Composition containing human urine concentrate, method for producing same, cell population, human urine collection system, muscle differentiation promoter, and muscle damage therapeutic agent

Abstract

Disclosed are: a composition containing a human urine concentrate; a method for producing the same; a cell population; a human urine collection system; a muscle differentiation promoter; and a muscle damage therapeutic agent. The muscle differentiation promoter and the muscle damage therapeutic agent contain a nucleic acid that promotes the expression of serglycin or serglycin core protein.

Description

Composition containing human urine concentrate and method for producing same, cell population, human urine collection system, muscle differentiation promoter, and muscle damage treatment agent

[0001] The present disclosure relates to a composition containing a human urine concentrate and a method for producing the same, a population of cells, a human urine collection system, a muscle differentiation promoter, and a muscle damage treatment agent.

[0002] Myotubes (also called "myotube cells") are immature muscle cells. Myotubes are involved in the formation and regeneration of muscle fibers. At sites where muscle fibers are damaged, for example, by trauma, muscle tissue is regenerated through the development and growth of myotubes.

[0003] Because collecting muscle fibers from human subjects is highly invasive, attempts have been made to directly induce myotubes from non-invasively obtainable human urine-derived cells as surrogates for muscle fibers used in drug evaluation for muscle diseases, muscle disease research, biopsies, etc. For example, Patent Literature 1 discloses a method for generating myotubes (myotube cells) from urine-derived cells, including the steps of introducing MyoD1 (myoblast determination protein 1), a muscle regulatory factor (MRF), into human urine-derived cells (urinary cells) and exposing the urine-derived cells to at least one epigenetics-regulating compound. Furthermore, further technological developments are being attempted for the establishment of human urine-derived cells.

[0004] Serglycin is a type of proteoglycan (glycoprotein). It is present in and secreted from various types of animal cells. Its main physiological function is known to be its involvement in immune function. For example, serglycin is known to be involved in maintaining homeostasis and regulating the storage function of secretory granules in immune cells, immunoregulation, apoptosis, etc. (Non-Patent Document 1).

[0005] International Publication No. 2020 / 136696

[0006] Svein O. Kolset and Gunnar Pejler “Serglycin: A Structural and Functional Chameleon with Wide Impact on Immune Cells”, The Journal of Immunol (2011) 187 (10): 4927-4933.Kunitake K, Motohashi N, Inoue T, Suzuki Y, Aoki Y. “Characterization of CD90 / Thy-1 as a crucial molecular signature for myogenic differentiation in human urine-derived cells through single-cell RNA sequencing. Sci Rep. 2024;14(1):2329.

[0007] The involvement of serglycin in muscle tissue formation and muscle differentiation is unknown.

[0008] An object of the present disclosure is to provide a muscle differentiation promoter and a muscle damage therapeutic agent.

[0009] Furthermore, since human urine-derived cells are useful cells that can be induced to differentiate into many types of cells, including myotubes, there is a need for a method for establishing human urine-derived cells. Therefore, another object of the present disclosure is to provide an invention that can contribute to the establishment of such human urine-derived cells.

[0010] The present inventors have discovered that serglycin has the ability to promote muscle differentiation and the effect of repairing muscle damage.

[0011] The present inventors have also succeeded in developing a composition containing a human urine concentrate, a method for producing the same, a cell population, and a human urine collection system, which can contribute to the establishment of human urine-derived cells.

[0012] For example, the present disclosure relates to the following: [1-A] A muscle differentiation promoter containing a nucleic acid that promotes the expression of serglycin or serglycin core protein. [1-B] A composition for promoting muscle differentiation containing a nucleic acid that promotes the expression of serglycin or serglycin core protein. [1-C] A method for promoting muscle differentiation, comprising administering a nucleic acid that promotes the expression of serglycin or serglycin core protein to a subject in need thereof. [1-D] A nucleic acid that promotes the expression of serglycin or serglycin core protein for use in promoting muscle differentiation. [1-E] Use of a nucleic acid that promotes the expression of serglycin or serglycin core protein in the manufacture of an agent for promoting muscle differentiation. [1-F] Use of a nucleic acid that promotes the expression of serglycin or serglycin core protein in the manufacture of a composition for promoting muscle differentiation. [1-G] Use of a nucleic acid that promotes the expression of serglycin or serglycin core protein in promoting muscle differentiation. [2-A] The muscle differentiation promoter according to [1-A], which is an agent for promoting muscle differentiation of human urine-derived cells or muscle satellite cells. [2-B] The composition described in [1-B], which is used to promote muscle differentiation of human urine-derived cells or muscle satellite cells. [2-C] The use described in [1-E], wherein the muscle differentiation promoter is an agent for promoting muscle differentiation of human urine-derived cells or muscle satellite cells. [2-D] The use described in [1-F], wherein the composition is used to promote muscle differentiation of human urine-derived cells or muscle satellite cells. [2-E] The use described in [1-G], wherein the composition is used to promote muscle differentiation of human urine-derived cells or muscle satellite cells. [3] A method for producing myotubes, comprising contacting cells with a nucleic acid that promotes expression of serglycin or serglycin core protein. [4] The method described in [3], wherein the cells are human urine-derived cells. [5] The method described in [3] or [4], further comprising introducing the MYOD1 gene into the cells. [6-A] A muscle damage therapeutic agent containing a nucleic acid that promotes expression of serglycin or serglycin core protein. [6-B] A composition for treating muscle damage, containing a nucleic acid that promotes expression of serglycin or serglycin core protein. A method for treating muscle damage, comprising administering to a subject in need thereof [6-C]serglycin or a nucleic acid that promotes expression of serglycin core protein.[6-D] A nucleic acid that promotes the expression of serglycin or serglycin core protein for use in treating muscle injury. [6-E] Use of a nucleic acid that promotes the expression of serglycin or serglycin core protein in the manufacture of a therapeutic agent for muscle injury. [6-F] Use of a nucleic acid that promotes the expression of serglycin or serglycin core protein in the manufacture of a composition for treating muscle injury. [7] A human urine collection system comprising a container having a storage section for storing human urine and a sealing means capable of sealing the storage section, and an antibiotic stored in the storage section. [8] A method for producing human urine-derived cells, comprising a step of collecting human urine with the human urine collection system described in [7]. [9] A composition containing a human urine concentrate, dimethyl sulfoxide, and serum.

[10] The composition described in [9], wherein the content of the dimethyl sulfoxide is 2.0 to 50% by volume of the total composition and the content of the serum is 15 to 80% by volume of the total composition.

[11] The composition described in [9] or

[10] , which is for preparing human urine-derived cells.

[12] A method for producing human urine-derived cells, comprising the steps of concentrating human urine to obtain a human urine concentrate, preparing a mixture containing the human urine concentrate, dimethyl sulfoxide, and serum, and cryopreserving the mixture.

[13] A population of cells derived from human urine, comprising the steps of isolating cells having a diameter of 10 μm or less from a population of cells derived from human urine.

[14] A method for producing human urine-derived cells, comprising the steps of isolating cells having a diameter of 10 μm or less from a population of cells derived from human urine.

[15] The method according to [8],

[12] , or

[14] , wherein the human urine is human urine voided within three hours of urination.

[16] The method for producing myotubes according to any one of [3] to [5], wherein the cells are human urine-derived cells produced by the method for producing human urine-derived cells according to any one of [7] to

[15] .

[0013] According to the present disclosure, a muscle differentiation promoter and a muscle damage therapeutic agent are provided.

[0014] The present disclosure also provides a composition containing a human urine concentrate, a method for producing the composition, a cell population, and a human urine collection system, which can contribute to the establishment of human urine-derived cells. Such a composition containing a human urine concentrate, a method for producing the composition, a cell population, and a human urine collection system can contribute to, for example, increasing the success rate of establishing human urine-derived cells, simplifying the collection and / or storage of human urine used to establish human urine-derived cells, and / or increasing the purity of the established human urine-derived cells.

