher Scientific), RNase inhibitor (Promega), and inorganic pyro-phosphatase (ThermoFisher Scientific). The reaction buffer mix included 10 mM Clean CAP AG reagent (TriLink Biotech) and 10 mM of each dNTP (adenosine-, guanosine-, cytidine- and uridine-triphosphate; Promega). The reaction was incubated at 37°C. for 2 h. After incubation, 10U DNase I exonuclease (ThermoFisher Scientific) was added to the reaction mix and incubated for 15 min at 37°C for the removal of residual dsDNA template. Subsequently, 1.5 volumes of 40 mM EDTA solution were added to the mix to stop any further enzymatic activity and LiCI-mediated precipitation was performed by adding half the reaction volume of 8 M LiCI (Sigma- Aldrich) to the mRNA solution. After storage at -20°C overnight, the mRNA sample was centrifuged (15 min at 16,000g), and the obtained pellet was washed with 70% ethanol (Sigma-Aldrich) and subsequently dissolved in RNase-free water (Gibco). The resulting MSDT encoding mRNA was subjected to quality controls, including spectrophotometric reading of optical density for the yield determination and purity (absorbance ratio at 260 / 280 nm), integrity (BioAnalyzer 2100, RNA 6500 chip), and cDNA sequence verification (cDNA kit; NEB and Eurofins Genomics).

[0189] Flow cytometry

[0190] Cells were harvested and washed twice with PBS containing 1 % BSA (flow cytometry buffer). The following antibodies were used to evaluate the viability and phenotype of the T cells: CD4, CD8, CD69, CD137 (41 BB), CD25, Fix-Viability-eFluor 506. Biotinylated Human B7-H3 (4lg) recombinant protein (AcroBiosystems) and PE-streptavidin (eBioscience) were used as staining to evaluate the NanoCAR expression.

[0191] T cell activation assay

[0192] Electroporations were performed using the Gene PulserXCell Electroporation System (Biorad). For every condition, 2*10A6 CD8+T cells were washed with Opti-MEM twice and electroporated with 10pg of NanoCAR-SDT mRNA using the Square Wave protocol set at 500V, 1 pulse, 5 ms using 4mm cuvettes in 200 pL optiMEM. After electroporation, T cells were incubated for 1 hour and cocultured with target cells in a 2:1 ratio (5*10A4 CD8+T cells and 2.5*10A4 LN229 cells). After 24h incubation, the cells were harvested for flow cytometry analysis, while the supernatant was collected and IFN-gamma ELISA (ThermoFisher) was performed according to the manufacturer’s instructions.

[0193] RESULTS Generation of IVT mRNA encoding nanobody-based chimeric antigen receptors starting from a MSDT

[0194] Figure 6A provides an overview of the workflow used to generate mRNA-encoding nanobodybased chimeric antigen receptors (NanoCARs) using a MSDT. Specifically, two single-stranded DNA oligonucleotides are used in an assembly PCR to produce a double-stranded DNA template, which is subsequently amplified in a second PCR to yield a sufficient amount for mRNA production via in vitro transcription.

[0195] The first oligonucleotide (550 bp) encodes the variable region (VR) of the NanoCAR and includes the T7 promoter, IgK leader sequence, 5’ UTR, and the open reading frame (ORF) encoding the nanobody and hinge region. The second oligonucleotide (800 bp) encodes the constant region (CR) of the NanoCAR, comprising the ORF of the hinge region, the transmembrane domain, and the intracellular part of the NanoCAR, followed by the 3’ UTR. The hinge region, present in both oligonucleotides, enables their hybridizing during the assembly PCR. In this example, variable regions encoding different nanobodies (NbO, Nb2, Nb16, Nb38) were designed and hybridized to the same constant region. This streamlined and scalable protocol allowed rapid testing of different NanoCAR variants.

