Composition containing bacterium having immunostimulating ability

A composition of heat-treated bacteria with specific DNA parameters maintains and enhances immunostimulatory activity, addressing the reduction caused by high-temperature sterilization, effectively activating dendritic cells and producing IFN-α.

WO2025206173A1PCT designated stage Publication Date: 2025-10-02KIRIN HOLDINGS KK
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2025/012452
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-03-28
Filing Date
2025-03-27
Publication Date
2025-10-02

AI Technical Summary

Technical Problem

Heat treatment at temperatures of 120°C or higher reduces the immunostimulatory ability of bacteria, necessitating a method to maintain or enhance this activity while ensuring sterilization.

Method used

A composition comprising heat-treated bacteria with specific DNA Integrity Number (DIN) and Cp value ranges, and DNA fragment copy numbers, which are optimized to retain and enhance immunostimulatory activity.

Benefits of technology

The immunostimulatory ability of bacteria is maintained and even enhanced through controlled heat treatment, enabling effective activation of dendritic cells and production of IFN-α.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure JPOXMLDOC01-APPB-T000001
    Figure JPOXMLDOC01-APPB-T000001
  • Figure JPOXMLDOC01-APPB-T000002
    Figure JPOXMLDOC01-APPB-T000002
  • Figure JPOXMLDOC01-APPB-T000003
    Figure JPOXMLDOC01-APPB-T000003
Patent Text Reader

Abstract

Disclosed is a composition containing: a heat-treated bacterium having a DIN (DNA Integrity Number) indicating a degree of degradation of 1.0-8.5 of the genomic DNA of the bacterium; a heat-treated bacterium having a Cp value (Crosspoint value) of 15.5-24.0 of the bacterium as measured under prescribed conditions; or a prescribed copy or more of a DNA fragment amplified by a prescribed primer set.
Need to check novelty before this filing date? Find Prior Art

Description

Composition containing bacteria having immunostimulatory activity

[0001] The present disclosure relates to compositions comprising bacteria with immunostimulatory capabilities.

[0002] Immunostimulating compositions containing bacteria are known. For example, Patent Document 1 discloses an immunostimulating food composition containing lactic acid bacteria that activates pDCs (plasmacytoid dendritic cells) and induces the production of IFN-α (interferon α). (Patent Document 1)

[0003] When bacteria are used in a composition, heat treatment may be carried out for the purpose of sterilization, etc. The most common sterilization method is high-pressure steam sterilization, which requires heating at 121°C for 15 minutes or more.

[0004] JP 2017-201984 A

[0005] The present inventors have discovered a new problem that when bacteria having immunostimulatory ability are heat-treated at a temperature of 120°C or higher, as in common sterilization methods, the immunostimulatory ability of the bacteria is reduced.

[0006] An object of the present invention is to provide a composition containing bacteria having immunostimulatory activity. Another object of the present invention is to provide a method for producing a composition containing bacteria having immunostimulatory activity and a method for improving the immunostimulatory activity of bacteria.

[0007] In response to the above-mentioned novel problem, the present inventors have discovered that when a parameter indicating a predetermined characteristic of an immunostimulatory bacterium or bacterial DNA, or the value of the copy number of a bacterial DNA fragment amplified by a predetermined primer set, is within a predetermined range, and / or when an immunostimulatory bacterium is heat-treated at a predetermined temperature lower than 120° C., it is possible to suppress the decrease in immunostimulatory ability observed in bacteria heat-treated at temperatures of 120° C. or higher. Furthermore, in the above cases, it was discovered that not only is the decrease in immunostimulatory ability suppressed, but the immunostimulatory ability of the bacteria is actually improved compared to when the bacteria are not sterilized, and this discovery led to the completion of the present disclosure.

[0008] The present disclosure relates to, for example, the following items. [A1] A composition comprising a heat-treated bacterium with immunostimulatory ability, wherein the DIN (DNA Integrity Number), which indicates the degree of degradation of the genomic DNA of the bacterium, is 1.0 to 8.5. [A2] A composition comprising a heat-treated bacterium with immunostimulatory ability, wherein the Cp value (crosspoint value) of the bacterium, measured under the following conditions, is 15.5 to 24.0. <Conditions> A DNA solution extracted from the bacterium is amplified by real-time PCR using the primer set shown below and the program shown below, and the Cp value is the cycle number at which the amplification curve reaches its maximum inflection point based on the measurement results of the amplification curve. [Primer set] Forward primer: GGATTAGATACCCGTAGTC (SEQ ID NO: 1) Reverse primer: CTTGTGCGGGCCCCCGTCAATTC (SEQ ID NO: 2) [Program] Stage 1: 1 cycle at 95°C for 30 seconds Stage 2: 40 cycles at 95°C for 5 seconds and at 50°C for 20 seconds Stage 3: 1 cycle at 95°C for 1 second, at 65°C for 30 seconds, and at 95°C for 1 second [A3] A composition comprising heat-treated bacteria with immunostimulatory activity, wherein the DNA fragment amplified by the following primer set is 2.4 x 10 2 [Primer set] Forward primer: CCTACGGGNGGCWGCAG (SEQ ID NO: 5) Reverse primer: TTACCGCGGCGCTGGCAC (SEQ ID NO: 6) [A4] A composition comprising a heat-treated bacterium having immunostimulatory activity, wherein a DNA fragment amplified by the following primer set is amplified at 1.2 × 10 copies per 1 mg of the bacterium. 5[Primer set] Forward primer: CCTACGGGNGGCWGCAG (SEQ ID NO: 5) Reverse primer: TTACCGCGGCGCTGGCAC (SEQ ID NO: 6) [A5] A composition comprising heat-treated bacteria with immunostimulatory activity, wherein the DNA fragment amplified by the following primer set is contained in 1 mg of the bacteria at a number of copies that is 1.1 times or more than the number of copies of the DNA fragment amplified by the primer set contained in 1 mg of bacteria of the same strain that has been heat-treated at 120°C for 30 minutes. [Primer set] Forward primer: CCTACGGGNGGCWGCAG (SEQ ID NO: 5) Reverse primer: TTACCGCGGCGCTGGCAC (SEQ ID NO: 6) [A6] A composition comprising heat-treated bacteria with immunostimulatory activity, wherein the bacteria comprises Lactococcus sp., and the DNA fragment amplified by the following primer set is contained in 1.0 x 10 5 [Primer set] Forward primer: CGTTTACGTGCTGCTTCTGA (SEQ ID NO: 3) Reverse primer: AGCTGGAACTCTTCAAGAGCTT (SEQ ID NO: 4) [A7] A composition comprising heat-treated bacteria having immunostimulatory activity, wherein the bacteria include bacteria of the genus Lactococcus, and a DNA fragment amplified by the following primer set is amplified at a concentration of 5.1 x 10 per mg of the bacteria of the genus Lactococcus: 7A composition containing at least 1 copy of the above-mentioned heat-treated bacterium. [Primer set] Forward primer: CGTTTACGTGCTGCTTCTGA (SEQ ID NO: 3) Reverse primer: AGCTGGAACTCTTCAAGAGCTT (SEQ ID NO: 4) [A8] A composition comprising a heat-treated bacterium having immunostimulatory activity, and satisfying at least one of the following conditions (1) to (7): (1) The DIN (DNA Integrity Number), which indicates the degree of degradation of the genomic DNA of the bacterium, is 1.0 to 8.5. (2) The Cp value (crosspoint value) of the bacterium measured under the following conditions is 15.5 to 24.0. <Conditions> A DNA solution extracted from the bacterium is amplified by real-time PCR using the primer set shown below and the program shown below, and the Cp value is the cycle number at which the amplification curve reaches its maximum inflection point based on the measurement results of the amplification curve. [Primer set] Forward primer: GGATTAGATACCCGTAGTC (SEQ ID NO: 1) Reverse primer: CTTGTGCGGGCCCCCGTCAATTC (SEQ ID NO: 2) [Program] Stage 1: 95°C for 30 seconds, 1 cycle Stage 2: 95°C for 5 seconds and 50°C for 20 seconds, 40 cycles Stage 3: 95°C for 1 second, 65°C for 30 seconds, and 95°C for 1 second, 1 cycle (3) The DNA fragment amplified by the following primer set was 2.4 x 10 2 [Primer set] Forward primer: CCTACGGGNGGCWGCAG (SEQ ID NO: 5) Reverse primer: TTACCGCGGCGCTGGCAC (SEQ ID NO: 6) (4) The DNA fragment amplified by the following primer set was diluted to 1.2 × 10 per mg of the bacteria. 5(5) The number of copies of the DNA fragment amplified by the following primer set per 1 mg of the bacterium is 1.1 times or more compared to the number of copies of the DNA fragment amplified by the above primer set per 1 mg of bacteria of the same strain that have been heat-treated at 120°C for 30 minutes. [Primer set] Forward primer: CCTACGGGNGGCWGCAG (SEQ ID NO: 5) Reverse primer: TTACCGCGGCGCTGGCAC (SEQ ID NO: 6) (6) The bacterium includes Lactococcus sp., and the number of copies of the DNA fragment amplified by the following primer set is 1.0 x 10 5 [Primer set] Forward primer: CGTTTACGTGCTGCTTCTGA (SEQ ID NO: 3) Reverse primer: AGCTGGAACTCTTCAAGAGCTT (SEQ ID NO: 4) (7) The bacterium includes Lactococcus sp., and a DNA fragment amplified by the following primer set is amplified at 5.1 × 10 per 1 mg of the Lactococcus sp. 7copies or more. [Primer set] Forward primer: CGTTTACGTGCTGCTTCTGA (SEQ ID NO: 3) Reverse primer: AGCTGGAACTCTTCAAGAGCTT (SEQ ID NO: 4) [A9] The composition according to any one of [A1] to [A8], wherein the immunostimulatory activity includes the ability to activate dendritic cells. [A10] The composition according to [A9], wherein the dendritic cell activation activity includes the ability to promote IFN-α production. [A11] The composition according to any one of [A1] to [A10], wherein the bacterium is a lactic acid bacterium and / or an acetic acid bacterium. [A12] The bacterium is selected from the group consisting of Lactobacillus rhamnosus CRL1505, Gluconacetobacter hansenii GK-1, Lactobacillus acidophilus L-92, Lactobacillus plantarum L-137, Lactobacillus bulgaricus OLL1073R-1, Lactococcus lactis subsp. lactis, and the like. The composition according to any one of [A1] to [A11], wherein the bacterium is at least one selected from the group consisting of Bifidobacterium animalis subsp. lactis JCM5805, Weissella paramesenteroides JCM9890, Bifidobacterium animalis subsp. lactis JCM10602, and Lactobacillus gasseri SBT2055. [A13] The composition according to any one of [A1] to [A12], wherein the Cp value of the heat-treated bacterium is 1.10 to 1.50 times the Cp value of the non-heat-treated bacterium. [A14] The composition according to any one of [A1] to [A13], wherein the proportion of the area occupied by DNA of 250 to 60,000 bp in a histogram of the genomic DNA of the bacterium is 65% or more.[A15] The composition according to any one of [A1] to [A14], wherein the heat-treated bacteria have improved immunostimulatory activity compared to the non-heat-treated bacteria. [A16] The composition according to any one of [A1] to [A15], wherein the heat-treated bacteria are a food composition, a pharmaceutical composition, or a feed. [A17] The composition according to any one of [A1] to [A16], wherein the heat-treated bacteria are a food composition, a pharmaceutical composition, or a feed. [A18] The composition according to any one of [A1] to [A17], wherein the dry weight of the bacteria is 0.0001% by mass or more relative to the total dry weight of the composition. [A19] When the composition is in a liquid form, the number of the bacteria relative to the composition is 1.0 x 10. 3 cells / ml~1.0×10 11cells / ml. [A20] A method for stimulating the immunity of a subject, comprising ingesting the composition of any one of [A1] to [A19] to the subject or administering it to a subject in need thereof. [A21] Use of the composition of any one of [A1] to [A19] in stimulating the immunity of a subject. [A22] The composition of any one of [A1] to [A19] for use in stimulating the immunity of a subject. [A23] Use of the bacterium in the manufacture of the composition of any one of [A1] to [A19]. [B1] A method for producing a composition containing a bacterium having immunostimulatory activity, comprising a heating step of heating the bacterium at a temperature of 60°C or higher and 110°C or lower. [B2] The method according to [B1], wherein the immunostimulatory activity includes the ability to activate dendritic cells. [B3] The method according to [B2], wherein the dendritic cell activation activity includes the ability to promote IFN-α production. [B4] The method according to any one of [B1] to [B3], wherein the bacterium is a lactic acid bacterium and / or an acetic acid bacterium. [B5] The method according to any one of [B1] to [B4], wherein the heating step comprises heating the bacterium at a temperature of 70°C or higher and 90°C or lower. [B6] The method according to any one of [B1] to [B5], wherein the heating time in the heating step is 5 minutes or higher and 60 minutes or lower. [B7] The method according to any one of [B1] to [B6], further comprising a step of culturing the bacterium in a glucose-containing medium before the heating step. [B8] The method according to [B7], wherein the glucose-containing medium is an MRS medium. [B9] The method according to any one of [B1] to [B8], further comprising a step of drying the heated bacterium after the heating step. [B10] The method according to [B9], wherein the drying is by spray drying. [B11] The method according to any one of [B1] to [B10], wherein the bacterium after the heating step has improved immunostimulatory activity compared to the bacterium before the heating step. [B12] The method according to any one of [B1] to [B11], wherein the composition produced is the composition according to any one of [A1] to [A19]. [B13] A composition produced by the method according to any one of [B1] to [B11].[B14] The composition according to any one of [A1] to [A19], produced by the method according to any one of [B1] to [B11]. [B15] A method for stimulating the immunity of a subject, comprising ingesting the composition according to [B13] or [B14] to the subject or administering it to a subject in need thereof. [B16] Use of the composition according to [B13] or [B14] in stimulating the immunity of a subject. [B17] The composition according to [B13] or [B14] for use in stimulating the immunity of a subject. [B18] Use of the bacterium in the production of the composition according to [B13] or [B14]. [C1] A method for improving the immunostimulatory ability of the bacterium, comprising a heating step of heating the bacterium at a temperature of 60°C or higher and 110°C or lower. [C2] The method according to [C1], wherein the immunostimulatory ability includes the ability to activate dendritic cells. [C3] The method according to [C2], wherein the dendritic cell activation ability includes the ability to promote IFN-α production. [C4] The method according to any one of [C1] to [C3], wherein the bacterium is a lactic acid bacterium and / or an acetic acid bacterium. [C5] The method according to any one of [C1] to [C4], wherein the heating step comprises heating the bacterium at a temperature of 70°C or higher and 90°C or lower. [C6] The method according to any one of [C1] to [C5], wherein the heating time in the heating step is 5 minutes or higher and 60 minutes or lower. [C7] The method according to any one of [C1] to [C6], further comprising a step of culturing the bacterium in a glucose-containing medium before the heating step. [C8] The method according to [C7], wherein the glucose-containing medium is an MRS medium. [C9] The method according to any one of [C1] to [C8], further comprising a step of spray-drying the heated bacterium after the heating step. [C10] The method according to [C9], wherein the drying treatment is spray-drying. [C11] The method according to any one of [C1] to [C10], wherein the bacterium after the heating step has improved immunostimulatory activity compared to the bacterium before the heating step. [C12] The composition described in any one of [A1] to [A19], wherein the bacterium has improved immunostimulatory activity by a method described in any one of [C1] to [C11].

[0009] According to the present disclosure, a composition containing bacteria having immunostimulatory activity can be provided. In particular, according to the present disclosure, a composition containing bacteria having high immunostimulatory activity can be provided. According to the present disclosure, a method for producing a composition containing bacteria having immunostimulatory activity or a method for improving the immunostimulatory activity of bacteria can also be provided. Furthermore, according to the present disclosure, a sterilization method or a heating method for maintaining or improving the immunostimulatory activity of bacteria having immunostimulatory activity can be provided.

[0010] FIG. 1 shows the measurement results of the amount of IFN-α in Example 1. FIG. 2 shows the measurement results of the amount of IFN-α in Example 2. FIG. 3 shows the results of electrophoresis and DIN in the Genomic DNA ScreenTape assay of heat-treated bacteria in Example 3. FIG. 4 shows the copy number of DNA amplified with the A9 primer when LC-Plasma is evaluated in Example 6. FIG. 5 shows the copy number of DNA amplified with the V3 primer when LC-Plasma is evaluated in Example 6. FIG. 6 shows the copy number of DNA amplified with the V3 primer when JCM9890 is evaluated in Example 6. FIG. 7 shows the copy number of DNA amplified with the V3 primer when JCM10602 is evaluated in Example 6. FIG. 8 shows the copy number of DNA amplified with the V3 primer when SBT2055 is evaluated in Example 6.

[0011] Hereinafter, an embodiment for carrying out the present invention will be described, but the present invention is not limited to the following embodiment.

[0012] A first embodiment of the present invention is a composition comprising a bacterium having immunostimulatory activity. Hereinafter, the bacterium having immunostimulatory activity contained in the composition of this embodiment may be referred to as "bacterium according to this embodiment." In one aspect, the bacterium according to this embodiment has a DIN (DNA Integrity Number), which indicates the degree of degradation of genomic DNA, within a predetermined range. In another aspect, the bacterium according to this embodiment has a Cp value measured under predetermined conditions within a predetermined range.

[0013] Immunostimulatory ability (immunostimulatory ability) refers to the stimulating (activating) effect of the innate immune system on cells or living organisms. The immunostimulatory ability according to one embodiment may include dendritic cell activation ability, or may be dendritic cell activation ability, in which case the bacteria possess dendritic cell activation ability. The dendritic cell activation ability may be an increase in the amount of cytokine expression by dendritic cells compared to when the bacteria are not administered, etc. The immunostimulatory ability according to one embodiment may include plasmacytoid dendritic cell activation ability (pDC activation ability), or may be pDC activation ability, in which case the bacteria possess pDC activation ability. The pDC activation ability may be an increase in the amount of cytokine expression by pDC compared to when the bacteria are not administered, etc. Plasmacytoid dendritic cells (pDCs) are also called plasmacytoid dendritic cells and are a type of dendritic cell that constitutes the innate immune system. pDCs are the main producers of type I interferon in the body. Type I interferon exhibits growth inhibitory activity against viruses, etc. Interferon α (IFN-α) and interferon β (IFN-β) are known as representative type I interferons, and these are thought to have immunostimulatory activity. The immunostimulatory activity, dendritic cell activation activity, or pDC activation activity according to one aspect may include the ability to promote interferon α (IFN-α) production, or may be the ability to promote IFN-α production. Furthermore, the composition of the present embodiment may be an immunostimulatory composition.

[0014] Whether the bacteria according to this embodiment have immunostimulatory activity can be confirmed, for example, by culturing the bacteria in the presence of pDCs induced from bone marrow cells of a mammal such as a mouse, and measuring the amount or concentration of IFNs such as IFN-α or IFN-β produced in the culture system upon activation of the pDCs.

[0015] As a more detailed example, whether the bacteria according to this embodiment have immunostimulatory activity can be confirmed by measuring the IFN-α concentration according to the following procedures (i) to (iv). As a more detailed example, whether the bacteria according to this embodiment have immunostimulatory activity can be confirmed by measuring the IFN-α concentration according to the procedures shown in the Examples. (i) Mouse-derived bone marrow cells from which red blood cells have been removed are placed in an RPMI medium prepared to the following composition at a concentration of 1 x 106 (ii) 1 mL of the prepared cell suspension is seeded on the plate, and the plate is then spun down to a concentration of 100 cells / mL to prepare a cell suspension. <Culture medium composition> 10% by volume FBS 100 U / mL penicillin / streptomycin 1 mM sodium pyruvate 2.5 mM HEPES 1% by mass MEM non-essential amino acid solution (x100) 50 μM β-mercaptoethanol 100 ng / mL Flt-3L 2 Incubated at 37°C and 5% CO 2 (iii) The bone marrow cells containing the induced pDCs are cultured at 2 × 10 5 The lactic acid bacteria are suspended at a concentration of 1 mg / mL, and 200 μL of each suspension is seeded onto a 96-well plate, to which 2 μL of a lactic acid bacteria suspension adjusted to a concentration of 1 mg / mL with PBS is added. (iv) After 24 hours, the culture supernatant is recovered, and the IFN-α concentration is measured by ELISA using a commercially available IFN-α measurement kit.

[0016] Whether the bacteria according to this embodiment have immunostimulatory activity or not was determined by comparing the bacteria at a final concentration of 10 μg / mL with a final concentration of 2 × 10 cells containing pDCs obtained by culturing the bacteria collected from mouse bone marrow in a cell culture medium containing 100 ng / mL Flt3-L for 7 days. 5 By co-culturing the cells with bone marrow cells at a concentration of 1000 cells / mL for 24 hours, the IFN-α produced can be expressed as an index of IFN-α production of 30 pg / mL or more, preferably 50 pg / mL or more, more preferably 60 pg / mL or more, more preferably 70 pg / mL or more, more preferably 80 pg / mL or more, more preferably 90 pg / mL or more, more preferably 100 pg / mL or more, more preferably 150 pg / mL or more, more preferably 200 pg / mL or more, more preferably 250 pg / mL or more, more preferably 300 pg / mL or more, more preferably 400 pg / mL or more, more preferably 500 pg / mL or more, more preferably 600 pg / mL or more, more preferably 700 pg / mL or more, and particularly preferably 800 pg / mL or more.

[0017] The bacteria according to this embodiment are not particularly limited, and may be bacteria that are harmless to the human body. In one embodiment, the bacteria may be gram-positive or gram-negative bacteria. The bacteria according to this embodiment may be lactic acid bacteria and / or acetic acid bacteria, and particularly lactic acid bacteria. The bacteria having immunostimulatory ability according to this embodiment may be one type of bacteria or a mixture of two or more types of bacteria, such as one or more types of lactic acid bacteria, one or more types of acetic acid bacteria, or a mixture of one or more types of lactic acid bacteria and one or more types of acetic acid bacteria.

[0018] Lactic acid bacteria are bacteria that produce lactic acid as a metabolite. Examples of lactic acid bacteria include bacteria of the genus Oenococcus, Bifidobacterium, Weissella, Tetragenococcus, Lactococcus, Leuconostoc, Pediococcus, Streptococcus, Enterococcus, Lactobacillus, and Bacillus.

[0019] In addition, the Lactobacillus bacteria in the present invention includes bacteria that were classified into the Lactobacillus genus before the reclassification of the Lactobacillus genus.For example, with the reclassification of the Lactobacillus genus, the genus Acetylactobacillus, the genus Agrilactobacillus, the genus Amylolactobacillus, the genus Apilactobacillus, the genus Bombilactobacillus, the genus Compan ... The genus Lactobacillus, the genus Dellaglioa, the genus Fructilactobacillus, the genus Furfurilactobacillus, the genus Holzapfelia, the genus Lacticaseibacillus, the genus Lactiplantibacillus, the genus Lapidilactob ... The genus Lapidilactobacillus, the genus Latilactobacillus, the genus Lentilactobacillus, the genus Levilactobacillus, the genus Ligilactobacillus, the genus Limosilactobacillus, the genus Liquorilactobacillus, The present invention includes bacteria classified into the genera Lactobacillus, Loigolactobacillus, Paralactobacillus, Paucilactobacillus, Schleiferilactobacillus, Secundilactobacillus, and the like.

[0020] Among the above, bacteria include bacteria of the genus Oenococcus, bacteria of the genus Bifidobacterium, bacteria of the genus Lentilactobacillus, bacteria of the genus Weissella, bacteria of the genus Tetragenococcus, bacteria of the genus Lactococcus, Bacteria of the genus Lactococcus, Leuconostoc, Pediococcus, Enterococcus, and the genera Lactobacillus and Lactiplantibacillus are preferred.

[0021] Examples of the Oenococcus include Oenococcus oeni, etc. Specific examples of the Oenococcus include Oenococcus oeni JCM 6125, etc.

[0022] Examples of the Bifidobacterium bacteria include Bifidobacterium animalis subsp. lactis and Bifidobacterium longum subsp. infantis. Specific examples of Bifidobacterium bacteria include Bifidobacterium animalis subsp. lactis JCM 10602, Bifidobacterium longum subsp. infantis JCM 1222, Bifidobacterium longum subsp. longum BB536, Bifidobacterium animalis subsp. lactis BB-12, Bifidobacterium longum subsp. infantis M-63, Bifidobacterium longum subsp. longum N61, Bifidobacterium bifidum OLB6378, Bifidobacterium breve M-16V, Bifidobacterium breve MCC1274, and Bifidobacterium pseudolongum. Examples include JCM 1205.

[0023] Examples of the Weissella genus include Weissella paramesenteroides and Weissella viridescens. Specific examples of the Weissella genus include Weissella paramesenteroides JCM 9890 and Weissella viridescens JCM 1174.

[0024] Examples of the Tetragenococcus bacteria include Tetragenococcus halophilus, etc. Specific examples of the Tetragenococcus bacteria include Tetragenococcus halophilus NRIC 0098 and Tetragenococcus halophilus No. 1.

[0025] Examples of the Lactococcus bacteria include Lactococcus lactis, Lactococcus lactis subsp. lactis, Lactococcus garvieae, Lactococcus lactis subsp. cremoris, Lactococcus lactis subsp. hordniae, and Lactococcus plantarum. plantarum) and the like.

[0026] Specific examples of the Lactococcus bacteria include Lactococcus lactis subsp. lactis JCM 5805, Lactococcus lactis subsp. lactis NBRC 12007, Lactococcus lactis subsp. lactis NRIC 1150, Lactococcus lactis subsp. lactis JCM 20101, Lactococcus lactis subsp. lactis JCM7638, Lactococcus lactis subsp. lactis ATCC 7963, Lactococcus lactis subsp. lactis ATCC 7962, Lactococcus lactis subsp. lactis ATCC 29146, and Lactococcus lactis subsp. lactis ATCC lactis ATCC 15577, Lactococcus lactis subsp. lactis ATCC 15346, Lactococcus lactis subsp. lactis ATCC 13675, Lactococcus lactis subsp. lactis ATCC 12929, Lactococcus lactis subsp. lactis ATCC 11955, Lactococcus lactis subsp. lactis ATCC 11454, Lactococcus lactis subsp. lactis ATCC 11007, Lactococcus garvieae NBRC 100934, Lactococcus lactis subsp. cremoris JCM 16167, Lactococcus lactis subsp. cremoris NBRC 100676, Lactococcus lactis subsp. holdoniae JCM 1180, Lactococcus lactis subsp. holdoniae JCM 11040, and Lactococcus plantarum JCM 11056.