[0015] 1 is a vector map of the lentiviral vector pLV[Exp]-Bsd-CMV>hSRGN[NM_001321053.2] for introducing the SRGN gene. 2 is a vector map of the lentiviral vector pLV[shRNA]-Bsd-U6>hSRGN for introducing shRNA with SRGN-KD effect. 3 is a diagram showing fluorescent images obtained by immunofluorescence staining in Test Example 4. 4 is a diagram showing the fusion index in Figure 3, with the results for CD90(-)MYOD1-UDCs as (A) and the results for CD90(+)MYOD1-UDCs as (B). 5 is a diagram showing fluorescent images obtained by immunofluorescence staining in Test Example 5. 5 is a diagram showing the fusion index in Figure 5 in Test Example 5. 6 is a diagram showing fluorescent images obtained by immunofluorescence staining in Test Example 6. 10 is a diagram showing the proportion of cells that were also stained with Edu among cells stained with DAPI, i.e., the proportion of proliferative cells, in the proliferation evaluation of FIG. 7 in Test Example 6. FIG. 11 is a diagram showing the fusion index in the evaluation of differentiation potential into myotubes in FIG. 7 in Test Example 6. FIG. 12 is a diagram showing fluorescent images obtained by immunofluorescence staining in Test Example 7. FIG. 13 is a diagram showing the change over time in the proportion of eMyHC-positive muscle fibers, a marker for regenerating muscle fibers, to all muscle fibers (eMyHC+ fibers (%)), calculated based on fluorescent images obtained in the same manner as in FIG. 10 in Test Example 7. FIG. 14 is a diagram showing the muscle torque measurement results, normalized by the muscle torque value measured on day 0 in Test Example 7.

[0016] Hereinafter, embodiments for carrying out the present disclosure will be described, but the present disclosure is not limited to the following embodiments.

[0017] In the present disclosure, when a protein or nucleic acid comprises an amino acid sequence or a nucleotide sequence that has 90% or more sequence identity with a given amino acid sequence or a nucleotide sequence, the protein or nucleic acid may have 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity with the given sequence, and in a preferred embodiment, 95% or more sequence identity, and in a most preferred embodiment, 100% sequence identity.

[0018] In the present disclosure, when a sequence contained in a certain protein or nucleic acid has a mutation (i.e., sequence identity is not 100%) with respect to a predetermined amino acid sequence or nucleotide sequence, the mutation may be a mutation selected from substitution, deletion, insertion, and addition of 1 to 10 consecutive or dispersed residues or 1 to 30 bases. In a preferred embodiment, the mutation may be a mutation selected from substitution, deletion, insertion, and addition of 1 to 3 consecutive or dispersed residues or 1 to 10 bases. In a more preferred embodiment, the mutation may be a mutation selected from substitution, deletion, insertion, and addition of 1 residue or 1 to 3 bases.

[0019] <Muscle Differentiation Promoting Agent> A first aspect of the present disclosure is a muscle differentiation promoting agent (also referred to as a muscle differentiation promoting composition) containing a nucleic acid that promotes the expression of serglycin or serglycin core protein.

[0020] Serglycin is a glycosylated form of the serglycin core protein. In vivo, the serglycin core protein biosynthesized within cells is glycosylated within the cell to form serglycin, a portion of which is secreted extracellularly. For example, the amino acid sequence of the physiologically present serglycin core protein in humans is represented by SEQ ID NO: 1, and its National Center for Biotechnology Information (NCBI) Reference Sequence Number is XP_054222221.1. Furthermore, in humans, the amino acid sequence of SEQ ID NO: 1 is encoded by the mRNA shown in SEQ ID NO: 2. The mRNA shown in SEQ ID NO: 2 corresponds to bases 803 to 1279 of the mRNA with NCBI Reference Sequence Number XM_054366246.1 (bases 1277 to 1279 are stop codons). The amino acid sequence of a physiologically present serglycin core protein in mice is represented by SEQ ID NO: 3, and its NCBI Reference Sequence Number is NP_001345894.1. In mice, the amino acid sequence of SEQ ID NO: 3 is encoded by the mRNA shown in SEQ ID NO: 4. The mRNA shown in SEQ ID NO: 4 corresponds to bases 230 to 688 of the mRNA with NCBI Reference Sequence Number NM_001358965.1 (bases 686 to 688 are stop codons).

[0021] In one aspect, serglycin may be recombinant serglycin. Serglycin is preferably derived from an animal to which the muscle differentiation promoter is administered or from an animal from which cells contacted with the serglycin originate. For example, when the muscle differentiation promoter is administered to a human or when cells contacted with the serglycin are human-derived cells, the serglycin is preferably recombinant serglycin derived from a human. Recombinant serglycin may be serglycin that has been expressed in cells derived from the animal from which the serglycin originates, and then isolated and purified according to methods commonly performed by those skilled in the art. For example, recombinant serglycin may be serglycin that has been expressed in human-derived cells by introducing a nucleic acid containing a nucleotide sequence encoding a serglycin core protein (e.g., a nucleic acid containing a nucleotide sequence encoding human serglycin, such as the sequence set forth in SEQ ID NO: 2) into the human-derived cells, and then isolated and purified from the cells and / or their culture supernatant. Such recombinant serglycin may be commercially available from suppliers such as abcam (e.g., Recombinant Human Serglycin protein (ab116977)), or may be substantially the same as the commercially available recombinant serglycin.

[0022] In one aspect, the serglycin core protein may be a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence set forth in SEQ ID NO: 1 or 3, or may be a protein comprising an amino acid sequence that has 90% or more sequence identity to the amino acid sequence set forth in SEQ ID NO: 1. In another aspect, the serglycin core protein may be a protein consisting of an amino acid sequence that has 90% or more sequence identity to the amino acid sequence set forth in SEQ ID NO: 1 or 3, or may be a protein consisting of an amino acid sequence that has 90% or more sequence identity to the amino acid sequence set forth in SEQ ID NO: 1.

[0023] In the serglycin of the muscle differentiation promoter of the first aspect, the sugar chain modification of the serglycin core protein may be a sugar chain modification that can occur physiologically in the body of a subject to which the muscle differentiation promoter is administered or in cells derived from the subject, for example, O-glycosylation. In one embodiment, the sugar chain modification of the serglycin core protein may be O-glycosylation with a sugar chain containing at least one selected from the group consisting of chondroitin sulfate and herapan sulfate. In a preferred embodiment, the sugar chain modification of the serglycin core protein may be modification with a sugar chain consisting of a primary sugar chain of chondroitin sulfate or herapan sulfate that directly O-glycosylates the serglycin core protein and a secondary sugar chain that further modifies the primary sugar chain, or may be modification with a mucopolysaccharide (glycosaminoglycan) consisting of them. In these cases, in one embodiment, the chondroitin sulfate may be at least one selected from the group consisting of chondroitin sulfate A, chondroitin sulfate C, chondroitin sulfate D, chondroitin sulfate E, chondroitin sulfate K, chondroitin sulfate 4 (Non-Patent Document 1), and chondroitin sulfate diB (Non-Patent Document 1). In a preferred embodiment, the chondroitin sulfate may be at least one selected from the group consisting of chondroitin sulfate E, chondroitin sulfate 4, and chondroitin sulfate diB, or may be chondroitin sulfate E, chondroitin sulfate 4, or chondroitin sulfate diB. In these cases, in a preferred embodiment, the herapan sulfate may be heparin.

[0024] The nucleic acid that promotes the expression of the serglycin core protein may be any nucleic acid that can promote the expression of the serglycin core protein. In one embodiment, the nucleic acid comprising a nucleotide sequence encoding the serglycin core protein may be a nucleic acid comprising a nucleotide sequence encoding the serglycin core protein that promotes the expression of the serglycin core protein. In a preferred embodiment, the nucleic acid comprising a nucleotide sequence encoding the serglycin core protein may be an mRNA comprising a nucleotide sequence encoding the serglycin core protein, or a nucleic acid that gives the mRNA after transcription and splicing by a eukaryotic cell. In these, the nucleotide sequence encoding the serglycin core protein may be, for example, a ribonucleic acid base sequence set forth in SEQ ID NO: 2 or 4 (a sequence corresponding to the mRNA), a deoxyribonucleic acid base sequence complementary to the ribonucleic acid base sequence (a sequence corresponding to the cDNA), or a ribonucleic acid base sequence that gives the ribonucleic acid base sequence after transcription and splicing by a eukaryotic cell (a sequence corresponding to the pre-mRNA). In one embodiment, the nucleic acid comprising a nucleotide sequence encoding the serglycin core protein may be an mRNA comprising a nucleotide sequence having 90% or more sequence identity to the nucleotide sequence set forth in SEQ ID NO: 2 or 4, a nucleic acid complementary to the mRNA (cDNA), a nucleic acid that provides the mRNA after transcription and splicing by eukaryotic cells (pre-mRNA), or a vector into which they have been incorporated. In a preferred embodiment, the nucleic acid comprising a nucleotide sequence encoding the serglycin core protein may be an mRNA comprising a nucleotide sequence having 90% or more sequence identity to the nucleotide sequence set forth in SEQ ID NO: 2, a nucleic acid that provides the mRNA after transcription and splicing by eukaryotic cells (pre-mRNA), or a viral vector into which they have been incorporated (e.g., a lentiviral vector, an adenoviral vector, or an adeno-associated viral vector). In a most preferred embodiment, the nucleic acid comprising a nucleotide sequence encoding the serglycin core protein may be an mRNA consisting of a nucleotide sequence having 90% or more sequence identity to the nucleotide sequence set forth in SEQ ID NO: 2, or a viral vector into which it has been incorporated.