[0196] Due to the low DNA concentration obtained after the assembly PCR (<15 ng / pL), further amplification was necessary to produce sufficient DNA template for the in vitro transcription reaction (Figure 6B). Synthetic poly-A tailing was achieved using a poly-T reverse primer in the amplification PCR. For all constructs, high mRNA yields (>100 pg) were obtained from a small, fixed amount of DNA template (2.5 pg), as shown in Figure 6C. Quality control assessments, including yield, purity, integrity, and sequence verification, were conducted for both DNA and mRNA products (Table 5). Electropherograms of the mRNA encoding the four NanoCARs (Figure 6D) confirm the integrity of the products, each represented by a primary peak corresponding to the expected length.

[0197] Table 5:

[0198] NanoCAR SDT DNA (after amplification)

[0199] NbO Nb2 Nb16 Nb38

[0200] Test Method Release criteria

[0201] Appearance Visual inspection Clear, colorless solution V V V

[0202] Content > 50 ng / pL 203.130 136.820 147.28 59.767 spectrophotometry

[0203] A260 / 280 1.8 - 2.0 2.0 1.96 2.1 2.3 peak matching theoretical

[0204] Integrity CGE-DNA length 1486bp 1459bp 1480bp 1480bp

[0205] Complete alignment with

[0206] Identity DNA sequencing reference sequence 100% 100% 100% 100%

[0207] NanoCAR SDT mRNA

[0208] NbO Nb2 Nb16 Nb38

[0209] Test Method Release criteria

[0210] Appearance Visual inspection Clear, colorless solution V V V Content > 100 ng / pL 1011.25 1028.95 1146.17 1064.77 spectrophotometry

[0211] A260 / 280 > 2.0 2.41 2.37 2.45 2.46 peak matching theoretical

[0212] Integrity CGE-RNA |engthV V V V

[0213] No detectable RNA after

[0214] Identity RNase digestion RNase digestion on CGE 1486b 1459b 1480b 1480b

[0215] Functional Evaluation of NanoCAR T cells generated via MSDT-mRNA

[0216] The functionality of MSDT-generated mRNA was evaluated by electroporating 10 pg of mRNA into human CD8+T cells, followed by coculture of the resulting NanoCAR T cells with target tumor cells. After 24 hours of coculture, NanoCAR T cells exhibited viability greater than 80% across all conditions, with NanoCAR expression observed in 70-90% of T cells (Figure 7A-B).

[0217] To assess T cell activation, IFNy production, a standard marker of T cell activation, was quantified in the coculture supernatants using ELISA. Notably, the four constructs incorporating the anti-B7- H3 nanobodies (Nbs) showed varied effects on T cell activation. Specifically, NanoCAR containing Nb38 demonstrated no IFNy production, Nb2 resulted in lower production compared to NbO, and Nb16 exhibited similar levels of activation of NbO (Figure 7C).

[0218] Following coculture, NanoCAR T cells were analyzed by flow cytometry for the expression of activation markers. As shown in Figure 7D, CD69, CD137 (4-1 BB), and CD25 expression levels were consistent with the corresponding IFNy concentration detected in the supernatants.

[0219] These findings highlight the feasibility of using the MSDT platform for rapid and versatile screening of newly developed mRNA-based CAR T cells.

[0220] EXAMPLE 3: Advantages of the MSDT method of the invention over the SDT method of the prior art.

[0221] Example 3.1

[0222] In this example, we assessed whether it is feasible to produce long modular synthetic DNA templates (MSDT) which generate templates of approximately 1000 kilobases (kb) by annealing of two short oligonucleotides of 500 kb by polymerase chain reaction (PCR), encoding the TCR alpha or beta chain, with the SDT method (using oligonucleotide of 200 kb) of Mey et al., 2022. Using the SDT method implies that multiple annealing steps would be required for the generation of longer DNA templates, instead of just one, as illustrated in Figure 8.