[0027] Examples of the Leuconostoc bacteria include Leuconostoc carnosum and Leuconostoc lactis. Specific examples of the Leuconostoc bacteria include Leuconostoc carnosum JCM 9695 and Leuconostoc lactis NBRC 12455.

[0028] Examples of the Pediococcus bacteria include Pediococcus acidilactici, Pediococcus pentosaceus, Pediococcus cellicola, Pediococcus claussenii, Pediococcus damnosus, Pediococcus ethanolidurans, and Pediococcus inopinatus. Pediococcus inopinatus), Pediococcus parvulus, Pediococcus stillesii, etc. Specific examples of the genus Pediococcus include Pediococcus acidilactici JCM 8797, Pediococcus acidilactici K15, and Pediococcus damnosus JCM 5886, etc.

[0029] Examples of the genus Streptococcus include Streptococcus thermophilus, etc. Specific examples of the genus Pediococcus include Streptococcus thermophilus SBC 8781, etc.

[0030] Examples of the Enterococcus bacteria include Enterococcus alcedinis and Enterococcus faecalis. Specific examples of Enterococcus bacteria include Enterococcus faecalis EC-12.

[0031] Examples of the Lactobacillus bacteria include Lactobacillus paracasei, Lactobacillus delbrueckii, Lactobacillus acidophilus, Lactobacillus casei, Lactobacillus fructivorans, Lactobacillus hilgardii, and Lactobacillus rhamnosus. rhamnosus, Lactobacillus gasseri, Lactobacillus acidophilus, Lactobacillus bulgaricus, Lactobacillus parakefiri, Lactobacillus plantarum, and Lactobacillus pentosus.

[0032] Specific examples of Lactobacillus bacteria include Lactobacillus paracasei KW3110, Lactobacillus paracasei MCC 1849, Lactobacillus paracasei K71, Lactobacillus paracasei K-2, Lactobacillus rhamnosus GG, Lactobacillus rhamnosus CRL1505, Lactobacillus gasseri SBT 2055, Lactobacillus gasseri OLL2716, Lactobacillus gasseri PA-3, Lactobacillus acidophilus L-92, Lactobacillus casei subsp. casei 327, Lactobacillus (newly classified as Lacticaseibacillus) casei Shirota, and Lactobacillus bulgaricus OLL. 1073R-1, Lactobacillus parakeefili (newly classified as Lentilactobacillus parakeefili) JCM 8573, Lactobacillus plantarum (newly classified as Lactipranchibacillus plantarum) L-137, Lactobacillus pentosus (newly classified as Lactipranchibacillus pentosus) ONRICb0240, and Lactobacillus helveticus GCL1815.

[0033] The Bacillus bacteria are not particularly limited, but examples thereof include Bacillus coagulans, etc. Specific examples of Bacillus bacteria include Bacillus coagulans SANK70258 strain, etc.

[0034] Acetic acid bacteria are bacteria that produce acetic acid as a metabolite. Examples of acetic acid bacteria include, but are not limited to, bacteria of the genus Gluconacetobacter, Acetobacter, and Gluconobacter, preferably bacteria of the genus Gluconacetobacter, more preferably Gluconacetobacter hansenii, and even more preferably Gluconacetobacter hansenii GK-1.

[0035] In one preferred embodiment, the bacteria include Lactobacillus rhamnosus CRL1505, Gluconacetobacter hansenii, Lactobacillus acidophilus (GK-1, Lactobacillus acidophilus) L-92, Lactobacillus plantarum L-137, Lactobacillus bulgaricus OLL1073R-1, and Lactococcus lactis subsp. lactis. lactis subsp. lactis JCM5805.

[0036] Of the above-mentioned lactic acid bacteria and acetic acid bacteria, the JCM strain can be obtained from the Microbial Materials Development Laboratory, BioResource Center, RIKEN (1-1 Takanodai 3-chome, Tsukuba, Ibaraki Prefecture), the NBRC strain from the Biological Genetic Resources Division, National Institute of Technology and Evaluation (5-8 Kazusa Kamatari 2-chome, Kisarazu, Chiba Prefecture), the NRIC strain from the Culture Collection, Tokyo University of Agriculture (1-1 Sakuragaoka 1-chome, Setagaya-ku, Tokyo), and the ATCC strain from the American Type Culture Collection (USA). In addition to being available from public institutions, the above-mentioned lactic acid bacteria and acetic acid bacteria can also be obtained by isolating or purifying them using known methods from commercially available products containing lactic acid bacteria or acetic acid bacteria.

[0037] Lactobacillus paracasei KW3110 is an international depositary authority under the Budapest Treaty for the Deposit of Patent Microorganisms, the National Institute of Advanced Industrial Science and Technology (AIST) Patent Organism Depositary (Central No. 6, 1-1-1 Higashi, Tsukuba, Ibaraki Prefecture, Japan) (currently the National Institute of Technology and Evaluation (NITE-IPOD) Patent Organism Depositary (Room 120, 2-5-8 Kazusa Kamatari, Kisarazu, Chiba Prefecture, Japan)) under the accession number FERM BP-08634 (deposit date: February 20, 2004). A derivative strain of Lactobacillus paracasei KW3110 has been deposited at the same Patent Organism Depositary as FERM BP-08635 (deposit date: February 20, 2004).

[0038] As mentioned above, Lactococcus lactis subsp. lactis JCM 5805 can be obtained from the Microbial Materials Development Laboratory of the RIKEN BioResource Center, but the present invention can use the same strain of Lactococcus lactis subsp. lactis JCM 5805 stored in a collection institution other than the Microbial Materials Development Laboratory of the RIKEN BioResource Center. Specifically, the same strain of Lactococcus lactis subsp. lactis JCM 5805 can be obtained from the Biological Genetic Resources Division of the National Institute of Technology and Evaluation (2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan), the Strain Collection of Tokyo University of Agriculture (1-1-1 Sakuragaoka, Setagaya-ku, Tokyo, Japan), the American Type Culture Collection (USA), etc. Lactococcus lactis subsp. lactis JCM 5805 has been deposited with the American Type Culture Collection as Lactococcus lactis subsp. lactis ATCC 9936 and Lactococcus lactis subsp. lactis ATCC 19435.

[0039] The bacterium according to this embodiment may be a mutant strain of a bacterial strain included in the above list. The bacterial mutant strain may have any property capable of achieving the objective of the present technology (e.g., immunostimulatory ability when the composition is an immunostimulatory composition). Such a mutant strain may be constructed by non-artificially introducing a mutation into a bacterial strain included in the above list. Furthermore, such a mutant strain may be constructed by artificially introducing a mutation into a bacterial strain included in the above list, for example, by introducing a mutation into the bacterium by treatment with a mutagen such as ultraviolet (UV) or a DNA alkylating agent, or by introducing a mutation into the strain using a genetic engineering method such as gene editing, typified by CRISPR-Cas9.

[0040] The bacteria according to this embodiment can be cultured by a conventional method depending on the bacterial species. For example, when the bacteria are lactic acid bacteria or acetic acid bacteria, they can be cultured by a known method using a known medium. The medium is not particularly limited as long as it is a medium capable of growing the bacteria, and a glucose-containing medium can be used, for example. The glucose-containing medium is a medium containing glucose, and the glucose is, for example, D-glucose. As the glucose-containing medium, for example, a medium obtained by appropriately adding glucose to MRS medium, GAM medium, or M17 medium can be used, and inorganic salts, vitamins, and / or amino acids, etc., may be added as appropriate. Culturing can be carried out at 25 to 40°C for several hours to several days.

[0041] The bacterium according to this embodiment may have a DNA Integrity Number (DIN), a parameter indicating the degree of degradation of genomic DNA relative to intact genomic DNA contained within the bacterium, within a predetermined range. That is, the DNA extracted from one embodiment of the bacterium, for example, by phenol-chloroform extraction, may have a DIN within a predetermined range. The DIN is a value output as an output of the 4200 TapeStation SoftWare controller Version A.02.01 SR1 in a Genomic DNA ScreenTape assay using an Agilent 4200 TapeStation system, and is a score of 1 to 10 obtained by scoring DNA according to the degree of degradation of genomic DNA. A higher DIN value indicates a longer base length and closer to intact genomic DNA. The DIN of the bacteria according to this embodiment may be 1.0 or more, 1.2 or more, 1.4 or more, 1.6 or more, 1.8 or more, 1.9 or more, 2.1 or more, 3.0 or more, 4.0 or more, or 5.0 or more, or may be 8.5 or less, 8.0 or less, 7.7 or less, 7.5 or less, 7.3 or less, 6.5 or less, 5.5 or less, 5.0 or less, 4.5 or less, 4.0 or less, 3.5 or less, 3.0 or less, 2.5 or less, or 2.1 or less. These lower limit values ​​and upper limit values ​​can be combined arbitrarily, and the DIN of the bacteria according to this embodiment is, for example, 1.0 to 8.5, 1.0 to 8.0, 1.0 to 7.7, 1.0 to 7.5, 1.0 to 7.3, 1.0 to 6.5, 1.0 to 5.5, 1.0 to 5.0, 1.0 to 4.5, 1.0 to 4.0, 1.0 to 3.5, 1.0 to 3.0, 1.0 to 2.5, 1.0 to 2.1, 1.2 to 8.5, 1.2 to 8.0, 1.2 to 7.7, 1.2 to 7.5, 1.2 to 7.3, 1.2 to 6.5, 1.2 to 5. 5, 1.2-5.0, 1.2-4.5, 1.2-4.0, 1.2-3.5, 1.2-3.0, 1.2-2.5, 1.2-2.1, 1.4-8.5, 1.4-8.0, 1.4-7.7, 1.4-7.5, 1.4-7.3, 1.4-6.5, 1.4-5.5, 1.4-5.0, 1.4-4.5, 1.4-4.0, 1.4-3.5, 1.4-3.0, 1.4-2.5, 1.4-2.1, 1.6-8.5, 1.6-8.0, 1.6-7.7, 1.6-7.5, 1.6-7.3, 1.6-6.5,1.6-5.5, 1.6-5.0, 1.6-4.5, 1.6-4.0, 1.6-3.5, 1.6-3.0, 1.6-2.5, 1.6-2.1, 1.8-8.5, 1.8-8.0, 1.8-7.7, 1.8-7.5, 1.8-7.3, 1.8-6.5, 1.8-5.5, 1.8-5.0, 1.8-4.5, 1.8-4.0, 1.8- 3.5, 1.8-3.0, 1.8-2.5, 1.8-2.1, 1.9-8.5, 1.9-8.0, 1.9-7.7, 1.9-7.5, 1.9-7.3, 1.9-6.5, 1.9-5.5, 1.9-5.0, 1.9-4.5, 1.9-4.0, 1.9-3.5, 1.9-3.0, 1.9-2.5, 1.9-2.1, 2.1-8.5, 2.1 to 8.0, 2.1 to 7.7, 2.1 to 7.5, 2.1 to 7.3, 2.1 to 6.5, 2.1 to 5.5, 2.1 to 5.0, 2.1 to 4.5, 2.1 to 4.0, 2.1 to 3.5, 2.1 to 3.0, 3.0 to 8.5, 3.0 to 8.0, 3.0 to 7.7, 3.0 to 7.5, 3.0 to 7.3, 3.0 to 6.5, 3.0 to 5.5, 3.0 to The DIN of the bacteria according to this embodiment may be 5.0, 3.0 to 4.5, 3.0 to 4.0, 4.0 to 8.5, 4.0 to 8.0, 4.0 to 7.7, 4.0 to 7.5, 4.0 to 7.3, 4.0 to 6.5, 4.0 to 5.5, 4.0 to 5.0, 5.0 to 8.5, 5.0 to 8.0, 5.0 to 7.7, 5.0 to 7.5, 5.0 to 7.3, 5.0 to 6.5, or 5.0 to 5.5. When the DIN of the bacteria according to this embodiment is within the above range, the immunostimulatory ability (e.g., dendritic cell activation ability, IFN-α production promotion ability, etc.) is enhanced compared to bacteria with a DIN outside the above range. The method for extracting the genome from the bacteria (e.g., the phenol-chloroform method) and the method for measuring the DIN may be the same as those used in the Examples. For example, DIN can be measured using Genomic DNA ScreenTape and Genomic DNA Reagent Kit (both manufactured by Agilent Technologies) and TapeStation (manufactured by Agilent Technologies) according to the instrument specifications.

[0042] More specifically, when the bacterium is a heat-treated bacterium belonging to the genus Lactococcus or Lactococcus lactis (e.g., heat-treated Lactococcus lactis subsp. lactis JCM5805), the DIN of the bacterium according to this embodiment may be, for example, 1.0 or more, 1.2 or more, 1.4 or more, 1.6 or more, 1.9 or more, 2.1 or more, 3.0 or more, 4.0 or more, or 5.0 or more, or 8.5 or less, 8.0 or less, 7.3 or less, 5.0 or less, 4.0 or less, 3.0 or less, 2.5 or less, or 2.1 or less. These lower and upper limits can be arbitrarily combined, and the DIN of the bacterium according to this embodiment may be, for example, 1.0 to 8.5, 1.2 to 8.0, 1.4 to 7.3, 1.8 to 5.0, or 1.9 to 2.5.

[0043] For example, when the bacterium is a heat-treated bacterium belonging to the genus Weissella or Weissella paramesenteroides (e.g., heat-treated Weissella paramesenteroides JCM9890), or is such a heat-treated bacterium, the DIN of the bacterium according to this embodiment may be, for example, 1.0 or more, 1.2 or more, 1.4 or more, 1.6 or more, 1.9 or more, 2.1 or more, 3.0 or more, 4.0 or more, or 5.0 or more, or 8.5 or less, 8.0 or less, 6.5 or less, 5.0 or less, 4.0 or less, 3.0 or less, 2.5 or less, or 2.1 or less. These lower and upper limits can be arbitrarily combined, and in this case, the DIN of the bacterium according to this embodiment may be, for example, 1.0 to 6.5, 1.0 to 5.5, 1.0 to 4.5, or 1.0 to 3.5.

[0044] Furthermore, for example, when the bacteria include or are heat-treated bacteria belonging to the genus Bifidobacterium or Bifidobacterium animalis (e.g., heat-treated Bifidobacterium animalis subsp. lactis JCM 10602), the DIN of the bacteria according to this embodiment may be, for example, 1.0 or more, 1.2 or more, 1.4 or more, 1.6 or more, 1.9 or more, 2.1 or more, 3.0 or more, 4.0 or more, or 5.0 or more, or may be 8.5 or less, 8.0 or less, 7.7 or less, 7.5 or less, 6.5 or less, 5.0 or less, 4.0 or less, 3.0 or less, 2.5 or less, or 2.1 or less. These lower limit values ​​and upper limit values ​​can be combined in any desired manner, and in this case, the DIN of the bacteria according to this embodiment may be, for example, 1.0 to 7.7, 1.0 to 7.5, 1.0 to 6.5, 1.0 to 5.5, 1.0 to 4.5, or 1.0 to 3.5.

[0045] For example, when the bacteria include heat-treated bacteria belonging to the genus Lactobacillus or Lactobacillus gasseri (e.g., heat-treated Lactobacillus gasseri SBT2055) or are such heat-treated bacteria, the DIN of the bacteria according to this embodiment may be, for example, 1.0 or more, 1.2 or more, 1.4 or more, 1.6 or more, 1.9 or more, 2.1 or more, 3.0 or more, 4.0 or more, or 5.0 or more, or 8.5 or less, 8.0 or less, 7.7 or less, 7.5 or less, 6.5 or less, 5.0 or less, 4.0 or less, 3.0 or less, 2.5 or less, or 2.1 or less. These lower and upper limits can be arbitrarily combined, and in this case, the DIN of the bacteria according to this embodiment may be, for example, 1.0 to 8.0, 1.0 to 7.7, 1.0 to 6.5, 1.0 to 5.5, 1.0 to 4.5, or 1.0 to 3.5.

[0046] The bacteria according to this embodiment may have a DIN within a predetermined range relative to the DIN of live bacteria. Here, live bacteria refer to bacteria that belong to the same species as the immunostimulatory bacteria and are alive; they do not necessarily have to be the same strain. Live bacteria may unintentionally contain a small amount of dead bacteria as contamination. When the immunostimulatory bacteria is a mixture of two or more species, the live bacteria is a live population in which live bacteria of each bacterial species constituting the immunostimulatory bacteria are present in the same proportion as in the immunostimulatory bacteria. Live bacteria according to this embodiment may be unsterilized bacteria that have not been sterilized or unheated bacteria that have not been heat-treated. The DIN of the bacteria according to this embodiment may be 0.10 or more, 0.15 or more, 0.20 or more, 0.50 or more, or 0.70 or more times the DIN of live bacteria, or may be 1.00 or less, 0.99 or less, 0.95 or less, or 0.90 or less. These lower and upper limits can be combined arbitrarily, and the DIN of bacteria in one embodiment is, for example, 0.10 to 1.00 times, 0.10 to 0.99 times, 0.10 to 0.95 times, 0.10 to 0.90 times, 0.15 to 1.00 times, 0.15 to 0.99 times, 0.15 to 0.95 times, 0.15 to 0.90 times, or 0.20 times or more of the DIN of live bacteria. The DIN of the bacterium may be 1.00-fold or less, 0.20-fold to 0.99-fold, 0.20-fold to 0.95-fold, 0.20-fold to 0.90-fold, 0.50-fold to 1.00-fold, 0.50-fold to 0.99-fold, 0.50-fold to 0.95-fold, 0.50-fold to 0.90-fold, 0.70-fold to 1.00-fold, 0.70-fold to 0.99-fold, 0.70-fold to 0.95-fold, or 0.70-fold to 0.90-fold. When the bacterium has a DIN within the above range, the bacterium has a higher immunostimulatory ability (e.g., the ability to activate dendritic cells, the ability to promote IFN-α production, etc.) than bacteria having a DIN outside the above range.

[0047] The bacterium according to this embodiment may have a DNA histogram in which the proportion of the area occupied by DNA of 250 to 60,000 bp is within a predetermined range. The DNA histogram according to this embodiment is obtained by electrophoretically developing DNA extracted from the bacterium according to this embodiment by phenol-chloroform extraction according to base length, followed by fluorescent labeling and fluorescence measurement. The horizontal axis represents DNA base length and the vertical axis represents fluorescence intensity. The electrophoresis conditions and the dye used for fluorescent labeling are not limited as long as they are capable of developing and labeling DNA extracted from the bacterium according to this embodiment, and those commonly used by those skilled in the art can be used. For example, the DNA histogram may be a histogram obtained by using Agilent's Genomic DNA ScreenTape assay for DNA extracted from the bacterium according to this embodiment by phenol-chloroform extraction. The percentage of the area occupied by DNA of 250 to 60,000 bp in the histogram of bacterial DNA according to this embodiment may be 65% or more, 70% or more, 75% or more, 80% or more, or 85% or more, or may be 100% or less, 99% or less, 97% or less, 95% or less, or 90% or less. These lower and upper limits can be arbitrarily combined, and the percentage of the area occupied by DNA of 250 to 60,000 bp in the histogram of bacterial DNA according to this embodiment may be, for example, 65% to 100%, 65% to 99%, 65% to 97%, 65% to 95%, 65% to 90%, 70% to 100%, 70% to 9 ... The percentage of the area occupied by DNA of 250 to 60,000 bp of the bacterium according to this embodiment may be 7%, 70% to 95%, 70% to 90%, 75% to 100%, 75% to 99%, 75% to 97%, 75% to 95%, 75% to 90%, 80% to 100%, 80% to 99%, 80% to 97%, 80% to 95%, 80% to 90%, 85% to 100%, 85% to 99%, 85% to 97%, 85% to 95%, or 85% to 90%. When the percentage of the area occupied by DNA of 250 to 60,000 bp of the bacterium according to this embodiment is within the above range, the bacterium has a higher immunostimulatory ability (e.g., the ability to activate dendritic cells, the ability to promote IFN-α production, etc.) than bacteria having a percentage of the area occupied by DNA of 250 to 60,000 bp outside the above range.

[0048] The bacteria according to this embodiment may have a Cp value (Crosspoint value) that is a multiplier within a predetermined range relative to the Cp value of live bacteria of the bacteria. Here, live bacteria refer to bacteria that belong to the same species as the bacteria having immunostimulatory ability and are alive. The bacteria do not necessarily have to be of the same strain; in one aspect, they may be of the same strain as the bacteria. Live bacteria may unintentionally contain a small amount of dead bacteria as contamination. When the bacteria having immunostimulatory ability is a mixture of two or more species of bacteria, the live bacteria are a live bacterial population in which live bacteria of each bacterial species constituting the bacteria having immunostimulatory ability are present in the same proportion as the proportion in the bacteria having immunostimulatory ability. The live bacteria according to this embodiment may be unsterilized bacteria that have not been sterilized or unheated bacteria that have not been heat-treated. The Cp value in the present invention is one of the parameters obtained by amplifying a target sequence for amplification using real-time PCR on DNA extracted from bacteria by phenol-chloroform extraction and analyzing the amplification results. Specifically, it is the cycle number at which the maximum inflection point of the amplification curve is reached, calculated from the second derivative using the 2nd Derivative Maximum Method (SDM method) based on the measurement results of the DNA amplification curve in real-time PCR. The smaller the Cp value, the greater the amount of DNA to be amplified. For example, in a sample exposed to conditions that may cause DNA cleavage, the smaller the Cp value, the less degradation of the DNA to be amplified. The Cp value of the bacteria according to this embodiment may be 1.01 times or more, 1.05 times or more, 1.10 times or more, 1.13 times or more, 1.17 times or more, 1.20 times or more, 1.24 times or more, 1.27 times or more, or 1.30 times or more of the Cp value of live bacteria of the bacteria, or may be 1.80 times or less, 1.50 times or less, 1.46 times or less, 1.43 times or less, 1.40 times or less, 1.35 times or less, 1.30 times or less, or 1.25 times or less.These lower and upper limits can be combined arbitrarily, and the Cp value of the bacterium according to this embodiment is, for example, 1.01 to 1.80 times, 1.01 to 1.50 times, 1.01 to 1.46 times, 1.01 to 1.43 times, 1.01 to 1.40 times, 1.01 to 1.35 times, 1.01 to 1.30 times, 1.05 to 1.80 times, 1.05 to 1.50 times, 1.05 to 1.46 times, 1.05 to 1.43 times, or 1.05 to 1.40 times the Cp value of live bacteria of the bacterium. 1.05 times to 1.35 times, 1.05 times to 1.30 times, 1.10 times to 1.80 times, 1.10 times to 1.50 times, 1.10 times to 1.46 times, 1.10 times to 1.43 times, 1.10 times to 1.40 times, 1.10 times to 1.35 times , 1.10 times to 1.30 times, 1.13 times to 1.80 times, 1.13 times to 1.50 times, 1.13 times to 1.46 times, 1.13 times to 1.43 times, 1.13 times to 1.40 times, 1.13 times to 1.35 times, 1.13 times to 1.30 times, 1 .. 17 times to 1.80 times, 1.17 times to 1.50 times, 1.17 times to 1.46 times, 1.17 times to 1.43 times, 1.17 times to 1.40 times, 1.17 times to 1.35 times, 1.17 times to 1.30 times, 1.20 times to 1.80 times, 1.2 0 times to 1.50 times, 1.20 times to 1.46 times, 1.20 times to 1.43 times, 1.20 times to 1.40 times, 1.20 times to 1.35 times, 1.20 times to 1.30 times, 1.24 times to 1.80 times, 1.24 times to 1.50 times, 1.24 1.46 times or more and 1.43 times or less, 1.24 times or more and 1.40 times or less, 1.24 times or more and 1.35 times or less, 1.27 times or more and 1.80 times or less, 1.27 times or more and 1.50 times or less, 1.27 times or more and 1.46 times or less, 1.27 times or more and 1.43 times or less, 1.27 times or more and 1.40 times or less, 1.27 times or more and 1.35 times or less, 1.30 times or more and 1.80 times or less, 1.30 times or more and 1.50 times or less, 1.30 times or more and 1.46 times or less, 1.30 times or more and 1.43 times or less, 1.30 times or more and 1.40 times or less, or 1.30 times or more and 1.35 times or less.When the Cp value of the bacterium according to this embodiment is within the above range, the bacterium has a higher immunostimulatory ability (for example, the ability to activate dendritic cells, the ability to promote IFN-α production, etc.) than when the Cp value of the bacterium is outside the above range.