[0025] In one aspect, the content of the nucleic acid that promotes the expression of serglycin or serglycin core protein in the muscle differentiation promoter is not particularly limited and may be, for example, 0.001 to 100% by mass based on the total amount of the formulation. In one aspect, the muscle differentiation promoter may be composed solely of a nucleic acid that promotes the expression of serglycin or serglycin core protein. In one aspect, the muscle differentiation promoter may contain, as an active ingredient, a nucleic acid that promotes the expression of serglycin or serglycin core protein.

[0026] In the present disclosure, muscle differentiation refers to the differentiation of cells with stem cell properties into muscle cells or their precursor cells, or the differentiation of muscle satellite cells into muscle cells (e.g., myotubes or myoblasts).

[0027] The muscle differentiation promoter according to the first aspect may be used as a medicine or a reagent.

[0028] <Muscle Differentiation Promoting Agent Used as a Pharmaceutical> When the muscle differentiation promoting agent according to the first aspect is used as a pharmaceutical, it can promote muscle differentiation of cells in a subject to which it is administered, thereby increasing the proportion of muscle cells in the subject and enabling the treatment of diseases associated with an endogenous or exogenous deficiency of muscle cells.

[0029] When the muscle differentiation promoter is used as a medicine, in addition to serglycin and a nucleic acid that promotes the expression of serglycin core protein, the muscle differentiation promoter may contain additives commonly used in the pharmaceutical technology field, such as excipients, buffers, stabilizers, antioxidants, binders, disintegrants, fillers, emulsifiers, and flow additives.

[0030] When the muscle differentiation promoter is used as a pharmaceutical, the serglycin or nucleic acid that promotes the expression of the serglycin core protein contained in the muscle differentiation promoter may be encapsulated in a drug carrier that can deliver a component that does not have cell membrane permeability into cells. Examples of such drug carriers include liposomes and capsids.

[0031] When the muscle differentiation promoter is used as a pharmaceutical, the subject to which it is administered may be a human or a non-human animal. The non-human animal may be, for example, a mammal other than a human, specifically a mouse, rat, guinea pig, hamster, chimpanzee, dog, cat, pig, or rabbit. In a preferred embodiment when the muscle differentiation promoter is used as a pharmaceutical, the subject to which it is administered may be a human. That is, in a preferred embodiment when the muscle differentiation promoter is used as a pharmaceutical, the muscle differentiation promoter may be intended for administration to a human subject.

[0032] When the muscle differentiation promoter is used as a pharmaceutical, it may be administered orally or parenterally. Parenteral administration may be by intravenous injection, subcutaneous injection, intramuscular injection, spinal injection, transdermal administration, eye drops, nasal drops, or other methods. As an example of a specific dosage, when administered to a human adult male (body weight 60 kg), the daily dosage of the formulation is typically 0.0001 μg to 10,000 mg / day / person, calculated as the amount of active ingredient.

[0033] When the muscle differentiation promoter according to the first aspect is used as a pharmaceutical, one of the diseases to be treated is muscle injury. Muscle injury refers to a state in which muscle fibers or tissues are damaged by some external or internal factor, typically resulting from physical impact or stress caused by an accident. The inventors have found that contact with serglycin promotes differentiation into muscle cells in muscle satellite cells. Therefore, without wishing to be bound by any theory, it is believed that administering the muscle differentiation promoter according to the first aspect to a subject with muscle injury promotes differentiation of muscle satellite cells at the site of muscle injury into muscle cells, thereby treating the muscle injury. The inventors have found that administration of the muscle differentiation promoter according to the first aspect to an animal with muscle injury results in repair of the muscle injury. Thus, one embodiment of the first aspect of the present disclosure may be a muscle injury treatment agent (or composition for treating muscle injury) containing serglycin or a nucleic acid that promotes expression of serglycin core protein. This embodiment may also be a method for treating muscle damage, comprising administering a nucleic acid that promotes the expression of serglycin or serglycin core protein to a subject in need thereof. This embodiment may also be a nucleic acid that promotes the expression of serglycin or serglycin core protein for use in treating muscle damage. In these cases, the components, dosage form, recipient, and dosage of the formulation may be the same as those described above for the muscle differentiation promoter of the first aspect. Whether a formulation is a muscle damage therapeutic agent (or has a muscle damage therapeutic effect) may be determined, for example, by observing pathological repair and / or functional repair of muscle damage (e.g., increased muscle strength) in a subject after administration of the formulation compared to when the formulation is not administered.

[0034] <Muscle differentiation promoter used as a reagent> When the muscle differentiation promoter according to the first aspect is used as a reagent, the muscle differentiation promoter can be used in an in vitro method for inducing muscle differentiation of cells.

[0035] When the muscle differentiation promoter is used as a reagent, in addition to serglycin and a nucleic acid that promotes the expression of serglycin core protein, the muscle differentiation promoter may contain additives commonly used in reagents for in vitro methods, such as buffers, antioxidants, surfactants, and pH adjusters.

[0036] When a muscle differentiation promoter is used as a reagent, the cells to be contacted with the muscle differentiation promoter may be cells whose muscle differentiation is promoted or has the potential to be promoted by the muscle differentiation promoter, such as stem cells. That is, the muscle differentiation promoter according to one embodiment may be a promoter of muscle differentiation of stem cells.

[0037] In a preferred embodiment when the muscle differentiation promoter is used as a reagent, the cells contacted with the muscle differentiation promoter may be human urine-derived cells. In other words, a preferred embodiment of the muscle differentiation promoter may be a muscle differentiation promoter for human urine-derived cells. Human urine-derived cells (Urine-derived cells: UDCs) are primary cultured cells derived from the upper urinary tract that can be collected from human urine. A cell population of human urine-derived cells is known to be a heterogeneous cell population containing cells of various morphologies and origins, such as renal epithelial cells and urinary tract epithelial cells. The human urine-derived cells of the present disclosure may be, for example, cells obtained by isolating urine collected from a human subject or a culture thereof, or cells obtained by culturing cells isolated from urine collected from a human subject. In this case, the cell isolation method is not particularly limited as long as it can isolate the cells from cell-containing urine or a culture thereof. For example, centrifugation or filtration may be used, with centrifugation being preferred. Human urine-derived cells can be prepared from human urine and therefore have stem cell properties that can be collected non-invasively. Therefore, when the muscle differentiation promoter is an agent for promoting muscle differentiation of human urine-derived cells, human-derived cells with stem cell properties can be obtained non-invasively.

[0038] Methods for preparing human urine-derived cells are known in the art and are not particularly limited, and can be prepared, for example, by the following method: Urine collected from a human subject is centrifuged to remove the supernatant, and the pellet is mixed with an initial medium (equal volumes of high-glucose DMEM (GE Healthcare, Logan, UT; SH30022.FS) and Ham's F-12 Nutrient Mix (Thermo Fisher Scientific; 11765-054) mixed with REGM SingleQuots (Lonza, Basel, Switzerland; CC-4127), tetracycline-free 10% fetal bovine serum (Clontech; 631106), 1% penicillin / streptomycin, and 0.5 μg / mL amphotericin B) and incubated at approximately 37°C. Subsequently, the cells are cultured in a growth medium (REGM Bullet Kit (Lonza; Equal volumes of tetracycline-free DMEM (Cell Signaling Module CC-3190) and high-glucose DMEM were mixed and cultured in a medium supplemented with 15% tetracycline-free fetal bovine serum, 0.5% Glutamax (Thermo Fisher Scientific; 35050-061), 0.5% non-essential amino acids (Thermo Fisher Scientific; 11140-050), 2.5 ng / mL fibroblast growth factor-basic (bFGF) (Sigma, St Louis, USA; F0291), PDGF-AB (Peprotech, Rocky Hill, NJ; 100-00AB), EGF (Peprotech; AF-100-15), 1% penicillin / streptomycin, and 0.5 μg / mL amphotericin B. Cells that formed colonies were selected approximately several days to two weeks after the initiation of culture. The cells thus obtained become stable cell lines with similar characteristics even after multiple subcultures.

[0039] An example of inducing muscle differentiation of cells in vitro is the production of myotubes. Myotubes (also called "myotube cells") are immature muscle cells. The production of myotubes can provide myotubes for use in, for example, high-throughput screening of therapeutic and preventive agents targeting myotubes. Furthermore, the production of myotubes can provide myotube cell populations from cells (e.g., human urine-derived cells) derived from individual patients with muscle diseases or muscular dystrophy. These myotube cell populations are useful, for example, for testing therapeutic and preventive agents useful in individual patients without the actual administration (so-called companion diagnostics), or for disease research by obtaining genetic profiles and phenotypes of myotubes derived from individual patients.

