Phytase variant

Abstract

The present application relates to a phytase variant and uses thereof.

Description

phytase mutant

[0001] The present application relates to a mutant polypeptide having phytase activity and its use.

[0002] Chemical treatment was attempted as a method to decompose phytic acid, but it was not put into practical use because it destroyed coexisting nutrients. Afterwards, phytase (myo-inositol hexakisphosphate phosphohydrolase), a phosphatase enzyme that catalyzes the hydrolysis of phytic acid and releases usable inorganic phosphorus (Mullaney EJ, et al., Advances in Applied Microbiology, Volume 47, 2000, Pages 157-199., 2000), was proven to be the most effective means of decomposing phytic acid without adverse nutritional effects on food or feed, and research to discover microorganisms that produce phytase has been conducted since the 1960s.

[0003] Since an increase in temperature when using enzymes can cause enzyme inactivation, it is very important to develop enzymes that can withstand such environments.

[0004] One aspect of the present application provides a mutant polypeptide having phytase activity.

[0005] Another aspect of the present application provides a composition comprising the mutant polypeptide.

[0006] Another aspect of the present application provides a composition for reaction with phytic acid, comprising the mutant polypeptide or the mutant polypeptide.

[0007] Another aspect of the present application provides a method for producing a hydrolysate of phytic acid and / or a method for hydrolyzing phytic acid, comprising the step of contacting a substrate with the mutant polypeptide, a host cell expressing the mutant polypeptide, and / or a composition comprising the mutant polypeptide.

[0008] Another aspect of the present application provides a polynucleotide encoding the mutant polypeptide; a nucleic acid construct comprising the polynucleotide; a vector comprising the polynucleotide or the nucleic acid construct; and a host cell comprising at least one of the polynucleotide, the nucleic acid construct, and the vector.

[0009] Another aspect of the present application provides a method for producing the mutant polypeptide.

[0010] Another aspect of the present application provides a use of the mutant polypeptide, composition, and host cell for phytic acid hydrolysis.

[0011] One aspect of the present application provides a variant polypeptide having phytase activity.

[0012] Another aspect of the present application provides a composition comprising the mutant polypeptide.

[0013] Another aspect of the present application provides a composition for reaction with phytic acid, the mutant polypeptide or a reaction composition comprising the mutant polypeptide.

[0014] Another aspect of the present application provides a method for preparing a hydrolysate of phytic acid and / or a method for hydrolyzing phytic acid, comprising the step of contacting a substrate with the mutant polypeptide, a host cell expressing the mutant polypeptide, and / or a composition comprising the mutant polypeptide.

[0015] Another aspect of the present application provides a polynucleotide encoding the mutant polypeptide; a nucleic acid construct comprising the polynucleotide; a vector comprising the polynucleotide or the nucleic acid construct; and a host cell comprising at least one of the polynucleotide, the nucleic acid construct, and the vector.

[0016] Another aspect of the present application provides a method for producing the mutant polypeptide.

[0017] Another aspect of the present application provides a use of the mutant polypeptide, composition, and host cell for phytic acid hydrolysis.

[0018] The present application enables the use of phytase with improved protein thermal stability.

[0019] Figure 1 is a diagram showing the results of confirming the residual activity (%) according to the heat treatment temperature (70, 75, and 80°C) of the reference protein (SEQ ID NO: 1) and the variant (SEQ ID NO: 3).

[0020] The specific details for implementing the invention are as follows. Furthermore, each description and embodiment disclosed in this application can be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below.

[0021] Furthermore, those skilled in the art will recognize or be able to ascertain, using only routine experimentation, numerous equivalents to the specific embodiments of the present application described herein. Furthermore, such equivalents are intended to be encompassed by this application.

[0022]

[0023] definition

[0024]

[0025] As used in the specification and appended claims of this application, the singular articles "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Unless the context clearly dictates otherwise, the singular terms include the plural and the plural terms include the singular. In the specification and appended claims of this application, unless the context clearly dictates otherwise, the use of "or" is intended to include "and / or."

[0026]

[0027] In this application, the term "about" may be used before a specific numerical value. As used herein, the term "about" encompasses not only the exact number described after the term, but also a range that is or is nearly that number. Whether a number is or is nearly the specific number described can be determined based on the context in which it is presented. For example, the term "about" may refer to a range of -10% to +10% of a numerical value. In another example, the term "about" may refer to a range of -5% to +5% of a given numerical value. However, this is not a limitation.

[0028]

[0029] In this application, the terms "first, second, third...", "i), ii), iii)...", or "(a), (b), (c), (d)..." are used to distinguish similar configurations, and these terms do not imply that the steps are performed consecutively or in order. For example, when the terms are used in relation to steps of a method, use, or analysis, these steps may be performed simultaneously, without a time interval, or may be performed at intervals of seconds, minutes, hours, days, or months.

[0030]

[0031] In this application, the term "consisting essentially of" means that a non-specific component may be present if the characteristics of the subject matter claimed in this application are not substantially affected by the presence of the non-specific component.

[0032] In this application, the term "consisting of" means that the proportion of a specific component(s) totals 100%. The components or features listed below the term "consisting of" may be essential or mandatory. In some embodiments, other than the components or features listed below "consisting of," other optional or nonessential components may be excluded.

[0033] In this application, the term "comprising" means the presence of a feature, step, or component described below, and does not exclude the presence or addition of one or more features, steps, or components. The components or features described below "comprising" in this application may be essential or mandatory, but in some embodiments, other optional or non-essential components or features may be further included.

[0034] In this application, the term “comprising” may, in some embodiments, be modified to refer to “consisting essentially of” or “consisting of.”

[0035] In the present application, with respect to an amino acid sequence, even if it is described as a polypeptide “comprising” an amino acid sequence set forth in a specific sequence number, a polypeptide “consisting of” an amino acid sequence set forth in a specific sequence number, or a polypeptide or protein “having” an amino acid sequence set forth in a specific sequence number, it is obvious that a protein having an amino acid sequence in which a portion of the sequence is deleted, modified, substituted, conservatively substituted, or added may also be used in the present application, as long as it has the same or corresponding activity as a polypeptide consisting of the amino acid sequence of the corresponding sequence number. For example, it may be a case in which the amino acid sequence has an addition of a sequence that does not alter the function of the protein at the N-terminus and / or C-terminus, a mutation that may occur naturally, a silent mutation thereof, or a conservative substitution, but is not limited thereto.

[0036]

[0037] In this application, the term "protein" or "polypeptide" refers to a polymer or oligomer of consecutive amino acid residues. In this application, "polypeptide," "protein," and "peptide" may be used interchangeably with "amino acid sequence."

[0038] In some cases, an amino acid sequence that exhibits activity may be referred to as an "enzyme." In this application, amino acid sequences are described in N-terminal → C-terminal orientation, unless otherwise indicated.

[0039]

[0040] In relation to a cell, nucleic acid, polypeptide, or vector, the term "recombinant" in this application means that the cell, nucleic acid, polypeptide, or vector has been modified by the introduction of a heterologous nucleic acid or polypeptide or by alteration of a native nucleic acid or polypeptide, or that the cell is derived from a cell so modified. Thus, for example, a recombinant cell may express a gene not found in the native (non-recombinant) form of the cell, or may express a native gene that is expressed or not expressed at all, or otherwise abnormally expressed.

[0041]

[0042] As used herein, the term "isolated" refers to a substance that exists in an environment where it does not occur naturally, or in a form that does not occur naturally. This includes the substance (sequence, enzyme, or nucleic acid) being at least substantially free from at least one other component with which it is naturally associated and found in nature, such as a sequence, enzyme, or nucleic acid.

[0043] For example, the isolated sequences, enzymes or nucleic acids provided in the present application may be provided in a form substantially free of one or more contaminants.

[0044] Examples of isolated substances may include, but are not limited to, i) any non-naturally occurring substance, ii) any substance from which one, more, or all naturally occurring components associated with it in nature have been removed (e.g., an enzyme, variant, nucleic acid, protein, peptide, or cofactor), iii) any substance found in nature that has been artificially modified, or iv) a substance that has been modified to alter the amount of that substance relative to other naturally associated components (e.g., increasing the number of copies of a gene encoding the substance; modifying a promoter naturally associated with a gene encoding the substance to a more active promoter, etc.).

[0045]

[0046] In this application, the term "wild type" means a naturally occurring polypeptide without any artificial modifications. When the term "wild type" is used in relation to a polypeptide, it means a naturally occurring polypeptide that does not have any artificial mutations (substitutions, insertions, deletions, etc.) at one or more amino acid positions. Similarly, when the term "wild type" is used in relation to a polynucleotide, it means a polypeptide that does not have any artificial modifications (substitutions, insertions, deletions) at one or more nucleotides. However, a polynucleotide encoding a wild type polypeptide is not limited to a naturally occurring polynucleotide, and also includes a sequence encoding any wild type polypeptide.

[0047]

[0048] In the present application, the parent sequence or backbone refers to a reference sequence into which a modification is introduced to become a mutant polypeptide. That is, the parent sequence may be a starting sequence into which mutations such as substitutions, insertions, and / or deletions are introduced. The parent sequence may be a naturally occurring or wild type, or a variant in which one or more substitutions, insertions, or deletions have occurred in the natural or wild type, or may be an artificially synthesized sequence. If the parent sequence is an amino acid sequence that exhibits activity, i.e., an amino acid sequence of an enzyme, it may be referred to as a parent enzyme.

[0049]

[0050] In this application, the term "reference sequence" refers to a sequence used to determine the position of an amino acid within an arbitrary amino acid sequence. By aligning an arbitrary amino acid sequence with a reference sequence, the position of an amino acid corresponding to a specific position of the reference sequence within the arbitrary amino acid sequence can be determined.

[0051]

[0052] In the present application, with respect to an amino acid or nucleic acid sequence, the term "fragment" means a portion of a parent sequence. For example, it may be a polypeptide in which one or more amino acids from the parent sequence are removed from the C or N terminus.

[0053] In the present application, a "fragment" of an enzyme may refer to a "functional fragment." A "functional fragment," also referred to as an "active fragment," refers to a polypeptide that is part of a parent enzyme and possesses the enzymatic activity of the parent enzyme. For example, a functional fragment of an enzyme may include the catalytic site of the enzyme.

[0054] The enzyme fragment may comprise a portion of the full length of the parent enzyme, for example, but not limited to, at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or less than 100% of the amino acids of the full length of the parent enzyme.

[0055]

[0056] In this application, "mutating / modifying" means changing or altering. This may be a change from a naturally occurring sequence. For example, an enzyme may be modified in such a way that it is altered from its parent sequence or reference sequence.

[0057] In the present application, the modified enzyme may be a non-naturally occurring enzyme, i.e., an enzyme that does not exist in nature itself.

[0058] The term "modified" in this application means, for example, something that has been altered from its naturally occurring form. The modified enzymes of this application include enzymes that do not occur naturally or naturally occurring variants. For example, the modified enzymes of this application are enzymes that are not found in nature. For example, the modified enzymes of this application may be, but are not limited to, enzymes that do not occur spontaneously.

[0059] When the term "modification" is used in relation to an amino acid / nucleic acid sequence in this application, it may include substitution of an amino acid / nucleic acid residue of the parent sequence for a different amino acid / nucleic acid residue at one or more sites in the amino acid sequence, deletion of an amino acid / nucleic acid residue (or a series of amino acid / nucleic acid residues) of the parent sequence at one or more sites, insertion of an amino acid / nucleic acid residue (or a series of amino acid / nucleic acid residues) of the parent sequence at one or more sites, truncation of the N-terminal and / or C-terminal amino acid sequence or 5' and / or 3' nucleic acid sequence, and any combination thereof.

[0060]

[0061] In the present application, a "variant" or "modified polypeptide" of an enzyme refers to a protein that differs from the parent enzyme in one or more amino acids by conservative substitution and / or modification. The terms "variant" and "modified polypeptide" may be used interchangeably. The variant or modified polypeptide may be, but is not limited to, a non-naturally occurring one.

[0062] The variant differs from the sequence of the parent enzyme by one or more modifications, e.g., amino acid substitutions, deletions and / or insertions.

[0063] Such variants can generally be identified by altering one or more amino acids in the parent enzyme and evaluating the properties of the altered protein. That is, the ability of the variant may be increased, unchanged, or decreased compared to the parent enzyme.

[0064] Additionally, some variants may comprise mutant polypeptides in which one or more portions, such as the N-terminal leader sequence or the transmembrane domain, are deleted.

[0065] Other variants may include variants in which portions are removed from the N- and / or C-terminus of the mature protein.

[0066] The term "variant" or "variant polypeptide" may be used interchangeably with terms such as variant, modification, mutated protein, and mutation (in English, modification, modified protein, mutant, mutein, divergent, variant, etc.), and is not limited thereto if the term is used in the meaning of variant.

[0067] Variants may include deletions or additions of amino acids that have minimal impact on the properties and secondary structure of the polypeptide. For example, the polypeptide may be conjugated to a signal (or leader) sequence at the N-terminus of the protein that is involved in co-translational or post-translational protein transfer. Furthermore, the polypeptide may be conjugated to other sequences or linkers to facilitate identification, purification, or synthesis of the polypeptide.

[0068]

[0069] In this application, the term "conservative substitution" refers to the replacement of one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues.

[0070]

[0071] Throughout this application, the conventional one-letter and three-letter codes for naturally occurring amino acids are used. Furthermore, amino acids referred to by abbreviations in this application are described according to the IUPAC-IUB nomenclature.

[0072]

[0073] Alanine Ala, A Arginine Arg, R

[0074] Asparagine Asn, N Aspartic acid Asp, D

[0075] Cysteine ​​Cys, C Glutamic acid Glu, E

[0076] Glutamine Gln, Q Glycine Gly, G

[0077] Histidine His, H Isoleucine Ile, I

[0078] Leucine Leu, L Lysine Lys, K

[0079] Methionine Met, M Phenylalanine Phe, F

[0080] Proline Pro, P Serine Ser, S

[0081] Threonine Thr, T Tryptophan Trp, W

[0082] Tyrosine Tyr, Y Valine Val, V

[0083]

[0084] Meanwhile, any amino acid can be written as Xaa, X.

