Alzheimer's disease model organoids and screening method

Abstract

The present disclosure relates to organoids and particularly to brain organoid models. The brain organoids include neurons, microglia, astrocytes, and blood vessels. The brain organoid models can be used to create models for Alzheimer's Disease. Methods of using the brain organoids for drug discovery are also described.

Description

[0001]3220-421482 70690-03 ALZHEIMER’S DISEASE MODEL ORGANOIDS AND SCREENING METHOD RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application Nos. 63 / 672,172, filed July 16, 2024, and 63 / 647,679, filed May 15, 2024, the entire disclosure of each of which is incorporated herein by reference. GOVERNMENT FUNDING This invention was made with government support under AG088662 and NS140907 awarded by the National Institutes of Health. The government has certain rights in the invention. FIELD OF THE INVENTION The present disclosure relates generally to the field of organoids, such as an in vitro brain organoid. In a more particular aspect, the present disclosure relates to model systems for studying Alzheimer’s Disease. The present disclosure further relates to the finding that AD patient brain extracts induce multiple pathologies in a vascularized neuroimmune organoid useful for disease modeling and drug discovery. BACKGROUND AND SUMMARY Alzheimer’s Disease (AD) is the most common cause of dementia afflicting 55 million individuals worldwide, with limited treatment available. Current AD models mainly focus on familial AD (fAD), which is due to genetic mutations. However, models for studying sporadic AD (sAD), which represents over 95% of AD cases without specific genetic mutations, are severely limited. Moreover, the fundamental species differences between humans and animals might significantly contribute to clinical failures for AD therapeutics that have shown success in animal models, highlighting the urgency to develop more translational human models for studying AD, particularly sAD. In this study, a complex human pluripotent stem cell (hPSC)- based vascularized neuroimmune organoid model was developed, which contains multiple cell types affected in human AD brains, including human neurons, microglia, astrocytes, and blood vessels. It was demonstrated that brain extracts from individuals with sAD can effectively induce multiple AD pathologies in organoids four weeks post-exposure, including amyloid beta (Aβ) plaques-like aggregates, tau tangles-like aggregates, neuroinflammation, elevated 3220-421482 70690-03 microglial synaptic pruning, synapse / neuronal loss, and impaired neural network. Furthermore, after treatment with Lecanemab, an FDA-approved drug targeting Aβ, AD brain extract exposed organoids showed a significant reduction of amyloid burden. Thus, the neuroimmune organoid model provides a unique opportunity to study AD, particularly sAD under a pathophysiological relevant three-dimensional (3D) human cell environment. It also holds great promise to facilitate AD drug development, particularly for immunotherapies. The present disclosure provides for constructing a human pluripotent stem cell (hPSC)- based vascularized neuroimmune organoid model, which contains multiple cell types affected in human AD brains, including human neurons, microglia, astrocytes, and blood vessels. The present disclosure provides for the organoid model as above wherein the multiple cell types are cells from hPSC which were derived from healthy individuals and Alzheimer’s Disease patients. The present disclosure provides for methods for constructing an organoid model as above, comprising combining multiple human cell types including and not limited to human pluripotent stem cell, neuron, microglia, astrocyte and blood vessel cell; and establishing a human pluripotent stem cell-based vascularized neuroimmune organoid model. The present disclosure provides for a method as described where in one or more of the human cell types are cells from hPSC which were derived from healthy individuals and Alzheimer’s Disease patients. The present disclosure further provides for the described method comprising the co-culture of hPSCs-derived neural progenitor cells (NPCs), primitive macrophage progenitors (PMPs), and vascular progenitors (VPs) under 3D conditions. The present disclosure also provides for the method as described comprising: generating NPCs and PMPs; generating VPs; combining to generate brain organoids, the initial number of cells was calibrated and co-cultured at 30,000 for NPCs, 12,000 for PMPs, and 7,000 for VPs. It is within the scope of the present disclosure to vary the number of cells and cell ratios. For example, a ratio of NPCs to PMPs to VPs is preferably around 30:12:7. This ratio can be