[0049] The Cp value in the present disclosure may be measured by a conventional method. The Cp value in the present disclosure may be measured by amplifying and labeling DNA using commercially available real-time PCR reagents such as TB Green® Premix Ex Taq® II according to the specifications, or may be a Cp value obtained by amplifying, labeling, and measuring DNA in a manner similar to that described in the Examples. Primers used in real-time PCR for measuring Cp values ​​may be primers that amplify part or the entire 16S rRNA conserved region of prokaryotes. The length of the sequence to be amplified may be 50 to 500 bp, preferably 100 to 400 bp, and more preferably 200 to 300 bp. For example, primers that amplify part or the entire 16S rRNA conserved region of prokaryotes may be primers that amplify the 16S rRNA conserved region V5 of prokaryotes. For example, the primers used in real-time PCR may be a primer set consisting of the base sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2. The bacterium according to this embodiment has a predetermined Cp value range. For example, when measured by real-time PCR using a primer set consisting of the base sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2 below, the Cp value may be, for example, 15.0 or more, 15.5 or more, 16.0 or more, 16.5 or more, 17.0 or more, 17.5 or more, 18.0 or more, 18.5 or more, 19.0 or more, 19.5 or more, 20.0 or more, 20.5 or more, 21.0 or more, 21.5 or more, 22.0 or more, 22.5 or more, or 23.0 or more, or 31.0 or less, 30.5 or less, 30.0 or less, 29.5 or less, 29.0 or less, 28.0 or less, 27.0 or less, 26.0 or less, 25.0 or less, 24.0 or less, 23.0 or less, 22.0 or less, 21.0 or less, or 20.5 or less. These lower limit values ​​and upper limit values ​​can be combined arbitrarily, and in this case, the Cp value of the bacterium according to this embodiment can be, for example, 15.0 or more and 31.0 or less, 15.0 or more and 30.5 or less, 15.0 or more and 30.0 or less, 15.0 or more and 29.5 or less, 15.0 or more and 29.0 or less, 15.0 or more and 28.0 or less, 15.0 or more and 27.0 or less, 15.0 or more and 26.0 or less, 15.0 or more and 25.0 or less, 15.0 or more and 24.0 or less, 15.0 or more and 23.0 or less, 15.0 or more and 22.0 or less, 15.0 or more and 21.0 or less,15.0 or above and below 20.5, 15.5 or above and below 31.0, 15.5 or above and below 30.5, 15.5 or above and below 30.0, 15.5 or above and below 29.5, 15.5 or above and below 29.0, 15.5 or above and below 28.0, 15.5 or above and below 27.0, 15.5 or above and below 26.0, 15.5 or above and below 25.0, 15.5 or above and below 24.0, 15.5 or above and below 23.0, 15.5 or above and below 22.0, 15.5 or above and below 21.0, 15.5 or above and below 20.5, 16.0 or above and below 31.0, 16.0 or above and below 30.5, 16.0 or above and below 30.0, 16.0 or above and below 29.5, 16. 0 and below 29.0, 16.0 and above 28.0 and below, 16.0 and above 27.0 and below, 16.0 and above 26.0 and below, 16.0 and above 25.0 and below, 16.0 and above 24.0 and below, 16.0 and above 23.0 and below, 16.0 and above 22.0 and below, 16.0 and above 21.0 and below, 16.0 and above 20.5 and below, 16.5 and above 31.0 and below, 16.5 and above 30.5 and below, 16.5 and above 30.0 and below, 16.5 and above 29.5 and below, 16.5 and above 29.0 and below, 16.5 and above 28.0 and below, 16.5 and above 27.0 and below, 16.5 and above 26.0 and below, 16.5 and above 25.0 and above, 16.5 and above Below 24.0, above 16.5 and below 23.0, above 16.5 and below 22.0, above 16.5 and below 21.0, above 16.5 and below 20.5, above 17.0 and below 31.0, above 17.0 and below 30.5, above 17.0 and below 30.0, above 17.0 and below 29.5, above 17.0 and below 29.0, above 17.0 and below 28.0, above 17.0 and below 27.0, above 17.0 and below 26.0, above 17.0 and below 25.0, above 17.0 and below 24.0, above 17.0 and below 23.0, above 17.0 and below 22.0, above 17.0 and below 21.0, above 17.0 and below 20.5, above 17.5 and below 31. 0 or less, 17.5 or more and less than 30.5, 17.5 or more and less than 30.0, 17.5 or more and less than 29.5, 17.5 or more and less than 29.0, 17.5 or more and less than 28.0, 17.5 or more and less than 27.0, 17.5 or more and less than 26.0, 17.5 or more and less than 25.0, 17.5 or more and less than 24.0, 17.5 or more and less than 23.0, 17.5 or more and less than 22.0, 17.5 or more and less than 21.0, 17.5 or more and less than 20.5, 18.0 or more and less than 31.0, 18.0 or more and less than 30.5, 18.0 or more and less than 30.0, 18.0 or more and less than 29.5, 18.0 or more and less than 29.0, 18.0 or more and less than 28.0,18.0 or above but below 27.0, 18.0 or above but below 26.0, 18.0 or above but below 25.0, 18.0 or above but below 24.0, 18.0 or above but below 23.0, 18.0 or above but below 22.0, 18.0 or above but below 21.0, 18.0 or above but below 20.5, 18.5 or above but below 31.0, 18.5 or above but below 30.5, 18.5 or above but below 30.0, 18.5 or above but below 29.5, 18.5 or above but below 29.0, 18.5 or above but below 28.0, 18.5 or above but below 27.0, 18.5 or above but below 26.0, 18.5 or above but below 25.0, 18.5 or above but below 24.0, 18.5 or above but below 23.0, 18.5 or above but below 22.0, 18.5 or above 21.0 or less, 18.5 or more but less than 20.5, 19.0 or more but less than 31.0, 19.0 or more but less than 30.5, 19.0 or more but less than 30.0, 19.0 or more but less than 29.5, 19.0 or more but less than 29.0, 19.0 or more but less than 28.0, 19.0 or more but less than 27.0, 19.0 or more but less than 26.0, 19.0 or more but less than 25.0, 19.0 or more but less than 24.0, 19.0 or more but less than 23.0, 19.0 or more but less than 22.0, 19.0 or more but less than 21.0, 19.0 or more but less than 20.5, 19.5 or more but less than 31.0, 19.5 or more but less than 30.5, 19.5 or more but less than 30.0, 19.5 or more but less than 29.5, 19.5 or more but less than 29.0, 19.5 or more but less than 28.0, 19.5 or more but less than 27.0, 19.5 or more but less than 26.0, 19.5 or more but less than 25.0, 19.5 or more but less than 24.0, 19.5 or more but less than 23.0, 19.5 or more but less than 22.0, 19.5 or more but less than 21.0, 19.5 or more but less than 20.5, 20.0 or more but less than 31.0, 20.0 or more but less than 30.5, 20.0 or more but less than 30.0, 20.0 or more but less than 29.5, 20.0 or more but less than 29.0, 20.0 or more but less than 28.0, 20.0 or more but less than 27.0, 20.0 or more but less than 26.0, 20.0 or more 25.0 or less, 20.0 or more but less than 24.0, 20.0 or more but less than 23.0, 20.0 or more but less than 22.0, 20.0 or more but less than 21.0, 20.0 or more but less than 20.5, 20.5 or more but less than 31.0, 20.5 or more but less than 30.5, 20.5 or more but less than 30.0, 20.5 or more but less than 29.5, 20.5 or more but less than 29.0, 20.5 or more but less than 28.0, 20.5 or more but less than 27.0, 20.5 or more but less than 26.0, 20.5 or more but less than 25.0, 20.5 or more but less than 24.0, 20.5 or more but less than 23.0, 20.5 or more but less than 22.0,20.5 or more and 21.0 or less, 21.0 or more and 31.0 or less, 21.0 or more and 30.5 or less, 21.0 or more and 30.0 or less, 21.0 or more and 29.5 or less, 21.0 or more and 29.0 Below, 21.0 to 28.0, 21.0 to 27.0, 21.0 to 26.0, 21.0 to 25.0, 21.0 to 24.0, 21.0 to 23 .. 0 or less, 21.5 or more and 31.0 or less, 21.5 or more and 30.5 or less, 21.5 or more and 30.0 or less, 21.5 or more and 29.5 or less, 21.5 or more and 29.0 or less, 21.5 or more 28.0 or less, 21.5 or more and 27.0 or less, 21.5 or more and 26.0 or less, 21.5 or more and 25.0 or less, 21.5 or more and 24.0 or less, 22.0 or more and 31.0 or less, 22. 0 or more and 30.5 or less, 22.0 or more and 30.0 or less, 22.0 or more and 29.5 or less, 22.0 or more and 29.0 or less, 22.0 or more and 28.0 or less, 22.0 or more and 27.0 or less, 22.0 to 26.0, 22.0 to 25.0, 22.5 to 31.0, 22.5 to 30.5, 22.5 to 30.0, 22.5 to 29.5 or lower, 22.5 or higher to 29.0 or lower, 22.5 or higher to 28.0 or lower, 22.5 or higher to 27.0 or lower, 22.5 or higher to 26.0 or lower, 23.0 or higher to 31.0 or lower, 23.0 or higher to 30.5 or lower, 23.0 or higher to 30.0 or lower, 23.0 or higher to 29.5 or lower, 23.0 or higher to 29.0 or lower, 23.0 or higher to 28.0 or lower, or 23.0 or higher to 27.0 or lower.

[0050] As a more specific example of the Cp value, when the bacterium includes or is a heat-treated bacterium belonging to the genus Lactococcus or Lactococcus lactis (e.g., heat-treated Lactococcus lactis subsp. lactis JCM5805), the Cp value of the bacterium according to this embodiment may be, for example, 15.0 or more and 24.0 or less, 16.0 or more and 23.0 or less, 17.0 or more and 22.0 or less, 17.5 or more and 21.0 or less, 17.5 or more and 20.0 or less, or 18.0 or more and 19.5 or less.

[0051] Furthermore, for example, when the bacterium includes or is a heat-treated bacterium belonging to the genus Weissella or Weissella paramesenteroides (e.g., heat-treated Weissella paramesenteroides JCM9890), the Cp value of the bacterium according to this embodiment may be, for example, 17.0 or more and 30.0 or less, 20.0 or more and 30.0 or less, or 20.0 or more and 26.0 or less.

[0052] Furthermore, for example, when the bacterium includes or is a heat-treated bacterium belonging to the genus Bifidobacterium or Bifidobacterium animalis (e.g., heat-treated Bifidobacterium animalis subsp. lactis JCM 10602), the Cp value of the bacterium according to this embodiment may be, for example, 21.0 or more and 31.0 or less, 22.5 or more and 31.0 or less, or 23.0 or more and 29.0 or less.

[0053] Furthermore, for example, when the bacteria include or are heat-treated bacteria belonging to the genus Lactobacillus or Lactobacillus gasseri (e.g., heat-treated Lactobacillus gasseri SBT2055), the Cp value of the bacteria according to this embodiment may be, for example, 18.0 or more and 31.0 or less.

[0054] The Cp value can be measured under the following conditions. <Conditions> A DNA solution extracted from the above bacteria is amplified by real-time PCR using the primer set shown below and the program shown below, and the cycle number at which the amplification curve reaches its maximum inflection point is taken as the Cp value based on the measurement results of the amplification curve. [Primer set] Forward primer: GGATTAGATACCCGTAGTC (SEQ ID NO: 1) Reverse primer: CTTGTGCGGGCCCCCGTCAATTC (SEQ ID NO: 2) [Program] Stage 1: 95°C for 30 seconds, 1 cycle Stage 2: 95°C for 5 seconds and 50°C for 20 seconds, 40 cycles Stage 3: 95°C for 1 second, 65°C for 30 seconds, and 95°C for 1 second, 1 cycle

[0055] An example of a specific measurement condition is Condition 1 shown below. <Condition 1> A bacterial DNA solution extracted by phenol-chloroform extraction is used so that the DNA amount is 90 ng, and evaluation is performed by real-time PCR using a LightCycler (registered trademark) 480 (Roche). In real-time PCR, the primer set shown above is used, and TB Green (registered trademark) Premix Ex Taq (registered trademark) II is used according to the specifications, and amplification is performed using the program shown above.

[0056] The bacteria according to the present embodiment may be bacteria including killed bacteria, and may be, for example, heat-treated or sterilized bacteria. The bacteria according to the present embodiment may preferably be heat-treated bacteria. The bacteria according to the present embodiment have a higher immunostimulatory ability (e.g., the ability to activate dendritic cells, the ability to promote IFN-α production) than live bacteria (e.g., unsterilized or unheated bacteria). In particular, when the bacteria according to the present embodiment have a DIN and / or a proportion of the area occupied by DNA of 250 to 60,000 bp and / or a Cp value within a predetermined range, the bacteria have a higher immunostimulatory ability (e.g., the ability to activate dendritic cells, the ability to promote IFN-α production, etc.) than live bacteria (e.g., unsterilized or unheated bacteria, etc.).

[0057] The composition of this embodiment or the bacterium of this embodiment may be a composition or bacterium heat-treated at a temperature within a predetermined range. The heat treatment temperature may be 60°C or higher, 65°C or higher, 70°C or higher, or 75°C or higher, or 110°C or lower, 100°C or lower, 90°C or lower, 85°C or lower, 80°C or lower, less than 80°C, 75°C or lower, or 70°C or lower. These lower and upper limits can be arbitrarily combined. For example, the heat treatment temperature may be 60°C or higher to 110°C or lower, 60°C or higher to 100°C or lower, 60°C or higher to 90°C or lower, 60°C or higher to 85°C or lower, 60°C or higher to 80°C or lower, 65°C or higher to 100°C or lower, 65°C or higher to 90°C or lower, 65°C or higher to 85°C or lower, 65°C or higher to 80°C or lower, 70°C or higher to 90°C or lower, 70°C or higher to 85°C or lower, 70°C or higher to 80°C or lower, 75°C or higher to 90°C or lower, or 75°C or higher to 85°C or lower. When the heat treatment temperature is within the above range, the immunostimulatory ability (e.g., the ability to activate dendritic cells, the ability to promote IFN-α production, etc.) is increased, and the immunostimulatory ability is higher than that of unsterilized and unheated bacteria, for example. The composition of this embodiment or the bacterium of this embodiment may be heated at a temperature not exceeding a predetermined upper limit temperature (e.g., 130°C, 120°C, 110°C, etc.). When heated at or below the predetermined upper limit temperature, the immunostimulatory ability (e.g., the ability to activate dendritic cells, the ability to promote IFN-α production, etc.) is higher than that of bacteria heated at a temperature exceeding the predetermined upper limit temperature.

[0058] The bacteria according to this embodiment may be heat-treated, for example, in the form of a powder or suspension, preferably in the form of a suspension. In these cases, the solvent for the suspension is not particularly limited and may be, for example, a glucose-containing medium (e.g., MRS (de Man, Rogosa and Sharpe) medium, etc.), a buffer solution (e.g., phosphate-buffered saline (PBS), etc.), or a mixture thereof. Heat treatment can be carried out using heating devices commonly used by those skilled in the art, such as a plate sterilizer, a tubular sterilizer, a direct-heat sterilizer, a jacketed tank, or an autoclave.

[0059] Patent Document 1 describes that the DNA or RNA of lactic acid bacteria contained in the immunostimulatory food composition is thought to activate pDC and induce IFN production. Therefore, because nucleic acids such as DNA and RNA have the property of being degraded under high temperature conditions, it has generally been thought that heat treatment of bacteria may reduce the immunostimulatory ability of bacteria, but not increase it. In contrast, the present inventors have unexpectedly discovered that when the heat treatment temperature is within the above-mentioned specified range, the immunostimulatory ability of bacteria is improved by heat treatment compared to unsterilized bacteria.

[0060] The bacterium according to this embodiment may be a bacterium that has been heat-treated for a predetermined time at a temperature within the above-described predetermined range. For example, the heat treatment time may be 1 minute or more, 3 minutes or more, 5 minutes or more, or 10 minutes or more, or 24 hours or less, 4 hours or less, 60 minutes or less, 45 minutes or less, or 30 minutes or less. These lower and upper limits may be combined arbitrarily. For example, the heat treatment time may be 1 minute or more and 24 hours or less, 3 minutes or more and 4 hours or less, or 5 minutes or more and 60 minutes or less.

[0061] The bacterium according to this embodiment may be a bacterium that has been heat-treated so that the product of the temperature (°C) and time (minutes) during the heat treatment is within a predetermined range. In a preferred embodiment, the bacterium has a heat treatment temperature (°C) and time (minutes) within a predetermined range, and the temperature is within the above-mentioned predetermined range. For example, the heat treatment temperature (°C) and time (minutes) of the bacterium according to this embodiment may be 150 or more, 300 or more, 500 or more, 800 or more, 1200 or more, 1500 or more, 1800 or more, or 2000 or more, or may be 30,000 or less, 20,000 or less, 15,000 or less, 10,000 or less, 7,000 or less, 5,000 or less, 4,000 or less, 3,500 or less, 3,000 or less, 2,700 or less, or 2,500 or less. These lower and upper limits may be combined arbitrarily, and the product of the temperature (°C) and time (minutes) in the heat treatment of the bacteria according to this embodiment may be, for example, 150 to 30,000, 150 to 20,000, 150 to 15,000, 150 to 10,000, 150 to 7,000, 150 to 5,000, 150 to 4,000, 150 to 3,500, 150 or more 3,000 or less, 150 or more and 2,700 or less, 150 or more and 2,500 or more, 300 or more and 30,000 or less, 300 or more and 20,000 or less, 300 or more and 15,000 or less, 300 or more and 10,000 or less, 3 00 to 7,000, 300 to 5,000, 300 to 4,000, 300 to 3,500, 300 to 3,000, 300 to 2,700, 300 to 2,500, 50 0 to 30,000, 500 to 20,000, 500 to 15,000, 500 to 10,000, 500 to 7,000, 500 to 5,000, 500 to 4,000 Lower, 500 to 3,500, 500 to 3,000, 500 to 2,700, 500 to 2,500, 800 to 30,000, 800 to 20,000, 800 to 1,500 0 or less, 800 to 10,000, 800 to 7,000, 800 to 5,000, 800 to 4,000, 800 to 3,500, 800 to 3,000, 800 to 270 0 or less, 800 or more and 2,500 or less, 1,200 or more and 30,000 or less, 1,200 or more and 20,000 or less, 1,200 or more and 15,000 or less, 1,200 or more and 10,000 or less, 1,200 or more and 7,000 or less,1,200 to 5,000, 1,200 to 4,000, 1,200 to 3,500, 1,200 to 3,000, 1,200 to 2,700, 1,200 to 2,500, 1,500 to 30,000, 1,500 to 20,000, 1,500 to 15,000, 1,500 to 10,000 Below, 1,500 to 7,000, 1,500 to 5,000, 1,500 to 4,000, 1,500 to 3,500, 1,500 to 3,000, 1,500 to 2,700, 1,500 to 2,500, 1,800 to 30,000, 1,800 to 20,000, 1,800 to 1,500 0 or less, 1800 to 10,000 or less, 1800 to 7,000 or less, 1800 to 5,000 or less, 1800 to 4,000 or less, 1800 to 3,500 or less, 1800 to 3,000 or less, 1800 to 2,700 or less, 1800 to 2,500 or less, 2000 to 30,000 or less, 2000 to 20,000 or less, 2000 to 15,000 or less, 2000 to 10,000 or less, 2000 to 7,000 or less, 2000 to 5,000 or less, 2000 to 4,000 or less, 2000 to 3,500 or less, 2000 to 3,000 or less, 2000 to 2,700 or less, or 2000 to 2,500 or less. In this case, the heat treatment includes all treatments in which bacteria are exposed to temperatures exceeding 50°C. When two or more such treatments are performed, it is preferable that the product of the temperature (°C) and the time (minutes) in those two or more treatments be within the above range.

[0062] The bacteria according to this embodiment include dead bacteria, and may be a mixture of live and dead bacteria. In other words, the composition according to this embodiment may include dead bacteria, or may include live and dead bacteria.

[0063] When the bacterium according to this embodiment is a heat-treated bacterium, the bacterium may be a dried bacterium that has been subjected to a drying treatment after the heat treatment. The drying treatment may be, for example, spray drying, which may be performed using a spray dryer used for spray drying bacteria. The drying treatment may also be, for example, freeze drying.

[0064] The bacterium according to this embodiment may not have been exposed to a temperature exceeding a predetermined temperature. The predetermined temperature may be 130°C, 120°C, 115°C, 110°C, 105°C, 100°C, 95°C, 90°C, or 89°C. When the bacterium according to one embodiment has not been exposed to a temperature exceeding the predetermined temperature, it has a higher immunostimulatory ability (e.g., the ability to activate dendritic cells, the ability to promote IFN-α production, etc.) than a bacterium exposed to a temperature exceeding the predetermined temperature.

[0065] The bacteria according to this embodiment may satisfy at least one, at least two, at least three, at least four, or five of the following: a DIN within a predetermined range, a DIN that is a predetermined multiple relative to the DIN of unsterilized bacteria, a Cp value that is a predetermined multiple relative to the Cp value of unsterilized bacteria, a predetermined range of area occupied by DNA of 250 to 60,000 bp in a DNA histogram, and bacteria that have been heat-treated under predetermined temperature conditions. The bacteria according to this embodiment may satisfy at least one, at least two, or three of the following: a DIN within a predetermined range, a Cp value that is a predetermined multiple relative to the Cp value of live bacteria, and a predetermined range of area occupied by DNA of 250 to 60,000 bp in a DNA histogram. The bacteria according to this embodiment may satisfy the following: a DIN within a predetermined range and / or a Cp value that is a predetermined multiple relative to the Cp value of live bacteria. The bacterium according to this embodiment may be a bacterium that satisfies at least one, at least two, or three of the following conditions: a DIN within a predetermined range; a Cp value that is a multiplier within a predetermined range relative to the Cp value of live bacteria; and a DNA histogram in which the proportion of the area occupied by DNA of 250 to 60,000 bp is within a predetermined range; and that has been heat-treated under predetermined temperature conditions. The bacterium according to this embodiment may have a Cp value that is a multiplier within a predetermined range relative to the Cp value of live bacteria, and that has been heat-treated. The bacterium according to this embodiment may have a Cp value that is 1.10 to 1.50 times, or 1.20 to 1.40 times, the Cp value of live bacteria, and that has been heat-treated, for example, at 60°C to 110°C or 70°C to 90°C.

[0066] The bacteria according to this embodiment have improved immunostimulatory ability compared to live bacteria. The bacteria according to this embodiment have improved immunostimulatory ability compared to bacteria that have not been heat-treated (unheated bacteria) or bacteria that have not been sterilized (unkilled bacteria). In these cases, the unheated bacteria and unkilled bacteria used for comparison are bacteria of the same strain as the bacteria according to this embodiment. For example, the immunostimulatory ability of the bacteria according to this embodiment may be 1.10 times or more, 1.50 times or more, 1.70 times or more, 1.90 times or more, 2.00 times or more, 2.50 times or more, 3.00 times or more, 3.50 times or more, 4.00 times or more, 4.25 times or more, or 4.26 times or more, or may be 10.0 times or less, or 5.00 times or less, compared to live bacteria (e.g., unheated or unkilled bacteria). These lower and upper limits may be combined arbitrarily, and the immunostimulatory ability of the bacteria according to this embodiment is, for example, 1.10 times or more and 10.0 times or less, 1.10 times or more and 5.00 times or less, 1.50 times or more and 10.0 times or less, 1.50 times or more and 5.00 times or less, 1.70 times or more and 10.0 times or less, 1.70 times or more and 5.00 times or less, 1.90 times or more and 10.0 times or less, 1.90 times or more and 5.00 times or less, 2.00 times or more and 10.0 times or less, The immunopotentiating ability may be 2.00 to 5.00 times, 2.50 to 10.0 times, 2.50 to 5.00 times, 3.00 to 10.0 times, 3.00 to 5.00 times, 3.50 to 10.0 times, 3.50 to 5.00 times, 4.00 to 10.0 times, 4.00 to 5.00 times, 4.25 to 10.0 times, 4.25 to 5.00 times, 4.26 to 10.0 times, or 4.26 to 5.00 times. Furthermore, as described above, the improved immunopotentiating ability may be the ability to activate dendritic cells or the ability to promote IFN-α production. The immunostimulatory activity may be evaluated, for example, by the amount of IFN-α produced by dendritic cells when the bacteria are exposed to the dendritic cells, and as a more detailed example, may be evaluated according to the method described in the Examples.

[0067] The effective amount of bacteria contained in the composition of the present embodiment is not particularly limited as long as it is an amount that can exert immunostimulatory activity, and may vary depending on the subject of application. When the subject of application is a mammal such as a human, for example, it is 1.0 × 10 4 pcs or more, 5.0×104 That's it, 1.0 x 10 5 pcs or more, 3.0×10 5 pcs or more, 1.0×10 6 pcs or more, 3.0×10 6 pcs or more, 1.0×10 7 pcs or more, 3.0×10 7 pcs or more, 1.0×10 8 pcs or more, 3.0×10 8 pcs or more, 5.0×10 8 pcs or more, 1.0×10 9 pcs or more, 5.0×10 9 pcs or more, 1.0×10 10 pcs or more, 5.0×10 10 or more or 1.0 x 10 11 may be 1.0 × 10 or more, 14 Less than or equal to 1.0×10 13 or less, or 1.0 x 10 12 These upper and lower limits can be arbitrarily combined, and the effective amount range is, for example, 1.0 × 10 5 pcs or more 1.0×10 14 Less than or equal to 1.0×10 5 pcs or more 1.0×10 13 Less than or equal to 1.0×10 5 pcs or more 1.0×10 12 Less than or equal to 3.0×10 5 pcs or more 1.0×10 14 Less than or equal to 3.0×10 5 pcs or more 1.0×10 13 Less than or equal to 3.0×10 5 pcs or more 1.0×10 12 Less than or equal to 1.0×10 6 pcs or more 1.0×10 14 Less than or equal to 1.0×10 6 pcs or more 1.0×10 13 Less than or equal to 1.0×10 6 pcs or more 1.0×10 12 Less than or equal to 3.0×10 6 pcs or more 1.0×10 14 Less than or equal to 3.0×10 6 pcs or more 1.0×10 13 Less than or equal to 3.0×10 6 pcs or more 1.0×10 12Less than 1.0×10 7 More than 1.0×10 14 Less than 1.0×10 7 More than 1.0×10 13 Less than 1.0×10 7 More than 1.0×10 12 Less than 3.0×10 7 More than 1.0×10 14 Less than 3.0×10 7 More than 1.0×10 13 Less than 3.0×10 7 More than 1.0×10 12 Less than 1.0×10 8 More than 1.0×10 14 Less than 1.0×10 8 More than 1.0×10 13 Less than 1.0×10 8 More than 1.0×10 12 Less than 3.0×10 8 More than 1.0×10 14 Less than 3.0×10 8 More than 1.0×10 13 Less than 3.0×10 8 More than 1.0×10 12 Less than 5.0×10 8 More than 1.0×10 14 Less than 5.0×10 8 More than 1.0×10 13 Less than 5.0×10 8 More than 1.0×10 12 Less than 1.0×10 9 More than 1.0×10 14 Less than 1.0×10 9 More than 1.0×10 13 Less than 1.0×10 9 More than 1.0×10 12 Less than 5.0×10 9 More than 1.0×10 14 Less than 5.0×10 9 More than 1.0×10 13 Less than 5.0×10 9 More than 1.0×10 12 Less than 1.0×10 10 More than 1.0×10 14 Less than 1.0×1010 pcs or more 1.0×10 13 Less than or equal to 1.0×10 10 pcs or more 1.0×10 12 Less than or equal to 5.0×10 10 pcs or more 1.0×10 14 Less than or equal to 5.0×10 10 pcs or more 1.0×10 13 Less than or equal to 5.0×10 10 pcs or more 1.0×10 12 Less than or equal to 1.0×10 11 pcs or more 1.0×10 14 Less than or equal to 1.0×10 11 pcs or more 1.0×10 13 or less or 1.0 x 10 11 pcs or more 1.0×10 12 The number of bacteria may be 1 or less. The number of bacteria can be measured using a known microscope, flow cytometer, or non-culture rapid microorganism testing device (e.g., ELESTA PixeeMo (AFI Technology Co., Ltd.)), but measurement using a microscope is preferred from the viewpoint of high versatility. The bacterium of one embodiment may be used as an immunostimulant as it is, or may be blended with other components and used as a composition having immunostimulating ability. The composition having immunostimulating ability may be used in the form of, for example, a food composition, a pharmaceutical composition, a quasi-drug, a bacterial bulk powder (a powder obtained by drying bacterial cells or a powder containing the same), or a feed. The subject to which the composition according to this embodiment is administered or ingested may be a human and / or a non-human mammal, preferably a human.