[0223] METHOD:

[0224] To synthesize a DNA template with short oligonucleotides three, or four (for TCR alpha and beta chains, respectively) assembly PCR would need to be performed, instead of a single assembly PCR for the MSDT method of the invention. To do so, the DNA template is cut in six separate nucleotides to cover the full sequence length of the TCR chain (as shown in Figure 8A), compared to two with the MSDT method. Subsequently, consecutive assembly PCR reactions were performed having the following results:

[0225] Assembly PCR 1 (annealing of Fw1 to Rv1):

[0226] The electropherogram, which shows the integrity of the generated DNA template, shows a sharp peak at approximately 400 bp (Figure 8.B), indicating successful assembly of the Fw1 and Rv1 oligo, of each 200 bp. This is a pure PCR product, as a single peak (implying size of the DNA template) is obtained.

[0227] Assembly PCR 2 (annealing of Fw2 to Rv2 and to the product of PCR1):

[0228] The two most prominent peaks on the electropherogram are found at 372 bp and 867 bp, showing an impure off-target PCR product (containing DNA templates of different lengths) with only a small fraction of theoretical expected template (Fw2 and Rv2 annealed to each other and PCR product 1) produced (Figure 8.C).

[0229] Assembly PCR 3 (annealing of Fw3 to Rv3 and to the product of PCR2):

[0230] Theoretically, PCR 3 should generate a DNA template equivalent to the MSDT method, though the electropherograms shows an impure off-target PCR product, not suitable for in vitro transcription, and a main peak at 300 bp (Figure 8.D), which does not match the expected theoretical peak of approximately 1000 bp, as observed with the MSDT method (Figure 8.E).

[0231] The product of PCR3 was subsequently used for in vitro transcription:

[0232] A very low yield of mRNA (36.12 ng / uL) is obtained, which is also observed in the electropherograms, confirming failure of the IVT reaction. The SDT approach revealed in a smear across the electrogram (Figure 8.F), which is highly contrasted by the MSDT method, where a clean peak at the expected size (Figure 8.G), and a high yield is observed.

[0233] The data shows that step one of the assembly process may still be successful when using SDT, however, the following two SDT assembly steps are clearly not. From this we conclude that it is not feasible to produce long modular synthetic DNA templates with the SDT method of Mey et al., 2022, which is also proved in the unsuccessful result of the in vitro transcription reaction. No mRNA could be generated thereof.

[0234] Example 3.2

[0235] The inventors evaluated the two-oligonucleotide assembly according to the invention, to a three- oligonucleotide assembly as described in the prior art wherein oligo 1 encodes for a T7 promotor and a 5’ UTR; oligo 2 encodes for the antigen receptor and oligo 3 encodes for the 3’ UTR and a poly(A) tail.

[0236] As shown on the right side of the electropherogram (Figure 9), the 2-oligo assembly according to the invention resulted in a single peak, matching the theoretical length of the entire construct (at ±1000 bp). No second round of assembly is required. After amplification - which is useful to have enough DNA template for in vitro transcription - the single peak remains. In vitro transcription results in mRNA matching the size of the DNA peak. The peak at 25 is the internal control reference added to the sample, as a reference for the Agilent bioanalyzer system.

[0237] On the other hand, assembly 1 of the corresponding 3-oligo assembly resulted in multiple off-target peaks at ±700-900 bp, wherein one peak might refer to the desired product, but other assembly products are also generated (smaller peaks at the base of the desired peak). The second round of assembly resulted in a main peak of undesired length indicating incorrect assembly of the oligonucleotides. Amplification of such a heterogenic mix of fragments results in amplification of multiple undesired PCR products which are not suitable and compromise further the IVT reaction and any possible use of the derived product. Still, after performing IVT of the amplification PCR products, this resulted in a low yield of mRNA with a broad peak, indicating a heterogenous pool of mRNA constructs, not suitable for further use.