[0040] <Method for producing myotubes, method for inducing muscle differentiation, and method for improving muscle differentiation potential> By using the muscle differentiation promoter according to the first aspect as a reagent, muscle differentiation of cells is promoted, and myotubes can be obtained. Thus, one embodiment of the first aspect can be a method for producing myotubes (hereinafter also referred to as a "myotube production method") that includes contacting cells with serglycin or a nucleic acid that promotes expression of serglycin core protein (contacting step). In one aspect, the cells used in the contacting step are cells including human-derived stem cells. In a preferred aspect, the cells used in the contacting step are human urine-derived cells.

[0041] The muscle differentiation of cells is promoted by using the muscle differentiation promoter according to the first aspect as a reagent. Thus, one embodiment of the first aspect may be a muscle differentiation induction method (hereinafter also referred to as a "muscle differentiation induction method") that includes contacting cells with serglycin or a nucleic acid that promotes expression of serglycin core protein (contacting step). In one aspect, the cells used in the contacting step are cells including human-derived stem cells. In a preferred aspect, the cells used in the contacting step are human urine-derived cells.

[0042] Use of the muscle differentiation promoter according to the first aspect as a reagent facilitates muscle differentiation of cells. Thus, one embodiment of the first aspect may be a method for enhancing the muscle differentiation potential of cells, comprising contacting cells with a nucleic acid that promotes the expression of serglycin or serglycin core protein (contacting step) (hereinafter also referred to as a "method for enhancing muscle differentiation potential"). In one aspect, the cells used in the contacting step are cells containing human-derived stem cells. In a preferred aspect, the cells used in the contacting step are human urine-derived cells.

[0043] In the contacting step, serglycin or a nucleic acid that promotes the expression of serglycin core protein is contacted with cells in a cell culture medium. The concentration of serglycin in the contacting step is not particularly limited and may be, for example, 0.3 to 300 ng / mL. The concentration of the nucleic acid that promotes the expression of serglycin core protein in the contacting step is not particularly limited and may be, for example, 1 ng / mL to 10 mg / mL or 3 μg / mL to 300 μg / mL. The medium used in the contacting step is not particularly limited and may be one that is commonly used by those skilled in the art. Examples of the medium include proliferation medium and differentiation medium (high-glucose DMEM with GlutaMAX-I (Thermo Fisher Scientific; 10569-010), containing 5% horse serum, ITS Liquid Media Supplement (Sigma; I3146), and 1 μg / mL doxycycline).

[0044] The contact time (culture period) in the contacting step is not particularly limited and may be, for example, 8 hours to 4 weeks. The contacting method in the contacting step is not particularly limited and may involve, for example, adding a nucleic acid that promotes the expression of serglycin or serglycin core protein, or a drug carrier-encapsulated nucleic acid, or a solution thereof, to a cell suspension. Alternatively, a solution of serglycin or a nucleic acid that promotes the expression of serglycin core protein, or a drug carrier-encapsulated nucleic acid, may be added to adherent or pelleted cells. The contacting conditions in the contacting step are not particularly limited. For example, the culture temperature may be set to a temperature suitable for cell culture, for example, 30 to 40°C, preferably about 37°C, and the pH may be maintained near neutral. The contacting period in the contacting step may be, for example, 2 days or more and 28 days or less, for example, 7 days. In one embodiment, when the nucleic acid that promotes the expression of serglycin core protein is a viral vector, the cells may be contacted with the viral vector (not encapsulated in a drug carrier). In one embodiment, when the nucleic acid that promotes the expression of serglycin core protein is mRNA, the cells may be contacted with mRNA encapsulated in a liposome. Such liposomes can be prepared according to methods commonly used by those skilled in the art using commercially available lipofection reagents such as the Lipofectamine® series (ThermoFisher Scientific). The contacting step may include selecting cells into which a nucleic acid that promotes the expression of a serglycin core protein has been introduced. Such selection may be performed according to methods commonly used by those skilled in the art, for example, by contacting blasticidin with cells into which a blasticidin-resistant gene has been introduced together with a nucleic acid that promotes the expression of a serglycin core protein.

[0045] In one aspect, the method for producing myotubes, the method for inducing muscle differentiation, and the method for improving muscle differentiation potential may include a step of inducing cells into myotubes after the contact step (induction step). The method for inducing cells into myotubes in the induction step is not particularly limited as long as it is a method that can induce the cells into myotubes.

[0046] In one aspect, the myotube production method, muscle differentiation induction method, and muscle differentiation potential improvement method may include introducing the MYOD1 gene into cells (introduction step) as an induction step or instead of an induction step. MYOD1 (myoblast determination protein 1) is a muscle-specific transcription factor that is listed as one of the muscle regulatory factors and belongs to the MYOD family. It is known that introducing the MYOD1 gene into fibroblasts and the like can induce differentiation into myotubes. The introduction step may be performed before, simultaneously with, or after the contact step.

[0047] The MYOD1 gene is well known in the art, and although not particularly limited, the human MYOD1 gene is preferably used. The sequence of the MYOD1 gene, for example, the sequence of the human MYOD1 gene, is registered in GenBank (National Center for Biotechnology Information, NCBI) under accession number NM_002478.4.

[0048] Introduction of the MYOD1 gene into human urine-derived cells can be performed by methods known in the art, such as the method described in Patent Document 1. For example, the MYOD1 gene is cloned and incorporated into an appropriate expression vector (e.g., a retroviral vector). In addition to the MYOD1 gene, a promoter, an enhancer, a selection marker gene, and the like may be inserted into the expression vector. The promoter can be selected appropriately, and an inducible promoter is preferably used. When MYOD1 is expressed and muscle differentiation begins, the proliferation capacity of cells is significantly reduced. However, by using an inducible promoter, it is possible to suppress muscle differentiation, thereby controlling cell proliferation and differentiation into myotubes. Specifically, the MYOD1 gene is introduced into cells using an inducible promoter, such as the TRE3GS promoter, and the MYOD1-introduced cells are then grown. Subsequently, doxycycline (Dox) is added to the culture medium to activate the promoter, thereby expressing the MYOD1 gene and inducing differentiation into myotubes. Although a selectable marker gene is not essential, it is preferable to incorporate it into the expression vector because it allows for easy selection of cells into which the MYOD1 gene has been introduced. Examples of selectable marker genes include puromycin resistance genes, neomycin resistance genes, zeocin resistance genes, hygromycin resistance genes, and blasticidin resistance genes. Such expression vectors are introduced into cells using methods known in the art, for example, using commercially available transfection reagents. Selection of introduced cells is also known in the art; for example, when a puromycin resistance gene is inserted into an expression vector, cells exhibiting resistance to puromycin are selected.

[0049] The conditions for introducing the MYOD1 gene in the introduction step are not particularly limited, and examples of the medium include a growth medium and a differentiation medium. For example, the culture temperature can be set to a temperature suitable for cell culture, such as 30 to 40°C, preferably about 37°C, and the pH is maintained near neutral, for example. The culture period may be from 1 hour to 4 weeks, preferably about 1 day to 2 weeks.

[0050] Thus, the muscle differentiation promoter according to the first aspect may be a promoter of muscle differentiation of human urine-derived cells or muscle satellite cells. Muscle satellite cells are a type of adult stem cell that normally exist in a dormant state, but upon muscle injury or other such event, they become activated and undergo proliferation and differentiation into muscle cells such as myotubes. The muscle satellite cells may be human muscle satellite cells.

[0051] Thus, the first aspect of the present disclosure can also be described as a method for promoting muscle differentiation, comprising administering a nucleic acid that promotes expression of serglycin or serglycin core protein to a subject in need thereof. The first aspect of the present disclosure can also be described as a nucleic acid that promotes expression of serglycin or serglycin core protein for use in promoting muscle differentiation.

[0052] <Method for producing human urine-derived cells> A second aspect of the present disclosure relates to a method for producing human urine-derived cells. Below, one embodiment of the method for producing human urine-derived cells according to the second aspect of the present disclosure (hereinafter also referred to as the "production method of the second aspect") is described, but the production method of the second aspect is not limited to the following embodiment. For example, the production method of the second aspect can also be carried out in more detail according to the methods described in the Examples.

[0053] A manufacturing method according to one embodiment of the second aspect (hereinafter also referred to as "the manufacturing method according to one embodiment") includes a step of collecting human urine (collection step), a step of concentrating human urine to obtain a human urine concentrate (concentration step), a step of preparing a mixture containing the human urine concentrate, dimethyl sulfoxide, and serum (mixing step), a step of freezing and storing the mixture (freezing and storing step), a step of thawing the frozen mixture (thawing step), a step of separating cells having a diameter of 10 μm or less from a population of cells derived from human urine (separation step), and a step of culturing cells derived from human urine (culture step).