[0068] The content of bacteria in the composition of this embodiment is not particularly limited as long as it is an amount that can exert immunostimulatory activity, and therefore generally may vary depending on the form of the composition and the amount ingested or administered. For example, the dry weight of bacteria in the composition of this embodiment may be 0.0001% by mass or more, 0.001% by mass or more, 0.005% by mass or more, 0.01% by mass or more, 0.02% by mass or more, 0.05% by mass or more, 0.10% by mass or more, 0.30% by mass or more, 1.0% by mass or more, 1.5% by mass or more, 2.0% by mass or more, 2.5% by mass or more, 3.0% by mass or more, 5.0% by mass or more, or the like, relative to the total dry weight of the composition. %, 7.0 mass% or more, 10.0 mass% or more, 80.0 mass% or more, 90.0 mass% or more, 95.0 mass% or more, 99.0 mass% or more, or 100 mass%, or it may be 100 mass% or less, 95 mass% or less, 90 mass% or less, 80 mass% or less, 70 mass% or less, 60 mass% or less, 50 mass% or less, 30 mass% or less, 25 mass% or less, 20 mass% or less, or 15 mass% or less. These lower and upper limits can be combined arbitrarily. For example, the dry weight of bacteria relative to the total dry weight of the composition of this embodiment can be set to 0.0001% by mass or more and 100% by mass or less, 0.0001% by mass or more and 95% by mass or less, 0.0001% by mass or more and 90% by mass or less, 0.0001% by mass or more and 80% by mass or less, 0.0001% by mass or more and 70% by mass or less, 0.0001% by mass or more and 60% by mass or less, 0.0001% by mass or more and 50% by mass or less, 0.0001% by mass or more and 30% by mass or less, 0.0001% by mass or more and 25% by mass or less, 0.0001% by mass or more and 20% by mass or less, 0.0001% by mass or more and 15% by mass or less, 0.0001% by mass or more and ... % to 10 mass%, 0.001 mass% to 100 mass%, 0.001 mass% to 95 mass%, 0.001 mass% to 90 mass%, 0.001 mass% to 80 mass%, 0.001 mass% to 70 mass%, 0.001 mass% to 60 mass%, 0.001 mass% to 50 mass%, 0.0 01 mass% or more and 30 mass% or less, 0.001 mass% or more and 25 mass% or less, 0.001 mass% or more and 20 mass% or less, 0.001 mass% or more and 15 mass% or less, 0.001 mass% or more and 10 mass% or less, 0.005 mass% or more and 100 mass% or less, 0.005 mass% or more and 95 mass% or less, 0.005 mass% or more and 90 mass% or less,0.005 mass% or more and less than 80 mass%, 0.005 mass% or more and less than 70 mass%, 0.005 mass% or more and less than 60 mass%, 0.005 mass% or more and less than 50 mass%, 0.005 mass% or more and less than 30 mass%, 0.005 mass% or more and less than 25 mass%, 0.005 mass% or more and less than 20 mass%, 0.005 mass% or more and less than 15 mass%, 0.005 mass% or more and less than 10 mass%, 0.01 mass% or more and less than 100 mass%, 0.01 mass% or more and less than 95 mass%, 0.01 mass% or more and less than 90 mass%, 0.01 mass% or more and less than 80 mass%, 0.01 mass% or more and less than 70 mass%, 0. 0.01% by mass or more and less than 60% by mass, 0.01% by mass or more and less than 50% by mass, 0.01% by mass or more and less than 30% by mass, 0.01% by mass or more and less than 25% by mass, 0.01% by mass or more and less than 20% by mass, 0.01% by mass or more and less than 15% by mass, 0.01% by mass or more and less than 10% by mass, 0.02% by mass or more and less than 100% by mass, 0.02% by mass or more and less than 95% by mass, 0.02% by mass or more and less than 90% by mass, 0.02% by mass or more and less than 80% by mass, 0.02% by mass or more and less than 70% by mass, 0.02% by mass or more and less than 60% by mass, 0.02% by mass or more and less than 50% by mass, 0.02% by mass or more and less than 30% by mass % or less, 0.02 mass% or more and 25 mass% or less, 0.02 mass% or more and 20 mass% or less, 0.02 mass% or more and 15 mass% or less, 0.02 mass% or more and 10 mass% or less, 0.05 mass% or more and 100 mass% or less, 0.05 mass% or more and 95 mass% or less, 0.05 mass% or more and 90 mass% or less, 0.05 mass% or more and 80 mass% or less, 0.05 mass% or more and 70 mass% or less, 0.05 mass% or more and 60 mass% or less, 0.05 mass% or more and 50 mass% or less, 0.05 mass% or more and 30 mass% or less, 0.05 mass% or more and 25 mass% or less, 0.05 mass% or more and 2 ... % or more than 15% by mass, 0.05% or more than 10% by mass, 0.10% or more than 100% by mass, 0.10% or more than 95% by mass, 0.10% or more than 90% by mass, 0.10% or more than 80% by mass, 0.10% or more than 70% by mass, 0.10% or more than 60% by mass, 0.10% or more than 50% by mass, 0.10% or more than 30% by mass, 0.10% or more than 25% by mass, 0.10% or more than 20% by mass, 0.10% or more than 15% by mass, 0.10% or more than 10% by mass, 0.30% or more than 100% by mass,0.30 mass% or more and less than 95 mass%, 0.30 mass% or more and less than 90 mass%, 0.30 mass% or more and less than 80 mass%, 0.30 mass% or more and less than 70 mass%, 0.30 mass% or more and less than 60 mass%, 0.30 mass% or more and less than 50 mass%, 0.30 mass% or more and less than 30 mass%, 0.30 mass% or more and less than 25 mass%, 0.30 mass% or more and less than 20 mass%, 0.30 mass% or more and less than 15 mass%, 0.30 mass% or more and less than 10 mass%, 1.0 mass% or more and less than 100 mass%, 1.0 mass% or more and less than 95 mass%, 1.0 mass% or more and less than 90 mass%, 1.0 mass% or more and less than 80 mass% % or less, 1.0% by mass or more and less than 70% by mass, 1.0% by mass or more and less than 60% by mass, 1.0% by mass or more and less than 50% by mass, 1.0% by mass or more and less than 30% by mass, 1.0% by mass or more and less than 25% by mass, 1.0% by mass or more and less than 20% by mass, 1.0% by mass or more and less than 15% by mass, 1.0% by mass or more and less than 10% by mass, 1.5% by mass or more and less than 100% by mass, 1.5% by mass or more and less than 95% by mass, 1.5% by mass or more and less than 90% by mass, 1.5% by mass or more and less than 80% by mass, 1.5% by mass or more and less than 70% by mass, 1.5% by mass or more and less than 60% by mass, 1.5% by mass or more and less than 50% by mass, 1.5% by mass or more and less than 100% by mass mass% or more and less than 30 mass%, 1.5 mass% or more and less than 25 mass%, 1.5 mass% or more and less than 20 mass%, 1.5 mass% or more and less than 15 mass%, 1.5 mass% or more and less than 10 mass%, 2.0 mass% or more and less than 100 mass%, 2.0 mass% or more and less than 95 mass%, 2.0 mass% or more and less than 90 mass%, 2.0 mass% or more and less than 80 mass%, 2.0 mass% or more and less than 70 mass%, 2.0 mass% or more and less than 60 mass%, 2.0 mass% or more and less than 50 mass%, 2.0 mass% or more and less than 30 mass%, 2.0 mass% or more and less than 25 mass%, 2.0 mass% or more and less than 20 mass%, 2.0 mass% or more and less than 15 mass% or less, 2.0 mass% or more and 10 mass% or less, 2.5 mass% or more and 100 mass% or less, 2.5 mass% or more and 95 mass% or less, 2.5 mass% or more and 90 mass% or less, 2.5 mass% or more and 80 mass% or less, 2.5 mass% or more and 70 mass% or less, 2.5 mass% or more and 60 mass% or less, 2.5 mass% or more and 50 mass% or less, 2.5 mass% or more and 30 mass% or less, 2.5 mass% or more and 25 mass% or less, 2.5 mass% or more and 20 mass% or less, 2.5 mass% or more and 15 mass% or less, 2.5 mass% or more and 10 mass% or less, 3.0 mass% or more and 100 mass% or less, 3.0 mass% or more and 95 mass% or less,3.0 mass% or more and 90 mass% or less, 3.0 mass% or more and 80 mass% or less, 3.0 mass% or more and 70 mass% or less, 3.0 mass% or more and 60 mass% or less, 3.0 mass% or more and 50 mass% or less, 3.0 mass% or more and 30 mass% or less, 3.0 mass% or more and 25 mass% or less, 3.0 mass% or more and 20 mass% or less, 3.0 mass% or more and 15 mass% or less, 3.0 mass% or more and 10 mass% or less, 5.0 mass% or more and 100 mass% or less, 5.0 mass% or more and 95 mass% or less, 5.0 mass% or more and 90 mass% or less, 5.0 mass% or more and 80 mass% or less, 5.0 mass% or more and 70 mass% or less, 5.0 mass% or more and 60 mass% or less, 5.0 mass% or more and 50 mass% or less, 5.0 mass% or more and 30 mass% or less, 5.0 mass% or more and 25 mass% or less, 5.0 mass% or more and 20 mass% or less, 5.0 mass% or more and 15 mass% or less, 5.0 mass% or more and 10 mass% or less, 7.0 mass% or more and 100 mass% or less, 7.0 mass% or more and 95 mass% or less, 7.0 mass% or more and 90 mass% or less, 7.0 mass% or more and 80 mass% or less, 7.0 mass% or more and 70 mass% or less, 7.0 mass% or more and 60 mass% or less, 7.0 mass% or more and 50 mass% or less, 7.0 mass% or more and 30 mass% or less, 7.0 mass% or more and 25 mass% or less, 7.0 mass% or more and 20 mass% or less, 7.0 mass% or more and 15 mass% or less, 7.0 mass% or more and 10 mass% or less, 10.0 mass% or more and 100 mass% or less, 10.0 mass% or more and 95 mass% or less, 10.0 mass% or more and 90 mass% or less, 10.0 mass% or more and 80 mass% or less, 10.0 mass% or more and 70 mass% or less, 10.0 mass% or more and 60 mass% or less, 10.0 mass% or more and 50 mass% or less, 10.0 mass% or more and 30 mass% or less, 10.0 mass% or more and 25 mass% or less, 10.0 mass% or more and 20 mass% or less, 10.0 mass% or more and 15 mass% or less, 80.0 mass% or more and 100 mass% or less, 80.0 mass% or more and 95 mass% or less, 80.0 mass% or more and 90 mass% or less, 90.0 mass% or more and 100 mass% or less, 90.0 mass% or more and 95 mass% or less or 95.0 mass% or more and 100 mass% or less may be used.

[0069] The composition of the present embodiment may be, for example, a food composition, a pharmaceutical composition, a dried microbial cell powder (powder obtained by drying microbial cells or powder containing the same), or a feed.

[0070] When the composition of the present embodiment is in a liquid form, the number of bacteria according to the present embodiment in the composition is 1.0 × 10 3 Cells / mL or more, 1.0 x 10 4 Cells / mL or more, 1.0 x 10 5 Cells / mL or more, 1.0 x 10 6 Cells / mL or more, 1.0 x 10 7 cells / mL or 4.0 x 10 7 cells / mL or more, and may be 1.0 x 10 11 Cells / mL or less, 1.0 x 10 10 Cells / mL or less, 3.0 x 10 9 cells / mL or less or 1.0 x 10 9 The lower limit and upper limit may be any combination of cells / mL or less. For example, the number of bacteria contained in the composition according to this embodiment may be 1.0 × 10 3 Cells / mL or more 1.0 x 10 11 Cells / mL or less, 1.0 x 10 3 Cells / mL or more 1.0 x 10 10 Cells / mL or less, 1.0 x 10 3 Cells / mL or more 3.0 x 10 9 Cells / mL or less, 1.0 x 10 3 Cells / mL or more 1.0 x 10 9 Cells / mL or less, 1.0 x 10 4 Cells / mL or more 1.0 x 10 11 Cells / mL or less, 1.0 x 10 4 Cells / mL or more 1.0 x 10 10 Cells / mL or less, 1.0 x 10 4 Cells / mL or more 3.0 x 10 9 Cells / mL or less, 1.0 x 10 4 Cells / mL or more 1.0 x 10 9 Cells / mL or less, 1.0 x 10 5 Cells / mL or more 1.0 x 10 11 Cells / mL or less, 1.0 x 10 5 Cells / mL or more 1.0 x 10 10 Cells / mL or less, 1.0 x 10 5 Cells / mL or more 3.0 x 10 9 Cells / mL or less, 1.0 x 10 5Cells / mL or more 1.0 x 10 9 Cells / mL or less, 1.0 x 10 6 Cells / mL or more 1.0 x 10 11 Cells / mL or less, 1.0 x 10 6 Cells / mL or more 1.0 x 10 10 Cells / mL or less, 1.0 x 10 6 Cells / mL or more 3.0 x 10 9 Cells / mL or less, 1.0 x 10 6 Cells / mL or more 1.0 x 10 9 Cells / mL or less, 1.0 x 10 7 Cells / mL or more 1.0 x 10 11 Cells / mL or less, 1.0 x 10 7 Cells / mL or more 1.0 x 10 10 Cells / mL or less, 1.0 x 10 7 Cells / mL or more 3.0 x 10 9 Cells / mL or less, 1.0 x 10 7 Cells / mL or more 1.0 x 10 9 Cells / mL or less, 4.0 x 10 7 Cells / mL or more 1.0 x 10 11 Cells / mL or less, 4.0 x 10 7 Cells / mL or more 1.0 x 10 10 Cells / mL or less, 4.0 x 10 7 Cells / mL or more 3.0 x 10 9 cells / mL or less or 4.0 x 10 7 Cells / mL or more 1.0 x 10 9 In these cases, when the composition is a liquid food composition, liquid pharmaceutical composition, or liquid feed, the daily intake or administration amount of the composition may be 10 mL to 1,000 mL, 10 mL to 800 mL, 10 mL to 500 mL, 10 mL to 250 mL, 30 mL to 1,000 mL, 30 mL to 800 mL, 30 mL to 500 mL, 30 mL to 250 mL, 50 mL to 1,000 mL, 50 mL to 800 mL, 50 to 500 mL, 50 mL to 250 mL, 100 mL to 1,000 mL, 100 mL to 800 mL, 100 to 500 mL, or 100 to 250 mL.

[0071] In one aspect, the composition of this embodiment may contain a DNA fragment amplified by a predetermined primer set. In the present disclosure, a composition containing a certain DNA fragment may mean that the composition contains bacteria having the DNA fragment and / or that the composition contains the DNA fragment in a free state. In other words, the content of the DNA fragment in the composition of this embodiment may be the sum of the amount of the DNA fragment in the bacteria contained in the composition and the amount of the DNA fragment contained in the composition in a free state. In one aspect, a composition containing a certain DNA fragment may mean that the composition contains at least bacteria having the DNA fragment, and the bacteria may be, for example, heat-treated bacteria.

[0072] The method for determining the amount and concentration of DNA fragments amplified by a predetermined primer set contained in a composition is not particularly limited, and can be evaluated, for example, as follows: In a specific embodiment, the amount and concentration of DNA fragments amplified by a predetermined primer set may be determined according to the same method as in Example 6.

[0073] First, nucleic acids are extracted from the composition while eluting them from the bacteria contained in the composition. The method for extracting nucleic acids from the composition is not particularly limited, as long as it does not degrade the DNA fragments that serve as PCR templates in the subsequent evaluation, and can be performed using methods commonly used by those skilled in the art. Extracting nucleic acids from the composition may include, for example, disrupting the bacterial cell walls and extracting the nucleic acids from a solution containing the contents of the bacteria whose cell walls have been disrupted, and may further include purifying the nucleic acids by isolating them as precipitates. Disruption of the bacterial cell walls may be achieved by physical disruption, such as bead crushing and ultrasonic irradiation, or chemical disruption, such as by adding a surfactant. Nucleic acids can be extracted, for example, by adding phenol and chloroform to a portion or all of the composition or a diluted solution thereof, and recovering the supernatant (phenol-chloroform extraction). In addition to phenol and chloroform, an organic solvent (e.g., isoamyl alcohol) may also be added. Nucleic acids can be precipitated, for example, by adding a reagent (e.g., sodium acetate) to adjust the pH and ion concentration as needed to a solution containing the nucleic acids, and then mixing the solution with isopropanol, ethanol, or the like.

[0074] In a more detailed example of the extraction method, a surfactant-containing extraction buffer (e.g., 300 μL of the extraction buffer whose composition is shown below) and a solution containing phenol and chloroform (e.g., 500 μL of the phenol / chloroform / isoamyl alcohol solution whose composition is shown below) are first added to a portion or all of the composition or a dilution thereof (e.g., 200 μL). The bacterial cell walls contained in the resulting mixture are disrupted by bead crushing, followed by centrifugation to recover the supernatant. If necessary, the recovered supernatant is washed again with a solution containing phenol and chloroform, and then 3 M sodium acetate (e.g., 25 μL) and isopropanol (e.g., 250 μL) are added to the washed supernatant (e.g., 250 μL) to precipitate the nucleic acid. The precipitated nucleic acid is recovered by centrifugation or other methods, and then washed with 70% ethanol or other methods as needed to extract the nucleic acid from the composition. The nucleic acid extracted in this manner can be used for subsequent evaluation, for example, as a DNA solution obtained by adding water to the dried pellet. The amount of nucleic acid extracted in this manner may be determined, for example, by absorbance measurement. [Extraction buffer] A mixture of 20 mL of 1 M Tris HCl (pH 8), 16 mL of UltraPure 0.5 M EDTA (pH 8.0) (Thermo Fisher Scientific, ref: 15575-020), 64 mL of MilliQ, and 20 mL of 10% SDS. [Phenol / chloroform / isoamyl alcohol solution] A mixed solution of phenol, chloroform, and isoamyl alcohol in a volume ratio of 25:24:1.

[0075] Next, the copy number of the DNA fragment amplified by a predetermined primer set in the extracted nucleic acid is evaluated. The evaluation method is not particularly limited as long as it can evaluate the copy number of the DNA fragment amplified by a predetermined primer set, and may be, for example, a digital PCR method. In the digital PCR method, a solution containing the DNA fragment is divided into a number of microsolutions so that the DNA fragment to be amplified is stochastically contained in less than one molecule, and then PCR is caused in each microsolution. The proportion of microsolutions in which PCR occurred is used as an indicator to evaluate the copy number of the DNA fragment contained in a unit volume of solution. The specific method of the digital PCR method is not particularly limited, and may be, for example, a method using droplets or microwells, and in one embodiment, a method using droplets. The digital PCR method using droplets is known as ddPCR (Droplet Digital PCR).

[0076] A detailed example of the ddPCR method is evaluation using the ddPCR method using a QX600 AutoDG Droplet Digital PCR System (Bio-Rad). More specifically, first, the DNA solution is diluted to an appropriate concentration. The dilution ratio may be determined based on the amount of extracted nucleic acid, for example, as determined by absorbance measurement. Next, ddPCR Evagreen Supermix (Bio-Rad, 1864033), a 10 μM forward primer solution, a 10 μM reverse primer solution, water, and a diluted DNA solution are mixed in a volume ratio of 11:0.4:0.4:8.2:2.0. This mixture is then passed through an Automated Droplet Generator (Bio-Rad, 1864101JA) to create droplets. Thereafter, a Pierceable Foil Heat Seal (Bio-Rad, 1814000J1) is attached to the plate using a PX1 (registered trademark) PCR Plate Sealer (Bio-Rad, 1814000J1), and PCR is performed using a PTC Tempo Deepwell Thermal Cycler (Bio-Rad, 12015392). In the PCR amplification program, the temperature change is performed at, for example, 2°C / second. PCR may also be performed using, for example, the following program. The sample after PCR is subjected to a QX600 Droplet Reader (Bio-Rad, 12013328), and the concentration of the DNA fragment amplified by the specified primer set is measured. In ddPCR, the concentration of a DNA fragment can be measured as the copy number per unit volume. [Program] Stage 1: 1 cycle of 5 minutes at 95°C Stage 2: 40 cycles of 5 seconds at 95°C and 20 seconds at 58°C Stage 3: 1 cycle of 1 second at 95°C and 20 seconds at 4°C

[0077] By using the above method, for example, the final measured concentration of the DNA fragment is multiplied by the dilution ratio used up to the preparation of the PCR reaction solution, and if a portion of the composition is used to prepare the DNA solution, this is converted to the total amount of the composition, thereby calculating the copy number of the DNA fragment contained in the total amount of the composition and amplified by the specified primer set (total composition copy number).Furthermore, by dividing the total composition copy number by the volume or mass of the composition, the copy number of the DNA fragment amplified by the specified primer set per unit volume or unit mass of the composition can be calculated.Furthermore, by dividing the total composition copy number by the mass or number of cells of the heat-treated bacteria contained in the composition, the copy number of the DNA fragment amplified by the specified primer set per unit mass or unit number of cells of the heat-treated bacteria contained in the composition can be calculated.