[0085] Additionally, the generally accepted three-letter codes for other amino acids, such as Aib (2-Aminoisobutyric acid), Sar (N-methylglycine), and α-methyl-glutamic acid, may be used, as well as for naturally occurring amino acids.

[0086]

[0087] Amino acids can generally be classified based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Accordingly, amino acid substitutions can generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues.

[0088] For example, among the amino acids having electrically charged side chains, positively charged (basic) amino acids include arginine, lysine, and histidine, and negatively charged (acidic) amino acids include glutamic acid and aspartic acid; among the amino acids having uncharged side chains, nonpolar amino acids include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline, and polar or hydrophilic amino acids include serine, threonine, cysteine, tyrosine, asparagine, and glutamine, and among the nonpolar amino acids, aromatic amino acids include phenylalanine, tryptophan, and tyrosine.

[0089] As used herein, the term "gene" refers to a polynucleotide encoding a polypeptide and a polynucleotide comprising regions preceding and following the coding region. In some embodiments, a gene may have a sequence (intron) inserted between each coding region (exon).

[0090]

[0091] As used herein, the terms "homology" or "identity" refer to the degree of relationship between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0092] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences are generally capable of hybridizing under moderate or high stringency conditions, typically along at least about 50%, 60%, 70%, 80%, or 90% of the entire sequence or its entire length. It should be appreciated that hybridization also encompasses polynucleotides containing common codons or codons that are considered codon degenerate.

[0093] Whether any two polynucleotide or polypeptide sequences are homologous, similar or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ET AL / .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using, but is not limited to, BLAST of the National Center for Biotechnology Information Database, or ClustalW.

[0094] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information, for example, using a GAP computer program such as that of Needleman et al. (1970), J Mol Biol. 48:443, as disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program are (1) unitary matrices (containing values ​​of 1 for identity and 0 for non-identity) and (2) a matrix of 1 and 0 for identity, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), Gribskov et al. (1986) Nucl. Acids Res. 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0095] Additionally, whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined by comparing the sequences by Southern hybridization experiments under defined stringent conditions, and the defined appropriate hybridization conditions are within the scope of the art and can be determined by methods well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F. M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, but are not limited thereto).

[0096]

[0097] In the present application, the term "mature polypeptide" refers to a polypeptide in a form that lacks a signal sequence or a propeptide sequence. A mature protein / polypeptide / peptide may be a functional form of a protein / polypeptide / peptide. A mature polypeptide may be a final form that has undergone post-translational or post-translational modifications. Examples of post-translational modifications include, but are not limited to, N- or C-terminal modifications, glycosylation, phosphorylation, and leader sequence removal.

[0098]

[0099] The term "nucleic acid construct" in this application means a single or double-stranded nucleic acid molecule that contains one or more regulatory sequences and is artificially synthesized, engineered to contain a specific sequence in a manner that does not exist in nature, or isolated from nature.

[0100]

[0101] As used herein, the term “expression” includes, but is not limited to, any step involved in the production of a polypeptide, such as transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0102] As used herein, the term "expression vector" means a linear or circular nucleic acid molecule comprising a coding sequence and regulatory sequences operably linked thereto for expression thereof.

[0103]

[0104] As used herein, the term "operably linked" refers to a configuration in which a regulatory sequence is positioned appropriately to direct the expression of a coding sequence. Therefore, "operably linked" includes a regulatory region of a functional domain with known or desired activity, such as a promoter, terminator, signal sequence, or enhancer region, attached or linked to a target (gene or polypeptide) so as to regulate the expression, secretion, or function of the target in accordance with the known or desired activity.

[0105]

[0106] As used herein, the term "cDNA" refers to a DNA sequence that can be produced by reverse transcription from a mature, spliced ​​mRNA molecule, which can be obtained from a eukaryotic or prokaryotic cell. The cDNA sequence does not include intron sequences that may be present in the corresponding genomic DNA. The initial primary RNA transcript is a precursor to mRNA before being processed through a series of steps, including splicing, to form the mature, spliced ​​mRNA.

[0107]

[0108] As used herein, the term "regulatory sequence" refers to a polynucleotide sequence necessary for the expression of a coding sequence. Each regulatory sequence may be native to the coding sequence (having the same origin) or foreign (derived from another gene). Examples of the regulatory sequence include a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal peptide sequence, an operator sequence, a sequence encoding a ribosome binding site, and a sequence that regulates transcription and translation termination. The minimum unit of the regulatory sequence may include a promoter, a transcription and translation termination sequence.

[0109]

[0110] To describe the mutant polypeptides provided in this application, the following nomenclature is used.

[0111] In this application, reference to a specific position in an amino acid sequence may include reference to an amino acid present or substituted at that position. Reference to an amino acid at a specific position may be described in various ways. For example, "position 33" may be described as "position 33," "amino acid 33," or "33rd amino acid." Furthermore, for example, if the amino acid at position 33 is methionine (M), it may be described as "M33" or "Met33."

[0112] Amino acid substitutions can be expressed by listing the amino acid before substitution, the position, and the amino acid being replaced. These amino acids can be expressed using conventional one-letter and three-letter codes. For example, if methionine, the amino acid at position 33 in a specific sequence, is replaced with threonine, it can be described as "M33T" or "Met34Thr."

[0113] Any amino acid at a particular position can be designated as "X". For example, X33 refers to any amino acid at position 33. Also, when a substituted amino acid is designated as X, it means that it is replaced with an amino acid different from the amino acid present before the substitution. For example, "M33X" indicates that M at position 33 is replaced with any amino acid other than M.

[0114] Different alternations can be expressed by listing multiple amino acids simultaneously using the " / " or "," symbols. For example, a substitution of methionine (M) at position 33 with T or K can be written interchangeably as M33T / K or M33T,K. As another example, M / K33T means that the amino acid M or K at position 33 before substitution is replaced with T.

[0115] Multiple mutations can be described using a "+". For example, a description such as "D91N+E92Q" means that aspartic acid at position 91 is replaced by asparagine, and glutamic acid at position 92 is replaced by glutamine, respectively.

[0116] Deletions of amino acids can be expressed by listing the amino acid before the deletion, the position, and then *. For example, if methionine, the amino acid corresponding to position 33 in a specific sequence, is deleted, it can be expressed as M33* or (Met33*).

[0117] Insertion of an amino acid may be described as, for example, Ala84IleLys or A84IK, when a lysine is inserted between an alanine at position 84 and an isoleucine at position 85 in a specific sequence. Insertion of more than one amino acid, for example, insertion of a lysine and a valine between an alanine at position 84 and an isoleucine at position 85 in a specific sequence, may be described as Ala84IleLysVal or A84IKV. In this case, the position of the inserted amino acid may be indicated using the amino acid number and the alphabet preceding the inserted amino acid, and for example, in the above case, the inserted lysine and valine may be numbered as 84aK and 84bV, respectively.

[0118]

[0119] As used herein, the term "corresponding to" refers to an amino acid residue at a position listed in a protein or polypeptide, or an amino acid residue that is similar, identical, or homologous to the residue listed in the protein or polypeptide. Identifying an amino acid at a corresponding position may be determining a specific amino acid in a sequence that references a particular sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related or reference protein.

[0120] In the present application, SEQ ID NO: 1 or SEQ ID NO: 3 may be used as a reference sequence to determine the position of an amino acid in any amino acid sequence.

[0121] That is, SEQ ID NO: 1 or SEQ ID NO: 3 disclosed in the present application can be used to determine the corresponding amino acid residue in a polypeptide having any phytase activity, and unless otherwise indicated in the present application, residues of a particular amino acid sequence are numbered based on SEQ ID NO: 1.

[0122] For example, any amino acid sequence can be aligned with SEQ ID NO: 1, and based on this, each amino acid residue of the amino acid sequence can be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue in SEQ ID NO: 1. For example, a sequence alignment algorithm such as that described in the present application can identify the position of an amino acid, or the position at which a modification such as a substitution, insertion, or deletion occurs, by comparing it to a query sequence (also referred to as a “reference sequence”).

[0123] These alignments can be performed using, but are not limited to, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), and Trends Genet. 16: 276-277).

[0124] Multiple sequence alignment can also be used to identify corresponding amino acid residues in other phytases. Examples of multiple sequence alignment programs known in the art include MUSCLE (multiple sequence comparison by log-expectation; version 3.5 or later; Edgar, 2004, Nucleic Acids Research 32: 1792-1797), MAFFT (version 6.857 or later; Katoh and Kuma, 2002, Nucleic Acids Research 30: 3059-3066; Katoh et al., 2005, Nucleic Acids Research 33: 511-518; Katoh and Toh, 2007, Bioinformatics 23: 372-374; Katoh et al., 2009, Methods in Molecular Biology 537: 39-64; Katoh and Toh, 2010, Bioinformatics 26: 1899-1900), and EMBOSS using ClustalW. EMMA (1.83 or higher; Thompson et al., 1994, Nucleic Acids Research 22: 4673-4680), etc., and the default parameters of each of the above programs can be used, but are not limited thereto.

[0125] Additionally, if enzymes diverged from the mature polypeptide of SEQ ID NO: 1 and their relationships cannot be detected by conventional sequence-based comparison, other pairwise sequence comparison algorithms can be used (Lindahl and Elofsson, 2000, J. Mol. Biol. 295: 613-615). Higher sensitivity can be achieved in sequence-based searches by using search programs that utilize probabilistic representations of polypeptide families (profiles) to search databases. For example, the PSI-BLAST program generates profiles through an iterative database search process and can detect remote homologs (Atschul et al., 1997, Nucleic Acids Res. 25: 3389-3402). Even greater sensitivity can be achieved if the family or superfamily for the polypeptide has more than one representation in a protein structure database. Programs such as GenTHREADER (Jones, 1999, J. Mol. Biol. 287: 797-815; McGuffin and Jones, 2003, Bioinformatics 19: 874-881) use information from a variety of sources, such as PSI-BLAST, secondary structure predictions, structural alignment profiles, and solvation potentials, as input to a neural network that predicts the structural folding of a query sequence. Similarly, the method of Gough et al., 2000, J. Mol. Biol. 313: 903-919 can be used to align an unknown sequence with superfamily models available in the SCOP database. These alignments can in turn be used to build homology models for the polypeptide, and these models can be evaluated for accuracy using a variety of tools developed for this purpose.

[0126] For proteins with known structures, several tools and resources are available for searching and generating structural alignments. For example, the SCOP superfamily of proteins is structurally aligned, and these alignments are accessible and downloadable. Two or more protein structures can be aligned using various algorithms, such as distance alignment matrix alignment (Holm and Sander, 1998, Proteins 33: 88-96) or Combinatorial extension (CE) (Shindyalov and Bourne, 1998, Protein Engineering 11: 739-747). Implementations of these algorithms can additionally be used to query structural databases containing the target structure to discover possible structural homologues (Holm and Park, 2000, Bioinformatics 16: 566-567).

[0127] The above methods are examples and are not limiting.

[0128]

[0129] Hereinafter, specific examples of the present application will be described in more detail as follows.

[0130]

[0131] One aspect of the present application is a mutant polypeptide having phytase activity, which is at least one of the following i) to iii):

[0132] i) a polypeptide having a sequence identity of 70% or more but less than 100% with an amino acid sequence having sequence number 1 or 90% or more sequence identity therewith;

[0133] ii) a polypeptide encoded by a polynucleotide having a sequence identity of at least 70% and less than 100% with a sequence encoding a mature polypeptide of SEQ ID NO: 1 or an amino acid sequence having at least 90% sequence identity therewith;

[0134] iii) a polypeptide encoded by (a) a mature polypeptide coding sequence of SEQ ID NO: 1 or an amino acid sequence having at least 90% sequence identity thereto, (b) a cDNA thereof, or (c) a polynucleotide that hybridizes under low stringency conditions, medium stringency conditions, medium-high stringency conditions, high stringency conditions, or very high stringency conditions to the full-length complement of (a) or (b),

[0135] A variant polypeptide is provided comprising any one of the following modifications:

[0136] 33, 44, 46, 48, 49, 51, 57, 58, 62, 63, 76, 80, 91, 92, 102, 112, 122, 125, 128, 135, 141, 157, 164, 178, 186, 188, 199, 212, 229, 231, 233, 237, 239, 247, 250, 255, 261, 279, 285, 297, 311, 317, A deletion, insertion of an amino acid, substitution with another amino acid, or a combination thereof at one or more of positions 343, 359, 9, 11, 38, 39, 85, 98, 113, 123, 131, 165, 166, 167, 215, 242, 263, 266, 280, 309, 310, 365, and 367;

[0137] Here, the position number corresponds to the position of the polypeptide of sequence number 1.

[0138]

[0139] In this application, "phytase" means an enzyme that catalyzes the reaction myo-inositol hexakisphosphate + H2O ⇔ D-myo-inositol 1,2,3,5,6-pentakisphosphate + phosphate. The enzyme may be classified under EC 3.1.3.26.

[0140] In the present application, phytase activity can be measured and evaluated using methods known in the art, including the embodiments described in the present application.

[0141]

[0142] In this application, "parent phytase" refers to a phytase that has been modified to produce a variant or mutant polypeptide of the present application. Specifically, the parent phytase, parent enzyme, or parent sequence may be a naturally occurring polypeptide or a wild-type polypeptide, may be a mature polypeptide thereof, may include a variant or functional fragment thereof, but is not limited to any polypeptide that has phytase activity and can be the parent of a variant.