[0238] Accordingly, when possible, an IVT was performed from these templates but the end product did not comply with the quality control (Figure 9) and thus were also unsuitable to be used for in vitro mRNA transcription. Thus, a 3-oligo assembly method leads to an assembling strategy wherein a heterogenic mix of synthetic DNA templates is formed which cannot be used to generate mRNA in an in vitro transcription reaction as it resulted in lack or aberrant transcription of mRNA molecules. The specific method according to the invention solves this problem as the method provides intact, viable DNA templates that are particularly suitable for in vitro mRNA transcription.

[0239] DISCUSSION

[0240] The present application provides an approach for the generation of modular synthetic DNA templates encoding TCR chains, suitable for IVT and mRNA-validation of TCR reactivity. This speeds up mRNA production from 4-to-6 weeks (when starting from cloning and bacterial amplification) to a process of a few hours, when using PCR-based assembly of oligonucleotides and amplification. Functionality of this platform was validated using healthy-donor primary T cells, showing T cell functionality upon electroporation of TCR encoding mRNA and recognition of a TCR cognate epitopes, showcased by upregulation of common T cell activation markers and release of the cytokines IFN-y and IL-2. This novel method for TCR mRNA production facilitates validation of in silico prioritized neo-epitope cognate TCR. Here, it has been demonstrated that TCR mRNA engineered T cells can kill the target cell line H1650, expressing the Mage A1 epitope, presented in HLA A*0201 showcasing therapeutic potential for TCR mRNA engineered T cells as an alternative medicinal product for personalized ACT. With this it is important to stress here is that validation of the right TCR prior to therapy initiation is key, and that the template and method described herein may further need in vivo validation to determine the right treatment set-up, as a main question regarding mRNA-based ACT remains whether transient expression of the engineered receptor is efficient enough to ensure disease control, although further optimization could be done to increase expression by incorporation of modified nucleotides or additional purification. On that note, as this production platform is fully synthetic, i.e. not relying on cloning and bacterial fermentation, a transition to production of mRNA according to good manufacturing practice (GMP) would be facilitated compared to conventional production methods. Additionally, it has been demonstrated that mRNA transfection of HLA-I and antigen mRNA results in efficient epitope presentation, which could allow versatile screening methods for epitope and TCR interaction. This eliminates the need for abundant patient derived material or time-consuming stable transfection of cell lines for validation experiments.

[0241] Fast and flexible validation of TCR - pHLA reactivity could not only be important for the discovery of neo-epitope cognate TCR, but could also be employed for TCR optimization studies, aiming at improving affinity and / or specificity. Ultimately, validation of TCR reactivity contributes to a deeper understanding of the TIL repertoire and improved computational pipelines predicting neo-epitope reactive TCR clones will drive the use, driving the use of TCR-based ACT to the clinic.

[0242] REFERENCES

[0243] W. de Mey et al., “A synthetic DNA template for fast manufacturing of versatile single epitope mRNA,” Mol Ther Nucleic Acids, vol. 29, pp. 943-954, Sep. 2022, doi: 10.1016 / j.omtn .2022.08.021 .

Claims

CLAIMS1 . A plasmid-free modular synthetic DNA template (MSDT) for in vitro mRNA transcription of an antigen receptor, obtainable by an assembly PCR of 2 synthetic oligonucleotides wherein:- a first synthetic oligonucleotide sequence (oligo 1) encodes an RNA polymerase promotor, a 5’ untranslated region (5’ UTR), and a variable region (VR) of the antigen receptor; and- a second synthetic oligonucleotide sequence (oligo 2) encodes a constant region (CR) of the antigen receptor, and a 3’ untranslated region (3’ UTR); wherein said oligo 1 comprises a hybridizing overlap sequence with oligo 2, wherein the sequence of said hybridizing overlap of oligo 1 is part of the constant region (CR) sequence of oligo 2.

2. The MSDT according to claim 1 , wherein each of said oligo 1 or oligo 2 is at least 600 bp in length, preferably at least 650 bp in length, more preferably at least 700 bp in length, even more preferably at least 800 bp in length.