[0078] The predetermined primer set may be, for example, a primer set consisting of the following forward and reverse primers (hereinafter also referred to as "A9 primer set"). The A9 primer set is a set of primers that amplify a genomic region of Lactococcus bacteria. Forward primer: CGTTTACGTGCTGCTTCTGA (SEQ ID NO: 3) Reverse primer: AGCTGGAACTCTTCAAGAGCTT (SEQ ID NO: 4)

[0079] In one aspect of this embodiment, when the heat-treated bacteria include Lactococcus bacteria, the composition contains a DNA fragment amplified by the A9 primer set at, for example, 1.0 × 10 5 Copy or more, 3.0 x 10 5 Copy or more, 7.0 x 10 5 Copy or more, 1.2 x 10 6 Copy or more, 1.9 x 10 6 Copy or more, 2.0 x 10 6 Copy or more, 2.1 x 10 6 Copy or more, 2.5 x 10 6 Copy or more or 3.0 x 10 6 It may contain more than 1.2 x 10 copies. 7 Copy and below, 1.0 x 10 7 Copy and below, 9.0 x 10 6Copy and below, 8.0 x 10 6 Copy or less or 7.6 x 10 6 In this case, these lower and upper limits may be arbitrarily combined, and the composition may contain, for example, 1.0 × 10 copies of the DNA fragment amplified by the A9 primer set. 5 1.2 x 10 7 Below, 1.0 x 10 5 Above 1.0 x 10 7 Below, 1.0 x 10 5 Above 9.0 x 10 6 Below, 1.0 x 10 5 Above 8.0 x 10 6 Below, 1.0 x 10 5 7.6 x 10 6 Below, 3.0 x 10 5 1.2 x 10 7 Below, 3.0 x 10 5 Above 1.0 x 10 7 Below, 3.0 x 10 5 Above 9.0 x 10 6 Below, 3.0 x 10 5 Above 8.0 x 10 6 Below, 3.0 x 10 5 7.6 x 10 6 Below, 7.0 x 10 5 1.2 x 10 7 Below, 7.0 x 10 5 Above 1.0 x 10 7 Below, 7.0 x 10 5 Above 9.0 x 10 6 Below, 7.0 x 10 5 Above 8.0 x 10 6 Below, 7.0 x 10 5 7.6 x 10 6 Below, 1.2 x 10 6 1.2 x 10 7 Below, 1.2 x 10 6 Above 1.0 x 10 7 Below, 1.2 x 10 6 Above 9.0 x 10 6 Below, 1.2 x 10 6 Above 8.0 x 10 6 Below, 1.2 x 10 6 7.6 x 10 6 Below, 1.9 x 106 Above 1.2×10 7 Below, 1.9×10 6 Above 1.0×10 7 Below, 1.9×10 6 Above 9.0×10 6 Below, 1.9×10 6 Above 8.0×10 6 Below, 1.9×10 6 Above 7.6×10 6 Below, 2.0×10 6 Above 1.2×10 7 Below, 2.0×10 6 Above 1.0×10 7 Below, 2.0×10 6 Above 9.0×10 6 Below, 2.0×10 6 Above 8.0×10 6 Below, 2.0×10 6 Above 7.6×10 6 Below, 2.1×10 6 Above 1.2×10 7 Below, 2.1×10 6 Above 1.0×10 7 Below, 2.1×10 6 Above 9.0×10 6 Below, 2.1×10 6 Above 8.0×10 6 Below, 2.1×10 6 Above 7.6×10 6 Below, 2.5×10 6 Above 1.2×10 7 Below, 2.5×10 6 Above 1.0×10 7 Below, 2.5×10 6 Above 9.0×10 6 Below, 2.5×10 6 Above 8.0×10 6 Below, 2.5×10 6 Above 7.6×10 6 Below, 3.0×10 6 Above 1.2×10 7 Below, 3.0×10 6 Above 1.0×10 7 Below, 3.0×10 6 Above 9.0×10 6 Below, 3.0×10 6Above 8.0 x 10 6 or less or 3.0 x 10 6 7.6 x 10 6 It may contain the following copies:

[0080] In one aspect of this embodiment, when the heat-treated bacteria include bacteria of the genus Lactococcus, the composition contains a DNA fragment amplified by the A9 primer set at, for example, 5.1 × 10 per mg of bacteria of the genus Lactococcus. 7 Copy or more, 1.5 x 10 8 Copy or more, 3.5 x 10 8 Copy or more, 3.5 x 10 8 Copy or more, 6.0 x 10 8 Copy or more, 9.5 x 10 8 Copy or more, 1.0 x 10 9 Copy or more, 1.0 x 10 9 Copy or more, 1.2 x 10 9 Copy or more or 1.5 x 10 9 It may contain more than 6.0 x 10 copies. 9 Copy and below, 5.0 x 10 9 Copy and below, 4.5 x 10 9 Copy and below, 4.0 x 10 9 Copy or less or 3.8 x 10 9 In this case, these lower and upper limits may be arbitrarily combined, and the composition may contain, for example, 5.1 × 10 copies of the DNA fragment amplified by the A9 primer set per mg of Lactococcus bacteria. 7 Above 6.0 x 10 9 Below, 5.1 x 10 7 Above 5.0 x 10 9 Below, 5.1 x 10 7 4.5 x 10 9 Below, 5.1 x 10 7 Above 4.0 x 10 9 Below, 5.1 x 10 7 3.8 x 10 9 Below, 1.5 x 10 8 Above 6.0 x 10 9 Below, 1.5 x 10 8 Above 5.0 x 10 9 Below, 1.5 x 10 8 4.5 x 109 Below, 1.5×10 8 Above 4.0×10 9 Below, 1.5×10 8 Above 3.8×10 9 Below, 3.5×10 8 Above 6.0×10 9 Below, 3.5×10 8 Above 5.0×10 9 Below, 3.5×10 8 Above 4.5×10 9 Below, 3.5×10 8 Above 4.0×10 9 Below, 3.5×10 8 Above 3.8×10 9 Below, 6.0×10 8 Above 6.0×10 9 Below, 6.0×10 8 Above 5.0×10 9 Below, 6.0×10 8 Above 4.5×10 9 Below, 6.0×10 8 Above 4.0×10 9 Below, 6.0×10 8 Above 3.8×10 9 Below, 9.5×10 8 Above 6.0×10 9 Below, 9.5×10 8 Above 5.0×10 9 Below, 9.5×10 8 Above 4.5×10 9 Below, 9.5×10 8 Above 4.0×10 9 Below, 9.5×10 8 Above 3.8×10 9 Below, 1.0×10 9 Above 6.0×10 9 Below, 1.0×10 9 Above 5.0×10 9 Below, 1.0×10 9 Above 4.5×10 9 Below, 1.0×10 9 Above 4.0×10 9 Below, 1.0×10 9 Above 3.8×10 9 Below, 1. ×10 9 Above 6.0×10 9Below, 1. x 10 9 Above 5.0 x 10 9 Below, 1. x 10 9 4.5 x 10 9 Below, 1. x 10 9 Above 4.0 x 10 9 Below, 1. x 10 9 3.8 x 10 9 Below, 1.2 x 10 9 Above 6.0 x 10 9 Below, 1.2 x 10 9 Above 5.0 x 10 9 Below, 1.2 x 10 9 4.5 x 10 9 Below, 1.2 x 10 9 Above 4.0 x 10 9 Below, 1.2 x 10 9 3.8 x 10 9 Below, 1.5 x 10 9 Above 6.0 x 10 9 Below, 1.5 x 10 9 Above 5.0 x 10 9 Below, 1.5 x 10 9 4.5 x 10 9 Below, 1.5 x 10 9 Above 4.0 x 10 9 or less or 1.5 x 10 9 3.8 x 10 9 It may contain the following copies:

[0081] In one aspect of this embodiment, when the heat-treated bacteria include Lactococcus bacteria, the composition contains a DNA fragment amplified by the A9 primer set at, for example, 5.2 × 10 per mL of the composition. 5 Copy or more, 1.5 x 10 6 Copy or more, 3.5 x 10 6 Copy or more, 6.0 x 10 6 Copy or more, 9.5 x 10 6 Copy or more, 1.0 x 10 7 Copy or more, 1.0 x 10 7 Copy or more, 1.2 x 10 7 Copy or more or 1.5 x 10 7 It may contain more than 6.0 x 10 copies. 7 Copy and below, 5.0 x 10 7Copy and below, 4.5 x 10 7 Copy and below, 4.0 x 10 7 Copy or less or 3.8 x 10 7 In this case, these lower and upper limits may be arbitrarily combined, and the composition may contain, for example, 5.2 × 10 copies of the DNA fragment amplified by the A9 primer set. 5 Above 6.0 x 10 7 Below, 5.2 x 10 5 Above 5.0 x 10 7 Below, 5.2 x 10 5 4.5 x 10 7 Below, 5.2 x 10 5 Above 4.0 x 10 7 Below, 5.2 x 10 5 3.8 x 10 7 Below, 1.5 x 10 6 Above 6.0 x 10 7 Below, 1.5 x 10 6 Above 5.0 x 10 7 Below, 1.5 x 10 6 4.5 x 10 7 Below, 1.5 x 10 6 Above 4.0 x 10 7 Below, 1.5 x 10 6 3.8 x 10 7 Below, 3.5 x 10 6 Above 6.0 x 10 7 Below, 3.5 x 10 6 Above 5.0 x 10 7 Below, 3.5 x 10 6 4.5 x 10 7 Below, 3.5 x 10 6 Above 4.0 x 10 7 Below, 3.5 x 10 6 3.8 x 10 7 Below, 6.0 x 10 6 Above 6.0 x 10 7 Below, 6.0 x 10 6 Above 5.0 x 10 7 Below, 6.0 x 10 6 4.5 x 10 7 Below, 6.0 x 10 6 Above 4.0 x 10 7 Below, 6.0 x 10 6 3.8 x 107 Below, 9.5×10 6 Above 6.0×10 7 Below, 9.5×10 6 Above 5.0×10 7 Below, 9.5×10 6 Above 4.5×10 7 Below, 9.5×10 6 Above 4.0×10 7 Below, 9.5×10 6 Above 3.8×10 7 Below, 1.0×10 7 Above 6.0×10 7 Below, 1.0×10 7 Above 5.0×10 7 Below, 1.0×10 7 Above 4.5×10 7 Below, 1.0×10 7 Above 4.0×10 7 Below, 1.0×10 7 Above 3.8×10 7 Below, 1.0×10 7 Above 6.0×10 7 Below, 1.0×10 7 Above 5.0×10 7 Below, 1.0×10 7 Above 4.5×10 7 Below, 1.0×10 7 Above 4.0×10 7 Below, 1.0×10 7 Above 3.8×10 7 Below, 1.2×10 7 Above 6.0×10 7 Below, 1.2×10 7 Above 5.0×10 7 Below, 1.2×10 7 Above 4.5×10 7 Below, 1.2×10 7 Above 4.0×10 7 Below, 1.2×10 7 Above 3.8×10 7 Below, 1.5×10 7 Above 6.0×10 7 Below, 1.5×10 7 Above 5.0×10 7 Below, 1.5×10 7 Above 4.5×10 7Below, 1.5 x 10 7 Above 4.0 x 10 7 or less or 1.5 x 10 7 3.8 x 10 7 It may contain the following copies:

[0082] The predetermined primer set may be, for example, a primer set consisting of the following forward primer and reverse primer (hereinafter also referred to as a "V3 primer set"). The V3 primer set is a set of primers that amplify the 16S conserved region V3 of prokaryotes. In the following forward primers, W means A or T, and N means A, C, G, or T. Forward primer: CCTACGGGNGGCWGCAG (SEQ ID NO: 5) Reverse primer: TTACCGCGGCGCTGGCAC (SEQ ID NO: 6)

[0083] In one aspect of this embodiment, the composition contains a DNA fragment amplified by the V3 primer set at, for example, 5.0 × 10 copies or more, 2.0 × 10 copies or more, 2 Copy or more, 2.4 x 10 2 Copy or more, 2.6 x 10 2 Copy or more, 4.0 x 10 2 Copy or more, 6.0 x 10 2 Copy or more, 1.0 x 10 3 Copy or more, 3.0 x 10 3 Copy or more, 1.0 x 10 4 Copy or more, 3.0 x 10 4 Copy or more, 1.0 x 10 5 Copy or more, 2.5 x 10 6 Copy or more, 5.0 x 10 6 Copy or more, 1.0 x 10 7 Copy or more, 3.0 x 10 7 Copy or more, 8.5 x 10 7 Copy or more, 1.2 x 10 8 Copy or more, 1.5 x 10 8 Copy or more, 1.8 x 10 8 Copy or more, 3.0 x 10 8 Copy or more, 1.0 x 10 9 Copy or more, 1.12 x 10 9 Copy or more, 1.2 x 109 Copy or more, 1.3 x 10 9 Copy or more, 1.4 x 10 9 Copy or more, 1.4 x 10 9 Copy or more or 1.5 x 10 9 It may contain more than 2.0 x 10 copies. 9 Copy and below, 1.6 x 10 9 Copy and below, 2.0 x 10 8 Copy and below, 1.9 x 10 8 Copy and below, 1.5 x 10 8 Copy or less or 1.3 x 10 8 These lower and upper limits may be combined in any combination. In one aspect of this embodiment, the composition may contain, for example, 5.0 × 10 copies of the DNA fragment amplified by the V3 primer set. 1 Above 2.0 x 10 9 Below, 5.0 x 10 1 1.6 x 10 9 Below, 5.0 x 10 1 Above 2.0 x 10 8 Below, 5.0 x 10 1 1.9 x 10 8 Below, 5.0 x 10 1 1.5 x 10 8 Below, 5.0 x 10 1 1.3 x 10 8 Below, 2.0 x 10 2 Above 2.0 x 10 9 Below, 2.0 x 10 2 1.6 x 10 9 Below, 2.0 x 10 2 Above 2.0 x 10 8 Below, 2.0 x 10 2 1.9 x 10 8 Below, 2.0 x 10 2 1.5 x 10 8 Below, 2.0 x 10 2 1.3 x 10 8 Below, 2.4 x 10 2 Above 2.0 x 10 9 Below, 2.4 x 10 2 1.6 x 10 9 Below, 2.4 x 10 2 Above 2.0 x 10 8Below, 2.4×10 2 Above 1.9×10 8 Below, 2.4×10 2 Above 1.5×10 8 Below, 2.4×10 2 Above 1.3×10 8 Below, 2.6×10 2 Above 2.0×10 9 Below, 2.6×10 2 Above 1.6×10 9 Below, 2.6×10 2 Above 2.0×10 8 Below, 2.6×10 2 Above 1.9×10 8 Below, 2.6×10 2 Above 1.5×10 8 Below, 2.6×10 2 Above 1.3×10 8 Below, 4.0×10 2 Above 2.0×10 9 Below, 4.0×10 2 Above 1.6×10 9 Below, 4.0×10 2 Above 2.0×10 8 Below, 4.0×10 2 Above 1.9×10 8 Below, 4.0×10 2 Above 1.5×10 8 Below, 4.0×10 2 Above 1.3×10 8 Below, 6.0×10 2 Above 2.0×10 9 Below, 6.0×10 2 Above 1.6×10 9 Below, 6.0×10 2 Above 2.0×10 8 Below, 6.0×10 2 Above 1.9×10 8 Below, 6.0×10 2 Above 1.5×10 8 Below, 6.0×10 2 Above 1.3×10 8 Below, 1.0×10 3 Above 2.0×10 9 Below, 1.0×10 3 Above 1.6×10 9 Below, 1.0×103 Above 2.0×10 8 Below, 1.0×10 3 Above 1.9×10 8 Below, 1.0×10 3 Above 1.5×10 8 Below, 1.0×10 3 Above 1.3×10 8 Below, 3.0×10 3 Above 2.0×10 9 Below, 3.0×10 3 Above 1.6×10 9 Below, 3.0×10 3 Above 2.0×10 8 Below, 3.0×10 3 Above 1.9×10 8 Below, 3.0×10 3 Above 1.5×10 8 Below, 3.0×10 3 Above 1.3×10 8 Below, 1.0×10 4 Above 2.0×10 9 Below, 1.0×10 4 Above 1.6×10 9 Below, 1.0×10 4 Above 2.0×10 8 Below, 1.0×10 4 Above 1.9×10 8 Below, 1.0×10 4 Above 1.5×10 8 Below, 1.0×10 4 Above 1.3×10 8 Below, 3.0×10 4 Above 2.0×10 9 Below, 3.0×10 4 Above 1.6×10 9 Below, 3.0×10 4 Above 2.0×10 8 Below, 3.0×10 4 Above 1.9×10 8 Below, 3.0×10 4 Above 1.5×10 8 Below, 3.0×10 4 Above 1.3×10 8 Below, 1.0×10 5 Above 2.0×10 9 Below, 1.0×10 5Above 1.6×10 9 Below, 1.0×10 5 Above 2.0×10 8 Below, 1.0×10 5 Above 1.9×10 8 Below, 1.0×10 5 Above 1.5×10 8 Below, 1.0×10 5 Above 1.3×10 8 Below, 2.5×10 6 Above 2.0×10 9 Below, 2.5×10 6 Above 1.6×10 9 Below, 2.5×10 6 Above 2.0×10 8 Below, 2.5×10 6 Above 1.9×10 8 Below, 2.5×10 6 Above 1.5×10 8 Below, 2.5×10 6 Above 1.3×10 8 Below, 5.0×10 6 Above 2.0×10 9 Below, 5.0×10 6 Above 1.6×10 9 Below, 5.0×10 6 Above 2.0×10 8 Below, 5.0×10 6 Above 1.9×10 8 Below, 5.0×10 6 Above 1.5×10 8 Below, 5.0×10 6 Above 1.3×10 8 Below, 1.0×10 7 Above 2.0×10 9 Below, 1.0×10 7 Above 1.6×10 9 Below, 1.0×10 7 Above 2.0×10 8 Below, 1.0×10 7 Above 1.9×10 8 Below, 1.0×10 7 Above 1.5×10 8 Below, 1.0×10 7 Above 1.3×10 8 Below, 3.0×10 7 Above 2.0×109 Below, 3.0×10 7 Above 1.6×10 9 Below, 3.0×10 7 Above 2.0×10 8 Below, 3.0×10 7 Above 1.9×10 8 Below, 3.0×10 7 Above 1.5×10 8 Below, 3.0×10 7 Above 1.3×10 8 Below, 8.5×10 7 Above 2.0×10 9 Below, 8.5×10 7 Above 1.6×10 9 Below, 8.5×10 7 Above 2.0×10 8 Below, 8.5×10 7 Above 1.9×10 8 Below, 8.5×10 7 Above 1.5×10 8 Below, 8.5×10 7 Above 1.3×10 8 Below, 1.2×10 8 Above 2.0×10 9 Below, 1.2×10 8 Above 1.6×10 9 Below, 1.2×10 8 Above 2.0×10 8 Below, 1.2×10 8 Above 1.9×10 8 Below, 1.2×10 8 Above 1.5×10 8 Below, 1.2×10 8 Above 1.3×10 8 Below, 1.5×10 8 Above 2.0×10 9 Below, 1.5×10 8 Above 1.6×10 9 Below, 1.5×10 8 Above 2.0×10 8 Below, 1.5×10 8 Above 1.9×10 8 Below, 1.5×10 8 Above 1.3×10 8 Below, 1.8×10 8 Above 2.0×10 9Below, 1.8 x 10 8 1.6 x 10 9 Below, 1.8 x 10 8 Above 2.0 x 10 8 Below, 1.8 x 10 8 1.9 x 10 8 Below, 3.0 x 10 8 Above 2.0 x 10 9 Below, 3.0 x 10 8 1.6 x 10 9 Below, 3.0 x 10 8 Above 2.0 x 10 8 Below, 3.0 x 10 8 1.9 x 10 8 Below, 1.0 x 10 9 Above 2.0 x 10 9 Below, 1.0 x 10 9 1.6 x 10 9 Below, 1.12 x 10 9 Above 2.0 x 10 9 Below, 1.12 x 10 9 1.6 x 10 9 Below, 1.2 x 10 9 Above 2.0 x 10 9 Below, 1.2 x 10 9 1.6 x 10 9 Below, 1.3 x 10 9 Above 2.0 x 10 9 Below, 1.3 x 10 9 1.6 x 10 9 Below, 1.4 x 10 9 Above 2.0 x 10 9 Below, 1.4 x 10 9 1.6 x 10 9 Below, 1.4 x 10 9 Above 2.0 x 10 9 Below, 1.4 x 10 9 1.6 x 10 9 Below, 1.5 x 10 9 Above 2.0 x 10 9 or less or 1.5 x 10 9 1.6 x 10 9 It may contain the following copies:

[0084] In one aspect of this embodiment, the composition contains a DNA fragment amplified by the V3 primer set at a concentration of, for example, 2.5 x 10 per mg of bacteria. 4 Copy or more, 1.0 x 10 5 Copy or more, 1.2 x 10 5 Copy or more, 1.3 x 10 5 Copy or more, 2.0 x 10 5 Copy or more, 3.0 x 10 5 Copy or more, 5.0 x 10 5 Copy or more, 1.5 x 10 6 Copy or more, 5.0 x 10 6 Copy or more, 1.5 x 10 7 Copy or more, 5.0 x 10 7 Copy or more, 1.2 x 10 9 Copy or more, 2.5 x 10 9 Copy or more, 5.0 x 10 9 Copy or more, 1.5 x 10 10 Copy or more, 4.2 x 10 10 Copy or more, 6.0 x 10 10 Copy or more, 7.5 x 10 10 Copy or more, 9.0 x 10 10 Copy or more, 1.5 x 10 11 Copy or more, 5.0 x 10 11 Copy or more, 5.6 x 10 11 Copy or more, 6.0 x 10 11 Copy or more, 6.5 x 10 11 Copy or more, 7.0 x 10 11 Copy or more, 7.2 x 10 11 Copy or more or 7.5 x 10 11 It may contain more than 1.0 x 10 copies. 12 Copy and below, 8.0 x 10 11 Copy and below, 1.0 x 10 11 Copy and below, 9.3 x 10 10 Copy and below, 7.5 x 10 10 Copy or less or 6.5 x 10 10 These lower and upper limits may be combined in any combination, and in one aspect of this embodiment, the composition may contain, for example, 2.5 × 10 copies or less of the DNA fragment amplified by the V3 primer set per mg of bacteria. 4Above 1.0×10 12 Below, 2.5×10 4 Above 8.0×10 11 Below, 2.5×10 4 Above 1.0×10 11 Below, 2.5×10 4 Above 9.3×10 10 Below, 2.5×10 4 Above 7.5×10 10 Below, 2.5×10 4 Above 6.5×10 10 Below, 1.0×10 5 Above 1.0×10 12 Below, 1.0×10 5 Above 8.0×10 11 Below, 1.0×10 5 Above 1.0×10 11 Below, 1.0×10 5 Above 9.3×10 10 Below, 1.0×10 5 Above 7.5×10 10 Below, 1.0×10 5 Above 6.5×10 10 Below, 1.2×10 5 Above 1.0×10 12 Below, 1.2×10 5 Above 8.0×10 11 Below, 1.2×10 5 Above 1.0×10 11 Below, 1.2×10 5 Above 9.3×10 10 Below, 1.2×10 5 Above 7.5×10 10 Below, 1.2×10 5 Above 6.5×10 10 Below, 1.3×10 5 Above 1.0×10 12 Below, 1.3×10 5 Above 8.0×10 11 Below, 1.3×10 5 Above 1.0×10 11 Below, 1.3×10 5 Above 9.3×10 10 Below, 1.3×10 5 Above 7.5×10 10 Below, 1.3×10 5 Above 6.5×1010 Below, 2.0×10 5 Above 1.0×10 12 Below, 2.0×10 5 Above 8.0×10 11 Below, 2.0×10 5 Above 1.0×10 11 Below, 2.0×10 5 Above 9.3×10 10 Below, 2.0×10 5 Above 7.5×10 10 Below, 2.0×10 5 Above 6.5×10 10 Below, 3.0×10 5 Above 1.0×10 12 Below, 3.0×10 5 Above 8.0×10 11 Below, 3.0×10 5 Above 1.0×10 11 Below, 3.0×10 5 Above 9.3×10 10 Below, 3.0×10 5 Above 7.5×10 10 Below, 3.0×10 5 Above 6.5×10 10 Below, 5.0×10 5 Above 1.0×10 12 Below, 5.0×10 5 Above 8.0×10 11 Below, 5.0×10 5 Above 1.0×10 11 Below, 5.0×10 5 Above 9.3×10 10 Below, 5.0×10 5 Above 7.5×10 10 Below, 5.0×10 5 Above 6.5×10 10 Below, 1.5×10 6 Above 1.0×10 12 Below, 1.5×10 6 Above 8.0×10 11 Below, 1.5×10 6 Above 1.0×10 11 Below, 1.5×10 6 Above 9.3×10 10 Below, 1.5×10 6 Above 7.5×10 10Below, 1.5×10 6 Above 6.5×10 10 Below, 5.0×10 6 Above 1.0×10 12 Below, 5.0×10 6 Above 8.0×10 11 Below, 5.0×10 6 Above 1.0×10 11 Below, 5.0×10 6 Above 9.3×10 10 Below, 5.0×10 6 Above 7.5×10 10 Below, 5.0×10 6 Above 6.5×10 10 Below, 1.5×10 7 Above 1.0×10 12 Below, 1.5×10 7 Above 8.0×10 11 Below, 1.5×10 7 Above 1.0×10 11 Below, 1.5×10 7 Above 9.3×10 10 Below, 1.5×10 7 Above 7.5×10 10 Below, 1.5×10 7 Above 6.5×10 10 Below, 5.0×10 7 Above 1.0×10 12 Below, 5.0×10 7 Above 8.0×10 11 Below, 5.0×10 7 Above 1.0×10 11 Below, 5.0×10 7 Above 9.3×10 10 Below, 5.0×10 7 Above 7.5×10 10 Below, 5.0×10 7 Above 6.5×10 10 Below, 1.2×10 9 Above 1.0×10 12 Below, 1.2×10 9 Above 8.0×10 11 Below, 1.2×10 9 Above 1.0×10 11 Below, 1.2×10 9 Above 9.3×10 10 Below, 1.2×109 Above 7.5×10 10 Below, 1.2×10 9 Above 6.5×10 10 Below, 2.5×10 9 Above 1.0×10 12 Below, 2.5×10 9 Above 8.0×10 11 Below, 2.5×10 9 Above 1.0×10 11 Below, 2.5×10 9 Above 9.3×10 10 Below, 2.5×10 9 Above 7.5×10 10 Below, 2.5×10 9 Above 6.5×10 10 Below, 5.0×10 9 Above 1.0×10 12 Below, 5.0×10 9 Above 8.0×10 11 Below, 5.0×10 9 Above 1.0×10 11 Below, 5.0×10 9 Above 9.3×10 10 Below, 5.0×10 9 Above 7.5×10 10 Below, 5.0×10 9 Above 6.5×10 10 Below, 1.5×10 10 Above 1.0×10 12 Below, 1.5×10 10 Above 8.0×10 11 Below, 1.5×10 10 Above 1.0×10 11 Below, 1.5×10 10 Above 9.3×10 10 Below, 1.5×10 10 Above 7.5×10 10 Below, 1.5×10 10 Above 6.5×10 10 Below, 4.2×10 10 Above 1.0×10 12 Below, 4.2×10 10 Above 8.0×10 11 Below, 4.2×10 10 Above 1.0×10 11 Below, 4.2×10 10Above 9.3×10 10 Below, 4.2×10 10 Above 7.5×10 10 Below, 4.2×10 10 Above 6.5×10 10 Below, 6.0×10 10 Above 1.0×10 12 Below, 6.0×10 10 Above 8.0×10 11 Below, 6.0×10 10 Above 1.0×10 11 Below, 6.0×10 10 Above 9.3×10 10 Below, 6.0×10 10 Above 7.5×10 10 Below, 6.0×10 10 Above 6.5×10 10 Below, 7.5×10 10 Above 1.0×10 12 Below, 7.5×10 10 Above 8.0×10 11 Below, 7.5×10 10 Above 1.0×10 11 Below, 7.5×10 10 Above 9.3×10 10 Below, 7.5×10 10 Above 6.5×10 10 Below, 9.0×10 10 Above 1.0×10 12 Below, 9.0×10 10 Above 8.0×10 11 Below, 9.0×10 10 Above 1.0×10 11 Below, 9.0×10 10 Above 9.3×10 10 Below, 1.5×10 11 Above 1.0×10 12 Below, 1.5×10 11 Above 8.0×10 11 Below, 1.5×10 11 Above 1.0×10 11 Below, 1.5×10 11 Above 9.3×10 10 Below, 5.0×10 11 Above 1.0×10 12 Below, 5.0×10 11 Above 8.0×1011 Below, 5.6 x 10 11 Above 1.0 x 10 12 Below, 5.6 x 10 11 Above 8.0 x 10 11 Below, 6.0 x 10 11 Above 1.0 x 10 12 Below, 6.0 x 10 11 Above 8.0 x 10 11 Below, 6.5 x 10 11 Above 1.0 x 10 12 Below, 6.5 x 10 11 Above 8.0 x 10 11 Below, 7.0 x 10 11 Above 1.0 x 10 12 Below, 7.0 x 10 11 Above 8.0 x 10 11 Below, 7.2 x 10 11 Above 1.0 x 10 12 Below, 7.2 x 10 11 Above 8.0 x 10 11 Below, 7.5 x 10 11 Above 1.0 x 10 12 Less than or equal to 7.5 x 10 11 Above 8.0 x 10 11 It may contain the following copies:

[0085] In one aspect of this embodiment, the composition contains a DNA fragment amplified by the V3 primer set at a concentration of, for example, 2.5 x 10 per mL of the composition. 2 Copy or more, 1.0 x 10 3 Copy or more, 1.2 x 10 3 Copy or more, 1.3 x 10 3 Copy or more, 2.0 x 10 3 Copy or more, 3.0 x 10 3 Copy or more, 5.0 x 10 3 Copy or more, 1.5 x 10 4 Copy or more, 5.0 x 10 4 Copy or more, 1.5 x 10 5 Copy or more, 5.0 x 10 5 Copy or more, 1.2 x 10 7 Copy or more, 2.5 x 10 7 Copy or more, 5.0 x 10 7 Copy or more, 1.5 x 10 8Copy or more, 4.2 x 10 8 Copy or more, 6.0 x 10 8 Copy or more, 7.5 x 10 8 Copy or more, 9.0 x 10 8 Copy or more, 1.5 x 10 9 Copy or more, 5.0 x 10 9 Copy or more, 5.6 x 10 9 Copy or more, 6.0 x 10 9 Copy or more, 6.5 x 10 9 Copy or more, 7.0 x 10 9 Copy or more, 7.2 x 10 9 Copy or more or 7.5 x 10 9 It may contain more than 1.0 x 10 copies. 10 Copy and below, 8.0 x 10 9 Copy and below, 1.0 x 10 9 Copy and below, 9.3 x 10 8 Copy and below, 7.5 x 10 8 Copy or less or 6.5 x 10 8 These lower and upper limits may be combined in any combination, and in one aspect of this embodiment, the composition may contain a DNA fragment amplified by the V3 primer set at, for example, 2.5 × 10 copies per mL of the composition. 2 Above 1.0 x 10 10 Below, 2.5 x 10 2 Above 8.0 x 10 9 Below, 2.5 x 10 2 Above 1.0 x 10 9 Below, 2.5 x 10 2 The above is 9.3 x 10 8 Below, 2.5 x 10 2 7.5 x 10 8 Below, 2.5 x 10 2 6.5 x 10 8 Below, 1.0 x 10 3 Above 1.0 x 10 10 Below, 1.0 x 10 3 Above 8.0 x 10 9 Below, 1.0 x 10 3 Above 1.0 x 10 9 Below, 1.0 x 10 3 The above is 9.3 x 10 8 Below, 1.0 x 103 Above 7.5×10 8 Below, 1.0×10 3 Above 6.5×10 8 Below, 1.2×10 3 Above 1.0×10 10 Below, 1.2×10 3 Above 8.0×10 9 Below, 1.2×10 3 Above 1.0×10 9 Below, 1.2×10 3 Above 9.3×10 8 Below, 1.2×10 3 Above 7.5×10 8 Below, 1.2×10 3 Above 6.5×10 8 Below, 1.3×10 3 Above 1.0×10 10 Below, 1.3×10 3 Above 8.0×10 9 Below, 1.3×10 3 Above 1.0×10 9 Below, 1.3×10 3 Above 9.3×10 8 Below, 1.3×10 3 Above 7.5×10 8 Below, 1.3×10 3 Above 6.5×10 8 Below, 2.0×10 3 Above 1.0×10 10 Below, 2.0×10 3 Above 8.0×10 9 Below, 2.0×10 3 Above 1.0×10 9 Below, 2.0×10 3 Above 9.3×10 8 Below, 2.0×10 3 Above 7.5×10 8 Below, 2.0×10 3 Above 6.5×10 8 Below, 3.0×10 3 Above 1.0×10 10 Below, 3.0×10 3 Above 8.0×10 9 Below, 3.0×10 3 Above 1.0×10 9 Below, 3.0×10 3Above 9.3×10 8 Below, 3.0×10 3 Above 7.5×10 8 Below, 3.0×10 3 Above 6.5×10 8 Below, 5.0×10 3 Above 1.0×10 10 Below, 5.0×10 3 Above 8.0×10 9 Below, 5.0×10 3 Above 1.0×10 9 Below, 5.0×10 3 Above 9.3×10 8 Below, 5.0×10 3 Above 7.5×10 8 Below, 5.0×10 3 Above 6.5×10 8 Below, 1.5×10 4 Above 1.0×10 10 Below, 1.5×10 4 Above 8.0×10 9 Below, 1.5×10 4 Above 1.0×10 9 Below, 1.5×10 4 Above 9.3×10 8 Below, 1.5×10 4 Above 7.5×10 8 Below, 1.5×10 4 Above 6.5×10 8 Below, 5.0×10 4 Above 1.0×10 10 Below, 5.0×10 4 Above 8.0×10 9 Below, 5.0×10 4 Above 1.0×10 9 Below, 5.0×10 4 Above 9.3×10 8 Below, 5.0×10 4 Above 7.5×10 8 Below, 5.0×10 4 Above 6.5×10 8 Below, 1.5×10 5 Above 1.0×10 10 Below, 1.5×10 5 Above 8.0×10 9 Below, 1.5×10 5 Above 1.0×109 Below, 1.5×10 5 Above 9.3×10 8 Below, 1.5×10 5 Above 7.5×10 8 Below, 1.5×10 5 Above 6.5×10 8 Below, 5.0×10 5 Above 1.0×10 10 Below, 5.0×10 5 Above 8.0×10 9 Below, 5.0×10 5 Above 1.0×10 9 Below, 5.0×10 5 Above 9.3×10 8 Below, 5.0×10 5 Above 7.5×10 8 Below, 5.0×10 5 Above 6.5×10 8 Below, 1.2×10 7 Above 1.0×10 10 Below, 1.2×10 7 Above 8.0×10 9 Below, 1.2×10 7 Above 1.0×10 9 Below, 1.2×10 7 Above 9.3×10 8 Below, 1.2×10 7 Above 7.5×10 8 Below, 1.2×10 7 Above 6.5×10 8 Below, 2.5×10 7 Above 1.0×10 10 Below, 2.5×10 7 Above 8.0×10 9 Below, 2.5×10 7 Above 1.0×10 9 Below, 2.5×10 7 Above 9.3×10 8 Below, 2.5×10 7 Above 7.5×10 8 Below, 2.5×10 7 Above 6.5×10 8 Below, 5.0×10 7 Above 1.0×10 10 Below, 5.0×10 7 Above 8.0×10 9Below, 5.0×10 7 Above 1.0×10 9 Below, 5.0×10 7 Above 9.3×10 8 Below, 5.0×10 7 Above 7.5×10 8 Below, 5.0×10 7 Above 6.5×10 8 Below, 1.5×10 8 Above 1.0×10 10 Below, 1.5×10 8 Above 8.0×10 9 Below, 1.5×10 8 Above 1.0×10 9 Below, 1.5×10 8 Above 9.3×10 8 Below, 1.5×10 8 Above 7.5×10 8 Below, 1.5×10 8 Above 6.5×10 8 Below, 4.2×10 8 Above 1.0×10 10 Below, 4.2×10 8 Above 8.0×10 9 Below, 4.2×10 8 Above 1.0×10 9 Below, 4.2×10 8 Above 9.3×10 8 Below, 4.2×10 8 Above 7.5×10 8 Below, 4.2×10 8 Above 6.5×10 8 Below, 6.0×10 8 Above 1.0×10 10 Below, 6.0×10 8 Above 8.0×10 9 Below, 6.0×10 8 Above 1.0×10 9 Below, 6.0×10 8 Above 9.3×10 8 Below, 6.0×10 8 Above 7.5×10 8 Below, 6.0×10 8 Above 6.5×10 8 Below, 7.5×10 8 Above 1.0×10 10 Below, 7.5×108 Above 8.0×10 9 Below, 7.5×10 8 Above 1.0×10 9 Below, 7.5×10 8 Above 9.3×10 8 Below, 7.5×10 8 Above 6.5×10 8 Below, 9.0×10 8 Above 1.0×10 10 Below, 9.0×10 8 Above 8.0×10 9 Below, 9.0×10 8 Above 1.0×10 9 Below, 9.0×10 8 Above 9.3×10 8 Below, 1.5×10 9 Above 1.0×10 10 Below, 1.5×10 9 Above 8.0×10 9 Below, 1.5×10 9 Above 1.0×10 9 Below, 1.5×10 9 Above 9.3×10 8 Below, 5.0×10 9 Above 1.0×10 10 Below, 5.0×10 9 Above 8.0×10 9 Below, 5.6×10 9 Above 1.0×10 10 Below, 5.6×10 9 Above 8.0×10 9 Below, 6.0×10 9 Above 1.0×10 10 Below, 6.0×10 9 Above 8.0×10 9 Below, 6.5×10 9 Above 1.0×10 10 Below, 6.5×10 9 Above 8.0×10 9 Below, 7.0×10 9 Above 1.0×10 10 Below, 7.0×10 9 Above 8.0×10 9 Below, 7.2×10 9 Above 1.0×10 10 Below, 7.2×10 9Above 8.0 x 10 9 Below, 7.5 x 10 9 Above 1.0 x 10 10 Less than or equal to 7.5 x 10 9 Above 8.0 x 10 9 It may contain the following copies:

[0086] In one aspect of this embodiment, the composition may contain 1.1-fold or more, 1.2-fold or more, 1.3-fold or more, 1.4-fold or more, 1.5-fold or more, 10.0-fold or more, 15.0-fold or more, 50.0-fold or more, 100-fold or more, 190-fold or more, 400-fold or more, 670-fold or more, 800-fold or more, 900-fold or more, 1200-fold or more, or 1500-fold or more copies of DNA fragments amplified by the V3 primer set per mg of heat-treated bacteria relative to the copies of DNA fragments amplified by the V3 primer set contained per mg of bacteria of the same strain heat-treated at 120°C for 30 minutes, or may contain 10,000-fold or less, 3,000-fold or less, 2,700-fold or less, 2,000-fold or less, 1,500-fold or less, 1,200-fold or less, or 1,000-fold or less copies. These lower and upper limits may be combined arbitrarily, and in one aspect of this embodiment, the composition contains a DNA fragment amplified by the V3 primer set per 1 mg of heat-treated bacteria at a concentration of, for example, 1.1 to 10,000 times, 1.1 to 3,000 times, 1.1 to 2,700 times, 1.1 to 2,000 times, 1.1 to 1,500 times, 1.1 to 1,200 times, 1.1 to 1,000 times, 1.2 to 10,000 times, 1.2 to 3,000 times, 1.2 to 2,700 times, 1.2 to 2,000 times, 1.2 to 1,500 times, 1.2 to 1,200 times, 1.2 ... 1.3 times to 1000 times, 1.3 times to 10,000 times, 1.3 times to 3,000 times, 1.3 times to 2,700 times, 1.3 times to 2,000 times, 1.3 times to 1,500 times, 1. 3 times or more and 1,200 times or less, 1.3 times or more and 1,000 times or less, 1.4 times or more and 10,000 times or less, 1.4 times or more and 3,000 times or less, 1.4 times or more and 2,700 times or less, 1.4 times or more and 2,000 times or less, 1. 4 times or more and 1,500 times or less, 1.4 times or more and 1,200 times or less, 1.4 times or more and 1,000 times or less, 1.5 times or more and 10,000 times or less, 1.5 times or more and 3,000 times or less, 1.5 times or more and 2,700 times or less, 1. 5 times or more and 2,000 times or less, 1.5 times or more and 1,500 times or less, 1.5 times or more and 1,200 times or less, 1.5 times or more and 1,000 times or less, 10.0 times or more and 10,000 times or less, 10.0 times or more and 3,000 times or less,10.0 times or more but less than 2700 times, 10.0 times or more but less than 2000 times, 10.0 times or more but less than 1500 times, 10.0 times or more but less than 1200 times, 10.0 times or more but less than 1000 times, 15.0 times or more but less than 1000 times, 15.0 times or more but less than 3000 times, 15.0 times or more but less than 2700 times, 15.0 times or more but less than 2000 times, 15.0 times or more but less than 1500 times, 15.0 times or more but less than 1200 times, 15.0 times or more but less than 1000 times, 50.0 times or more but less than 10000 times, 50.0 times or more but less than 3000 times, 50.0 times or more but less than 2700 times, 50.0 times or more but less than 2000 times, 50.0 times or more but less than 2700 times 0.0 times or more but less than 1500 times, 50.0 times or more but less than 1200 times, 50.0 times or more but less than 1000 times, 100 times or more but less than 10000 times, 100 times or more but less than 3000 times, 100 times or more but less than 2700 times, 100 times or more but less than 2000 times, 100 times or more but less than 1500 times, 100 times or more but less than 1200 times, 100 times or more but less than 1000 times, 190 times or more but less than 10000 times, 190 times or more but less than 3000 times, 190 times or more but less than 2700 times, 190 times or more but less than 2000 times, 190 times or more but less than 1500 times, 190 times or more but less than 1200 times, 190 times or more but less than 1000 times, 4 100 times or more but less than 10,000 times, 400 times or more but less than 3,000 times, 400 times or more but less than 2,700 times, 400 times or more but less than 2,000 times, 400 times or more but less than 1,500 times, 400 times or more but less than 1,200 times, 400 times or more but less than 1,000 times, 670 times or more but less than 10,000 times, 670 times or more but less than 3,000 times, 670 times or more but less than 2,700 times, 670 times or more but less than 2,000 times, 670 times or more but less than 1,500 times, 670 times or more but less than 1,200 times, 670 times or more but less than 1,000 times, 800 times or more but less than 10,000 times, 800 times or more but less than 3,000 times, 800 times or more but less than 2,700 times, 800 times or more but less than 1,000 times times but less than 2000 times, 800 times but less than 1500 times, 800 times but less than 1200 times, 800 times but less than 1000 times, 900 times but less than 1000 times, 900 times but less than 3000 times, 900 times but less than 2700 times, 900 times but less than 2000 times, 900 times but less than 1500 times, 900 times but less than 1200 times, 900 times but less than 1000 times, 1200 times but less than 10000 times, 1200 times but less than 3000 times, 1200 times but less than 2700 times, 1200 times but less than 2000 times, 1500 times but less than 10000 times, 1500 times but less than 3000 times,It may be contained at a concentration of 1500 times or more and 2700 times or less, or 1500 times or more and 2000 times or less.

[0087] In one aspect of this embodiment, when the heat-treated bacteria include Lactococcus bacteria, the composition contains a DNA fragment amplified by the V3 primer set in a concentration of, for example, 2.0 × 10 2 Copy or more, 1.0 x 10 3 Copy or more, 1.0 x 10 4 Copy or more, 1.0 x 10 5 Copy or more, 1.0 x 10 6 Copy or more, 2.5 x 10 6 Copy or more, 1.0 x 10 6 Copy or more, 3.5 x 10 7 Copy or more, 7.0 x 10 7 Copy or more, 1.2 x 10 8 Copy or more, 1.8 x 10 8 Copy or more, 4.0 x 10 8 Copy or more, 1.0 x 10 9 Copy or more, 1.1 x 10 9 Copy or more, 1.2 x 10 9 Copy or more, 1.3 x 10 9 Copy or more, 1.4 x 10 9 Copy or more or 1.5 x 10 9 It may contain more than 1.6 x 10 copies. 9 Copy and below, 1.1 x 10 9 Copy and below, 7.0 x 10 8 Copy and below, 4.0 x 10 8 Copy or less 2.0 x 10 8 Copy or less or 1.4 x 10 8 The content may be 100 copies or less, and these lower and upper limits may be arbitrarily combined.

[0088] In one aspect of this embodiment, when the heat-treated bacteria include bacteria of the genus Lactococcus, the composition contains a DNA fragment amplified by the V3 primer set at, for example, 1.0 × 10 per mg of bacteria of the genus Lactococcus. 5 Copy or more, 5.0 x 10 5 Copy or more, 5.0 x 10 6 Copy or more, 5.0 x 10 7 Copy or more, 5.0 x 108 Copy or more, 1.2 x 10 9 Copy or more, 5.0 x 10 8 Copy or more, 1.7 x 10 10 Copy or more, 3.5 x 10 10 Copy or more, 6.0 x 10 10 Copy or more, 9.0 x 10 10 Copy or more, 2.0 x 10 11 Copy or more, 5.0 x 10 11 Copy or more, 5.6 x 10 11 Copy or more, 6.0 x 10 11 Copy or more, 6.5 x 10 11 Copy or more, 7.0 x 10 11 Copy or more or 7.5 x 10 11 It may contain more than 8.0 x 10 copies. 11 Copy and below, 5.5 x 10 11 Copy and below, 3.5 x 10 11 Copy and below, 2.0 x 10 11 Copy below 1.0 x 10 11 Copy or less or 7.0 x 10 10 The content may be 100 copies or less, and these lower and upper limits may be arbitrarily combined.

[0089] In one aspect of this embodiment, when the heat-treated bacteria include Lactococcus bacteria, the composition contains a DNA fragment amplified by the V3 primer set at, for example, 1.0 × 10 per mL of the composition. 3 Copy or more, 5.0 x 10 3 Copy or more, 5.0 x 10 4 Copy or more, 5.0 x 10 5 Copy or more, 5.0 x 10 6 Copy or more, 1.2 x 10 7 Copy or more, 5.0 x 10 6 Copy or more, 1.7 x 10 8 Copy or more, 3.5 x 10 8 Copy or more, 6.0 x 10 8 Copy or more, 9.0 x 10 8 Copy or more, 2.0 x 10 9 Copy or more, 5.0 x 10 9 Copy or more, 5.6 x 10 9 Copy or more, 6.0 x 109 Copy or more, 6.5 x 10 9 Copy or more, 7.0 x 10 9 Copy or more or 7.5 x 10 9 It may contain more than 8.0 x 10 copies. 9 Copy and below, 5.5 x 10 9 Copy and below, 3.5 x 10 9 Copy and below, 2.0 x 10 9 Copy below 1.0 x 10 9 Copy or less or 7.0 x 10 8 The content may be 100 copies or less, and these lower and upper limits may be arbitrarily combined.

[0090] In one aspect of this embodiment, when the heat-treated bacteria include Weissella sp., the composition contains a DNA fragment amplified by the V3 primer set in a volume of, for example, 2.5 × 10 2 Copy or more, 4.0 x 10 2 Copy or more, 5.0 x 10 2 Copy or more or 6.0 x 10 2 It may contain more than 6.0 x 10 copies. 5 Copy and below, 4.0 x 10 5 Copy and below, 2.2 x 10 5 Copy and below, 1.0 x 10 5 Copy and below, 6.0 x 10 4 Copy or less or 3.0 x 10 4 The content may be 100 copies or less, and these lower and upper limits may be arbitrarily combined.

[0091] In one aspect of this embodiment, when the heat-treated bacteria include bacteria of the genus Weissella, the composition contains a DNA fragment amplified by the V3 primer set at, for example, 1.2 × 10 per mg of bacteria of the genus Weissella. 5 Copy or more, 2.0 x 10 5 Copy or more, 2.5 x 10 5 Copy or more or 3.0 x 10 5 It may contain more than 3.0 x 10 copies. 8 Copy and below, 2.0 x 10 8 Copy and below, 1.1 x 10 8 Copy and below, 5.0 x 10 7 Copy and below, 3.0 x 107 Copy or less or 1.5 x 10 7 The content may be 100 copies or less, and these lower and upper limits may be arbitrarily combined.

[0092] In one aspect of this embodiment, when the heat-treated bacteria include bacteria of the genus Weissella, the composition contains a DNA fragment amplified by the V3 primer set at, for example, 1.2 × 10 per mL of the composition. 3 Copy or more, 2.0 x 10 3 Copy or more, 2.5 x 10 3 Copy or more or 3.0 x 10 3 It may contain more than 3.0 x 10 copies. 6 Copy and below, 2.0 x 10 6 Copy and below, 1.1 x 10 6 Copy and below, 5.0 x 10 5 Copy and below, 3.0 x 10 5 Copy or less or 1.5 x 10 5 The content may be 100 copies or less, and these lower and upper limits may be arbitrarily combined.

[0093] In one aspect of this embodiment, when the heat-treated bacteria include Bifidobacterium, the composition contains, for example, 1.5 × 10 2 Copy or more, 2.0 x 10 2 Copy or more, 2.5 x 10 2 Copy or more, 3.0 x 10 2 Copy or more, 1.0 x 10 3 Copy or more, 3.0 x 10 3 Copy or more, 1.0 x 10 4 Copy or more or 1.5 x 10 4 It may contain more than 2.0 x 10 copies. 6 Copy and below, 1.1 x 10 6 Copy and below, 8.0 x 10 5 Copy and below, 6.0 x 10 5 Copy or less or 4.5 x 10 5 The lower limit and upper limit may be arbitrarily combined.

[0094] In one aspect of this embodiment, when the heat-treated bacteria include bacteria of the genus Bifidobacterium, the composition contains a DNA fragment amplified by the V3 primer set at, for example, 7.5 × 10 per mg of bacteria of the genus Bifidobacterium. 4 Copy or more, 1.0 x 10 5 Copy or more, 1.2 x 10 5 Copy or more, 1.5 x 10 5 Copy or more, 5.0 x 10 5 Copy or more, 1.5 x 10 6 Copy or more, 5.0 x 10 6 Copy or more or 7.5 x 10 6 It may contain more than 1.0 x 10 copies. 9 Copy and below, 5.5 x 10 8 Copy and below, 4.0 x 10 8 Copy and below, 3.0 x 10 8 Copy or less or 2.3 x 10 8 The lower limit and upper limit may be arbitrarily combined.

[0095] In one aspect of this embodiment, when the heat-treated bacteria include bacteria of the genus Bifidobacterium, the composition contains a DNA fragment amplified by the V3 primer set at, for example, 7.5 × 10 per mL of the composition. 2 Copy or more, 1.0 x 10 3 Copy or more, 1.2 x 10 3 Copy or more, 1.5 x 10 3 Copy or more, 5.0 x 10 3 Copy or more, 1.5 x 10 4 Copy or more, 5.0 x 10 4 Copy or more or 7.5 x 10 4 It may contain more than 1.0 x 10 copies. 7 Copy and below, 5.5 x 10 6 Copy and below, 4.0 x 10 6 Copy and below, 3.0 x 10 6 Copy or less or 2.3 x 10 6 The lower limit and upper limit may be arbitrarily combined.

[0096] In one aspect of this embodiment, when the heat-treated bacteria include Lactobacillus bacteria, the composition contains a DNA fragment amplified by the V3 primer set in a volume of, for example, 3.0 × 10 2 Copy or more, 4.0 x 10 2 Copy or more, 5.0 x 10 2 Copy or more, 5.9 x 10 2 Copy or more, 6.0 x 10 2 Copy or more, 1.0 x 10 3 Copy or more, 2.5 x 10 3 Copy or more, 5.0 x 10 3 Copy or more, 1.0 x 10 4 Copy or more, 3.0 x 10 4 Copy or more, 1.0 x 10 5 Copy or more, 3.0 x 10 5 Copy or more, 1.0 x 10 6 Copy or more, 3.0 x 10 6 Copy or more or 1.0 x 10 7 It may contain more than 2.0 x 10 copies. 7 Copy and below, 1.5 x 10 7 Copy and below, 1.1 x 10 7 Copy and below, 8.0 x 10 6 Copy and below, 2.0 x 10 6 Copy and below, 6.0 x 10 5 Copy or less or 3.2 x 10 5 The lower limit and upper limit may be arbitrarily combined.

[0097] In one aspect of this embodiment, when the heat-treated bacteria include bacteria of the genus Lactobacillus, the composition contains a DNA fragment amplified by the V3 primer set at, for example, 1.5 × 10 per mg of bacteria of the genus Lactobacillus. 5 Copy or more, 2.0 x 10 5 Copy or more, 2.5 x 10 5 Copy or more, 2.9 x 10 5 Copy or more, 3.0 x 10 5 Copy or more, 5.0 x 10 5 Copy or more, 1.2 x 10 6 Copy or more, 2.5 x 10 6 Copy or more, 5.0 x 10 6Copy or more, 1.5 x 10 7 Copy or more, 5.0 x 10 7 Copy or more, 1.5 x 10 8 Copy or more, 5.0 x 10 8 Copy or more, 1.5 x 10 9 Copy or more or 5.0 x 10 9 It may contain more than 1.0 x 10 copies. 10 Copy and below, 7.5 x 10 9 Copy and below, 5.5 x 10 9 Copy and below, 4.0 x 10 9 Copy and below, 1.0 x 10 9 Copy and below, 3.0 x 10 8 Copy or less or 1.6 x 10 8 The lower limit and upper limit may be arbitrarily combined.

[0098] In one aspect of this embodiment, when the heat-treated bacteria include Lactobacillus bacteria, the composition contains a DNA fragment amplified by the V3 primer set at, for example, 1.5 × 10 per mL of the composition. 3 Copy or more, 2.0 x 10 3 Copy or more, 2.5 x 10 3 Copy or more, 2.9 x 10 3 Copy or more, 3.0 x 10 3 Copy or more, 5.0 x 10 3 Copy or more, 1.2 x 10 4 Copy or more, 2.5 x 10 4 Copy or more, 5.0 x 10 4 Copy or more, 1.5 x 10 5 Copy or more, 5.0 x 10 5 Copy or more, 1.5 x 10 6 Copy or more, 5.0 x 10 6 Copy or more, 1.5 x 10 7 Copy or more or 5.0 x 10 7 It may contain more than 1.0 x 10 copies. 8 Copy and below, 7.5 x 10 7 Copy and below, 5.5 x 10 7 Copy and below, 4.0 x 10 7 Copy and below, 1.0 x 10 7 Copy and below, 3.0 x 106 Copy or less or 1.6 x 10 6 The lower limit and upper limit may be arbitrarily combined.