[0143] The parent phytase provided in the present application may be, but is not limited to, a polypeptide of SEQ ID NO: 1. In addition, as long as it has phytase activity, it may be a polypeptide having a sequence identity of at least about 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% with the polypeptide of SEQ ID NO: 1, and as long as it has the same or corresponding activity as the polypeptide consisting of the amino acid sequence of SEQ ID NO: 1, it may be included in the scope of the parent phytase without limitation.

[0144] In the present application, the parent phytase may include an amino acid sequence having sequence number 1 and a sequence identity of 90% or more therewith.

[0145]

[0146] The parent phytase of the mutant polypeptide provided in the present application may be derived from, but is not limited to, Turicimonas muris.

[0147] Meanwhile, the above-mentioned microorganism is an example of a microorganism from which the parent phytase provided in the present application can be derived, and includes a microorganism derived from a taxonomically homologous microorganism, regardless of the name of the microorganism.

[0148] In the present application, a sequence "derived from" a particular microorganism is not limited to a sequence that is naturally produced or can be produced in the microorganism, but also includes a sequence encoded by a gene that is produced and isolated from the microorganism containing the gene.

[0149] For example, a phytase derived from the genus Thurisimonas includes enzymes having phytase activity that are naturally produced in Thurisimonas, as well as those produced from a Thurisimonas source, and those produced in other host cells through genetic modification known in the art (e.g., transformation with a sequence encoding the enzyme).

[0150]

[0151] In the present application, the “variant polypeptide having phytase activity” may be a variant of the parent phytase.

[0152] In this application, the term "mutant of parent phytase" or "phytase mutant" refers to a protein having one or more amino acids different from the amino acid sequence of the parent phytase and having phytase activity.

[0153] The above “mutant polypeptide having phytase activity”, “mutant of parent phytase” and “phytase mutant” can be used interchangeably.

[0154] The variant polypeptide provided in the present application may have phytase activity and include modifications of one or more amino acids in the parent phytase sequence. In addition, the variant polypeptide of the present application is i) a polypeptide having 70% or more and less than 100% sequence identity with an amino acid sequence having 90% or more sequence identity therewith; and / or ii) the variant polypeptide is a polypeptide encoded by a polynucleotide having 70% or more and less than 100% sequence identity with a sequence encoding a mature polypeptide of SEQ ID NO: 1 or an amino acid sequence having 90% or more sequence identity therewith; And / or iii) the variant polypeptide may be a polypeptide encoded by (a) a mature polypeptide coding sequence of SEQ ID NO: 1 or an amino acid sequence having at least 90% sequence identity thereto, (b) a cDNA thereof, or (c) a polynucleotide that hybridizes to the full-length complement of (a) or (b) under low stringency conditions, medium stringency conditions, medium-high stringency conditions, high stringency conditions, or very high stringency conditions.

[0155] Specifically, the variant polypeptide provided in the present application may have one or more altered functions or properties compared to the parent phytase, including modification of one or more amino acids in the parent phytase sequence, while having phytase activity.

[0156] In one specific example, the variant polypeptide provided in the present application has phytase activity, and may have one or more altered functions or properties compared to the parent phytase, including modification of one or more amino acids in the parent phytase sequence, and may have one or more conservative substitutions.

[0157]

[0158] The mutant polypeptide provided in the present application may be a mutant of a parent phytase and may be a polypeptide having phytase activity.

[0159] In one specific example, the mutant polypeptide provided in the present application is selected from the group consisting of 33, 44, 46, 48, 49, 51, 57, 58, 62, 63, 76, 80, 91, 92, 102, 112, 122, 125, 128, 135, 141, 157, 164, 178, 186, 188, 199, 212, 229, 231, 233, 237, 239, 247, 250, 255, 261, 279, 285, It may include modifications at one or more positions corresponding to positions 297, 311, 317, 343, 359, 9, 11, 38, 39, 85, 98, 113, 123, 131, 165, 166, 167, 215, 242, 263, 266, 280, 309, 310, 365, and 367.

[0160] In this application, the position number is a position corresponding to the position of the polypeptide of sequence number 1, and “corresponding” is as described above.

[0161] The variant polypeptides provided in this application include all possible combinations of the above-described modifications.

[0162]

[0163] In one specific example, the mutant polypeptide provided in the present application is a mutant polypeptide having phytase activity, which is at least one of the following i) to iii):

[0164] i) a polypeptide having the amino acid sequence of sequence number 1 or a sequence identity of at least 90% thereto;

[0165] ii) a polypeptide encoded by a polynucleotide encoding a mature polypeptide having the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having at least 90% sequence identity thereto;

[0166] iii) a polypeptide encoded by (a) a mature polypeptide coding sequence of SEQ ID NO: 1 or an amino acid sequence having at least 90% sequence identity thereto, (b) a cDNA thereof, or (c) a polynucleotide that hybridizes to the full-length complement of (a) or (b) under low stringency conditions, medium stringency conditions, medium-high stringency conditions, high stringency conditions, or very high stringency conditions,

[0167] It may be a mutant polypeptide comprising a substitution of an amino acid at one or more positions selected from the following:

[0168] 33, 44, 46, 48, 49, 51, 57, 58, 62, 63, 76, 80, 91, 92, 102, 112, 122, 125, 128, 135, 141, 157, 164, 178, 186, 188, 199, 212, 229, 231, 233, 237, 239, 247, 250, 255, 261, 279, 285, 297, 311, 317, 343 and 359 (wherein the position numbers correspond to the positions of the polypeptide of SEQ ID NO: 1).

[0169] In one specific example, the amino acids before modification of the variant polypeptide provided in the present application may be any one or more selected from the following: amino acids 33 and 239 are methionine; amino acids 44, 48, 92, and 255 are glutamic acid; amino acids 46, 58, 62, 188, 212, 250, 261, and 279 are glycine; amino acids 49, 112, 122, 128, and 164 are lysine; amino acids 51 and 57 are tyrosine; amino acid 63 is threonine; amino acids 76, 102, 125, 186, 233, 247, and 343 are serine; Amino acids 80, 285, and 311 are asparagine; amino acid 91 is aspartic acid; amino acids 135 and 237 are arginine; amino acids 141 and 178 are alanine; amino acid 157 is histidine; amino acids 199 and 359 are leucine; and amino acids 229, 231, 297, and 317 are valine.

[0170]

[0171] In one specific example, the variant polypeptide of the present application may comprise an amino acid substitution at any one or more positions selected from the following: 46; 48; 51; 57; 58; 62; 76; 80; 112; 122; 125; 128; 135; 157; 164; 186; 188; 199; 212; 229; 231; 233; 237; 239; 250; 261; 279; 285; 297; 311; 317; 343; 91 and 92; 141 and 178; 247 and 359; 255 and 317 (wherein the position numbers correspond to the positions of the polypeptide of SEQ ID NO: 1).

[0172] In one specific example of the above-described specific examples, the variant polypeptide of the present application may comprise one or more amino acid substitutions selected from the following: substitution of amino acid 46 with proline; substitution of amino acid 48 with proline; substitution of amino acid 51 with a positively charged (basic) amino acid, specifically lysine, arginine, or histidine; substitution of amino acid 57 with glycine; substitution of amino acid 58 with tyrosine; substitution of amino acid 62 with alanine; substitution of amino acid 76 with proline; substitution of amino acid 80 with alanine; substitution of amino acid 112 with proline; substitution of amino acid 122 with proline; substitution of amino acid 125 with histidine; substitution of amino acid 128 with glutamic acid; Substitution of amino acid position 135 with a negatively charged (acidic) amino acid, specifically aspartic acid or glutamic acid; substitution of amino acid position 157 with proline; substitution of amino acid position 164 with isoleucine; substitution of amino acid position 186 with aspartic acid; substitution of amino acid position 188 with alanine; substitution of amino acid position 199 with phenylalanine; substitution of amino acid position 212 with alanine; substitution of amino acid position 229 with alanine; substitution of amino acid position 231 with alanine; substitution of amino acid position 233 with aspartic acid; substitution of amino acid position 237 with glycine; substitution of amino acid position 239 with proline; substitution of amino acid position 250 with alanine; substitution of amino acid position 261 with aspartic acid; substitution of amino acid position 279 with serine; substitution of amino acid position 285 with aspartic acid; Substitution of amino acid 297 with proline; substitution of amino acid 311 with aspartic acid; substitution of amino acid 343 with proline; substitution of amino acid 91 with asparagine and substitution of amino acid 92 with glutamine; substitution of amino acids 141 and 178 with cysteine; substitution of amino acids 247 and 359 with cysteine; and substitution of amino acid 255 with glycine and substitution of amino acid 317 with alanine.

[0173] In one specific example of the above-described specific examples, the mutant polypeptide of the present application may include one or more amino acid substitutions selected from, but not limited to: G46P; E48P; Y51K, Y51R, or Y51H; Y57G; G58Y; G62A; S76P; N80A; K112P; K122P; S125H; K128E; R135D or R135E; H157P; K164I; S186D; G188A; L199F; G212A; V229A; V231A; S233D; R237G; M239P; G250A; G261D; G279S; N285D; V297P; N311D; S343P; D91N+E92Q; A141C+A178C; S247C+L359C; and E255G+V317A.

[0174] In one specific example, the variant polypeptide of the present application may comprise an amino acid substitution at any one or more positions selected from, but not limited to: positions 186 and 80; positions 102 and 80; positions 285 and 80; positions 285, 102, and 80; positions 239, 186, 285, and 80; positions 135 and 250; positions 33, 44, 48, 49, 58, 62, and 63 (wherein the position numbers correspond to positions of the polypeptide of SEQ ID NO: 1).

[0175] In one specific example of the above-described specific example, the mutant polypeptide may include one or more amino acid substitutions selected from, but not limited to: substitution of amino acid 186 with aspartic acid and substitution of amino acid 80 with alanine; substitution of amino acid 102 with leucine and substitution of amino acid 80 with alanine; substitution of amino acid 285 with aspartic acid and substitution of amino acid 80 with alanine; substitution of amino acid 285 with aspartic acid, substitution of amino acid 102 with leucine, and substitution of amino acid 80 with alanine; substitution of amino acid 239 with proline, substitution of amino acids 186 and 285 with aspartic acid, and substitution of amino acid 80 with alanine; substitution of amino acid 135 with aspartic acid and substitution of amino acid 250 with alanine; and substitution of amino acid 33 with threonine, substitution of amino acid 44 with aspartic acid, substitution of amino acids 48 and 49 with proline, substitution of amino acid 58 with tyrosine, substitution of amino acid 62 with alanine, and substitution of amino acid 63 with glutamine.

[0176] In one specific example of the above-described specific examples, the mutant polypeptide of the present application may include one or more amino acid substitutions selected from, but not limited to: S186D+N80A; S102L+N80A; N285D+N80A; N285D+S102L+N80A; M239P+S186D+N285D+N80A; R135D+G250A; and M33T+E44D+E48P+K49P+G58Y+G62A+T63Q.

[0177]

[0178] In one specific example, the variant polypeptide of the present application may comprise, consist of, consist essentially of, or have an amino acid sequence of SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, and SEQ ID NO: 11 to SEQ ID NO: 68 or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0179] For example, in the present application, a variant polypeptide comprising a V231A substitution in SEQ ID NO: 1 is represented by SEQ ID NO: 11; a variant polypeptide comprising a K128E substitution is represented by SEQ ID NO: 12; a variant polypeptide comprising an E255G+V317A substitution is represented by SEQ ID NO: 13; a variant polypeptide comprising an E48P substitution is represented by SEQ ID NO: 14; a variant polypeptide comprising a G58Y substitution is represented by SEQ ID NO: 15; a variant polypeptide comprising a G250A substitution is represented by SEQ ID NO: 16; a variant polypeptide comprising a G188A substitution is represented by SEQ ID NO: 17; a variant polypeptide comprising a R135D substitution is represented by SEQ ID NO: 18; a variant polypeptide comprising a G62A substitution is represented by SEQ ID NO: 19; a variant polypeptide comprising an A141C+A178C substitution is represented by SEQ ID NO: 20; A variant polypeptide comprising a K112P substitution has a sequence number of SEQ ID NO: 21; a variant polypeptide comprising a K122P substitution has a sequence number of SEQ ID NO: 22; a variant polypeptide comprising a G279S substitution has a sequence number of SEQ ID NO: 23; a variant polypeptide comprising a V297P substitution has a sequence number of SEQ ID NO: 24; a variant polypeptide comprising a V229A substitution has a sequence number of SEQ ID NO: 25; a variant polypeptide comprising a R237G substitution has a sequence number of SEQ ID NO: 26; a variant polypeptide comprising a R135E substitution has a sequence number of SEQ ID NO: 27; a variant polypeptide comprising a G261D substitution has a sequence number of SEQ ID NO: 28; a variant polypeptide comprising a N311D substitution has a sequence number of SEQ ID NO: 29; a variant polypeptide comprising a S343P substitution has a sequence number of SEQ ID NO: 30; a variant polypeptide comprising a S76P substitution has a sequence number of SEQ ID NO: 31; A variant polypeptide comprising a D91N+E92Q substitution has a sequence number of SEQ ID NO: 32; a variant polypeptide comprising a M239P substitution has a sequence number of SEQ ID NO: 33; a variant polypeptide comprising a S233D substitution has a sequence number of SEQ ID NO: 34; a variant polypeptide comprising a G212A substitution has a sequence number of SEQ ID NO: 35; a variant polypeptide comprising a L199F substitution has a sequence number of SEQ ID NO: 36; a variant polypeptide comprising a S186D substitution has a sequence number of SEQ ID NO: 37;A variant polypeptide comprising an N285D substitution has a sequence number of SEQ ID NO: 38; a variant polypeptide comprising an H157P substitution has a sequence number of SEQ ID NO: 39; a variant polypeptide comprising an S125H substitution has a sequence number of SEQ ID NO: 40; a variant polypeptide comprising an N80A substitution has a sequence number of SEQ ID NO: 41; a variant polypeptide comprising an Y57G substitution has a sequence number of SEQ ID NO: 42; a variant polypeptide comprising an Y51K substitution has a sequence number of SEQ ID NO: 43; a variant polypeptide comprising an Y51R substitution has a sequence number of SEQ ID NO: 44; a variant polypeptide comprising an Y51H substitution has a sequence number of SEQ ID NO: 45; a variant polypeptide comprising an G46P substitution has a sequence number of SEQ ID NO: 46; a variant polypeptide comprising an S247C+L359C substitution has a sequence number of SEQ ID NO: 47; a variant polypeptide comprising an S186D+N80A substitution has a sequence number of SEQ ID NO: 48; A variant polypeptide comprising a S102L+N80A substitution may be represented by an amino acid sequence as set forth in SEQ ID NO: 49; a variant polypeptide comprising a N285D+N80A substitution may be represented by an amino acid sequence as set forth in SEQ ID NO: 50; a variant polypeptide comprising a N285D+S102L+N80A substitution may be represented by an amino acid sequence as set forth in SEQ ID NO: 51; and a variant polypeptide comprising a M239P+S186D+N285D+N80A substitution may be represented by an amino acid sequence as set forth in SEQ ID NO: 52. These variant polypeptides may comprise, consist essentially of, or have an amino acid sequence of the above SEQ ID NO: or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto while comprising the above-described substitutions.