3. The MSDT according to any one of claim 1 or 2, wherein the length of said MSDT is at least 1400 bp, preferably at least 1500 bp, more preferably at least 1600 bp, even more preferably at least 1700 bp, most preferably at least 1800 bp.

4. The MSDT according to any one of claim 1 to 3, wherein said hybridizing overlap sequence of oligo 1 is the reverse complement sequence of a part of the constant region (CR) sequence of oligo 2, in particular the reverse complement sequence of the 3’ end of the constant region (CR) sequence of oligo 2.

5. The MSDT according to any one of claim 1 to 4; wherein the hybridizing overlap sequence is about and between 10 to about 200 nucleotides, in particular about and between 15 to about 100 nucleotides, more in particular about and between 20 to about 40 nucleotides.

6. The MSDT according to any one of claims 1 to 5, wherein said hybridizing overlap sequence of oligo 1 comprises a nucleic acid sequence as set forth in any one of SEQ ID NO: 41-44, 60-61 , or a sequence having at least 85% sequence identity thereto.

7. The MSDT according to any one of claim 1 to 6, wherein the variable region (VR) of the antigen receptor is in the form of a variable domain derived from an antibody, a Camelidae antibody, or an antigen binding fragment (Fab); or in the form of one or more single chain variable fragments (scFv), or one or more single domain antibodies (VHH).

8. The MSDT according to any one of claims 1 to 7, wherein said antigen receptor is a T-cell antigen receptor, a chimeric antigen receptor, a B cell antigen receptor, or an antibody receptor.

9. The MSDT according to any one of claim 1 to 7, wherein the antigen receptor is a T-cell antigen receptor, in particular a T-cell antigen receptor wherein said oligo 1 sequence encodes forthe alpha and / or beta chain of the variable region of said antigen receptor and wherein said oligo 2 sequence encodes for the alpha and / or beta chain of the constant region of said antigen receptor.

10. The MSDT according to any one of claim 1 to 7, wherein the antigen receptor is a chimeric antigen receptor, in particular a chimeric antigen receptor wherein the variable domain is in the form of one or more single chain variable fragments (scFv), or one or more single domain antibodies (VHH).11 . The MSDT according to any one of claim 1 to 10, wherein oligo 1 or oligo 2 further comprises a sequence as set forth in SEQ ID NO: 62, or having at least 85% sequence identity thereto, in particular wherein said sequence is located upstream of the RNA polymerase promotor sequence of oligo 1.

12. The MSDT according to any one of claims 1 to 11 for use in immunotherapy or for use in immunotherapy screening, in particular for neo-epitope and antigen receptor screening and validation.

13. Use of the MSDT according to any one of claims 1 to 11 , in plasmid-free manufacturing of mRNA.

14. A method of manufacturing a plasmid-free modular synthetic DNA template (MSDT) for in vitro mRNA transcription of an antigen receptor, said method comprising:- contacting a synthetic oligonucleotide sequence (oligo 1) encoding an RNA polymerase promotor, a 5’ untranslated region (5’ UTR), and a variable region (VR) of the antigen receptor, with a synthetic oligonucleotide sequence (oligo 2) encoding a constant region (CR) of the antigen receptor, and a 3’ untranslated region (3’ UTR), wherein said oligo 1 comprises a hybridizing overlap with oligo 2, wherein the sequence of said hybridizing overlap of oligo 1 is part of the constant region (CR) sequence of oligo 2;- performing an assembly PCR;- optionally purifying said formed MSDT PCR product.

15. An in vitro method of plasmid-free manufacturing of mRNA for use in immunotherapy, in immunotherapy screening, or mRNA-based therapeutic evaluation, said method comprising:- performing an assembly PCR of the 2 synthetic oligonucleotides as defined in the preceding claims, yielding a plasmid-free modular synthetic dsDNA template (MSDT);- amplification of said MSDT, yielding a plurality of plasmid-free MSDT amplification products; and- performing a plasmid-free in vitro transcription (IVT) reaction of said MSDT amplification products.

Images