adjusted depending upon the desired composition of differentiated cell type desired in the resultant organoid. In some embodiments, about 5% to about 40% of the total progenitor cell population are PMPs. In some embodiments, about 5% to about 60% of the total progenitor cell population are VPs. In some embodiments, about 5% to about 40% of the total progenitor cells are PMPs and about 5% to about 60% of the total progenitor cells are VPs. Cell types in the final model include neurons, microglia or blood vessels. The initial number of cells can also be adjusted depending on how long a period of time is desired for keeping the organoids in the proliferative stage / mode to all the progenitor cells to expand. Thus, the actual number of cells utilized with 3220-421482 70690-03 fall within a ratio of initial cells, which can vary within a range that yields the desired organoids. Thus, it is within the scope of the present disclosure to construct the desired organoids from starting cell rations (NPC:PMP:VP) of around 15:12:7, to 60:12:7; around 30:6:7 to 30:24:7; around 30:12:3 to 30:12:14, or variations thereof. The present disclosure further provides for the described method where identifying hPSCs-derived NPCs was confirmed by co-expression of neural progenitor cell markers, PAX6 and NESTIN. The present disclosure provides for the described method where PMPs were confirmed by co-expression of CD235 and CD43. The present disclosure provides for the method as described where culture of the organoids was supplemented with mitogen fibroblast growth factor (bFGF) for about 5 days to promote cellular proliferation. The present disclosure provides for a proliferation phase which lasts from about 1 day to about 14 days or more, depending upon the amount of proliferation desired. It is within the scope of the disclosure that the culture of organoids can be maintained in culture for prolonged periods of time as per cell culture technology. It is contemplated that the appropriate conditions can be used to maintain continuous organoid culture. The disclosure provides for the method where organoids, after proliferation, are transitioned to a neural differentiation medium which contained neurotrophic factors, interleukin-34 (IL-34), vascular endothelial growth factor (VEGF), and other necessary supplements for long-term culture to support neuronal, microglial, and vascular maturation . The present disclosure provides for a method for screening for effective therapeutic treatment of Alzheimer's Disease pathologies comprising administering target treatment to the organoid model as above and assessing resultant effects. The present disclosure provides for the method as above, further comprising comparing efficacy of the test treatment as compared to a control sample. The present disclosure provides for a system for Alzheimer's Disease drug discovery comprising an organoid model as described, and systematic screening of target treatments for efficacy using the organoid model. The present disclosure provides for a system as described above, adapted to automated testing and monitoring. The present disclosure provides for a method for inducing Alzheimer's Disease pathologies in an organoid model, comprising; constructing a neurological organoid model, introducing a brain extract from Alzheimer’s Disease patient to the organoid model. 3220-421482 70690-03 The present disclosure provides for the method for inducing Alzheimer's Disease pathologies in a vascularized organoid model as described above, comprising introducing brain extracts from Alzheimer’s Disease patients to the organoid model. The present disclosure provides for a method as described comprising treating organoids with sAD individual postmortem tissue-derived brain extracts to model sAD. The present disclosure provides for the method as described where the organoids undergo 10 days of neuronal differentiation, exposed to AD brain extracts for two days, and samples collected 2 to 4 weeks after exposure. The present disclosure provides for a differentiation phase can last from less than about 1 day to about 28 days or more, depending upon the amount of differentiation is desired. It is within the scope of the disclosure that the culture of organoids can be maintained in culture for prolonged periods of time as per cell culture technology. The same method can be applied to familial AD (fAD) by using fAD brain extracts to treat fAD iPSC-derived organoids. It is within the scope of the disclosure that longer term culture and exposure to AD brain extract is advantageous for AD pathologies to accumulate in the system. Thus, it is contemplated that exposure of organoids can take place in the time frame of less than 1 day to 2 days or much longer, for example