[0180]

[0181] As a specific example, a variant polypeptide comprising M33T, E44D, E48P, K49P, G58Y, G62A, and T63Q substitutions in SEQ ID NO: 1 in the present application may be represented by SEQ ID NO: 3.

[0182] In one specific example, the variant polypeptide of the present application may comprise, consist of, consist essentially of, or have a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence of SEQ ID NO: 3.

[0183] In one specific example, the variant polypeptide of the present application may be a variant polypeptide further comprising a substitution of an amino acid at any one or more positions selected from the following: positions 33; 51; 125; 250; 11 and 309; positions 9 and 309; positions 9 and 310; positions 98 and 113; positions 242 and 280; positions 85 and 263; positions 85 and 266; positions 131 and 365; positions 122 and 365; positions 122 and 367; positions 123 and 367; positions 165 and 212; positions 165 and 215; positions 38 and 166; and positions 39 and 167 (wherein the position numbers correspond to positions of the polypeptide of SEQ ID NO: 3).

[0184] In one specific example, the variant polypeptide of the present application may be a variant polypeptide further comprising a substitution of an amino acid at one or more positions selected from the following: positions 33, 51, 125 and 250 (wherein the position numbers correspond to positions of the polypeptide of SEQ ID NO: 3).

[0185] In one specific example, the amino acid before modification of the mutant polypeptide may be any one or more selected from the following: amino acid position 33 is threonine; amino acid position 51 is tyrosine; amino acid position 125 is serine; and amino acid position 250 is glycine.

[0186] In one specific example, the variant polypeptide may include a substitution of amino acid position 33 with lysine; amino acid position 51 with arginine; amino acid position 125 with asparagine; and amino acid position 250 with phenylalanine.

[0187] The above mutant polypeptide may comprise one or more amino acid substitutions selected from, but not limited to: T33K; Y51R; S125N; and G250F.

[0188]

[0189] In one specific example, the variant polypeptide comprising the T33K substitution in SEQ ID NO: 3 in the present application may be represented by SEQ ID NO: 88; the variant polypeptide comprising the Y51R substitution may be represented by SEQ ID NO: 89; the variant polypeptide comprising the S125N substitution may be represented by SEQ ID NO: 90; and the variant polypeptide comprising the G250F substitution may be represented by SEQ ID NO: 91. These variant polypeptides may comprise, consist essentially of, or have an amino acid sequence of the above SEQ ID NO: or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto while including the above-described substitutions.

[0190]

[0191] In one specific example, the amino acids before modification of the mutant polypeptide may be any one or more selected from the following: amino acids 11, 85, and 167 are glutamic acid; amino acids 9, 113, 131, 165, and 309 are valine; amino acid 123 is leucine; amino acid 237 is arginine; amino acids 62, 98, 242, 280, and 365 are alanine; amino acids 212 and 310 are glycine; amino acids 166 and 266 are threonine; amino acid 38 is serine; amino acids 39 and 263 are proline; amino acid 122 is lysine; amino acid 367 is aspartic acid; and amino acid 215 is glutamine.

[0192] In one specific example, amino acids 11 and 309; 9 and 309; 9 and 310; 98 and 113; 242 and 280; 85 and 263; 85 and 266; 131 and 365; 122 and 365; 122 and 367; 123 and 367; 165 and 212; 165 and 215; 38 and 166; and 39 and 167 may include substitutions with hydrophilic amino acids, specifically cysteine.

[0193] The above mutant polypeptide may comprise one or more amino acid substitutions selected from, but not limited to: E11C+V309C; V9C+V309C; and V9C+G310C.

[0194] In one specific example, a variant polypeptide having one or more positions substituted at positions corresponding to the positions of the polypeptide of SEQ ID NO: 3 (e.g., E11C+V309C) may further include one or more substitutions selected from the following: substitution of amino acids 98 and 113 with cysteine; substitution of amino acids 242 and 280 with cysteine; substitution of amino acids 85 and 263 with cysteine; substitution of amino acids 85 and 266 with cysteine; substitution of amino acids 131 and 365 with cysteine; substitution of amino acids 122 and 365 with cysteine; substitution of amino acids 122 and 367 with cysteine; substitution of amino acids 123 and 367 with cysteine; substitution of amino acids 165 and 212 with cysteine; Substitution of amino acids 165 and 215 with cysteine; substitution of amino acids 38 and 166 with cysteine; and substitution of amino acids 39 and 167 with cysteine ​​(wherein the position numbers correspond to the positions of the polypeptide of SEQ ID NO: 3).

[0195] In one specific example of the above-described specific embodiments, the mutant polypeptide may comprise an amino acid substitution selected from, but not limited to: substitution of amino acids 11, 309, 98, and 113 with cysteine; substitution of amino acids 11, 309, 242, and 280 with cysteine; substitution of amino acids 11, 309, 85, and 263 with cysteine; substitution of amino acids 11, 309, 85, and 266 with cysteine; substitution of amino acids 11, 309, 131, and 365 with cysteine; substitution of amino acids 11, 309, 122, and 365 with cysteine; Substitution of amino acids 11, 309, 122, and 367 with cysteine; substitution of amino acids 11, 309, 123, and 367 with cysteine; substitution of amino acids 11, 309, 85, 263, 122, and 367 with cysteine; substitution of amino acids 11, 309, 9, and 310 with cysteine; substitution of amino acids 11, 309, 85, 263, 165, and 212 with cysteine; substitution of amino acids 11, 309, 85, 263, 165, and 215 with cysteine; Substitution of amino acids 11, 309, 85, 263, 38, and 166 with cysteine; and substitution of amino acids 11, 309, 85, 263, 39, and 167 with cysteine.

[0196] In one specific example of the above-described specific example, the mutant polypeptide may include one or more amino acid substitutions selected from, but not limited to: A98C+V113C; A242C+A280C; E85C+P263C; E85C+T266C; V131C+A365C; K122C+A365C; K122C+D367C; L123C+D367C; V165C+G212C; V165C+Q215C; S38C+T166C; and P39C+E167C.

[0197] In one specific example of the above-described specific example, the mutant polypeptide may comprise an amino acid substitution selected from, but not limited to: E11C+V309C+A98C+V113C; E11C+V309C+A242C+A280C; E11C+V309C+E85C+P263C; E11C+V309C+E85C+T266C; E11C+V309C+V131C+A365C; E11C+V309C+K122C+A365C; E11C+V309C+K122C+D367C; E11C+V309C+L123C+D367C; E11C+V309C+E85C+P263C+K122C+D367C; E11C+V309C+V9C+G310C; E11C+V309C+E85C+P263C+V165C+G212C; E11C+V309C+E85C+P263C+V165C+Q215C; E11C+V309C+E85C+P263C+S38C+T166C; and E11C+V309C+E85C+P263C+P39C+E167C.

[0198]

[0199] In one specific example, in the present application, a variant polypeptide comprising an E11C+V309C substitution in SEQ ID NO: 3 is represented by SEQ ID NO: 53; a variant polypeptide comprising a V9C+V309C substitution is represented by SEQ ID NO: 54; a variant polypeptide comprising a V9C+G310C substitution is represented by SEQ ID NO: 55; a variant polypeptide comprising an E11C+V309C+A98C+V113C substitution is represented by SEQ ID NO: 56; a variant polypeptide comprising an E11C+V309C+A242C+A280C substitution is represented by SEQ ID NO: 57; a variant polypeptide comprising an E11C+V309C+E85C+T266C substitution is represented by SEQ ID NO: 58; a variant polypeptide comprising an E11C+V309C+V131C+A365C substitution is represented by SEQ ID NO: 59; A variant polypeptide comprising an E11C+V309C+K122C+A365C substitution has a SEQ ID NO: 60; A variant polypeptide comprising an E11C+V309C+K122C+D367C substitution has a SEQ ID NO: 61; A variant polypeptide comprising an E11C+V309C+L123C+D367C substitution has a SEQ ID NO: 62; A variant polypeptide comprising an E11C+V309C+E85C+P263C+K122C+D367C substitution has a SEQ ID NO: 63; A variant polypeptide comprising an E11C+V309C+V9C+G310C substitution has a SEQ ID NO: 64; A variant polypeptide comprising the substitution E11C+V309C+E85C+P263C+V165C+G212C may be represented by the amino acid sequence of SEQ ID NO: 65; a variant polypeptide comprising the substitution E11C+V309C+E85C+P263C+V165C+Q215C may be represented by the amino acid sequence of SEQ ID NO: 66; a variant polypeptide comprising the substitution E11C+V309C+E85C+P263C+S38C+T166C may be represented by the amino acid sequence of SEQ ID NO: 67; and a variant polypeptide comprising the substitution E11C+V309C+E85C+P263C+P39C+E167C may be represented by the amino acid sequence of SEQ ID NO: 68.These variant polypeptides may comprise, consist essentially of, or have an amino acid sequence of the above sequence number or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, while including the substitutions described above.

[0200]

[0201] As a specific example, a variant polypeptide comprising E11C, V309C, E85C, and P263C substitutions in SEQ ID NO: 3 in the present application may be represented by SEQ ID NO: 5.

[0202] In one specific example, the variant polypeptide of the present application may comprise, consist of, consist essentially of, or have a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence of SEQ ID NO: 5.

[0203] In one specific example of the above-described specific example, the variant polypeptide of the present application may comprise any one of the following modifications selected from the amino acid sequence of SEQ ID NO: 5:

[0204] (i) deletion of amino acids at positions 1 to 10 from the N-terminus of SEQ ID NO: 5; and (ii) replacement of amino acids at positions 1 to 8 of SEQ ID NO: 5 with leucine, asparagine, serine, serine, valine, proline, glycine, and alanine, respectively (wherein the position numbers correspond to the positions of the polypeptide of SEQ ID NO: 5).

[0205] In one specific example, the amino acid before substitution of the mutant polypeptide may be any one or more selected from the following: amino acid 1 is glutamine; amino acid 2 is glutamic acid; amino acids 3 and 8 are leucine; amino acid 4 is isoleucine; amino acid 5 is proline; amino acid 6 is glycine; and amino acid 7 is threonine.

[0206] In one specific example, the mutant polypeptide of (ii) above may include the following amino acid substitutions: amino acid 1, glutamine, is replaced with leucine; amino acid 2, glutamic acid, is replaced with asparagine; amino acid 3, leucine, is replaced with serine; amino acid 4, isoleucine, is replaced with serine; amino acid 5, proline, is replaced with valine; amino acid 6, glycine, is replaced with proline; amino acid 7, threonine, is replaced with glycine; and amino acid 8, leucine, is replaced with alanine.

[0207] As a specific example, the variant polypeptide may comprise, but is not limited to, the following amino acid substitutions: Q1L+E2N+L3S+I4S+P5V+G6P+T7G+L8A.

[0208] In one specific example, the mutant polypeptide may comprise one or more amino acids of SEQ ID NO: 7 and SEQ ID NO: 9, and the mutant polypeptides of (i) and (ii) may be SEQ ID NO: 7 and SEQ ID NO: 9, respectively.

[0209]

[0210] In one specific example, the variant polypeptide provided in the present application may have a sequence identity of at least about 60%, for example, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% and less than 100% to the parent phytase; its mature polypeptide or a functional fragment thereof.

[0211] In one specific example, the variant polypeptide provided in the present application may have an amino acid sequence having at least 90% sequence identity with SEQ ID NO: 1, SEQ ID NO: 3, or one or more thereof, and at least about 60%, for example, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% and less than 100% sequence identity.

[0212] In one specific example, the variant polypeptide provided in the present application can be a polypeptide encoded by a polynucleotide having a sequence identity of at least about 60%, for example, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% and less than 100%, to a sequence encoding a mature polypeptide of SEQ ID NO: 1, SEQ ID NO: 3, or at least one of them.

[0213] In one specific example, the variant polypeptide provided in the present application may have a functional fragment of an amino acid sequence having at least 90% sequence identity with SEQ ID NO: 1, SEQ ID NO: 3, or any one of SEQ ID NOs: 1 and 3, and at least about 60%, for example, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% and less than 100% sequence identity.

[0214]

[0215] The variant polypeptides provided in the present application may have one or more altered properties or attributes of the polypeptide that can be selected or detected compared to other phytases, such as wild-type phytase, parent phytase, other phytase variants, etc.