[0099] The food composition, pharmaceutical composition, bacterial bulk powder, or feed of this embodiment may be ingested or administered only once or multiple times, and if sustained immunostimulation is desired, it is preferably ingested or administered continuously or intermittently over a certain period of time. The food composition of one embodiment may be ingested, for example, for one week or more, two weeks or more, one month or more, three months or more, six months or more, one year or more, three years or more, five years or more, or ten years or more, at a frequency of 1 to 5 times a day, once every two days, once every three days, once every four days, or once a week.

[0100] The food composition, pharmaceutical composition, bacterial bulk powder, or feed of this embodiment may contain the bacterium of this embodiment as an active ingredient. The food composition, pharmaceutical composition, bacterial bulk powder, or feed of this embodiment may contain an effective amount of the bacterium of this embodiment.

[0101] The food composition, pharmaceutical composition, bacterial bulk powder, or feed of this embodiment can be ingested or administered to a subject in need of immunostimulation. The subject in need of immunostimulation is not particularly limited, but examples thereof include subjects infected with a virus, subjects suffering from a cold, and subjects aged 65 or over.

[0102] Examples of food compositions of this embodiment include immunostimulating health foods, functional foods, nutritional compositions, dietary supplements, supplements, health foods, foods for specified health uses, foods with nutrient functions, and foods with functional claims. Such food compositions can be labeled, for example, as those that support the maintenance of immune function in healthy people (immune care), those concerned about a decline in immune function, those that suppress a decline in immune function, those concerned about sunburn, those concerned about skin damage in daily life, those concerned about dry skin, those concerned about hot flashes, those concerned about erythema, those concerned about redness of the skin, those concerned about rosy faces, and those concerned about rough hands.

[0103] The food composition of this embodiment may be in any form, such as solid, semi-solid, liquid, paste, jelly, etc. Examples of food compositions include, but are not limited to, beverages such as lactic acid bacteria drinks, yogurt drinks, carbonated drinks, coffee, juice, tea drinks, and dairy drinks; alcoholic beverages such as beer, sake, Western liquor, and fruit wine; confectioneries such as chocolate, donuts, pies, cream puffs, gum, jelly, candy, cookies, cakes, puddings, daifuku (rice cakes), mochi (rice cakes), manju (buns), castella cakes, anmitsu (sweet bean paste), and yokan (sweet bean jelly); frozen desserts such as ice cream, popsicles, and sorbet; cooked foods such as retort pouch foods; seasonings such as dressings, mayonnaise, furikake (rice seasonings), umami seasonings, and soup bases; and fermented milk (yogurt). In the case of a food composition being a nutritional supplement or a supplement, the food composition may be in the form of, for example, a tablet (including plain tablets, sugar-coated tablets, effervescent tablets, film-coated tablets, chewable tablets, troches, etc.), a capsule, a pill, a powder (dispersed medicine), fine granules, granules, a liquid, a suspension, an emulsion, a syrup, a paste, or the like.

[0104] In addition to the bacteria of this embodiment, the food composition of this embodiment may contain other food-acceptable ingredients, such as at least one selected from the group consisting of sugars, proteins, lipids, amino acids, vitamins, minerals, flavonoids, quinones, polyphenols, nucleic acids, fatty acids, acidulants, sweeteners, colorings, flavorings, seasonings, salt, emulsifiers, stabilizers, cooling agents, binders, disintegrants, lubricants, colorings, preservatives, sustained-release regulators, surfactants, solubilizers, humectants, and water quality conditioners. One aspect of the food composition can be produced using the bacteria of this embodiment as a raw material according to a method typically selected by those skilled in the art depending on the form of the food composition. For example, a food composition can be obtained by mixing an effective amount of the bacteria of this embodiment with an intermediate product or a final product during the production process. The bacteria of this embodiment may be obtained according to the production method of the second embodiment described below. Furthermore, the food composition of this embodiment also includes bacteria produced during the production process of the food composition.

[0105] The pharmaceutical composition of this embodiment can be formulated as an oral or parenteral preparation and provided as a pharmaceutical or quasi-drug. Oral preparations include granules, powders, tablets (including sugar-coated tablets), pills, capsules, syrups, liquids, jellies, emulsions, and suspensions. Parenteral preparations include injections suitable for local administration (including intradermal, subcutaneous, intramuscular, and intravenous injections), inhalants (e.g., inhalation aerosols, inhalation powders, and inhalation liquids), nasal drops (e.g., nasal powders and nasal liquids), ointments, creams, gels, suppositories, patches, and poultices. These preparations can be formulated using the bacteria of this embodiment and a pharmaceutically acceptable carrier using techniques commonly used in the art. Pharmaceutically acceptable carriers include excipients, binders, diluents, additives, flavorings, buffers, thickeners, colorants, stabilizers, emulsifiers, dispersants, suspending agents, and preservatives. The bacteria according to this embodiment can be obtained according to the manufacturing method of the second embodiment described below, and the pharmaceutical composition of this embodiment also includes bacteria according to this embodiment produced during the manufacturing process of the pharmaceutical composition.

[0106] Examples of diseases for which the pharmaceutical composition of this embodiment can be administered include cancers already known to be treated with type I interferon, including renal cancer, multiple myeloma, chronic myeloid leukemia, hairy cell leukemia, glioblastoma, medulloblastoma, astrocytoma, malignant melanoma, mycosis fungoides, and adult T-cell leukemia; viral infections including subacute sclerosing panencephalitis, HTLV-1 myelopathy, hepatitis B, and hepatitis C; bacterial infections such as chlamydia (sexually transmitted diseases), mycobacterium (tuberculosis), listeria (sepsis, etc.), staphylococcus (food poisoning), and helicobacter (gastritis); and autoimmune diseases including multiple sclerosis. The composition of this embodiment can be used to prevent or treat the above-mentioned diseases. Furthermore, because type I interferon is known to have the function of inhibiting differentiation of osteoblasts into osteoclasts, the composition of the present invention can also be used to prevent or treat osteoporosis and the like.

[0107] The bacterial cell bulk powder of this embodiment may be obtained by sterilizing and drying the bacterial cells themselves, obtained by separating the culture medium from a culture of the bacterium of this embodiment, according to the manufacturing method of Embodiment 2. Alternatively, the bacterial cell bulk powder of this embodiment may be obtained by sterilizing and drying a culture containing the bacterial cells of the bacterium of this embodiment according to the manufacturing method of Embodiment 2.

[0108] The bacterial bulk powder of this embodiment may contain components acceptable for use as food, medicine, or feed, in addition to the bacteria of this embodiment and components derived from the medium used to culture the bacteria, and may further contain at least one component selected from the group consisting of, for example, sugars, proteins, lipids, amino acids, vitamins, minerals, flavonoids, quinones, polyphenols, nucleic acids, fatty acids, acidulants, sweeteners, colorings, fragrances, seasonings, salt, emulsifiers, stabilizers, cooling agents, binders, disintegrants, lubricants, colorings, preservatives, sustained-release regulators, surfactants, and solubilizers.

[0109] The bacterial bulk powder of this embodiment can be used as a raw material for the food composition, pharmaceutical composition, or feed of this embodiment.

[0110] In addition, in the first embodiment of the present invention, the aspect in which the composition is an immunostimulatory composition can also be said to be, in another aspect, a method for stimulating the immunity of a subject, comprising having a subject ingest or administering to a subject the composition according to one aspect of the first embodiment. The subject to which the composition is ingested or administered may be a subject in need thereof, such as a subject in need of the above-mentioned immunostimulation.

[0111] Furthermore, in the first embodiment of the present invention, the aspect in which the composition is an immunostimulatory composition can also be said to be, in another aspect, use of the composition according to one aspect of the first embodiment in stimulating the immunity of a subject. In this case, the use may be non-therapeutic use and / or therapeutic use, and is preferably non-therapeutic use.

[0112] In the present disclosure, "therapeutic" use refers to use in treating the human or animal body. A therapeutic use according to the present disclosure may be, for example, a use for the purpose of or in conjunction with medical treatment. A therapeutic use according to the present disclosure may involve, for example, a medical professional administering or ingesting a substance to a human or animal, or instructing a human or animal to administer or ingest a substance. A therapeutic use according to the present disclosure may be, for example, a use for therapeutic purposes or a preventative purpose, or may be a preventative use involving the ingestion of a food composition, or may be a therapeutic purpose. A therapeutic use according to the present disclosure may be, for example, a use on an unhealthy individual.

[0113] In the present disclosure, "non-therapeutic" use refers to use of a substance that does not fall under therapeutic use. Non-therapeutic use according to the present disclosure may, for example, be use that is not intended for and / or does not involve medical treatment. Non-therapeutic use according to the present disclosure may not, for example, involve a medical professional administering or having a human or animal ingest the substance and / or instructing a human or animal to administer or ingest the substance. Non-therapeutic use according to the present disclosure may, for example, be use for preventive or health promotion purposes, and may be use for preventive or health promotion purposes involving the administration or ingestion of a pharmaceutical composition or quasi-drug. Non-therapeutic use according to the present disclosure may, for example, be use in healthy individuals.

[0114] Furthermore, in the first embodiment of the present invention, the aspect in which the composition is an immunostimulatory composition can also be said to be, in another aspect, a composition according to one aspect of the first embodiment for use in stimulating the immunity of a subject. In this case, the use is, for example, therapeutic use.

[0115] Furthermore, in the first embodiment of the present invention, the aspect in which the composition is an immunostimulatory composition can also be said to be, as another aspect, the use of the above-mentioned bacterium in the production of a composition relating to one aspect of the first embodiment.

[0116] A second embodiment of the present invention is a method for producing a composition containing bacteria having immunostimulatory activity, the method comprising a heating step of heating the bacteria at a temperature within a predetermined range. One aspect of the second embodiment of the present invention may also be a method for producing a composition according to one aspect of the first embodiment of the present invention. Furthermore, the heat-treated composition containing bacteria according to one aspect of the first embodiment of the present invention may be a composition containing bacteria produced according to the method according to one aspect of the second embodiment of the present invention. Furthermore, the production method according to one aspect of the second embodiment of the present invention can also provide a composition containing bacteria according to one aspect of the first embodiment of the present invention, wherein the DIN is within a predetermined range, and / or the DIN is a multiplier within a predetermined range relative to the DIN of live bacteria, and / or the Cp value is a multiplier within a predetermined range relative to the Cp value of live bacteria, and / or the proportion of the area occupied by DNA of 250 to 60,000 bp in a DNA histogram is within a predetermined range, and / or the composition contains a predetermined number of copies or more of a DNA fragment amplified by a predetermined primer set.

[0117] The biological classification and strain of bacteria that can be used as a raw material in the production method of the second embodiment of the present invention are the same as those of the "bacteria according to this embodiment" described in the first embodiment of the present invention. For example, the bacteria used as a raw material may be lactic acid bacteria and / or acetic acid bacteria. Furthermore, the bacteria used as a raw material in the production method of the second embodiment of the present invention may primarily contain live bacteria, and may contain, for example, 80% or more, 85% or more, 90% or more, or 95% or more live bacteria, and may also contain a small amount of dead bacteria (e.g., 20% or less, 15% or less, 10% or less, 5% or less, 3% or less, or 1% or less).

[0118] Furthermore, the immunostimulatory ability of the composition containing the bacteria having immunostimulatory ability produced by the production method of the second embodiment of the present invention is the same as the immunostimulatory ability described in the first embodiment of the present invention. For example, the immunostimulatory ability of the composition containing the bacteria having immunostimulatory ability may include the ability to activate dendritic cells. Furthermore, the dendritic cell activation ability of the composition containing the bacteria having dendritic cell activation ability may include the ability to promote IFN-α production.

[0119] In the heating step, the bacteria may be heated as is, in powder form, or in the form of a bacterial suspension. Heating in the heating step can be carried out using a temperature-setting heating device commonly used by those skilled in the art, such as a plate sterilizer, a tubular sterilizer, a direct heating sterilizer, a jacketed tank, or an autoclave. The bacterial powder may be, for example, a powder obtained by dry spraying at a temperature at which the bacteria will not be killed. The temperature at which the bacteria will not be killed may vary depending on the bacteria, but may be, for example, a temperature of 90°C or less, 80°C or less, 70°C or less, 60°C or less, or 50°C or less.

[0120] When bacteria in a suspension state are heated in the heating step, the concentration of bacteria in the suspension is not particularly limited and may be, for example, 0.001% to 10.0% by volume or 0.01% to 1.0% by volume. The cell suspension may be a bacterial suspension obtained by suspending bacteria in, for example, a culture medium, a buffer solution, or a mixture thereof. The culture medium may be a culture medium commonly used by those skilled in the art for bacterial culture, such as MRS medium. The buffer solution may be a buffer solution commonly used by those skilled in the art for cell experiments, such as phosphate-buffered saline (PBS) or Hank's balanced salt solution (HBSS). The liquid component of the suspension may include components that may be contained in culture media commonly used by those skilled in the art for bacterial culture and buffer solutions commonly used by those skilled in the art for cell experiments, such as at least one selected from the group consisting of sugars, peptone, beef extract, yeast extract, metal ions, buffers, osmotic pressure adjusters, pH adjusters, amino acids, vitamins, antioxidants, and surfactants.

[0121] In the heating step, the bacteria are heated at a temperature within a predetermined range. The heating temperature may be 60°C or higher, 65°C or higher, 70°C or higher, or 75°C or higher, and may be 110°C or lower, 100°C or lower, 90°C or lower, 85°C or lower, or 80°C or lower. These lower and upper limits can be arbitrarily combined. For example, the heating temperature may be 60°C or higher and 110°C or lower, 60°C or higher and 100°C or lower, 60°C or higher and 90°C or lower, 60°C or higher and 85°C or lower, 60°C or higher and 80°C or lower, 65°C or higher and 100°C or lower, 65°C or higher and 90°C or lower, 65°C or higher and 85°C or lower, 65°C or higher and 80°C or lower, 70°C or higher and 90°C or lower, 70°C or higher and 85°C or lower, 70°C or higher and 80°C or lower, 75°C or higher and 90°C or lower, or 75°C or higher and 85°C or lower.

[0122] The heating time in the heating step is not particularly limited, but may be, for example, 1 minute or more, 3 minutes or more, 5 minutes or more, or 10 minutes or more, and may be 24 hours or less, 4 hours or less, 60 minutes or less, 45 minutes or less, or 30 minutes or less. These lower and upper limits can be combined arbitrarily, and for example, the heat treatment time may be 1 minute or more and 24 hours or less, 3 minutes or more and 4 hours or less, or 5 minutes or more and 60 minutes or less.

[0123] In one embodiment of the manufacturing method, the product of the heating temperature (°C) and the heating time (minutes) in the heating step may be within a predetermined range. In one embodiment of the manufacturing method, the product of the heating temperature (°C) and the heating time (minutes) in the heating step may be within a predetermined range, and the temperature may be within the above-mentioned predetermined range. For example, in one embodiment of the manufacturing method, the product of the heating temperature (°C) and the heating time (minutes) in the heating step may be 150 or more, 300 or more, 500 or more, 800 or more, 1200 or more, 1500 or more, 1800 or more, or 2000 or more, or may be 30,000 or less, 20,000 or less, 15,000 or less, 10,000 or less, 7,000 or less, 5,000 or less, 4,000 or less, 3,500 or less, 3,000 or less, 2,700 or less, or 2,500 or less. These lower and upper limits may be combined arbitrarily, and the product of the heating temperature (°C) and time (minutes) in the heating step of one embodiment of the production method may be, for example, 150 to 30,000, 150 to 20,000, 150 to 15,000, 150 to 10,000, 150 to 7,000, 150 to 5,000, 150 to 4,000, 150 to 3,500, 150 to 3,000, or 150 to 3,000. 00 or less, 150 or more and 2,700 or less, 150 or more and 2,500 or less, 300 or more and 30,000 or less, 300 or more and 20,000 or less, 300 or more and 15,000 or less, 300 or more and 10,000 or less, 300 or more 7,000 or less, 300 to 5,000, 300 to 4,000, 300 to 3,500, 300 to 3,000, 300 to 2,700, 300 to 2,500, 500 to 300 00 or less, 500 to 20,000, 500 to 15,000, 500 to 10,000, 500 to 7,000, 500 to 5,000, 500 to 4,000, 500 to 3 500 or less, 500 to 3,000, 500 to 2,700, 500 to 2,500, 800 to 30,000, 800 to 20,000, 800 to 15,000, 800 to 1 0,000 or less, 800 or more and 7,000 or less, 800 or more and 5,000 or less, 800 or more and 4,000 or less, 800 or more and 3,500 or less, 800 or more and 3,000 or less, 800 or more and 2,700 or less, 800 or more and 25 00 or less, 1,200 or more and 30,000 or less, 1,200 or more and 20,000 or less, 1,200 or more and 15,000 or less, 1,200 or more and 10,000 or less, 1,200 or more and 7,000 or less, 1,200 or more and 5,000 or less,1,200 to 4,000, 1,200 to 3,500, 1,200 to 3,000, 1,200 to 2,700, 1,200 to 2,500, 1,500 to 30,000, 1,500 to 20,000, 1,500 to 15,000, 1,500 to 10,000, 1,500 to 7 000 or less, 1,500 to 5,000, 1,500 to 4,000, 1,500 to 3,500, 1,500 to 3,000, 1,500 to 2,700, 1,500 to 2,500, 1,800 to 30,000, 1,800 to 20,000, 1,800 to 15,000, 18 00 or more and 10,000 or less, 1,800 or more and 7,000 or less, 1,800 or more and 5,000 or less, 1,800 or more and 4,000 or less, 1,800 or more and 3,500 or less, 1,800 or more and 3,000 or less, 1,800 or more and 2,700 or less, 1,800 or more and 2,500 or less, 2,000 or more and 30,000 or less, 2,000 or more and 20,000 or less, 2,000 or more and 15,000 or less, 2,000 or more and 10,000 or less, 2,000 or more and 7,000 or less, 2,000 or more and 5,000 or less, 2,000 or more and 4,000 or less, 2,000 or more and 3,500 or less, 2,000 or more and 3,000 or less, 2,000 or more and 2,700 or less, or 2,000 or more and 2,500 or less.

[0124] In one embodiment of the production method, the bacteria after the heating step have improved immunostimulatory ability compared to the bacteria before the heating step. For example, in one embodiment of the production method, the immunostimulatory ability of the bacteria after the heating step may be 1.10-fold or more, 1.50-fold or more, 1.70-fold or more, 1.90-fold or more, 2.00-fold or more, 2.50-fold or more, 3.00-fold or more, 3.50-fold or more, 4.00-fold or more, 4.25-fold or more, or 4.26-fold or more, or may be 10.0-fold or less, or 5.00-fold or less, relative to the immunostimulatory ability of the bacteria before the heating step. Furthermore, the improved immunostimulatory ability may be the ability to activate dendritic cells or the ability to promote IFN-α production. The immunostimulatory ability may be evaluated, for example, by the amount of IFN-α produced by dendritic cells when the bacteria are exposed to dendritic cells. As a more detailed example, it may be evaluated according to the method described in the Examples. Thus, in one aspect, the production method according to the second embodiment of the present invention can also be a method for improving the immunostimulatory ability of bacteria, which includes a heating step of heating the bacteria at a temperature within a predetermined range.

[0125] One embodiment of the production method may include a step of culturing bacteria (culturing step) prior to the heating step. The medium used in the culturing step may be a medium that a person skilled in the art would use for culturing bacteria, preferably MRS medium. The culturing time in the culturing step may be a time sufficient to increase the bacteria to a desired number, and may be, for example, 1 hour or more, 3 hours or more, 6 hours or more, or 12 hours or more, and may be 336 hours or less, 168 hours or less, 72 hours or less, or 48 hours or less, for example, 24 hours. The culturing temperature in the culturing step is less than 60°C. Within this range, the temperature may be 20°C or more, 22°C or more, 25°C or more, or 30°C or more, and may be 45°C or less, 40°C or less, 38°C or less, 35°C or less, or 30°C or less, for example, 30°C.

[0126] One embodiment of the production method may include a step of washing the bacteria after the culturing step and before the heating step. The washing method in the washing step is not particularly limited, but in a preferred embodiment, washing by centrifugation (centrifugal washing) may be used. In centrifugal washing, the culture medium after the culturing step is centrifuged to precipitate the bacteria, and then a portion or all of the supernatant may be removed. Instead, a washing solution may be added, for example, in an amount equal to the amount of the removed supernatant. The bacteria are then washed by repeating the centrifugation, removal of a portion or all of the supernatant, and addition of a washing solution. The washing solution may be one that is typically used to wash bacteria, such as a buffer solution such as PBS. The number of washes (i.e., the number of centrifugations) in the washing step is not particularly limited and may be, for example, 1, 2, 3, 4, or 5 times. The centrifugation speed may be the same as that typically used to precipitate bacteria, and may be, for example, 1,000 to 10,000 rpm, e.g., 5,000 rpm.

[0127] The production method of one embodiment may further include a step of drying the heated bacteria after the heating step. The drying step may be, for example, spray drying. The spray drying method is not particularly limited and may be performed using a spray dryer as described above. The drying step may be, for example, freeze drying.

[0128] The production method of one embodiment does not need to include exposing the bacteria to a temperature exceeding a predetermined temperature. The predetermined temperature may be 130°C, 120°C, 115°C, 110°C, 105°C, 100°C, 95°C, 90°C, or 89°C. When the production method of one embodiment does not include exposing the bacteria to a temperature exceeding the predetermined temperature, the produced bacteria will have a higher immunostimulatory ability (e.g., the ability to activate dendritic cells, the ability to promote IFN-α production, etc.) than bacteria produced by a production method that includes exposing the bacteria to a temperature exceeding the predetermined temperature.

[0129] Compositions produced by the production method of one embodiment include food compositions, pharmaceutical compositions, bacterial bulk powders, and feeds.

[0130] When the composition produced by one embodiment of the production method is a bacterial bulk powder, the bacterial culture, or the bacterial cells themselves obtained by separating the culture medium from the bacterial culture, can be sterilized and dried as described above to obtain the bacterial bulk powder.

[0131] When the composition produced by one embodiment of the production method is a bacterial bulk powder, the production process of the bacterial bulk powder may include a step of adding components acceptable for use as food, pharmaceuticals, or feed, in addition to the bacteria and components derived from the culture medium used to culture the bacteria. For example, the process may include a step of further adding at least one selected from the group consisting of sugars, proteins, lipids, amino acids, vitamins, minerals, flavonoids, quinones, polyphenols, nucleic acids, fatty acids, acidulants, sweeteners, coloring agents, fragrances, seasonings, salt, emulsifiers, stabilizers, cooling agents, binders, disintegrants, lubricants, coloring agents, preservatives, sustained-release regulators, surfactants, and solubilizers.

[0132] When the composition produced by one embodiment of the production method is a food composition, examples of the food composition include, but are not limited to, the above-mentioned lactic acid bacteria drinks, yogurt drinks, coffee, juice, tea drinks, dairy drinks, fermented milk, etc. When the composition produced by one embodiment of the production method is a food composition, the bacteria contained in the food composition may be a bacterial bulk powder obtained through the above-mentioned culturing step, heating step, drying step, etc., or may be a bacterium obtained through the above-mentioned culturing step, heating step, drying step, etc. in the production process of the food composition.

[0133] When the composition produced by the production method of one embodiment is a pharmaceutical composition, examples of the pharmaceutical composition include, but are not limited to, the oral or parenteral forms described above. When the composition produced by the production method of one embodiment is a pharmaceutical composition, the bacteria contained in the pharmaceutical composition may be a bacterial bulk powder obtained through the culturing step, heating step, drying step, or the like described above, or may be a bacterium obtained through the culturing step, heating step, drying step, or the like in the production process of the pharmaceutical composition.

[0134] When the composition produced by one embodiment of the production method is a feed, the bacteria contained in the feed may be a bacterial bulk powder obtained through the above-mentioned culturing step, heating step, drying step, etc., to which has been added, or may be a bacterial bulk powder obtained through the above-mentioned culturing step, heating step, drying step, etc., in the production process of the feed.

[0135] The present invention will be described in more detail below using examples, but the present invention is not limited to the following examples.

[0136] In this example, the bacterium used was Lactococcus lactis subsp. lactis JCM5805. Hereinafter, this strain will also be referred to as "LC-Plasma." The LC-Plasma used in this example is manufactured by Kirin Holdings Co., Ltd.

[0137] Example 1: Effect of heating temperature on the immunostimulatory activity of LC-Plasma In a 150 ml storage bottle (CORNING), 100 mL of MRS medium (MRS BROTH, CM0359, Oxoid) was inoculated (seeded) with LC-Plasma to a concentration of 0.1% (v / v), and cultured in an incubator (Tokyo Rikakikai Co., Ltd.) at 30°C for 24 hours (static culture). After static culture, the culture solution was concentrated by centrifugation (5000 rpm), and the supernatant was removed to obtain a bacterial solution. Subsequently, the obtained bacterial solution was mixed with milliQ at a ratio of 1:19, and the mixture was washed twice by centrifugation (5000 rpm).

[0138] The washed LC-Plasma was suspended in 20 mL of milliQ and heated in an autoclave at 60°C, 70°C, 80°C, 90°C, 100°C, 110°C, 120°C, or 130°C for 30 minutes to obtain a heat-treated bacterial sample. As a control, a bacterial sample that was not heat-treated was also prepared. These bacterial samples were dried by lyophilization to obtain a bacterial powder.