[0054] In the collection step, human urine is collected. For example, human urine can be collected by having a human subject urinate into a bottle made of glass, plastic, or the like, which is capable of collecting and storing liquid components. Alternatively, human urine can be collected by having the human subject urinate into a cup or the like, and then transferring the collected human urine into a bottle. The amount of human urine collected in the collection step is not particularly limited, and may be the entire amount or a portion of the urine excreted by a human in one urination, for example, 25 to 250 mL.

[0055] In one embodiment, the bottle (container) used in the collection step has a storage section and a sealing means. The storage section stores human urine collected in the collection step. The sealing means is a means capable of sealing the storage section, and can be, for example, a cap such as a screw cap or a flip-top cap, a zipper, or a seal such as a heat seal, and one example is a screw cap.

[0056] In one embodiment, an antibiotic is contained in the storage portion of the bottle used in the collection step. The antibiotic is contained in the storage portion before human urine is collected in the storage portion. This allows the antibiotic to dissolve in the human urine collected in the bottle immediately after it is stored in the storage portion, thereby preventing bacterial infection of the collected human urine. For example, the antibiotic is at least one antibiotic selected from the group consisting of penicillin antibiotics, cephalosporin antibiotics, macrolide antibiotics, tetracycline antibiotics, and aminoglycoside antibiotics. Examples of antibiotics include penicillin and streptomycin. The amount of antibiotic is, for example, 0.1 μg to 1 kg per bottle (or per 25 to 250 mL of human urine), for example, 20,000 μg. The amount of antibiotic is, for example, 1.0 x 10 Units to 1.0 x 10 ８ Units, for example, 2.0 x 10 ４ Units.

[0057] In one embodiment, the container of the bottle used in the collection step further contains an antifungal drug in addition to an antibiotic. The antibiotic and antifungal drug are contained in the container before human urine is collected in the container. This allows the antibiotic and antifungal drug to dissolve in the human urine collected in the bottle immediately after it is stored in the container, thereby preventing bacterial and fungal infection of the collected human urine. For example, the antifungal drug is at least one antifungal drug selected from the group consisting of azole antifungal drugs, polyene antifungal drugs, allylamine antifungal drugs, and echinocandin antifungal drugs. An example of the antifungal drug is amphotericin B. The amount of the antifungal drug is, for example, 1 ng to 10 g per bottle (or per 25 to 250 mL of human urine), for example, 0.2 μg.

[0058] In one embodiment, the time from when the human urine is urinated by the human subject to when it is stored in the storage section of the bottle during the collection step is, for example, within 3 hours, and may also be within 1 hour, 15 minutes, 5 minutes, 1 minute, or 15 seconds. When the time is within 15 seconds, for example, when the human subject urinates so that the urine is stored in the storage section of the bottle. When the time from when the human subject urinates to when the collected human urine is stored in the storage section of the bottle is within the above-mentioned upper limit, bacterial infection of the collected human urine is suppressed, and the success rate of establishing human urine-derived cells increases.

[0059] In the concentration step, human urine is concentrated to obtain a human urine concentrate. The human urine concentrate obtained in the concentration step is a cell suspension in which the concentration of cellular components contained in human urine is higher than that of human urine. The method for concentrating human urine in the concentration step is a concentration method that does not significantly affect cell viability or proliferation, such as concentration by centrifuging or leaving the urine to stand at a temperature of 4°C to 40°C, followed by removal of the supernatant. In one embodiment, the concentration step first involves transferring the human urine collected in the collection step to multiple conical tubes, each containing up to 50 mL. Next, the conical tubes are centrifuged at 4 to 30°C and 100 to 1000 × g for 2 to 30 minutes, and then recovering the supernatant until the volume reaches 1 to 10 mL. The pelleted cellular components are suspended in the remaining liquid components, diluted with a buffer such as physiological saline, as needed, and then collecting a total of 20 to 50 mL of cell suspension in a single conical tube. The conical tube is centrifuged at 100 to 1000 × g for 2 to 30 minutes at 4 to 30°C, and the supernatant is then recovered until the volume reaches 1 to 10 mL, thereby obtaining a human urine concentrate containing the cellular components of the human urine (e.g., 25 to 250 mL) collected in the collection step and about 1 to 10 mL of liquid components.

[0060] In the mixing step, a mixture (composition) containing human urine concentrate, dimethyl sulfoxide, and serum is prepared. The resulting mixture (composition) can be used as a composition for preparing human urine-derived cells. In one embodiment, in the mixing step, dimethyl sulfoxide and serum are added to the human urine concentrate obtained in the concentration step. The amount of dimethyl sulfoxide added may be 2.0 to 50% by volume, 2.5 to 30% by volume, 3.0 to 20% by volume, or 3.5 to 10% by volume, and is, for example, 5% by volume, based on the total volume of the mixture. The amount of serum added may be 15 to 80% by volume, 20 to 70% by volume, 25 to 60% by volume, or 30 to 50% by volume based on the total volume of the mixture. The serum is, for example, fetal bovine serum (FBS). Dimethyl sulfoxide and serum may be added, for example, by adding a solution containing them, such as CELLBANKER (registered trademark) 1 (Takara Bio, CB011), in a volume that is 0.01 to 100 times, 0.1 to 10 times, or 0.3 to 3 times the volume of the human urine concentrate, and as an example, in a volume that is 1 time the volume of the human urine concentrate.

[0061] In the cryopreservation step, a composition containing a human urine concentrate, dimethyl sulfoxide, and serum is cryopreserved. The cryopreservation temperature may be any temperature at which the composition freezes, for example, −100°C or higher and −20°C or lower, preferably −100°C or higher and −50°C or lower, and an example is −80°C. The cryopreservation period is not particularly limited, and may be, for example, one week or longer, one month or longer, three months or longer, one year or longer, or two years or longer, and may be 100 years or shorter, 10 years or shorter, five years or shorter, three years or shorter, or two years or shorter. In one embodiment of the cryopreservation step, the mixture obtained in the mixing step is stored at −80°C for one year or longer. In one embodiment of the cryopreservation step, freezing is preferably performed within 8 hours, and more preferably within 3 hours, of the start of the collection step (i.e., urination by the human subject), from the viewpoint of increasing the success rate of establishment of human urine-derived cells. Furthermore, in one embodiment, freezing in the cryopreservation step is preferably performed within 1 hour, more preferably within 15 minutes, and even more preferably within 3 minutes after mixing the human urine concentrate and dimethyl sulfoxide in the mixing step, from the viewpoint of increasing the success rate of establishing human urine-derived cells.

[0062] In the thawing step, a frozen mixture (composition) containing human urine concentrate, dimethyl sulfoxide, and serum is thawed. In one embodiment, the thawing step involves thawing the frozen mixture obtained in the cryopreservation step. The thawing method in the thawing step is a thawing method that does not significantly affect cell viability and proliferation, such as leaving the cells to stand at 25 to 45°C. The thawed product obtained in the thawing step can be used in the fractionation step or culture step described below by diluting it with a medium, or by separating the cells by centrifugation or the like and then resuspending the cells in a medium.

[0063] In the sorting step, cells with a diameter of 10 μm or less are sorted from a population of cells derived from human urine. In one embodiment, in the sorting step, a population of cells with a diameter of 10 μm or less is sorted from a population of cells contained in the lysate obtained in the thawing step or a culture product thereof. Cells contained in human urine include not only human urine-derived cells but also other cells (e.g., cells without stem cell properties). Here, a high proportion of human urine-derived cells have a diameter of 10 μm or less. On the other hand, among the cells contained in human urine, a high proportion of cells other than human urine-derived cells (contaminant cells) have a diameter exceeding 10 μm. Therefore, by sorting cells with a diameter of 10 μm or less from a population of cells derived from human urine, the proportion of human urine-derived cells can be increased.

[0064] The method for sorting cells having a diameter of 10 μm or less in the sorting step is not particularly limited as long as it is a method commonly used by those skilled in the art, and may be, for example, a method using a flow cytometer or a cell sorter. In one embodiment, the sorting step may use a Sony Cell Sorter SH800 flow cytometer to sort a fraction having an FSC (forward scattering) value of 300,000 or less.

[0065] In the culturing step, cells derived from human urine are cultured. In one embodiment, the culturing step is carried out at least after the sorting step, and may also be carried out after the thawing step and before the sorting step. Established human urine-derived cells are finally obtained by the culturing step carried out after the sorting step. The culture conditions, such as the culture medium, culture conditions, and culture period, in the culturing step are not particularly limited as long as they suppress the differentiation of human urine-derived cells into plasma cells, and can be carried out using methods commonly used by those skilled in the art. The culture medium in the culturing step is, for example, an initial medium, a growth medium, or a mixture thereof. The culture period in the culturing step is, for example, 1 to 4 weeks.