[0216] The above properties or attributes include, but are not limited to, oxidative stability, substrate specificity, catalytic activity, thermal stability, alkaline stability, pH activity profile, resistance to proteolysis, Km, kcat, kcat / Km ratio, protein folding, induction of an immune response, ability to bind a ligand, ability to bind a receptor, ability to be secreted, ability to be displayed on the surface of cells, ability to form oligomers, ability to signal, ability to promote cell proliferation, ability to inhibit cell proliferation, ability to induce apoptosis, ability to be modified by phosphorylation or glycosylation, and / or ability to treat a disease.

[0217]

[0218] Specifically, the variant polypeptides provided in the present application may have one or more of the following altered activities compared to the parent sequence:

[0219] i) Increase or decrease in enzyme activity;

[0220] ii) increase or decrease in specific activity; and

[0221] iii) Increase or decrease in heat resistance; but is not limited thereto.

[0222]

[0223] In the present application, "enzymatic activity" refers to at least one catalytic activity. Specifically, it may be, but is not limited to, the conversion efficiency of an enzyme, which is mainly expressed as kcat / Km.

[0224] kcat is the catalytic constant for the conversion of a single enzyme into a product per unit time when the enzyme is completely saturated with substrate, and is also called the turnover number. Km is the substrate concentration when the reaction rate is half of the maximum value (Vmax).

[0225] Examples of ways to express enzyme activity include specific activity (umol of converted substrate x mg -1 x min -1) or volumetric activity (umol of converted substrate x mL -1 x min -1).

[0226] However, the definition of enzyme activity is not limited to the above-mentioned content, and can be defined and evaluated based on known content such as Irwin H. Segel, Enzyme kinetics, John Wiley & Sons, 1979; AG Marangoni, Enzyme kinetics, Wiley-Interscience, 2003; A. Fersht, Enzyme structure and mechanisms, John Wiley & Sons, 1981; Structure and Mechanism in Protein Science: A guide to enzyme catalysis and protein folding, Alan Fersht, WH Freeman, 1999; Fundamentals of Enzyme Kinetics, Athel Cornish-Bowden, Wiley-Blackwell 2012 and Voet ef a / ., "Biochemie" [Biochemistry], 1992, VCH-Verlag, Chapter 13, pages 331-332 with respect to enzymatic activity.

[0227]

[0228] In one specific example, the variant polypeptide provided in the present application may have an increased enzymatic activity of about 101% or about 110% or more compared to the parent enzyme.

[0229] In another specific embodiment, the variant polypeptide provided in the present application may have a reduced enzymatic activity of about 99%, about 95%, or about 90% or less compared to the parent enzyme.

[0230]

[0231] The term "specific activity" in this application refers to the activity of an enzyme per unit weight of protein, expressed as unit / mg. Protein quantification can be performed, for example, using SDS-PAGE or the Bradford assay.

[0232] Enzyme stability refers to the preservation of enzyme activity during storage or reaction time. To measure changes in this stability, the initial enzyme activity is measured at time zero (100%) and after a specified time (x%) under defined conditions. This comparison allows for the expression of enzyme stability, or the level at which enzyme activity is lost.

[0233]

[0234] Factors that affect enzyme activity include, for example, pH, heat, and the presence of other substances (e.g., oxidizing agents, chelating agents).

[0235]

[0236] As used herein, the term "pH stability" refers to the ability of a protein to function within a specific pH range. In one specific example, the variant polypeptide provided herein may be active at a pH ranging from about pH 3.0 to about pH 12.0, but is not limited thereto. A protein that maintains its function within a specific pH range is defined as having "pH stability," and depending on the pH range, it may be defined as having "acid resistance," "alkali resistance," etc.

[0237]

[0238] As used herein, the term "thermal stability" refers to the ability of a protein to function within a specific temperature range. In one specific example, the variant polypeptide provided in this application may be active in a temperature range of about 20°C to about 70°C, but is not limited thereto.

[0239] As used herein, the term "thermal tolerance" refers to the ability of a protein to function after exposure to a specific temperature, such as high or low temperatures. For example, a protein that is thermostable may not function at the temperature to which it is exposed, but may regain function when returned to its optimal temperature environment.

[0240]

[0241] Increased stability includes maintaining high enzymatic activity compared to other enzymes, e.g., wild-type enzymes, parent enzymes, and / or other mutant polypeptides; increasing the range of pH, temperature, and / or time over which the protein remains functional.

[0242] Decreased stability includes lower retention of enzyme activity compared to other enzymes, e.g., wild-type enzymes, parent enzymes, and / or other mutant polypeptides; a decrease in the range of pH, temperature, and / or time over which the protein remains functional.

[0243]

[0244] As used herein, the term "substrate specificity" refers to the ability of an enzyme to distinguish between substrates and molecules that compete with the substrate. Substrate specificity can be determined by measuring the activity of an enzyme toward different substrates. In one embodiment, the change in substrate specificity may be a change in the direction of increasing specificity toward a substrate capable of producing a desired product. In another embodiment, the change in substrate specificity may be a change in the direction of decreasing specificity toward a substrate capable of producing a desired product.

[0245]

[0246] The altered properties of the mutant polypeptides provided in the present application may be activities, improved activities, suitable for application in various compositions including foods, feeds, pharmaceuticals, and detergents.

[0247]

[0248] Another aspect of the present application provides a polynucleotide encoding a variant polypeptide of the present application.

[0249] The above mutant polypeptide is as described in other aspects.

[0250] A polynucleotide encoding a variant polypeptide of the present invention may comprise the coding sequence of the variant polypeptide described above. The polynucleotide may undergo various modifications to the coding region within a range that does not alter the amino acid sequence of the polypeptide, due to codon degeneracy or in consideration of codons preferred by the organism intended to express the polypeptide.

[0251] In addition, the polynucleotide of the present application may include, without limitation, a probe that can be prepared from a known gene sequence, for example, a sequence that hybridizes under stringent conditions with a complementary sequence to all or part of the base sequence, so long as it encodes a variant polypeptide of the present application.

[0252] The above "stringent conditions" refer to conditions that allow specific hybridization between polynucleotides. Such conditions are specifically described in the literature (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).

[0253] For example, conditions in which polynucleotides having a high degree of homology or identity hybridize with each other, specifically with a homology or identity of 40% or more, specifically with a homology or identity of 90% or more, more specifically with a homology or identity of 95% or more, 96% or more, 97% or more, 98% or more, and even more specifically with a homology or identity of 99% or more, and polynucleotides having a lower degree of homology or identity than that hybridize, or conditions in which washing is performed once, specifically twice or three times, at a salt concentration and temperature corresponding to 60°C 1XSSC, 0.1% SDS, specifically with 60°C 0.1XSSC, 0.1% SDS, and more specifically with 68°C 0.1XSSC, 0.1% SDS, which are washing conditions of typical southern hybridization, can be listed.

[0254] Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Therefore, the polynucleotides of the present application may also include isolated nucleic acid fragments that are complementary in their entirety, as well as substantially similar nucleic acid sequences.

[0255] Specifically, polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. In addition, the Tm value may be, but is not limited to, 60°C, 63°C, or 65°C and can be appropriately adjusted by those skilled in the art depending on the purpose.

[0256] The appropriate stringency for hybridizing polynucleotides depends on the length and degree of complementarity of the polynucleotides, variables well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).

[0257] For example, “high stringency” may occur at about 5 to 10°C below the Tm of the probe; “medium stringency” may occur at about 10 to 20°C below the Tm of the probe; and “low stringency” may occur at about 20 to 25°C below the Tm, but is not limited thereto.

[0258] For example, “low stringency conditions” can be prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms / ml of sheared and denatured salmon sperm DNA, and 25% formamide for 12-24 hours, for a probe of at least 100 nucleotides in length, according to standard Southern blotting procedures. The carrier material can be finally washed two to three times for 15 minutes each with 2 X SSC, 0.1 to 0.2% SDS at 50°C.

[0259] For example, “medium stringency conditions” can be prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms / ml of sheared and denatured salmon sperm DNA, and 35% formamide for 12-24 hours, for a probe of at least 100 nucleotides in length, according to standard Southern blotting procedures. The carrier material can be finally washed two to three times for 15 minutes each with 2 X SSC, 0.1 to 0.2% SDS at 55°C. For example, “medium-high stringency conditions” can be prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms / ml of sheared and denatured salmon sperm DNA, and 35% formamide for 12-24 hours, for a probe of at least 100 nucleotides in length, according to standard Southern blotting procedures. The carrier material can be finally washed two to three times for 15 minutes each with 1 to 2 X SSC, 0.1 to 0.2% SDS at 60°C.

[0260] For example, “high stringency conditions” can be prehybridization and hybridization at 42°C in 5 X SSPE, 0.3% SDS, 200 micrograms / ml of sheared and denatured salmon sperm DNA, and 35% formamide for 12-24 hours, for a probe of at least 100 nucleotides in length, according to standard Southern blotting procedures. The carrier material can be finally washed two to three times for 15 minutes each with 2 X SSC, 0.1 to 0.2% SDS at 65°C.

[0261] In one specific example, the polynucleotide sequence encoding the variant polypeptide of the present application may comprise, consist of, consist essentially of, or have, or may be a degenerate sequence thereof, of the polynucleotide sequences of SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, and SEQ ID NO: 10, or a sequence having at least 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, but is not limited thereto.

[0262] As a specific example, the sequence encoding the amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, and SEQ ID NO: 9 of the present application may be, but is not limited to, the polynucleotide sequences of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, and SEQ ID NO: 10, respectively. In addition, it is obvious that a polynucleotide sequence encoding a variant polypeptide of the present application can be obtained based on the technical common sense of a person skilled in the art.

[0263] Another aspect of the present application provides a nucleic acid construct comprising a polynucleotide of the present application.

[0264] Another aspect of the present application provides a vector comprising a polynucleotide of the present application or a nucleic acid construct of the present application.

[0265] The above polynucleotide is as described in other aspects of the present application.

[0266] The nucleic acid construct provided in the present application comprises a polynucleotide encoding a variant polypeptide provided in the present application, operably linked to one or more regulatory sequences that direct expression of the coding sequence in a suitable host cell under conditions suitable for the regulatory sequences.

[0267] Polynucleotides can be manipulated in a variety of ways to enable the expression of variant polypeptides. Depending on the expression vector, it may be desirable or necessary to manipulate the polynucleotide before inserting it into the vector. Such manipulations can be performed using methods known in the art.

[0268]

[0269] The "vector" provided in the present application refers to a DNA construct containing a base sequence of a polynucleotide encoding a variant polypeptide of the present application, operably linked to a suitable expression control region (or expression control sequence) so as to enable expression of the variant polypeptide of the present application in a suitable host. The expression control region may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After being transformed into a suitable host cell, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself.

[0270] The vector that can be used in the present application is not particularly limited, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used as plasmid vectors. Specifically, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors can be used.

[0271] For example, a polynucleotide encoding a variant polypeptide provided in the present application can be inserted into a chromosome via a vector for intracellular chromosomal insertion. The insertion of the polynucleotide into the chromosome can be achieved by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker for confirming the chromosomal insertion can be additionally included. The selection marker is used to select cells transformed with the vector, i.e., to confirm the insertion of the target nucleic acid molecule, and markers that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or expression of a surface polypeptide, can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, so that transformed cells can be selected.

[0272]

[0273] Another aspect of the present application provides a host cell comprising at least one of the variant polypeptide of the present application, the polynucleotide of the present application, the nucleic acid construct of the present application, and the vector of the present application.

[0274] The above mutant polypeptides, polynucleotides, nucleic acid structures, and vectors are as described in other aspects.

[0275] The host cell of the present application may include, without limitation, any cell capable of expressing the mutant polypeptide of the present application.

[0276] The host cell of the present application may comprise the above-described mutant polypeptide, a polynucleotide encoding the mutant polypeptide, a nucleic acid construct comprising the same, and / or a vector.

[0277] The nucleic acid construct or vector may be integrated into a chromosome as described above, or may be maintained as an extrachromosomal vector that replicates autonomously.

[0278] The host cell of the present invention includes any progeny of the parent cell that are not identical to the parent cell due to mutations that occur during replication.

[0279] The host cell may be any cell useful for the recombinant production of a variant polypeptide, e.g., a prokaryotic or eukaryotic cell.

[0280] The prokaryotic host cell can be any gram-positive or gram-negative bacterium.

[0281] Gram-positive bacteria include, but are not limited to, Bacillus, Clostridium, Enterococcus, Geobacillus, Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus, and Streptomyces.

[0282] Gram-negative bacteria include, but are not limited to, Campylobacter, Escherichia coli, Flavobacterium, Fusobacterium, Helicobacter, Iliobacter, Neisseria, Pseudomonas, Salmonella, Vibrio (e.g., Vibrio natriegens), and Ureaplasma.

[0283] In one specific example, the bacterial host cell can be a Bacillus genus host cell, specifically including but not limited to Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis and Bacillus thuringiensis cells.

[0284] In one specific example, the bacterial host cell can be a Streptococcus genus host cell, specifically including but not limited to Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis and Streptococcus equi subspecies Zooepidemicus cells.

[0285] In one specific example, the bacterial host cell may be a host cell of the genus Streptomyces, specifically including but not limited to Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces griseus, and Streptomyces lividans cells.

[0286] In one specific example, the bacterial host cell may be a host cell of the genus Corynebacterium, such as Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes. ammoniagenes), Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris or Corynebacterium flavescens.

[0287] The host cell may be a eukaryote, such as a mammalian, insect, plant, or fungal cell.

[0288] The host cell may be a fungal cell. In the present application, "fungus" includes the Ascomycota, Basidiomycota, Fasciomycota, and Zygomycota, as well as the Oomycota and all imperfect fungi.

[0289] The fungal host cell may be a yeast cell. The term "yeast" in the present application includes yeasts belonging to the order ascosporogenous yeasts (Endomycetales), basidiosporogenous yeasts, and Fungi imperfecti (Blastomycetes). However, this classification may vary and may be defined according to the Biology and Activities of Yeast (Skinner, Passmore, and Davenport, editors, Soc. App. Bacteriol. Symposium Series No. 9, 1980).