[0139] The test was carried out according to the following procedures (i) to (iv): (i) Bone marrow cells derived from female BALB / c mice were placed in RPMI medium (Sigma) prepared to the following composition at a concentration of 1 x 10 6 [Culture composition] 10% by volume FBS 100 U / mL penicillin / streptomycin 1 mM sodium pyruvate 2.5 mM HEPES 1% MEM non-essential amino acid solution (x100) (Gibco, REF: 11140-050) 50 μM β-mercaptoethanol 100 ng / mL Flt-3L (ii) 1 mL of the prepared cell suspension was seeded and incubated for 2 hours at 25°C. 2 Incubated at 37°C and 5% CO 2 (iii) The bone marrow cells containing the induced pDCs were cultured for 1 week under the conditions of (iii) and (iii) at a concentration of 2 × 10 5The cells were suspended at a concentration of 100 cells / mL and 200 μL of each aliquot was seeded onto a 96-well plate (Corning), bacterial powder was added to a final concentration of 2 μg / well, and the mixture was incubated at 37° C. for 24 hours. (iv) After 24 hours, the culture supernatant was collected and the IFN-α concentration was measured using an IFN-α measurement kit (PBL Assay Science Ltd.) according to the protocol described in the kit's instructions.

[0140] FIG. 1 shows the results of measuring the amount of IFN-α. The results in FIG. 1 are shown as mean values ​​± standard deviations. As shown in FIG. 1, the amount of IFN-α produced by dendritic cells exposed to bacteria heat-treated at 60 to 110°C was significantly increased compared to exposure to bacteria that had not been heat-treated. On the other hand, in dendritic cells exposed to bacteria heat-treated at temperatures above 110°C, no increase in the amount of IFN-α was observed, and in fact, it was lower than when exposed to bacteria that had not been heat-treated. These results demonstrate that bacteria heat-treated at temperatures between 60°C and 110°C have high immunostimulatory activity.

[0141] Example 2: Effect of heating time on the immunostimulatory activity of LC-Plasma LC-Plasma that had been statically cultured and washed in the same manner as in Example 1 was heated in an autoclave at 60°C, 80°C, or 110°C for 5 minutes, 30 minutes, or 60 minutes to obtain heat-treated bacterial samples. As a control, a bacterial sample that had not been heat-treated was also prepared. These bacterial samples were dried in a freeze dryer to obtain bacterial powder. Thereafter, the bacteria were exposed to mouse BMDCs, and the amount of IFN-α in the culture supernatant was measured, in the same manner as in Example 1.

[0142] Figure 2 shows the results of measuring the amount of IFN-α. The results in Figure 2 are shown as mean values ​​± standard deviations. Figure 2 reveals that bacteria heat-treated within a specified temperature range exhibit high immunostimulatory activity, at least when the heating time is in the range of 5 to 60 minutes.

[0143] Example 3: Measurement of DNA size in heat-treated LC-Plasma Similar to Example 1, heat-treated or unheat-treated bacterial powders were prepared. DNA was extracted from these bacterial powders by phenol-chloroform extraction. Specifically, the bacterial powder was diluted with PBS to a concentration of 10 mg / mL. 200 μL of the resulting bacterial suspension was mixed with 300 μL of an extraction buffer solution with the following composition and 500 μL of a phenol / chloroform / isoamyl alcohol solution with the following composition:

[0144] [Extraction buffer] A mixture of 20 mL of 1 M Tris HCl (pH 8) (Nippon Gene, ref: 312-90061), 16 mL of UltraPure 0.5 M EDTA (pH 8.0) (Thermo Fisher Scientific, ref: 15575-020), 64 mL of MilliQ, and 20 mL of 10% SDS (Nippon Gene, ref: 311-90271).

[0145] [Phenol / chloroform / isoamyl alcohol solution] A mixed solution of phenol, chloroform, and isoamyl alcohol in a volume ratio of 25:24:1 (Nippon Gene, ref: 311-90151)

[0146] The mixture obtained above was added to a tube (Lysing MatrixE TUBE, MP, ref: 6914500, hereinafter the same) and treated for 60 seconds in a vortex mixer (VORTEX GENIE2: Scinetific Industries, hereinafter the same). The tube containing the mixture was centrifuged at 12,000 rpm at room temperature for 5 minutes using a centrifuge (TOMY MX-301, hereinafter the same). 350 μL of the supernatant was collected in a new tube, mixed with 350 μL of a phenol / chloroform / isoamyl alcohol solution, and homogenized using a vortex mixer. The tube containing the mixed solution was centrifuged at 12,000 rpm at room temperature for 5 minutes using a centrifuge. DNA was thus extracted from the bacteria. 250 μL of the supernatant was collected in a new tube, and 50 μL of 3 M sodium acetate and 250 μL of isopropanol were added thereto. The solution was centrifuged at 15,000 rpm and 4°C for 15 minutes using a centrifuge. The supernatant was discarded, and 500 μL of 70% ethanol was added thereto. The solution was centrifuged at 15,000 rpm and 4°C for 3 minutes using a centrifuge. After discarding the supernatant, the pellet in the tube was dried under reduced pressure. RNase-Free Water (Qiagen, ref: 129112) was added to the dried pellet and mixed to obtain a DNA solution.

[0147] The DNA solution was evaluated by Genomic DNA ScreenTape assay, an electrophoresis method using a fully automated electrophoresis system, TapeStation (Agilent Technologies). For electrophoresis, Genomic DNA ScreenTape and Genomic DNA reagent kits (both Agilent Technologies) were used according to their specifications. As an evaluation result, DIN (DNA Integrity Number) was obtained. DIN is the value output as an output in the Genomic DNA ScreenTape assay using Agilent's Agilent 4200 TapeStation system, and is a score of 1 to 10 (the smaller the value, the more degraded the DNA) according to the degree of degradation of gDNA. Note that 1 is the detection limit of the above machine.

[0148] Figure 3 shows the results of electrophoresis and DIN in the Genomic DNA ScreenTape assay for heat-treated bacteria. According to the results in Figure 3, the DIN of bacteria heat-treated at 60 to 100°C was 1.0 to 8.5. Furthermore, the DIN of heat-treated bacteria decreased in a temperature-dependent manner when the heat treatment temperature was greater than 70°C and less than 110°C. These results, together with those of Example 1, suggest that bacteria with a DIN within a specified range have high immunostimulatory activity.

[0149] Example 4 Evaluation of DNA size distribution in heat-treated LC-Plasma In the electrophoresis results obtained in Example 3 ( FIG. 3 ), a range of 250 to 60,000 bp was specified on the DNA histogram on the TapeStation instrument, and the proportion of the spectral area occupied by DNA having a base length in this range to the total DNA was calculated.

[0150] Table 1 shows the spectral area ratio of DNA having a base length of 250 to 60,000 bp to the total DNA in heat-treated bacteria. According to the results in Table 1, the spectral area ratio of 250 to 60,000 bp was 70% or more when the heat treatment temperature was 70°C or higher. Furthermore, the spectral area ratio in this range was maximized in the bacteria heat-treated at 80°C and 90°C, which showed high immunopotentiating ability in Example 1. These results, together with those of Example 1, suggest that bacteria with a spectral area ratio of 250 to 60,000 bp within a specified range have high immunopotentiating ability.

[0151]

[0152] The DNA solution obtained in Example 3 was used to evaluate the DNA amount at 90 ng by real-time PCR using a LightCycler® 480 (Roche). For real-time PCR, the following primer set was used, and amplification was performed using TB Green® Premix Ex Taq® II according to the specifications, using the following program. In the following program, the temperature change was performed at 20°C / sec. [Primer set] Primer set 1: primers that amplify the prokaryotic 16S conserved region V5 Forward primer: GGATTAGATACCCGTAGTC (SEQ ID NO: 1) Reverse primer: CTTGTGCGGGCCCCCGTCAATTC (SEQ ID NO: 2) [Program] Stage 1: 1 cycle at 95°C for 30 seconds Stage 2: 40 cycles at 95°C for 5 seconds and 50°C for 20 seconds Stage 3: 1 cycle at 95°C for 1 second, 65°C for 30 seconds, and 95°C for 1 second

[0153] Table 2 shows the Cp value (crosspoint value) calculated on the instrument based on the measurement results of fluorescence intensity in real-time PCR. The Cp value is the cycle number at the maximum inflection point of the amplification curve, calculated from the second derivative using the 2nd Derivative Maximum Method (SDM). In the results shown in Table 2, a smaller Cp value indicates less degradation of the DNA to be amplified. The results in Table 2 show that bacteria heat-treated at a temperature of about 60°C or higher but less than 110°C had a higher Cp value than bacteria not heated, and a lower Cp value than bacteria heat-treated at a high temperature of 120°C or higher. These results, along with the results of Example 1, suggest that bacteria with a Cp value of 15.5 to 24.0, or bacteria with a Cp value that is 1.10 to 1.50 times that of live bacteria, have high immunostimulatory activity.

[0154]

[0155] Example 5: Evaluation using various heat-treated bacteria A similar test to Example 1 was also performed using lactic acid bacteria other than LC-Plasma. The strains of lactic acid bacteria used are shown in Table 3. The culture conditions indicated as A and B in Table 3 are shown in Table 4. In the examples, lactic acid bacteria, except for Lactobacillus gasseri SBT 2055, were cultured using the culture method described in Table 4 according to the correspondence between A and B shown in Table 3, and then used as bacterial bulk powder (dried powder of bacterial cells or powder containing the same, etc.) prepared as follows. The bacteria were cultured in MRS medium (MRS BROTH, CODE: CM0359, Oxoid). The culture solution was centrifuged (5000 rpm), and the supernatant was removed to obtain a bacterial solution. Next, the obtained bacterial solution was mixed with phosphate-buffered saline (Takara Bio Inc.) at a ratio of 1:19 and washed twice by centrifugation (5000 rpm). The washed bacterial solution was heat-treated according to the temperature and time conditions of each Example to kill the lactic acid bacteria in the bacterial solution. The heat-treated bacterial solution was freeze-dried to obtain a bacterial bulk powder.

[0156] For Lactobacillus gasseri SBT 2055, a bacterial bulk powder prepared as follows was used. A Lactobacillus gasseri SP capsule (manufactured by Megmilk Snow Brand), a supplement containing Lactobacillus gasseri SBT 2055, was dissolved in 10 mL of MRS medium to prepare a solution containing Lactobacillus gasseri SBT 2055. The solution was applied to MRS agar medium and streaked to obtain single-colony Lactobacillus gasseri SBT 2055. A colony of Lactobacillus gasseri SBT 2055 was added to MRS medium, and 700 μL of the culture solution was incubated at 37 ° C for 24 hours. 300 μL of 80% glycerol was mixed with the culture solution to prepare a glycerol stock of Lactobacillus gasseri SBT 2055, which was then stored at -80 ° C. 100 μL of glycerol stock of Lactobacillus gasseri SBT 2055 was added to 100 mL of MRS medium and incubated at 37 ° C for 24 hours. The culture medium was collected, centrifuged and washed twice with ultrapure water, and then suspended in 20 mL of ultrapure water. The resulting suspension was heat-treated according to the temperature and time conditions of each example and then freeze-dried. The resulting powder was used in the following examples as bacterial bulk powder of Lactobacillus gasseri SBT 2055.

[0157] Weissella paramesenteroides JCM 9890, Bifidobacterium animalis subsp. lactis JCM 10602, and Lactobacillus gasseri SBT2055 were each heat-treated at 60°C, 80°C, 100°C, 110°C, or 120°C for 30 minutes, and unsterilized cells were prepared. The amount of IFN-α expressed by dendritic cells was measured for each bacterial strain using the method described in Example 1. The results are shown in Table 5. These results suggest that bacteria other than LC-Plasma that were heat-treated at a specified temperature range also have high immunostimulatory activity.

[0158] Example 6: Evaluation of various heat-treated bacteria using droplet digital PCR (ddPCR) Heat-treated and unheat-treated bacterial powders were prepared for LC-Plasma, JCM9890, JCM10602, and SBT2055 in the same manner as in Examples 1 and 5. DNA was extracted from these bacterial powders by phenol-chloroform extraction. Specifically, the bacterial powder was first diluted with PBS to a concentration of 10 mg / mL. Subsequently, 200 μL of the resulting bacterial suspension was mixed with 300 μL of an extraction buffer solution with the following composition and 500 μL of a phenol / chloroform / isoamyl alcohol solution with the following composition:

[0159] [Extraction buffer] A mixture of 20 mL of 1 M Tris HCl (pH 8) (Nippon Gene, ref: 312-90061), 16 mL of UltraPure 0.5 M EDTA (pH 8.0) (Thermo Fisher Scientific, ref: 15575-020), 64 mL of MilliQ, and 20 mL of 10% SDS (Nippon Gene, ref: 311-90271).

[0160] [Phenol / chloroform / isoamyl alcohol solution] A mixed solution of phenol, chloroform, and isoamyl alcohol in a volume ratio of 25:24:1 (Nippon Gene, ref: 311-90151)

[0161] [Test Method] The mixture obtained above was added to a tube (Lysing MatrixE TUBE, MP Corporation, ref: 6914500, hereinafter the same) and treated for 60 seconds with a vortex mixer (VORTEX GENIE2: Scinetific Industries, hereinafter the same). The tube containing the mixed solution was disrupted using a FastPrep-24 (registered trademark) 5G (MP Biomedicals) at 6.5 m / s for 45 seconds, and then centrifuged at 12,000 rpm and room temperature for 5 minutes using a centrifuge (TOMY MX-301, hereinafter the same). 350 μL of the supernatant was collected in a new tube, mixed with 350 μL of phenol / chloroform / isoamyl alcohol solution, and homogenized using a vortex mixer. The tube containing the mixed solution was centrifuged at 12,000 rpm at room temperature for 5 minutes. DNA was thus extracted from the bacteria. 250 μL of the supernatant was collected in a new tube, and 25 μL of 3 M sodium acetate and 250 μL of isopropanol were added. The solution was centrifuged at 15,000 rpm at 4°C for 15 minutes. The supernatant was discarded, and 500 μL of 70% ethanol was added. The solution was centrifuged at 15,000 rpm at 4°C for 5 minutes. After discarding the supernatant, the pellet in the tube was dried. RNase-Free Water (Qiagen, ref: 129112) was added to the dried pellet and mixed to obtain a DNA solution. The amount of DNA (ng / μL) in the DNA solution thus obtained from the 10 mg / mL bacterial suspension was measured using a Thermo Scientific® NanoDrop® spectrophotometer (ThermoFisher Scientific).

[0162] [ddPCR] The DNA solution obtained above was diluted to a DNA amount of 0.03 ng / μL, 0.3 ng / μL, or 3 ng / μL for ddPCR, and evaluated by ddPCR using a QX600 AutoDG Droplet Digital PCR system (Bio-Rad). In ddPCR, the following primer set (FASMAC) was used, and ddPCR Evagreen Supermix (Bio-Rad, 1864033) was used. The following composition was used in an Automated Droplet Generator (Bio-Rad, 1864101JA) to create droplets. Then, a Pierceable Foil Heat Seal (Bio-rad, 1814040) was applied to the plate using a PX1 (registered trademark) PCR Plate Sealer (Bio-rad, 1814000J1), and PCR amplification was performed using a PTC Tempo Deepwell Thermal Cycler (Bio-rad, 12015392). The temperature change in the PCR amplification program was 2 ° C / sec. The sample after PCR amplification was then subjected to a QX600 Droplet Reader (Bio-rad, 12013328) to measure the DNA concentration. [Composition] ddPCR Evagreen Supermix 11 μL / well, 10 μM forward primer 0.4 μL / well, 10 μM reverse primer 0.4 μL / well, RNase-free water 8.2 μL / well, to which 2 μL / well of DNA solution was added.[Primer set] Primer set 1: Primers that amplify a genomic region possessed by bacteria of the genus Lactococcus (A9 primers) Forward primer: CGTTTACGTGCTGCTGCTTCTGA (SEQ ID NO: 3) Reverse primer: AGCTGGAACTCTTCAAGAGCTT (SEQ ID NO: 4) Primer set 2: Primers that amplify the 16S conserved region V3 of prokaryotes (V3 primers) Forward primer: CCTACGGGNGGCWGCAG (SEQ ID NO: 5) Reverse primer: TTACCGCGGCGCTGGCAC (SEQ ID NO: 6) [Program] Stage 1: 1 cycle at 95°C for 5 minutes Stage 2: 40 cycles at 95°C for 5 seconds and at 58°C for 20 seconds Stage 3: 1 cycle at 95°C for 1 second and at 4°C for 20 seconds.

[0163] 1) Evaluation of LC-Plasma Using A9 Primers Table 6 and Figure 4 show the DNA copy numbers calculated by ddPCR for LC-Plasma under various heat treatment conditions using A9 primers (N = 3). In ddPCR, a smaller DNA copy number indicates greater degradation of the DNA to be amplified. Therefore, the decrease in DNA concentration in heat-treated bacteria indicates that heat-induced DNA degradation is accelerated. Furthermore, based on the amount of DNA in the DNA solution obtained from the 10 mg / mL bacterial suspension obtained in this example and the DNA copy number calculated by ddPCR, the copy number of DNA to be amplified by A9 primers contained in the bacterial cells and each well used to evaluate IFN-α production in Example 1 was calculated as shown in Table 7, expressed as the number per 2 mg of bacterial cells and per well in Example 1. In this calculation, the efficiency of DNA extraction from the bacterial cells was assumed to be 100%. Taking into account the results of Example 1 and these results, it was suggested that compositions in which the DNA copy number calculated by the ddPCR method using the A9 primer falls within a predetermined range have high immunostimulatory activity.

[0164] 2) Evaluation of four types of bacteria using V3 primers. Table 8 and Figures 5-8 show the DNA copy numbers calculated by ddPCR for various bacteria under various heat treatment conditions using V3 primers (N = 1). Figures 5, 6, 7, and 8 show the results of evaluation of LC-Plasma, JCM9890, JCM10602, and SBT2055, respectively. Table 8 and Figures 5-8 show that the phenomenon of DNA degradation in heat-treated bacteria is not specific to LC-Plasma; the other three strains also experienced heat-dependent DNA degradation. Based on the amount of DNA in the DNA solution obtained from the 10 mg / mL bacterial suspension obtained in this example and the DNA copy number calculated by ddPCR, the copy number of DNA to be amplified by V3 primers contained in the bacterial cells used to evaluate IFN-α production in Examples 1 and 5 was calculated as the number per 2 mg of bacterial cells and per well in Example 5, as shown in Tables 9 and 10, respectively. In the calculations, the efficiency of DNA extraction from bacterial cells was assumed to be 100%. In Tables 8 to 10, the measurement result "-" indicates that the measurement was not performed. Taking into account the results of Examples 1 and 5 and these results, it was suggested that compositions in which the DNA copy number calculated by ddPCR using the V3 primer falls within a predetermined range have high immunostimulatory activity.

Claims

1. A composition containing heat-treated bacteria with immunostimulatory activity, containing 2.4 x 10 DNA fragments amplified by the following primer set: 2 [Primer set] Forward primer: CCTACGGGNGGCWGCAG (SEQ ID NO: 5) Reverse primer: TTACCGCGGCGCTGGCAC (SEQ ID NO: 6) 2. A composition containing heat-treated bacteria with immunostimulatory activity, wherein a DNA fragment amplified by the following primer set is added at 1.2 x 10 per 1 mg of the bacteria: 5 [Primer set] Forward primer: CCTACGGGNGGCWGCAG (SEQ ID NO: 5) Reverse primer: TTACCGCGGCGCTGGCAC (SEQ ID NO: 6) 3. A composition comprising heat-treated bacteria having immunostimulatory activity, wherein the composition contains 1.1 times or more copies of a DNA fragment amplified by the following primer set per mg of the bacteria compared to the copies of the DNA fragment amplified by the primer set contained per mg of bacteria of the same strain that have been heat-treated at 120°C for 30 minutes. [Primer set] Forward primer: CCTACGGGNGGCWGCAG (SEQ ID NO: 5) Reverse primer: TTACCGCGGCGCTGGCAC (SEQ ID NO: 6) 4. A composition comprising heat-treated bacteria having immunostimulatory activity, wherein the DIN (DNA Integrity Number), which indicates the degree of degradation of the genomic DNA of the bacteria, is 1.0 to 8.

5.

5. A composition comprising a heat-treated bacterium having immunostimulatory activity, wherein the Cp value (crosspoint value) of the bacterium measured under the following conditions is 15.5 to 24.

0. <Conditions> A DNA solution extracted from the bacterium is amplified by real-time PCR using the primer set shown below and the program shown below, and the Cp value is the cycle number at which the amplification curve reaches its maximum inflection point based on the measurement results of the amplification curve. [Primer set] Forward primer: GGATTAGATACCCGTAGTC (SEQ ID NO: 1) Reverse primer: CTTGTGCGGGCCCCCGTCAATTC (SEQ ID NO: 2) [Program] Stage 1: 95°C for 30 seconds, 1 cycle Stage 2: 95°C for 5 seconds and 50°C for 20 seconds, 40 cycles Stage 3: 95°C for 1 second, 65°C for 30 seconds, and 95°C for 1 second, 1 cycle 6. A composition comprising heat-treated bacteria having immunostimulatory activity, wherein the bacteria include bacteria of the genus Lactococcus, and a DNA fragment amplified by the following primer set is contained in an amount of 1.0 x 10 5 [Primer set] Forward primer: CGTTTACGTGCTGCTTCTGA (SEQ ID NO: 3) Reverse primer: AGCTGGAACTCTTCAAGAGCTT (SEQ ID NO: 4) 7. A composition comprising heat-treated bacteria having immunostimulatory activity, wherein the bacteria include bacteria of the genus Lactococcus, and a DNA fragment amplified by the following primer set is added at 5.1 x 10 per 1 mg of the bacteria of the genus Lactococcus: 7 [Primer set] Forward primer: CGTTTACGTGCTGCTTCTGA (SEQ ID NO: 3) Reverse primer: AGCTGGAACTCTTCAAGAGCTT (SEQ ID NO: 4) 8. The composition according to any one of claims 1 to 7, wherein the immunostimulatory activity includes the ability to activate dendritic cells.

9. The composition according to claim 8, wherein the ability to activate dendritic cells includes the ability to promote IFN-α production.

10. A composition according to any one of claims 1 to 7, wherein the bacteria are lactic acid bacteria and / or acetic acid bacteria.

11. The bacterium is selected from the group consisting of Lactobacillus rhamnosus CRL1505, Gluconacetobacter hansenii GK-1, Lactobacillus acidophilus L-92, Lactobacillus plantarum L-137, Lactobacillus bulgaricus OLL1073R-1, Lactococcus lactis subsp. lactis, and Lactococcus lactis subsp. lactis. The composition according to any one of claims 1 to 7, wherein the bacterium is at least one bacterium selected from the group consisting of Bifidobacterium animalis subsp. lactis JCM5805, Weissella paramesenteroides JCM9890, Bifidobacterium animalis subsp. lactis JCM10602, and Lactobacillus gasseri SBT2055.

12. A composition described in any one of claims 1 to 7, wherein the Cp value of the heat-treated bacteria is 1.10 to 1.50 times the Cp value of the non-heat-treated bacteria.

13. The composition according to any one of claims 1 to 7, wherein the area ratio occupied by DNA of 250 to 60,000 bp in a histogram of the bacterial genomic DNA is 65% or more.

14. The composition according to any one of claims 1 to 7, wherein the heat-treated bacteria have improved immunostimulatory activity compared to the non-heat-treated bacteria.

15. The composition according to any one of claims 1 to 7, which is a food composition, a pharmaceutical composition or a feed.

16. The composition according to any one of claims 1 to 7, which is an immunostimulating composition.

17. A composition described in any one of claims 1 to 7, wherein the dry weight of the bacteria is 0.0001 mass% or more relative to the total dry weight of the composition.

18. When the composition is in a liquid form, the number of bacteria in the composition is 1.0 x 10 3 cells / ml~1.0×10 11 The composition of any one of claims 1 to 7, wherein the composition is in a concentration of 0.1 to 0.5% by weight of cells / ml.

19. A method for producing a composition containing bacteria having immunostimulatory activity, comprising a heating step of heating the bacteria at a temperature of 60°C or higher and 110°C or lower.

20. The method of claim 19, wherein the immunostimulatory activity includes dendritic cell activation activity.

21. The method according to claim 20, wherein the ability to activate dendritic cells includes the ability to promote IFN-α production.

22. The method of claim 19, wherein the bacteria are lactic acid bacteria and / or acetic acid bacteria.

23. The method of claim 19, wherein the heating step comprises heating the bacteria to a temperature of 70°C or higher and 90°C or lower.

24. The method according to claim 19, wherein the heating time in the heating step is from 5 minutes to 60 minutes.

25. The method of claim 19, further comprising culturing the bacteria in a glucose-containing medium prior to the heating step.

26. The method of claim 19, further comprising the step of drying the heated bacteria after the heating step.

27. The method according to claim 19, wherein the bacteria after the heating step have improved immunostimulatory activity compared to the bacteria before the heating step.

28. A method for improving the immunostimulatory activity of a bacterium, comprising a heating step of heating the bacterium at a temperature of 60°C or higher and 110°C or lower.

29. The method of claim 28, wherein the immunostimulatory activity includes dendritic cell activation activity.

30. The method according to claim 29, wherein the ability to activate dendritic cells includes the ability to promote IFN-α production.

31. The method of claim 28, wherein the bacteria are lactic acid bacteria and / or acetic acid bacteria.

32. The method of claim 28, wherein the heating step comprises heating the bacteria to a temperature of 70°C or higher and 90°C or lower.

33. The method according to claim 28, wherein the heating time in the heating step is from 5 minutes to 60 minutes.

34. The method of claim 28, further comprising culturing the bacteria in a glucose-containing medium prior to the heating step.

35. The method of claim 28, further comprising the step of drying the heated bacteria after the heating step.

36. The method according to claim 28, wherein the bacteria after the heating step have improved immunostimulatory activity compared to the bacteria before the heating step.

Citation Information

Patent Citations

  • Cytokine production accelerant and cytotoxicity activating agent

    JP2023041649A

  • Immunoregulatory function inducer and food composition

    WO2009066537A1