several days, or even weeks, depending on the level of pathology desired. Thus, the present disclosure contemplates exposure to brain extract of about 1 day, about 2 days, about 3 or more days, up to 1 week or more depending on the level of pathologies desired. It is further contemplated that continuous exposure of organoid culture to brain extract can be maintained in an environment for long-term study and testing. BRIEF DESCRIPTIONS OF THE DRAWINGS Figs.1(A-G). Generation and characterization of vascularized neuroimmune organoids. (Fig.1A) Schematic image of the generation of vascularized neuroimmune organoids. hPSCs- derived NPCs, PMPs, and VPs were co-cultured to form 3D spheroids. The proliferation stage lasted for five days before organoids were cultured in a differentiation medium. Scale bars, 750 or 300 µm as indicated. (Fig. 1B) Left panel, representatives of PAX6+and NESTIN+NPCs. Right panel, CD235+and CD43+PMPs. Scale bars, 20 or 10 μm as indicated. (Fig. 1C) Representatives of blood vessels in 12-day-old organoids. Left panel, CAGG-derived blood vessels in living organoids; Middle panel, sections of organoids incorporated with CAGG- derived blood vessels; Right panel, representative of CD31 staining. Scale bars, 300, 100, or 20 μm as indicated. (Fig. 1D) Representative of neural rosette stained with PAX6 and βIII- tubulin in 12-day-old organoids. Scale bar, 20 μm. (Fig. 1E) Characterization of microglia in 3220-421482 70690-03 12-day-old organoids. Left panel, representative of CD45+microglia; Right panel, representative of CD45+Iba1+microglia. Scale bars, 20, 10, or 5 μm as indicated. (Fig. 1F) Representative of MAP2 expression in 45-day-old organoids. Scale bar, 50 μm. (Fig. 1G) Representatives of NeuN+neurons and S100β+astrocytes in 45-day-old organoids. Scale bar, 20 μm. Figs.2(A-F). Sporadic AD patient-derived brain extracts induce amyloid pathology in organoids. (Fig. 2A) Schematic image of experimental design. (Fig. 2B) Representatives of 6E10 in organoids at 2 or 4 weeks post-exposure to AD brain extracts or vehicle. Scale bars, 20 or 10 µm as indicated. (Fig.2C) Representatives of 4G8 in organoids at 2 or 4 weeks post- exposure to AD brain extracts or vehicle. Scale bars, 20 or 10 µm as indicated. (Fig. 2D) Quantification of percentage area of 6E10+signals and 4G8+signals over time. n=4 independent experiments from 3 hPSC lines, each experiment used one hPSC line and contained 4-6 organoids. Data are presented as mean ± SEM. Unpaired t test with Welch’s correction, *p < 0.05, ns represents no significance. (Fig. 2E) Representatives of co-staining with 6E10 and Aβ42 in organoids at 4 weeks post-exposure to AD brain extracts. Scale bars, 10 or 5 µm as indicated. (Fig. 2F) Representatives of Thioflavin-S+and 6E10+structures in organoids at 4 weeks post-exposure to AD brain extracts or vehicle. Scale bar, 20 μm. Figs. 3(A-D). Sporadic AD patient-derived brain extracts induce tau pathology in organoids. (Fig.3A) Representatives of AT8+cells in organoids at 2 or 4 weeks post-exposure to AD brain extracts or vehicle. Scale bars, 20 or 10 μm as indicated. (Fig.3B) Quantification of AT8 positive cells over time. n=4 independent experiments from 3 hPSC lines, each experiment used one hPSC line and contained 4-6 organoids. Data are presented as mean ± SEM. Unpaired t test with Welch’s correction, *p < 0.05, ns represents no significance. (Fig. 3C) Representative images of AT8 and pThr217 double staining in organoids at 4 weeks post AD brain extract exposure. The arrow and arrowhead indicate the co-localized AT8 and pThr217 signal in the soma and processes, respectively. Scale bars, 20 or 10 μm as indicated. (Fig. 3D) Representatives of AT8 and Thioflavin-S labeled hyperphosphorylated tau aggregates in organoids at 4 weeks post-exposure to AD brain extracts. Scale bars, 20, 10, or 5 μm as indicated. (Fig.3D) Representatives of Gallyas silver staining of organoid at 4 weeks post-exposure to AD brain extracts or vehicle. Scale bar, 20 μm. Figs. 4(A-D). The AD neuroimmune organoids recapitulate neuroinflammation, phagocytosis of Αβ, and excessive microglial synaptic pruning. (Fig. 4A) qPCR analysis of mRNA expression level of IL-6 and CCL2 in organoids from 4 to 6 weeks post-exposure to 3220-421482 70690-03 AD brain extract or vehicle. n = 3 independent from two hPSCs lines, each experiment used one hPSC line and contained 4-6 organoids. Unpaired student’s t test, *p < 0.05, **p < 0.01. (Fig. 4B) 3D reconstructive image showing microglia phagocytizing Aβ. Organoid sections from the AD group treated with AD brain extracts were stained with IBA1 and 6E10. Scale bar, 2 μm. (Fig. 4C) 3D reconstructive image showing microglial synaptic pruning. Sections from organoids at 4 weeks