[0290] The yeast host cell is a Candida, Hansenula, Kluyveromyces, Pichia, Komagataella, Saccharomyces, Schizosaccharomyces or Yarrowia cell, for example, Pichia pastoris, Kluyveromyces lactis, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, It may be a cell of Saccharomyces norbensis, Saccharomyces oviformis, Komagataella phaffii or Yarrowia lipolytica.

[0291] The fungal host cell may be a filamentous fungal cell. "Filamentous fungi" include all filamentous forms of the phylum Eumycota and the subphylum Oomycota (as defined in the above reference (Hawksworth et al., 1995)). Filamentous fungi are typically characterized by a hyphal wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation, and carbonation is strictly aerobic. In contrast, vegetative growth in yeasts, such as Saccharomyces cerevisiae, is by germination of a unicellular thallus, and carbonation may be fermentative.

[0292] The filamentous fungal host cells are Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Mycellioptora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, It may be a cell of Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes or Trichoderma.

[0293] For example, the filamentous fungal host cells include Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zonatum, Coprinus cinereus, Coriolus hirsutus, Fusarium Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense,Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Mysellioptora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum,It may be a cell of Trichoderma reesei or Trichoderma viride, but is not limited thereto.

[0294]

[0295] Another aspect of the present application provides a composition comprising a variant polypeptide of the present application.

[0296] Another aspect of the present application provides a mutant polypeptide of the present application or a reaction composition comprising the mutant polypeptide for reaction with phytic acid.

[0297] The above mutant polypeptide is as described in other aspects.

[0298] The composition of the present application (including both the composition and the composition for reaction; the same applies hereinafter) can be used to convert phytic acid (which may include a substrate including the same; the same applies hereinafter) into a hydrolyzate of phytic acid.

[0299] The composition of the present application may further comprise other components in addition to the mutant polypeptide provided in the present application. Those skilled in the art can appropriately select the components to be added to the composition of the present application.

[0300] In one specific example, the composition of the present application may further comprise any component suitable for converting phytic acid into a hydrolyzate of phytic acid.

[0301] In one specific example, the composition of the present application may further comprise any component suitable for application in various compositions including foods, feeds, pharmaceuticals, and detergents.

[0302] Examples of substances that may be added include, but are not limited to, stabilizers, surfactants, builders, chelating agents, dispersants, enzymes, enzyme stabilizers, catalysts, activators, carriers, compounding agents, lubricants, disintegrants, excipients, solubilizers, suspending agents, colorants, flavorings, buffers, preservatives, analgesics, solubilizers, isotonic agents, stabilizers, diluents, lubricants, preservatives, and the like.

[0303] In one specific example, the composition provided in the present application may further include a naturally occurring substance or a non-naturally occurring substance in addition to the mutant polypeptide provided in the present application.

[0304] In one specific example, the composition provided in the present application may further comprise, in addition to the mutant polypeptide provided in the present application, additional enzymes used in various compositions including foods, feeds, pharmaceuticals, and detergents.

[0305] For example, the additional enzyme may further comprise one or more enzymes selected from the group consisting of beta-amylase, cellulase (beta-glucosidase, cellobiohydrolase and endoglucanase), glucoamylase, hemicellulase (e.g., xylanase), isoamylase, isomerase, lipase, phytase, protease, pullulanase and / or alpha-amylase, along with other enzymes useful in commercial processes.

[0306]

[0307] Another aspect of the present application provides a method for producing a phytic acid hydrolysate, comprising contacting a substrate with at least one of a variant polypeptide of the present application and a host cell expressing the variant polypeptide.

[0308] Another aspect of the present application provides a method for hydrolyzing phytic acid, comprising contacting a substrate with at least one of a variant polypeptide of the present application and a host cell expressing the variant polypeptide.

[0309] The above substrate may include phytin, but is not limited to, as long as it includes phytic acid.

[0310] The above mutant polypeptide and host cell, etc. are as described in other aspects.

[0311]

[0312] Another aspect of the present application provides a method for producing a variant polypeptide having phytase activity, comprising the step of culturing a host cell.

[0313] The above mutant polypeptide, host cell, and phytase, etc. are as described in other aspects.

[0314] The method for producing the mutant polypeptide of the present application may include a step of recovering the step of culturing the host cell.

[0315] In this application, the term "cultivation" refers to growing the host cells under appropriately controlled environmental conditions. The culturing process of this application can be performed using any suitable medium and culture conditions known in the art. This culturing process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culturing process may be batch, continuous, or fed-batch, but is not limited thereto.

[0316] In this application, the term "medium" refers to a material containing nutrients as a main component necessary for culturing the host cells, and supplies nutrients and growth factors, including water, which is essential for survival and development. Specifically, the medium and other culture conditions used for culturing the host cells of the present application may be any medium used for culturing conventional host cells without particular limitation, but the host cells of the present application may be cultured under aerobic conditions while controlling temperature, pH, etc. in a conventional medium containing an appropriate carbon source, nitrogen source, phosphorus source, inorganic compound, amino acid, and / or vitamin.

[0317] In the present application, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted into reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.

[0318] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc.; peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.

[0319] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.

[0320] In addition, during the cultivation of the host cells, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. can be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during the cultivation, foaming can be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. In addition, in order to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas can be injected into the medium, or in order to maintain the anaerobic and microaerobic state, nitrogen, hydrogen, or carbon dioxide gas can be injected without injecting gas, but is not limited thereto.

[0321] The temperature of the medium may be, but is not limited to, 20°C to 45°C, specifically 25°C to 40°C. The incubation period may continue until the desired amount of useful material is produced, and specifically may be, but is not limited to, 10 to 160 hours.

[0322]

[0323] In one specific example, the method for producing a mutant polypeptide having phytase activity of the present application may further include a step of recovering the mutant polypeptide having phytase activity of the present application expressed in the culturing step.

[0324] In another specific embodiment, the mutant polypeptide expressed in the above-described culturing step can be recovered using methods known in the art. For example, the mutant polypeptide can be recovered from the nutrient medium by conventional procedures, including but not limited to collection, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.

[0325] The above recovery method may be to collect the mutant polypeptide using a suitable method known in the art according to the culture method of the host cell of the present application, for example, a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallizing protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC and a combination of these methods may be used, and the mutant polypeptide may be recovered from the medium or host cell using a suitable method known in the art.

[0326] In another specific embodiment, the mutant polypeptide expressed by the host cell during the culture step may not be recovered. In this specific embodiment, the host cell itself expressing the mutant polypeptide may be used as a source of the mutant polypeptide.

[0327]

[0328] The mutant polypeptide of the present application, the host cell expressing the same, and the composition comprising the mutant polypeptide and / or the host cell can be used to convert a substrate (e.g., myo-inositol hexakisphosphate) into a final product (e.g., 1D-myo-inositol 1,2,3,5,6-pentakisphosphate). In the substrate hydrolysis step, in addition to the mutant polypeptide of the present application, cofactors, coenzymes, etc. can be added. The substrate hydrolysis step can be performed under optimal pH, temperature, etc. conditions, and those skilled in the art can select appropriate conditions.

[0329]

[0330] The mutant polypeptide of the present invention can be used to treat feeds containing grains and oilseeds containing or consisting of phytic acid. Such feeds can be used by mixing one or more of organic acids such as citric acid, fumaric acid, adipic acid, and lactic acid; phosphates such as potassium phosphate, sodium phosphate, and polymeric phosphate; and natural antioxidants such as polyphenols, catechins, tocopherols, vitamin C, green tea extract, chitosan, and tannic acid for administration. Other conventional additives such as anti-influenza agents, buffers, and bacteriostatic agents can be added as needed. In addition, diluents, dispersants, surfactants, binders, or lubricants can be additionally added to formulate the feeds into injectable formulations such as aqueous solutions, suspensions, and emulsions, capsules, granules, or tablets. In addition, the above feed can be used with various auxiliary ingredients such as amino acids, minerals, vitamins, antioxidants, antifungals, antibacterial agents, etc., as auxiliary ingredients, and plant-based protein feed such as ground or crushed wheat, barley, corn, etc., animal-based protein feed such as blood meal, meat meal, fish meal, etc., animal fats and plant-based fats, in addition to the main ingredients, nutritional supplements, growth promoters, digestion and absorption promoters, and disease preventive agents. The treatment can provide mineral sufficiency for humans and livestock through decomposition in the digestive tract of single-animal animals, and prevent eutrophication and water pollution in rivers and lakes in densely populated areas.

[0331]

[0332] Another aspect of the present application provides a use of any one or more of the variant polypeptides of the present application and a host cell expressing the variant polypeptide for phytic acid hydrolysis.

[0333] The above mutant polypeptide and host cell, etc. are as described in other aspects.

[0334] The present application will be described in more detail below through examples. However, the following examples are merely preferred embodiments intended to illustrate the present application and are therefore not intended to limit the scope of the present application. Furthermore, technical details not described herein can be readily understood and implemented by those skilled in the technical field of the present application or similar fields.

[0335]

[0336] Example 1: Construction of a mutant phytase expression vector and expression strain.

[0337] 1-1. Confirmation of phytase activity of sequence number 1

[0338] Phytase enzyme activity was evaluated based on candidate proteins known to be histidine acid phosphatase. For this, a reaction solution composed of 2 mM phytic acid (Merck, Cat no. 593648) and 250 mM buffer (pH 5.5: Invitrogen, Cat no. AM9740) was previously kept at 37°C in a thermomixer (Eppendorf, EP5382000023). The purified enzymes for the candidate proteins were mixed with the reaction solution, and the reaction was allowed to react for a certain period of time. The reaction was stopped with a color development buffer (containing nitric acid, ammonium molybdate, and ammonium metavanadate). The absorbance was measured at 415 nm 10 minutes after stopping the reaction, and the activity was confirmed at pH 5.5 as follows.

[0339] - Activity: Defined as Unit / mg, where Unit is the amount of enzyme that releases 1 μmol of phosphate per minute.

[0340] As a result, there were many candidate proteins with low or almost no phytase activity, but the protein of sequence number 1 was confirmed to have phytase activity, with an activity of 6,135 Units / mg.

[0341]

[0342] 1-2. Construction of mutant phytase expression vector and expression strain

[0343] In order to improve the phytase obtained in Example 1-1, a mutant phytase expression vector introducing various amino acid mutations was constructed. Specifically, various point mutations were introduced into the polynucleotide of SEQ ID NO: 2 encoding the amino acid sequence of SEQ ID NO: 1 introduced into the pPICZ (alpha) vector through site-directed mutagenesis. Among the primer pairs for PCR, the forward primer was designed to have a 13 base sequence in the 3' direction and a 20 base sequence in the 5' direction based on the three pairs of base sequences encoding the amino acid to be substituted, and the reverse primer was designed to have a 20 base sequence complementary to the upper strand in the 3' direction from the substitution site. For example, the forward primer sequence of the primer pair for producing phytase introducing the V231A mutation in Table 2 is ATTGAGAGTTGGTGCCTTTTCCATTTTGAACAGAGA (SEQ ID NO: 69), and the reverse primer sequence is ACCAACTCTCAATGGCATGA (SEQ ID NO: 70). In the same manner as above, primer pairs for producing various mutant phytases were synthesized and PCR was performed using them, and vectors in which mutations were properly introduced were selected and used for transformation. In the case of a phytase expression vector having two combined mutations, the vector introducing the first mutation was used as a template and the primer pair for introducing the second mutation was used to produce the vector through PCR in the same manner as above, and in the case of a phytase expression vector having three or more mutations, the mutations were introduced sequentially in the same manner. The constructed recombinant vector was introduced into Pichia pastoris (Pichia pastorisbg10, Ravinder Kumar, Yeast, 2019, 36(6):399-410) by electroporation after treatment with the restriction enzyme sac1.This was spread on YPD medium (Yeast extract 1%, peptone 2%, Dextrose 2%, Agar 2%) containing the antibiotic zeocin and cultured at 30°C for 3 days. The desired transformants were selected by amplifying the target gene using the primers in Table 1 below.

[0344] Sequence name Primer sequence (5' → 3') pPICZ-N ​​(SEQ ID NO: 71) ACAGCACAAATAACGGGTTATTGTTTATAAAT pPICZ-C (SEQ ID NO: 72) AATGATTTCCCAAACCCCTACCACAAGATATTC

[0345]

[0346] Example 2: Expression of mutant phytase

[0347] Each transformant produced in Example 1 was inoculated into 5 ml of 1% BMGY medium and pre-cultured for 24 hours at 30°C and 220 rpm. 1 ml of the pre-culture was then incubated in 20 ml of 1% BMGY medium at 28°C for 24 hours at 220 rpm. After 24 hours, 0.3 ml of 100% methanol was added to the main culture for induction, and 0.3 ml of methanol was added every 24 hours. 72 hours after methanol induction, the culture was stopped, and the culture was centrifuged to separate the bacteria and enzyme solution.

[0348]

[0349] Example 3: Evaluation of the heat resistance of mutant phytase

[0350] 3-1. Heat resistance evaluation method

[0351] To evaluate the heat resistance of the mutant phytase, 4-MUP (4-Methylumbelliferyl phosphate) was dissolved in 50 mM glycine buffer at pH 3 to a concentration of 1 mM.

[0352] The enzyme solution isolated in Example 2 was mixed with 50 mM cysteine ​​buffer (pH 6) in a volume ratio of 1:3 and heat-treated at each temperature for 1 minute (55°C, 60°C, 65°C) using a PCR machine (Mastercycler® nexus, Eppendorf). 5 μl of the enzyme solution before and after heat treatment was dispensed into each well of a 96-well plate (SPL LIFE SCIENCES ALL RIGHTS RESERVED, 34096), and 150 μl of 4-MUP solution was added to each well and mixed. The enzyme activity before and after heat treatment was measured by fluorescence kinetic assay at 360 nm and 440 nm, and the residual activity was calculated as follows.