[0066] In one aspect, in the culturing step, cells derived from human urine may be cultured in a medium containing an agonist of the Piezo1 (Piezo-type mechanosensitive ion channel component 1) ion channel. The Piezo1 ion channel is a mechanosensitive calcium ion channel. The present inventors have found that culturing cells derived from human urine in a medium containing an agonist of the Piezo1 ion channel increases the proliferation ability of the human urine-derived cells. The Piezo1 ion channel may be, for example, Yoda1. Yoda1 is an agonist of the Piezo1 ion channel with CAS number 448947-81-7 and can be obtained from suppliers such as Sigma-Aldrich (product number SML1558). Culturing in a medium containing Yoda1 increases the proliferation ability of the human urine-derived cells. The concentration of the Piezo1 ion channel agonist to be added to the culture medium may be appropriately determined by those skilled in the art as a concentration that can enhance the proliferation ability of human urine-derived cells, depending on the type of agonist. The concentration of Yoda1 to be added to the culture medium may be, for example, 0.1 μg / mL to 100 μg / mL, and may be 5 μg / mL, for example.

[0067] One embodiment of the manufacturing method includes a step of collecting human urine (collection step) using a human urine collection system. The human urine collection system includes a container (bottle) having a storage section for storing human urine and a sealing means for sealing the storage section, and an antibiotic stored in the storage section. This allows the antibiotic to dissolve in the human urine collected in the bottle immediately after it is stored in the storage section, preventing bacterial infection of the collected human urine. This increases the success rate (establishment success rate) when producing human urine-derived cells from human urine. Furthermore, human urine-derived cells can be established even if a long period of time (e.g., four hours or more) is required from the time of collecting human urine to the time of establishment. Successful establishment of human urine-derived cells means that the human urine-derived cells are recovered as viable cells capable of cell division and possessing stem cell properties. For example, successful establishment of human urine-derived cells can be confirmed by colony formation when the recovered cells are cultured. Furthermore, for example, successful establishment of human urine-derived cells was demonstrated when colonies were formed by culturing the collected cells and 1.0 × 10 cells were obtained from one bottle of urine (e.g., 25 to 250 mL of urine). ５ This can be confirmed based on the fact that at least 100 cells were obtained.

[0068] A production method according to one embodiment includes a step of concentrating human urine to obtain a human urine concentrate (concentrating step), a step of preparing a mixture containing the human urine concentrate, dimethyl sulfoxide, and serum (mixing step), and a step of cryopreserving the mixture (cryopreserving step). By including these steps, the production method according to one embodiment allows for the preparation of human urine-derived cells from the mixture after thawing, even if the cryopreservation step is continued for a long period of time (e.g., one year or more). That is, by including these steps, the production method according to one embodiment enables the long-term storage of samples that can be used for the establishment of human urine-derived cells. In other words, a composition containing a human urine concentrate, dimethyl sulfoxide, and serum is a composition that can be stored for a long period of time and can be used for the preparation of human urine-derived cells, and the composition may be a composition for an in vitro method. The composition may have a dimethyl sulfoxide content of 2.0 to 50% by volume relative to the total volume of the composition, and a serum content of 15 to 80% by volume relative to the total volume of the composition. The composition may be used for the preparation of human urine-derived cells. In these cases, the human urine concentrate may be a human urine concentrate voided from the human subject within three hours, in order to increase the success rate of establishment.

[0069] In addition, if long-term storage is not performed, the production method according to another embodiment does not need to include the mixing step, the freezing and thawing step. In this case, the human urine concentrate obtained in the concentration step or its dilution (e.g., a medium dilution) may be used directly in the separation step or the culture step. Furthermore, if the production method according to another embodiment does not include the mixing step, the freezing and thawing step and the human urine concentrate obtained in the concentration step or its dilution is used directly in the separation step, the human urine concentrate or its dilution used in the separation step may be prepared from human urine voided from a human subject within three hours, in order to increase the success rate of establishment.

[0070] A production method according to one embodiment includes a step of separating cells having a diameter of 10 μm or less from a population of cells derived from human urine (a separation step). Because a high proportion of human urine-derived cells have a diameter of 10 μm or less, the inclusion of the separation step can increase the proportion of human urine-derived cells in the population of cells derived from human urine. This can reduce the proportion of contaminating cells in the established human urine-derived cells. In other words, a population of cells derived from human urine having a diameter of 10 μm or less can be suitably used to establish human urine-derived cells with a low proportion of contaminating cells.

[0071] Human urine-derived cells produced by the production method according to one embodiment may be used, for example, as a source cell in a method for producing myotubes according to one embodiment of the first aspect.

[0072] The present disclosure will be described in more detail below using examples, but the present disclosure is not limited to the following examples.

[0073] Preparation Example 1: Establishment of Human Urine-Derived Cells Step 1: Urine Collection 20,000 units of penicillin, 20,000 μg of streptomycin (Thermo Fisher Scientific, Waltham, MA; 15140-122), and 0.2 μg of amphotericin B (Sigma, St. Louis, USA; A2942) were added to a sterilized plastic bottle (Corning Incorporated, NY, USA; 430281). Urine was collected by having a human subject urinate into the bottle. In this manner, 25 to 250 mL of urine was collected per bottle.

[0074] [Step 2: Concentration of Urine] The human urine collected in Step 1 was dispensed into multiple 50 mL conical tubes. The tubes were centrifuged at 400 × g for 10 minutes at room temperature, and the supernatant was removed so that only 3 mL remained. 3 mL of washing solution (Ca ２＋ and Mg ２＋A 50 mL PBS solution containing 1% penicillin / streptomycin (Thermo Fisher Scientific, Waltham, MA; 15140-122) and 0.5 μg / mL amphotericin B (Sigma, St. Louis, USA; A2942) was added. The mixtures from the tubes were pooled into a single 50 mL conical tube. The tubes were centrifuged at 200 × g for 10 minutes at room temperature, and only 3 mL of supernatant was removed.

[0075] [Step 3: Preparation of a mixture for cryopreservation and cryopreservation] A mixture for cryopreservation was obtained by adding 3 mL of CELLBANKER (registered trademark) 1 (Takara Bio, CB011) to the tube after centrifugation in step 2. The obtained mixture for cryopreservation was placed in a deep freezer at −80° C. and stored in a frozen state for one year or more.

[0076] [Step 4: Establishment of human urine-derived cells from the cryopreservation mixture] The cryopreservation mixture frozen in step 3 was left to stand at room temperature until thawed. The thawed cryopreservation mixture was centrifuged at 200 × g for 5 minutes at room temperature, and only 3 mL of the supernatant was removed. Six mL of initial medium (a mixture of equal volumes of high-glucose DMEM (GE Healthcare, Logan, UT; SH30022.FS) and Ham's F-12 Nutrient Mix (Thermo Fisher Scientific; 11765-054) supplemented with REGM SingleQuots (Lonza, Basel, Switzerland; CC-4127), tetracycline-free 10% fetal bovine serum (Clontech; 631106), 1% penicillin / streptomycin, and 0.5 μg / mL amphotericin B) was added to obtain a cell suspension. From the obtained cell suspension, a fraction with an FSC (forward scattering) value of 300,000 or less was collected using a flow cytometer (SONY, Cell Sorter SH800), thereby separating cells with a diameter of 10 μm or less from the cells contained in the cell suspension. The collected fraction was centrifuged to precipitate the cells, and the pellet was resuspended in 9 mL of initial medium to obtain a cell suspension for culture. The obtained cell suspension for culture was added to a gelatin-coated 6-well plate (IWAKI, Shizuoka, Japan; 4810-020) at 1.5 mL per well and incubated at 5% CO ２The cells were cultured in an incubator at 37°C. 1.5 mL of initial medium was added every day, and on the fourth day of culture, 2 mL of growth medium (REGM Bullet Kit (Lonza; CC-3190) was mixed with equal volumes of high-glucose DMEM, supplemented with tetracycline-free 15% fetal bovine serum, 0.5% Glutamax (Thermo Fisher Scientific; 35050-061), 0.5% non-essential amino acids (Thermo Fisher Scientific; 11140-050), 2.5 ng / mL fibroblast growth factor-basic (bFGF) (Sigma, St Louis, USA; F0291), PDGF-AB (Peprotech, Rocky Hill, NJ; 100-00AB), EGF (Peprotech; AF-100-15), 1% penicillin / streptomycin, and 0.5 μg / mL amphotericin B) was added. The medium was replaced with amphotericin B / gentamicin (excluding amphotericin B / gentamicin from the Bullet Kit). The human urine-derived cells formed colonies within a few days to about two weeks after the start of culture. Through the above procedures, human urine-derived cells were established.