[0353]

[0354] - Residual activity (%) = 100 (%) x Enzyme activity after heat treatment / Enzyme activity before heat treatment

[0355]

[0356] 3-2. Heat resistance evaluation results (1)

[0357] The results of evaluating the residual activity of each of the point mutants and combination mutants V231A, K128E, K164I, and E255G+V317A together with the enzyme protein of sequence number 1 (reference protein) after heat treatment at 55°C for 1 minute are shown in Table 2 below.

[0358]

[0359] Enzyme residual activity (%) Sequence number 165V231A100K128E100E255G+V317A81K164I92

[0360]

[0361] As shown in Table 2 above, it was confirmed that the residual activity of the mutant V231A was improved by 54%, K128E by 54%, K164I by 42%, and E255G+V317A by 25% compared to the reference protein.

[0362]

[0363] 3-3. Heat resistance evaluation results (2)

[0364] The results of evaluating the residual activity of the enzyme protein of sequence number 1 (reference protein) and 20 mutants after heat treatment at 60°C for 1 minute are shown in Table 3 below.

[0365]

[0366] Enzyme residual activity (%) Sequence number 142E48P97G58Y90G250A75G188A60R135D75G62A82A141C+A178C81K112P78K122P81W203E0W203Q5G279S91V297P71V229A51R237G59G299V2R135E76G261D72N311D71S343P84

[0367]

[0368] As shown in Table 3 above, it was confirmed that 17 species, excluding the three point mutants W203E, W203Q, and G299V, had higher thermal stability than the reference protein.

[0369]

[0370] 3-4. Heat resistance evaluation results (3)

[0371] The results of evaluating the residual activity of the enzyme protein of sequence number 1 (reference protein) and 23 mutants after heat treatment at 65°C for 1 minute are shown in Table 4 below.

[0372]

[0373] Enzyme residual activity (%) Sequence number 14S76P16D91N+E92Q44M239P18S233D6G212A14L199F6S186D16N285D21H157P13S125H7S102L0N80A16Y57G11Y51K5Y51R8Y51H14G46P13S247C+L359C44S186D+N80A13S102L+N80A21N285D+N80A12N285D+S102L+N80A20M239P+S186D+N285D+N80A7

[0374]

[0375] As shown in Table 4 above, the S102L point mutant was found to have no residual activity at 65°C, and the other 23 mutants were found to have higher thermal stability than the reference protein.

[0376]

[0377] Example 4: Generation of a random library of mutant phytases (error prone library)

[0378] A random library was prepared to produce a mutant phytase with excellent heat resistance. To this end, a DNA fragment was amplified using the DNA sequence of SEQ ID NO: 2 as a template and the primer pairs in Table 5 below. For PCR, STD02-P096 from SolGent Co., Ltd. was used, and the manganese concentration was adjusted to 0.04 mM. Deuterium oxide (D2O) was added to complete the reaction in a total volume of 20 μl (Methods Mol Biol. 2017:1498:491-495). The amplified gene fragment was cloned into the pPICZ (alpha) vector using product number 639648 from Takara Korea Biomedical Inc.

[0379] The constructed recombinant plasmid was introduced into Pichia pastoris bg10 (Ravinder Kumar, Yeast, 2019, 36(6):399-410) by electroporation after treatment with the restriction enzyme sac1. This was spread on YPD medium (1% yeast extract, 2% peptone, 2% dextrose, 2% agar) containing the antibiotic zeocin and cultured at 30°C for 3 days. The desired transformants were selected by amplifying the target gene using the primer pairs in Table 1 described above.

[0380]

[0381] Sequence name Primer sequence (5' → 3') SEQ ID NO: 2-N (SEQ ID NO: 73) AGAGGCTGAAGCTCAAGAATTGATCCCAGGAACTCTG SEQ ID NO: 2-C (SEQ ID NO: 74) TGATGATGATGCTCGAGATCATTAGCAATACATCTAGAATCCAATC

[0382]

[0383] Example 5: Production of mutant phytase and evaluation of its heat resistance.

[0384] 5-1. Production of mutant phytase

[0385] The phytase transformants of the library produced in Example 4 were inoculated into 5 ml of 1% BMGY medium and cultured for 48 hours at 30°C and 220 rpm. 0.1 ml of 100% methanol was added to the culture medium, and an additional 0.1 ml of methanol was added every 24 hours. 72 hours after methanol induction, the culture was stopped, and the culture medium was centrifuged to separate the bacteria and enzyme solution.

[0386]

[0387] 5-2. Heat resistance evaluation

[0388] To evaluate the heat resistance of the produced mutant fiatase, 4-MUP evaluation was conducted as in Example 3.

[0389] After treating the enzyme solution for 3 minutes at each of 70, 75, and 80°C, which are heat treatment temperatures at which the reference protein (SEQ ID NO: 1) has 0 residual activity, and screening using 4-MUP evaluation, the mutant of SEQ ID NO: 3, which maintains the highest level of residual activity, was confirmed.

[0390] The results of confirming the residual activity (%) according to the heat treatment temperature (70, 75, and 80°C) of the reference protein (SEQ ID NO: 1) and the variant (SEQ ID NO: 3) are shown in Figure 1.

[0391] As a result of evaluating the heat resistance of the enzyme with the highest residual activity among the produced mutant phytases, the reference protein (SEQ ID NO. 1) showed no residual activity at any temperature, but the mutant (SEQ ID NO. 3) showed excellent residual activity of 79% at 70°C and residual activity was confirmed to exist up to 80°C.

[0392] At this time, as a result of sequence comparison, it was confirmed that sequence number 3 contains a combination mutation of M33T+E44D+E48P+K49P+G58Y+G62A+T63Q based on sequence number 1.

[0393]

[0394]

[0395] Example 6: Production of a mutant phytase based on an excellent mutant (SEQ ID NO: 3) and evaluation of improved heat resistance - 1

[0396] 6-1. Production of mutant phytase

[0397] To improve the mutant of sequence number 3 manufactured in Example 5, a mutant phytase expression vector introducing various amino acid mutations was constructed in a similar manner to Example 1-2. PCR primers for site-directed mutagenesis were designed to have 24 base sequences in the 3' direction and 6 base sequences in the 5' direction based on the amino acid coding sequence to be substituted, and the synthesized primers are shown in Table 6 below.

[0398]

[0399] Mutation sequence number primer sequence (5' → 3')T33K78ForwardGCTGAGaaaaTTGGCTTCTTGGTCTCCAAGACAA79ReverseAGCCAAtttCTCAGCAGATTGAGTTGGAGATCTY51R80ForwardCCTGGTcgtCTTACTCCTCGTGGATATTACCTT81ReverseAGTAAGacgACCAGGTGGGACTCCCCAATCAG GS125N82ForwardTTGTTTaacCCATTGAAAGCTAAAGTCTGTAAG83ReverseCAATGGgttAAACAATTTAGAGTGCTTAGCAGAG250F84ForwardGCCTTGtttGCTAAAATTATTGAGTCTTTGGAG85ReverseTTTAGCaaaCAAGGCAGAACCCTTGTATCTAGC

[0400]

[0401] Using the pPICZ (alpha) vector containing the polynucleotide sequence of sequence number 4 as a template, the primer pair prepared above and PCR premix (iNtRON, cat no. 25185) were used to perform PCR, respectively, to produce a mutant phytase expression vector.

[0402] PCR was performed using Eppendorf Mastercycler Nexus GX2, and the reaction conditions were as follows.

[0403] Initial denaturation - 94℃, 2min

[0404] Denaturation - 94℃, 20sec

[0405] Annealing - 50℃, 10sec

[0406] Extension - 72℃, 10min (30 cycles from denaturation to extension)

[0407] Final Extension - 72℃, 5min

[0408] The obtained vector was linearized by treatment with the restriction enzyme sac1, and then introduced into Pichia pastoris (Pichia pastorisbg10, Ravinder Kumar, Yeast, 2019, 36(6):399-410) by electroporation. The vector was plated on YPD medium containing antibiotics (zeocin) and cultured in an incubator at 30°C for 3 days. The target transformants were selected by gene amplification using the primers in Table 7.

[0409]

[0410] Sequence nameSequence numberPrimer sequence (5' → 3')pPICZ-N86TTTCCAACAGCACAAATAACGGGpPICZ-C87GCATTCTGACATCCTCTTGA

[0411]

[0412] 6-2. Evaluation of mutant activity

[0413] The transformant prepared in Example 6-1 was inoculated into 5 ml of 1% BMGY, and pre-culture was performed for 24 hours at 30°C and 220 rpm. 1 ml of the pre-culture was then subjected to main culture in 20 ml of 1% BMGY at 28°C and 220 rpm for 24 hours. After 24 hours, 0.3 ml of 100% methanol was added to the main culture for induction, and 0.3 ml of methanol was added every 24 hours. 72 hours after methanol induction, the culture was stopped, and the culture was centrifuged to separate the bacteria and enzyme solution.

[0414] The enzyme solution was passed through Ni-NTA resin (Qiagen, Cat no. 30230) for adsorption, and then washing buffer (50 mM Tris-HCl pH 8.0, 100 mM NaCl, 20 mM imidazole) and elution buffer (50 mM Tris-HCl pH 8.0, 100 mM NaCl, 250 mM imidazole) were passed sequentially to purify the enzyme, and activity evaluation was performed using the purified enzyme.

[0415] Protein concentration was determined by adding 4 ㎕ of diluted enzyme solution + Bradford solition (Quick Start TM Bradford 1x Dye Reagent, #5000205) was mixed and the absorbance at 595 nm was measured.

[0416] The method for analyzing enzyme activity is as follows.

[0417] 0.2 ml of the appropriately diluted purified enzyme was mixed with 1.8 ml of 250 mM Acetate Buffer (pH 5.5), then 4 ml of 7.5 mM Phytic acid sodium salt hydrate (Sigma-Aldrich, 68388) was added and the reaction was stopped at 37°C for 30 minutes. The reaction was stopped by adding 4 ml of a color developing reagent to the reaction solution. The color developing reagent was prepared by adding 4 ml of 100 g / L Ammonium molybdate and 4 ml of 2.35 g / L Ammonium metavanadate to 8 ml of a 2 / 3 diluted nitric acid solution, mixing, and storing in the dark. The mixture was left at room temperature for 10 minutes to develop color, centrifuged, transferred to a cuvette, and the absorbance was measured at 415 nm to evaluate the activity. The relative activity was calculated compared to that of SEQ ID NO: 3.

[0418] As a result of evaluating the activity of the mutants, it was confirmed that the relative activity increased by 10 to 40% due to the introduction of point mutations, as shown in Table 8.

[0419]

[0420] Enzyme Relative Activity (%) Sequence Number 3100.0T33K126.2Y51R124.1S125N110.2G250F140.7

[0421]

[0422] 6-3. Thermal stability evaluation

[0423] The enzyme purified according to Example 6-2 was used to evaluate its thermal stability. The protein concentration of the purified enzyme was measured and diluted to a final concentration of 1 mg / ml. The diluted purified enzyme was incubated in a 70°C water bath for 3 minutes, then transferred to ice and left to stand for 10 minutes. After appropriate dilution, the activity was measured using the same method as in Example 6-2. The ratio of the activity after heat treatment to the activity of the unheated sample was calculated as the residual activity.

[0424] As a result of the residual activity evaluation, as shown in Table 9, it was confirmed that the residual activity at 70℃ for 3 minutes in the mutant increased by 4 to 15 times or more.

[0425]

[0426] Enzyme 70℃, 3 min residual activity (%) relative activity (%) sequence number 32.3100.0T33K14.3621.7S125N35.71552.2G250F11.7508.7

[0427]

[0428] Example 7: Production of a mutant phytase based on an excellent mutant (SEQ ID NO: 3) and evaluation of improved heat resistance - 2

[0429] Based on the polynucleotide sequence SEQ ID NO: 4 encoding the variant of SEQ ID NO: 3 produced in Example 5, point mutations were introduced in the same manner as in Example 1, and a 4-MUP evaluation for heat resistance was performed as in Example 3. The variant was designed to include multiple mutations of two or more.

[0430] The results of measuring the residual activity of enzymes with various point mutations are shown in Table 10 below.

[0431]

[0432] Enzyme mutation location heat treatment temperature residual activity (%) 70℃75℃80℃85℃90℃ standard protein sequence number 379442--DS1E11C+V309C765533--DS2V9C+V309C805525--DS3V9C+G310C-5815--DS4E11C+V309C+A98C+V113C-402218-DS5E11C+V309C+A242C+A280C-4928--DS6E11C+V309C +E85C+P263C-69545346DS7E11C+V309C+E85C+T266C-4315--DS8E11C+V309C+V131C+A 365C-4928--DS9E11C+V309C+K122C+A365C-5327--DS10E11C+V309C+K122C+D367C-463 5--DS11E11C+V309C+L123C+D367C-432118-DS12E11C+V309C+E85C+P263C+K122C+D36 7C-40322629DS13E11C+V309C+V9C+G310C-45252423DS14E11C+V309C+E85C+P263C+V16 5C+G212C--4545-DS15E11C+V309C+E85C+P263C+V165C+Q215C--3935-DS16E11C+V309 C+E85C+P263C+S38C+T166C--3525-DS17E11C+V309C+E85C+P263C+P39C+E167C--4845-

[0433]

[0434] As shown in Table 10 above, DS1 to DS17 all showed residual activity at temperatures of 70, 75, 80°C and / or higher, which are the heat treatment temperatures at which sequence number 1 has a residual activity of 0, suggesting that they have excellent heat resistance and utility as feed enzymes.