[0077] <Test Example 1: Success rate of establishing human urine-derived cells depending on the presence or absence of antibiotics in the bottle> The success rate of establishing human urine-derived cells from human urine (establishment success rate) was evaluated using the percentage of collected urine samples in which human urine-derived cells were successfully established as an index. In the following test examples, successful establishment of human urine-derived cells was determined when cell colonies were observable and 1.0 × 10 cells were obtained from urine per bottle. ５The success rate was determined by the number of cells obtained. As a result, the success rate of establishing human urine-derived cells using the method described in Preparation Example 1 was 93%. Furthermore, even when the cells were left to stand at room temperature for up to 8 hours between steps 1 and 2, no decrease in the success rate was observed. On the other hand, when urine was collected in a bottle to which no antibiotics had been added beforehand and steps 2 and later were performed in the same manner as in Preparation Example 1, the success rate of establishing cells decreased significantly due to bacterial infection if the room temperature standing time between steps 1 and 2 exceeded 4 hours. Furthermore, when urine was collected in a bottle to which no antibiotics had been added beforehand and steps 2 and later were performed in the same manner as in Preparation Example 1, the success rate of establishing cells was 82%, even if the room temperature standing time between steps 1 and 2 was within 4 hours. These results demonstrate that collecting human urine in a bottle to which antibiotics had been added beforehand increases the success rate of establishing human urine-derived cells and increases the time allowance for room temperature standing after collecting the human urine.

[0078] Test Example 2: Preservation of samples that can be used for establishing human urine-derived cells by including the preparation of a cryopreservation mixture According to the method described in Preparation Example 1, human urine-derived cells could be established without a decrease in the establishment success rate, even when the cryopreservation mixture was stored for up to two years. In contrast, when step 3 was not included and instead collected human urine was stored directly in a refrigerator or freezer for more than four hours and then step 4 was performed as in Preparation Example 1, the establishment success rate decreased significantly. This demonstrates that including step 3 of preparing and cryopreserving a cryopreservation mixture enables long-term storage of samples that can be used for establishing human urine-derived cells.

[0079] Test Example 3: Presence or absence of contaminating cells due to inclusion of cell sorting According to the method described in Preparation Example 1, it was possible to establish human urine-derived cells with a high purity of human urine-derived cells (i.e., few contaminating cells). In contrast, when step 4 did not include sorting cells with a diameter of 10 μm or less by flow cytometry, the proportion of contaminating cells in the established human urine-derived cells was high. This demonstrated that including sorting cells with a diameter of 10 μm or less by flow cytometry makes it possible to establish human urine-derived cells with a reduced rate of contaminating cells.

[0080] Test Example 4: Myotube differentiation potential of human urine-derived cells dependent on expression level of nucleic acid (SRGN gene) encoding serglycin core protein. We investigated whether overexpression or knockdown of the SRGN gene in human urine-derived cells would alter the myotube differentiation potential of human urine-derived cells. It is known that the muscle differentiation potential of human urine-derived cells is positively correlated with the expression level of CD90 (Cluster of Differentiation 90, also known as THY1), a mesenchymal stem cell marker (Non-Patent Document 2). Based on this, we investigated whether overexpression or knockdown of the SRGN gene would alter the myotube differentiation potential of human urine-derived cells with low or high CD90 expression.

[0081] From the human urine-derived cells established in Preparation Example 1, human urine-derived cells with low CD90 expression (CD90(-)) and high CD90 expression (CD90(+)) were separated according to the method described in Non-Patent Document 2. These human urine-derived cells were seeded on culture dishes or plates (3,000 to 5,000 cells / cm). ２ MYOD1 was introduced into human urine-derived cells by infecting them with a retroviral vector for MYOD1 gene introduction described in Patent Document 1 (hereinafter referred to as "MYOD1 viral vector"). Two days after infection, puromycin was added to the medium, and the cells were cultured for 7 days to select human urine-derived cells into which the MYOD1 gene had been introduced (MYOD1-UDCs).

[0082] CD90(-) or CD90(+) human urine-derived cells transfected with the MYOD1 gene were subjected to overexpression (SRGN-OE) or knockdown (SGRN-KD) of the nucleic acid encoding the serglycin core protein (SRGN gene). Specifically, MYOD1-UDCs were infected with a lentiviral vector for introducing the SRGN gene, pLV[Exp]-Bsd-CMV>hSRGN[NM_001321053.2] (the vector map is shown in Figure 1 , and the nucleotide sequence is shown in SEQ ID NO: 5), or a lentiviral vector for introducing shRNA with SRGN-KD effect, pLV[shRNA]-Bsd-U6>hSRGN (the vector map is shown in Figure 2 , and the nucleotide sequence is shown in SEQ ID NO: 6; the target sequence in this lentiviral vector is GCTGCAATCCAGACAGTAATT (SEQ ID NO: 7)), both purchased from VectorBuilder, at a concentration of 30 μg / mL. Two days after infection, blasticidin was added to the medium to a final concentration of 10 μg / mL, and the cells were cultured for 7 days to select SRGN-OE or SRGN-KD MYOD1-UDCs.

[0083] Myotube formation by the MYOD1-UDCs obtained above was evaluated by immunofluorescence staining. Immunofluorescence staining was performed according to the following protocol. Cells from the cell population were washed with PBS, fixed with 4% paraformaldehyde, and incubated with 0.1% Triton-X at room temperature for 10 minutes. The primary antibody used was anti-myosin heavy chain antibody (1:50, R&D, Minneapolis, USA; MAB4470), and the secondary antibody used was Alexa Fluor 546 goat anti-mouse IgG (H+L) (1:300, Invitrogen; A11003). DAPI was used for nuclear staining. Images were captured using a fluorescence microscope (BZ-9000 or BZ-X800, KEYENCE, Osaka, Japan) and analyzed using a BZ-X Analyzer (KEYENCE).

[0084] Figure 3 shows fluorescent images obtained by immunofluorescence staining. Figure 4 shows the fusion index (the proportion of cell nuclei contained within myotubes, indicated as MYHC, among the cell nuclei contained in the image, indicated as DAPI) in Figure 3, with the results for CD90(-)MYOD1-UDCs shown as (A) and the results for CD90(+)MYOD1-UDCs shown as (B). The results in Figure 4 are shown as mean ± standard deviation (Mean ± S.D.), and values ​​of <0.0001 indicate a P value of less than 0.0001 in Student's t-test. The results in Figures 3 and 4 indicate that in CD90(-)MYOD1-UDCs with low muscle differentiation potential, overexpression of the SRGN gene significantly increased the fusion index, indicating a significant increase in muscle differentiation potential. Furthermore, according to the results of Figures 3 and 4, in CD90(+)MYOD1-UDCs, which have high muscle differentiation potential, knockdown of the SRGN gene significantly reduced the fusion index and muscle differentiation potential. These results demonstrated that the expression level of the SRGN gene is a factor related to the muscle differentiation potential of cells. Furthermore, it was revealed that increasing the expression level of the SRGN gene can enhance the muscle differentiation potential of cells.

[0085] Test Example 5: Induction of muscle differentiation of human urine-derived cells by addition of serglycin to cell supernatant. We investigated whether the addition of serglycin to the culture supernatant promotes muscle differentiation of MYOD1-UDCs. It is known that extracellularly secreted serglycin in vivo binds to CD44 (Cluster of Differentiation 44), a glycoprotein receptor expressed on the cell surface of surrounding cells. Based on this, we also investigated whether the effect of adding serglycin to the culture supernatant on muscle differentiation of MYOD1-UDCs is suppressed by competition with an anti-CD44 antibody.

[0086] 25 ng / mL of human recombinant serglycin (13648-H08H, Sino Biological, rSRGN) and / or 10 ng / mL of anti-CD44 neutralizing antibody (14-0441-82, Affymetrix, Anti CD44) were added to the culture supernatant of CD90(-)MYOD1-UDCs prepared in the same manner as in Test Example 4, and the cells were cultured for 14 days. Thereafter, immunofluorescent staining and acquisition of fluorescent images were performed in the same manner as in Test Example 4.

[0087] Figure 5 shows a fluorescent image obtained by immunofluorescence staining. Figure 6 shows the fusion index (the proportion of cell nuclei contained within myotubes, indicated as MYHC, among the cell nuclei contained in the image, indicated as DAPI) in Figure 5. The results in Figure 6 are shown as mean ± standard deviation (Mean ± S.D.), with P values ​​of 0.2239, <0.0001, and 0.9643 in Student's T-test being 0.2239, less than 0.0001, and 0.9643, respectively. The results in Figures 5 and 6 show that the fusion index was significantly greater in the group to which serglycin was added (rSRGN+ / Anti CD44-) than in the control group to which serglycin was not added (rSRGN- / Anti CD44-), demonstrating a significant improvement in muscle differentiation potential. Furthermore, this improvement in muscle differentiation potential was suppressed in the group in which serglycin and anti-CD44 neutralizing antibody were added to the culture supernatant (rSRGN+ / Anti CD44+), and did not occur in the group in which anti-CD44 neutralizing antibody alone was added (rSRGN- / Anti CD44+). These results demonstrate that an increase in serglycin concentration in the cell's surrounding environment improves the muscle differentiation potential of the cells.

[0088] Test Example 6: Addition of serglycin to cell supernatant promotes differentiation of mouse-derived satellite cells into myotubes We investigated whether the promotion of muscle differentiation observed in Test Example 5 could also be observed in mouse-derived satellite cells, a cell type other than UDCs. Satellite cells are a type of adult stem cell that normally exist in a dormant state, but when muscle is damaged, they become activated and begin to proliferate and differentiate into muscle cells such as myotubes.

[0089] Skeletal muscle was collected from the lower limbs of 10-week-old C57 / BL6J mice (CLEA Japan, Inc.). After collagenase treatment, the collected muscle was reacted with antibodies for flow cytometry according to standard methods. The antibodies used were: an antibody against CD31 (Invitrogen, 11-0311-81), a marker for blood cells; an antibody against CD45 (Invitrogen, 11-0451-82), a marker for vascular endothelial cells; an antibody against Sca-1 (BD Pharmingen, 553108), a marker for fibroblasts; and an antibody against Integrin-α7 (MBL, K0046-3), a marker for muscle satellite cells. Flow cytometry analysis identified a population of CD31(-), CD45(-), Sca-1(-), and Integrin-α7(+) cells as muscle satellite cells. After isolation, the cells were cultured in FBS-containing DMEM medium.

[0090] To the culture supernatant of mouse-derived satellite cells obtained above, 25 ng / mL of recombinant mouse serglycin (10190-SN-050, R&D, SRGN) was added and cultured for 24 hours. After culture, the cells before fixation were stained with EdU (5-ethynyl-2'-deoxyuridine) according to standard methods to evaluate cell proliferation. DAPI was used for nuclear staining. Cells prepared and cultured in the same manner were also subjected to immunofluorescence staining as in Test Example 4 to evaluate their differentiation potential into myotubes. Fluorescent images of the stained cells were obtained as in Test Example 4.

[0091] Figure 7 shows fluorescent images obtained by immunofluorescence staining. Figure 8 shows the percentage of cells stained with Edu among cells stained with DAPI, i.e., the percentage of proliferative cells, in the proliferation assessment in Figure 7. The results in Figure 8 are shown as mean ± standard deviation (Mean ± S.D.), and ns indicates a P value of 0.05 or greater in Student's t-test. Figure 9 shows the fusion index (the percentage of cell nuclei contained in myotubes, indicated as MYHC, among cell nuclei indicated as DAPI in the image) in the assessment of myotube differentiation potential in Figure 7. The results in Figure 9 are shown as mean ± standard deviation (Mean ± S.D.), and ** indicates a P value of less than 0.01 in Student's t-test. The results of Figures 7 to 9 show that, compared to the control group (SRGN-) where no serglycin was added, the group (SRGN+) in which serglycin was added to the satellite cell culture supernatant showed no significant difference in satellite cell proliferation, but the differentiation of satellite cells into myotubes was significantly promoted. This demonstrates that increasing serglycin concentrations in the cell environment improves the muscle differentiation potential of satellite cells as well as UDCs.

[0092] Test Example 7: Repair of muscle damage in mice by administration of serglycin. On day 0, 1.2% BaCl was administered to the gastrocnemius muscle of 10-week-old C57 / BL6J mice (CLEA Japan, Inc.). ２ On day 1, saline or 25 μg / mL mouse recombinant serglycin (10190-SN-050, R&D, SRGN) was administered intramuscularly in 50 μL of BaCl ２The solution was administered intramuscularly to the gastrocnemius muscle. On days 5, 8, or 11, the gastrocnemius muscle was harvested and frozen sections were prepared. The sections were fixed in cold acetone for 10 minutes and then incubated in 0.1% Triton for 10 minutes. Subsequently, the sections were blocked with 5% goat serum in 10% BSA / PBS at room temperature for at least 15 minutes. The sections were then incubated overnight at 4°C with mouse anti-eMyHC antibody (1:200) and rat anti-Laminin antibody (1:200) diluted in 10% BSA / PBS as primary antibodies. Secondary antibodies, anti-mouse ALEXA FLUOR® 488-labeled antibody and anti-rat ALEXA FLUOR® 594-labeled antibody, were used. The sections were incubated at room temperature for 1 hour in a secondary antibody solution diluted in 10% BSA / PBS. Furthermore, the muscle sections were stained for nuclei with DAPI according to standard methods. Fluorescent images of the stained muscle sections were obtained in the same manner as in Test Example 4.

[0093] Figure 10 shows fluorescent images obtained by immunofluorescence staining. Figure 11 shows the time-dependent change in the percentage of eMyHC-positive muscle fibers, a marker for regenerating muscle fibers, relative to the total muscle fibers (eMyHC+ fibers (%)), calculated based on fluorescent images obtained in the same manner as in Figure 10. The results in Figure 11 are shown as mean ± standard deviation (Mean ± S.D.), and **** indicates a P value of less than 0.0001 in Student's t-test. eMyHC+ fibers (%) is a parameter that increases after muscle injury when regenerating muscle fibers appear. Figures 10 and 11 show that in the serglycin-administered group, a significant increase in eMyHC+ fibers (%) was observed on day 5, and a significant decrease in eMyHC+ fibers (%) was observed on day 8. In other words, the recovery rate of muscle damage was faster in the group administered serglycin, making it clear from a pathological point of view that administration of serglycin promotes repair of muscle damage.

[0094] Furthermore, muscle torque was measured on days 5 and 8 in mice that had undergone muscle damage induction and received either saline or serglycin. Muscle torque measurements were performed by immobilizing the lower legs of the mice on a torque measuring instrument (S-14154, Takei Machinery Industry Co., Ltd.), attaching electrodes, and inducing muscle contraction of the ankle plantar flexors with electrical stimulation. Figure 12 shows the muscle torque measurements normalized to the muscle torque measured on day 0. The results in Figure 12 are presented as mean ± standard deviation (Mean ± S.D.), and *** indicates a P value of less than 0.001 in the Student's t-test. The results in Figure 12 show that muscle torque was significantly greater and recovered more quickly in the serglycin-administered group compared to the saline-administered group on both days 5 and 8. This demonstrates that serglycin administration promotes muscle damage repair from a functional perspective. Therefore, the results in Figures 10 to 12 demonstrate that serglycin has a therapeutic effect on muscle damage.

Claims

1. A composition comprising human urine concentrate, dimethyl sulfoxide and serum.

2. The composition according to claim 1, wherein the content of said dimethyl sulfoxide is 2.0 to 50% by volume based on the total volume of the composition, and the content of said serum is 15 to 80% by volume based on the total volume of the composition.

3. The composition according to claim 1 or 2, which is for preparing cells derived from human urine.

4. A method for producing human urine-derived cells, comprising the steps of: concentrating human urine to obtain a human urine concentrate; preparing a mixture containing the human urine concentrate, dimethyl sulfoxide, and serum; and freezing and storing the mixture.

5. A population of cells less than 10 μm in diameter derived from human urine.

6. A method for producing human urine-derived cells, comprising the step of isolating cells with a diameter of 10 μm or less from a population of cells derived from human urine.

7. A human urine collection system comprising: a container having a storage portion for storing human urine and a sealing means capable of sealing said storage portion; and an antibiotic stored in said storage portion.

8. A method for producing human urine-derived cells, comprising the step of collecting human urine in the human urine collection system described in claim 7.

9. The method of claim 4, 6 or 8, wherein the human urine is human urine voided within 3 hours of urination.

10. A muscle differentiation promoter containing a nucleic acid that promotes the expression of serglycin or serglycin core protein.

11. The muscle differentiation promoter according to claim 10, which is a muscle differentiation promoter for human urine-derived cells or muscle satellite cells.

12. A method for producing myotubes, comprising contacting cells with a nucleic acid that promotes expression of serglycin or serglycin core protein.

13. The method of claim 12, wherein the cells are human urine-derived cells.

14. The method of claim 12 or 13, further comprising introducing the MYOD1 gene into the cells.

15. A muscle damage treatment agent containing a nucleic acid that promotes the expression of serglycin or serglycin core protein.

Images