[0435] The improved strains DS4, DS7, DS11, and DS12 showed decreased residual activity at 75°C compared to the reference protein (SEQ ID NO: 3). However, their stability at 80°C was confirmed to be improved compared to the reference protein. On the other hand, DS1, DS2, DS3, DS5, DS6, DS8, DS9, DS10, and DS13 showed better stability than the reference protein at both 75°C and 80°C. DS14, DS15, DS16, and DS17 also showed high residual activity at 80°C and 85°C. In particular, DS6 (SEQ ID NO: 5) showed 46% residual activity up to 90°C, which suggests that it can be very useful as a feed enzyme.

[0436] At this time, as a result of sequence comparison, it was confirmed that sequence number 5 (DS6) had a combination mutation of E11C+E85C+P263C+V309C based on sequence number 3.

[0437]

[0438] Example 8: Evaluation of heat resistance of an improved N-terminal random mutant library based on DS6 (SEQ ID NO: 5)

[0439]

[0440] Using the recombinant plasmid introduced with the DNA of SEQ ID NO: 6, which is a polynucleotide encoding the variant of SEQ ID NO: 5 produced in Example 7, as a template, a recombinant plasmid introduced with SEQ ID NO: 8 (SBS1) using the primer pair of SEQ ID NO: 6-N1 and SEQ ID NO: 6-C as shown in Table 11 below was prepared as in Example 4, and a recombinant plasmid introduced with SEQ ID NO: 10 (SBS2) was prepared using the primer pair of SEQ ID NO: 6-N2 and SEQ ID NO: 6-C, and a transformant introduced with the recombinant plasmid was prepared, and enzyme expression and 4-MUP evaluation for heat resistance evaluation were performed as in Example 5.

[0441]

[0442] Sequence name Primer sequence (5' → 3') SEQ ID NO: 6-N1 (SEQ ID NO: 75) AGAGGCTGAAGCTGAAGCTTGcGAGttgGAAAAAGTTGTTgttgt SEQ ID NO: 6-N2 (SEQ ID NO: 76) AGAGGCTGAAGCTGNNKNNKNNKNNKNNKNNKNNKNNKGTTTATTGCGAGTTGGAAAAAGTTGTTG SEQ ID NO: 6-C (SEQ ID NO: 77) TGATGATGATGCTCGAGATCATTAGCAATACATCTAGAATCCAATC

[0443]

[0444] Enzyme solutions were heat-treated for 3 minutes at 70, 75, and 80°C, respectively, and the mutants with the best residual activity were selected through screening using the 4-MUP assay. Two excellent mutants were selected from the N-terminal random mutant library, and their sequences are shown in SEQ ID NOs: 7 and 9. The results of confirming the residual activity by heat treatment temperature are shown in Table 12 below.

[0445]

[0446] Enzyme sequence heat treatment temperature residual activity (%) 70℃75℃80℃85℃90℃ standard protein sequence number 5-69545346 SBS1 sequence number 7-82767672 SBS2 sequence number 9--767671

[0447] As shown in Table 12 above, both SBS1 and SBS2 showed a residual activity of more than 70% under heat treatment conditions of 90°C for 3 minutes, and exhibited the best heat resistance among the mutants.

[0448] At this time, the N-terminal sequence analysis result of SBS1 confirmed that up to Y10 of sequence number 5 was deleted (sequence number 7), and in the case of SBS2, amino acids Q1 to L8 of sequence number 5 were replaced with LNSSVPGA (sequence number 9).

[0449]

[0450] The above results suggest that all phytase variants based on sequence numbers 1 and 3 of the present application have excellent heat resistance.

[0451]

[0452] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering its technical concept or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted to include all changes or modifications derived from the meaning and scope of the following claims and their equivalents, rather than the detailed description above.

Claims

1. A mutant polypeptide having phytase activity, which is at least one of the following i) to iii): i) a polypeptide having the amino acid sequence of sequence number 1 or a sequence identity of at least 90% thereto; ii) a polypeptide encoded by a polynucleotide encoding a mature polypeptide having the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having at least 90% sequence identity thereto; iii) a polypeptide encoded by (a) a mature polypeptide coding sequence of SEQ ID NO: 1 or an amino acid sequence having at least 90% sequence identity thereto, (b) a cDNA thereof, or (c) a polynucleotide that hybridizes to the full-length complement of (a) or (b) under low stringency conditions, medium stringency conditions, medium-high stringency conditions, high stringency conditions, or very high stringency conditions, A variant polypeptide comprising a substitution of an amino acid at one or more positions selected from the following: 33, 44, 46, 48, 49, 51, 57, 58, 62, 63, 76, 80, 91, 92, 102, 112, 122, 125, 128, 135, 141, 157, 164, 178, 186, 188, 199, 212, 229, 231, 233, 237, 239, 247, 250, 255, 261, 279, 285, 297, 311, 317, No. 343 and No. 359; Here, the position number corresponds to the position of the polypeptide of sequence number 1.

2. In the first paragraph, the mutant polypeptide comprises an amino acid substitution at one or more positions selected from the following: 46; 48; 51; 57; 58; 62; 76; 80; 112; 122; 125; 128; 135; 157; 164; 186; 188; 199; 212; 229; 231; 233; 237; 239; 250; 261; 279; 285; 297; 311; 317; 343; 91 and 92; 141 and 178; 247 and 359; 255 and 317, Here, the position number corresponds to the position of the polypeptide of sequence number 1.

3. In the first paragraph, the mutant polypeptide comprises one or more amino acid substitutions selected from the following: Substitution of amino acid 46 with proline; Substitution of amino acid 48 with proline; Substitution of amino acid 51 with lysine, arginine, or histidine; Substitution of amino acid 57 with glycine; Substitution of amino acid 58 with tyrosine; Substitution of amino acid 62 with alanine; Substitution of amino acid 76 with proline; Substitution of amino acid 80 with alanine; Substitution of amino acid 112 with proline; Substitution of amino acid 122 with proline; Substitution of amino acid 125 with histidine; Substitution of amino acid 128 with glutamic acid; Substitution of amino acid 135 with aspartic acid or glutamic acid; Substitution of amino acid 157 with proline; Substitution of amino acid 164 with isoleucine; Substitution of amino acid 186 with aspartic acid; Substitution of amino acid 188 with alanine; Substitution of amino acid 199 with phenylalanine; Substitution of amino acid 212 with alanine; Substitution of amino acid 229 with alanine; Substitution of amino acid 231 with alanine; Substitution of amino acid 233 with aspartic acid; Substitution of amino acid 237 with glycine; Substitution of amino acid 239 with proline; Substitution of amino acid 250 with alanine; Substitution of amino acid 261 with aspartic acid; Substitution of amino acid 279 with serine; Substitution of amino acid 285 with aspartic acid; Substitution of amino acid 297 with proline; Substitution of amino acid 311 with aspartic acid; Substitution of amino acid 343 with proline; Substitution of amino acid 91 with asparagine and substitution of amino acid 92 with glutamine; Substitution of amino acids 141 and 178 with cysteine; Substitution of amino acids 247 and 359 with cysteine; and Substitution of amino acid 255 with glycine and substitution of amino acid 317 with alanine, Here, the position number corresponds to the position of the polypeptide of sequence number 1.

4. In the first paragraph, the mutant polypeptide comprises an amino acid substitution at one or more positions selected from the following: 186 and 80; 102 and 80; 285 and 80; 285, 102, and 80; 239, 186, 285, and 80; 135 and 250; 33, 44, 48, 49, 58, 62, and 63; Here, the position number corresponds to the position of the polypeptide of sequence number 1.

5. In the first paragraph, the mutant polypeptide comprises one or more amino acid substitutions selected from the following: Substitution of amino acid 186 with aspartic acid and substitution of amino acid 80 with alanine; Substitution of amino acid 102 with leucine and substitution of amino acid 80 with alanine; Substitution of amino acid 285 with aspartic acid and substitution of amino acid 80 with alanine; Substitution of amino acid 285 with aspartic acid, substitution of amino acid 102 with leucine, and substitution of amino acid 80 with alanine; Substitution of amino acid 239 with proline, substitution of amino acids 186 and 285 with aspartic acid, and substitution of amino acid 80 with alanine; Substitution of amino acid 135 with aspartic acid and substitution of amino acid 250 with alanine; and Substitution of amino acid 33 with threonine, substitution of amino acid 44 with aspartic acid, substitution of amino acids 48 and 49 with proline, substitution of amino acid 58 with tyrosine, substitution of amino acid 62 with alanine, and substitution of amino acid 63 with glutamine. Here, the position number corresponds to the position of the polypeptide of sequence number 1.

6. A mutant polypeptide according to claim 1, wherein the mutant polypeptide has at least 90% identity with the amino acid sequence of SEQ ID NO:

3.

7. In the sixth paragraph, the mutant polypeptide further comprises a substitution of an amino acid at one or more positions selected from the following: 33; 51; 125; 250; 11 and 309; 9 and 309; 9 and 310; 98 and 113; 242 and 280; 85 and 263; 85 and 266; 131 and 365; 122 and 365; 122 and 367; 123 and 367; 165 and 212; 165 and 215; 38 and 166; and 39 and 167. Here, the position number corresponds to the position of the polypeptide of sequence number 3.

8. In the 7th paragraph, the mutant polypeptide comprises one or more amino acid substitutions selected from the following: Substitution of amino acid 33 with lysine; substitution of amino acid 51 with arginine; substitution of amino acid 125 with asparagine; and substitution of amino acid 250 with phenylalanine. Here, the position number corresponds to the position of the polypeptide of sequence number 3.

9. In the 7th paragraph, the mutant polypeptide comprises one or more amino acid substitutions selected from the following: Substitution of amino acids 11 and 309 with cysteine; Substitution of amino acids 9 and 309 with cysteine; Substitution of amino acids 9 and 310 with cysteine; Here, the position number corresponds to the position of the polypeptide of sequence number 3.

10. In the 9th paragraph, the mutant polypeptide further comprises one or more substitutions selected from the following: Substitution of amino acids 98 and 113 with cysteine; substitution of amino acids 242 and 280 with cysteine; substitution of amino acids 85 and 263 with cysteine; substitution of amino acids 85 and 266 with cysteine; substitution of amino acids 131 and 365 with cysteine; substitution of amino acids 122 and 365 with cysteine; substitution of amino acids 122 and 367 with cysteine; substitution of amino acids 123 and 367 with cysteine; substitution of amino acids 165 and 212 with cysteine; substitution of amino acids 165 and 215 with cysteine; substitution of amino acids 38 and 166 with cysteine; and substitution of amino acids 39 and 167 with cysteine. Here, the position number corresponds to the position of the polypeptide of sequence number 3.

11. In the 10th paragraph, the mutant polypeptide comprises an amino acid substitution selected from the following: Substitution of amino acids 11, 309, 98, and 113 with cysteine; Substitution of amino acids 11, 309, 242, and 280 with cysteine; Substitution of amino acids 11, 309, 85, and 263 with cysteine; Substitution of amino acids 11, 309, 85, and 266 with cysteine; Substitution of amino acids 11, 309, 131, and 365 with cysteine; Substitution of amino acids 11, 309, 122, and 365 with cysteine; Substitution of amino acids 11, 309, 122, and 367 with cysteine; Substitution of amino acids 11, 309, 123, and 367 with cysteine; Substitution of amino acids 11, 309, 85, 263, 122, and 367 with cysteine; Substitution of amino acids 11, 309, 9, and 310 with cysteine; Substitution of amino acids 11, 309, 85, 263, 165, and 212 with cysteine; Substitution of amino acids 11, 309, 85, 263, 165, and 215 with cysteine; Substitution of amino acids 11, 309, 85, 263, 38, and 166 with cysteine; and Substitution of amino acids 11, 309, 85, 263, 39, and 167 with cysteine.

12. A mutant polypeptide according to claim 7, wherein the mutant polypeptide comprises an amino acid sequence of SEQ ID NO:

5.

13. In the 12th paragraph, the mutant polypeptide comprises any one of the following modifications selected from the amino acid sequence of SEQ ID NO: 5: (i) a deletion of amino acids at positions 1 to 10 from the N-terminus of sequence number 5; and (ii) Amino acids at positions 1 to 8 of SEQ ID NO: 5 are substituted with leucine, asparagine, serine, serine, valine, proline, glycine, and alanine, respectively (wherein the position numbers correspond to the positions of the polypeptide of SEQ ID NO: 5).

14. A mutant polypeptide according to claim 13, wherein the mutant polypeptide comprises at least one amino acid selected from among SEQ ID NO: 7 and SEQ ID NO:

9.

15. A mutant polypeptide according to any one of claims 1 to 14, wherein the mutant polypeptide has increased heat resistance compared to a polypeptide consisting of the amino acid sequence of SEQ ID NO:

1.

16. A method for producing a phytic acid hydrolysate, comprising the step of contacting a substrate with at least one of the mutant polypeptides of any one of claims 1 to 14 and a host cell expressing the mutant polypeptide.

17. A method for producing a phytic acid hydrolysate in claim 16, wherein the substrate comprises phytin.

18. A method for hydrolyzing phytic acid, comprising the step of contacting a substrate with at least one of the mutant polypeptides of any one of claims 1 to 14 and a host cell expressing the mutant polypeptide.

19. A polynucleotide encoding a mutant polypeptide of any one of claims 1 to 14.

20. A host cell comprising at least one of a mutant polypeptide according to any one of claims 1 to 14, a polynucleotide encoding the mutant polypeptide, a nucleic acid structure comprising the polynucleotide, and a vector comprising the nucleic acid structure.

21. A method for producing a mutant polypeptide having phytase activity, comprising the step of culturing the host cell of item 20.

22. A method for producing a mutant polypeptide having phytase activity, further comprising a step of recovering a mutant polypeptide expressed in the culturing step in claim 21.

23. Use of any one of the variant polypeptides of any one of claims 1 to 14 and any one or more host cells expressing the variant polypeptide for phytic acid hydrolysis.

Images