post-exposure to the vehicle or AD brain extracts were stained with Homer1 and hCD45. Scale bars, 5 or 3 μm as indicated. (Fig. 4D) Quantification of Homer1 puncta engulfment within CD45-positive microglia for the vehicle and AD groups. The phagocytic activity of microglia was quantified by dividing Homer1 puncta volume with microglia volume. n = 4 independent experiments from three hPSC lines, each experiment used one hPSC line and contained 4-6 organoids. Data are presented as mean ± SEM. Unpaired t test with Welch’s correction, ***p < 0.001. Scale bars, as indicated. Figs.5(A-H). The AD neuroimmune organoids recapitulate synapse / neuronal loss and impaired neural activity. (Fig.5A) Representatives of Homer1 staining in the vehicle and AD groups at 4 weeks post-exposure to the vehicle or AD brain extracts, respectively. Scale bar, 5 μm. (Fig. 5B) Quantification of Homer1 puncta number per 2500 μm2. n = 4 independent experiments from three hPSC lines, each experiment used one hPSC line and contained 4-6 organoids. Data are presented as mean ± SEM. Unpaired t test with Welch’s correction, **p < 0.01. (Fig.5C) Representatives of activated Caspase3 staining in the vehicle and AD groups at 4 weeks post-exposure to the vehicle or AD brain extracts, respectively. Scale bars, 20 or 10 μm as indicated. (Fig. 5D) Quantification of the percentage of Caspase3+cells. n = 4, four independent experiments from three hPSC lines, each experiment used one hPSC line and contained 4-6 organoids. Data are presented as mean ± SEM. Unpaired t test with Welch’s correction, **p < 0.01. (Fig.5E) Representative of organoid attached to MEA plate. Scale bar, 300 μm. (Fig. 5F) Representatives of spikes / bursts within 2 s on a single electrode in the organoids from the vehicle group or the AD group. (Fig. 5G) Representatives of spike raster plot generated from MEA recording raw data from the vehicle group and AD group. (Fig.5H) Quantification of MEA parameters. n = 4 independent experiments from two hPSC lines, each experiment used one hPSC line and contained 4-6 organoids. Data are presented as mean ± SEM. Unpaired t test with Welch’s correction, **p < 0.01, ***p < 0.001. Figs. 6(A-D). Anti-Aβ antibody Lecanemab relieved amyloid burden in AD neuroimmune organoids. (Fig.6A) Representatives of 6E10 and 4G8 staining from the vehicle group, AD group, and Lecanemab-treated group. Scale bar, 20 μm. (Fig.6B) Quantification of 3220-421482 70690-03 6E10 and 4G8 positive area. n = 3, three independent experiments from three hPSC lines, each experiment used one hPSC line and contained 4-6 organoids. Data are presented as mean ± SEM. One-way ANOVA, *p < 0.05, ns represents no significance. (Fig. 6C) Representatives of 3D reconstructive figures showing the internalization of Aβ by microglia. Organoids from the AD group and Lecanemab-treated group were stained with IBA1 and 6E10. Scale bars, 4 or 2 μm as indicated. (Fig. 6D) Quantification of microglial phagocytosis of Aβ. n = 3 independent experiments from three hPSC lines, each experiment used one hPSC line and contained 4-6 organoids. Data are presented as mean ± SEM. Unpaired two-tailed t test with Welch’s correction, *p < 0.05. Figs. 7(A-D). Representative images of sections of organoids with CAGG hPSC- derived vasculatures. (Fig.7A) Vasculature formation in whole organoids, scale bar, 400 μm. (Fig. 7B) Local magnification of blood vessel tubular structure, scale bar, 200 μm. (Fig. 7C) Co-locolization of collagen IV+and CAGG GFP+signals, scale bars, 20 μm or 10 μm as indicated. (Fig.7D) Co-locolization of PDGFRβ+and CAGG GFP+signals, scale bars, 20 μm or 10 μm as indicated. Fig. 8. Diffused 6E10 and 4G8 signals in organoids at 2 weeks post-exposure to AD brain extracts, indicating endogenous APP instead of Aβ aggregates. Scale bars, 20 or 10 μm as indicated Figs.9A-B. Diffuse but not aggregated 6E10 and 4G8 signals in organoids treated with healthy individual-derived brain extracts. (Fig.9A) Diffuse 6E10-positive signals observed in organoids at 2 weeks or 4 weeks post-exposure to age-matched healthy individual-derived brain extracts (healthy control brain extract). Scale bar, 20 μm. (Fig.9B) Diffuse 4G8-positive signals observed in organoids at 4 weeks post-exposure to brain extracts from age-matched healthy individuals (healthy control brain extract). Scale bar, 20 μm. Fig. 10. Organoids exposed to AD brain extracts but not the vehicle showed intraneuronal Aβ aggregates. Representatives of MOAB2+cells in organoids at 2 weeks post- exposure to AD brain extracts or vehicle. Scale bars, 20 μm. Figs. 11A-B. Quantification of 6E10+and AT8+Area from organoids generated from male and female hPSC lines. After 2 weeks or 4 weeks of brain extract exposure, %6E10+Area (Fig. 11A) and % AT8+Area (Fig. 11B) were quantified in both male and female hiPSC- derived organoids. For the male group, n=4 independent experiments from 4 different cell lines. Each experiment used one hPSC cell line and contained 4-6 organoids. For the female group, n=3 independent experiments from 1 cell line. Each experiment contained 4 organoids. Data 3220-421482 70690-03 are represented as Mean ± SEM. Unpaired t test with Welch’s correction, ns represents no significance. Figs. 12A-B. Confirming tau seeding activity of AD and age-matched healthy individual (Con)-derived brain extracts. (Fig. 12A) Representative image showing PHF-1 (pS396 / pS404) immunoreactivity in brain extracts. (Fig. 12B) Confirmation of tau seeding activity in brain extracts presented by insoluble tau using seeded tau aggregation assay, and AD but not Con brain extracts show tau seeding activity. Fig.13. AT8 signals in organoids treated with healthy individual-derived brain extract. Diffuse AT8+signals were observed in organoids at 2 weeks post-exposure to healthy individual-derived brain extracts, but no AT8+signal was observed at 4 weeks post-exposure. Scale bar, 20 μm. Figs. 14A-B. AT8 signals in organoids at 2 weeks post-exposure to the vehicle or AD brain extracts. (Fig. 14A) Representative image showing only modest diffuse axonal AT8+signals in organoids at 2 weeks post-exposure to vehicle. Diffuse AT8 signals were pointed with arrows. Scale bars, 20 μm. (Fig.14B) Representative image showing AT8+signals in organoids at 2 weeks post-exposure to AD brain extracts. Mainly aggregation was observed while few diffuse axonal signals were captured. Diffuse AT8 signals were pointed with arrows. Scale bars, 20 μm. Fig.15. MGI mammalian phenotype enrichment analysis of upregulated DEPs between AD group and vehicle group organoids. Fig.16. JENSEN Disease Enrichment analysis of 28 DEPs consistent with patient brain tissue derived results. 28 DEPs were identified that have a consistent upregulating trend with proteomics data obtained from pre-clinical / mild cognitive impairment / clinical stage AD patients. Figs.17 (A-C) Proteomics analysis highlights disrupted pathways in AD neuroimmune organoids. (Fig. 17A) Volcano plot displaying DEPs between AD group and vehicle group organoids (FC ≥ 1.5, p < 0.05, and FDR < 1%). A total of 87 proteins were identified, with 76 proteins upregulated and 11 proteins downregulated. (Fig.17B) Top 5 pathways identified via JENSEN Disease Enrichment analysis of the 76 identified upregulated proteins. (Fig. 17C) Top 8 pathways identified via KEGG Enrichment analysis of the 76 identified upregulated proteins. 3220-421482 70690-03 DETAILED DESCRIPTION Before the present disclosure is further described, it is to be understood that this disclosure is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. For the sake of brevity, the disclosures of the publications cited in this specification, including patents, are herein incorporated by reference. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which this disclosure belongs. All patents, applications, published applications and other publications referred to herein are incorporated by reference in their entireties. If a definition set forth in this section is contrary to or otherwise inconsistent with a definition set forth in a patent, application, or other publication that is herein incorporated by reference, the definition set forth in this section prevails over the definition incorporated herein by reference. As used herein and in the appended clauses, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. It is further noted that the clauses may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of clause elements, or use of a “negative” limitation. As used herein, the terms “including,” “containing,” and “comprising” are used in their open, non-limiting sense. To provide a more concise description, some of the quantitative expressions given herein are not qualified with the term “about.” It is understood that, whether the term “about” is used explicitly or not, every quantity given herein is meant to refer to the actual given value, and it is also meant to refer to the approximation to such given value that would reasonably be inferred based on the ordinary skill in the art, including equivalents and approximations due to the experimental and / or measurement conditions for such given value. Whenever a yield is given as a percentage, such yield refers to a mass of the entity for which the yield is given with respect to the maximum amount of the same entity that could be obtained under the particular stoichiometric conditions. Concentrations that are given as percentages refer to mass ratios, unless indicated differently. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein 3220-421482 70690-03 can also be used in the practice or testing of the present disclosure, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. Except as otherwise noted, the methods and techniques of the present embodiments are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification. See, e.g., Loudon, Organic Chemistry, Fourth Edition, New York: Oxford University Press, 2002, pp.360-361, 1084-1085; Smith and March, March's Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, Fifth Edition, Wiley-Interscience, 2001. Chemical nomenclature for compounds described herein has generally been derived using the commercially-available ACD / Name 2014 (ACD / Labs) or ChemBioDraw Ultra 13.0 (Perkin Elmer). As used herein and in connection with chemical structures depicting the variousembodiments described herein, “*”, “**”, and “ ”, each represent a point of covalentattachment of the chemical group or chemical structure in which the identifier is shown to an adjacent chemical group or chemical structure. For example, in a hypothetical chemical structure A-B, where A and B are joined by a covalent bond, in some embodiments, the portion of A-B defined by the group or chemical structure A can be represented by , ,or , where each of “-*”, “-**”, and “ ” represents a bond to A andthe point of covalent bond in some embodiments, the portion of A-B defined by the group or chemical structure B can be represented by "* B" , ,or , where each of “*”, “-**”, and “ ” represents a bond to B and the It is appreciated that certain features of the disclosure, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the disclosure, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination. All combinations of the embodiments pertaining to the chemical groups represented by the variables are specifically embraced by the present disclosure and are disclosed herein just as if each and every combination was individually and explicitly 3220-421482 70690-03 disclosed, to the extent that such combinations embrace compounds that are stable compounds (i.e., compounds that can be isolated, characterized, and tested for biological activity). In addition, all subcombinations of the chemical groups listed in the embodiments describing such variables are also specifically embraced by the present disclosure and are disclosed herein just as if each and every such sub-combination of chemical groups was individually and explicitly disclosed herein. DEFINITIONS Unless otherwise defined herein, scientific and technical terms used in this application shall have the meanings that are commonly understood by those of ordinary skill in the art. Generally, nomenclature used in connection with, and techniques of, chemistry, cell and tissue culture, molecular biology, cell and cancer biology, neurobiology, neurochemistry, virology, immunology, microbiology, pharmacology, genetics and protein and nucleic acid chemistry, described herein, are those well known and commonly used in the art. The methods and techniques of the present disclosure are generally performed, unless otherwise indicated, according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout this specification. See, e.g. “Principles of Neural Science”, McGraw-Hill Medical, New York, N.Y. (2000); Motulsky, “Intuitive Biostatistics”, Oxford University Press, Inc. (1995); Lodish et al., “Molecular Cell Biology, 4th ed.”, W. H. Freeman & Co., New York (2000); Griffiths et al., “Introduction to Genetic Analysis, 7th ed.”, W. H. Freeman & Co., N.Y. (1999); and Gilbert et al., “Developmental Biology, 6th ed.”, Sinauer Associates, Inc., Sunderland, Mass. (2000). All of the above, and any other publications, patents and published patent applications referred to in this application are specifically incorporated by reference herein. In case of conflict, the present specification, including its specific definitions, will control. To provide a more concise description, some of the quantitative expressions given herein are not qualified with the term “about.” It is understood that, whether the term “about” is used explicitly or not, every quantity given herein is meant to refer to the actual given value, and it is also meant to refer to the approximation to such given value that would reasonably be inferred based on the ordinary skill in the art, including equivalents and approximations due to the experimental and / or measurement conditions for such given value. For example, the term “about” may be an approximation of ± 10%, ±5%, or ±1%. Whenever a yield is given as a percentage, such yield refers to a mass of the entity for which the yield is given with respect to the maximum amount of the same entity that could be obtained under the particular 3220-421482 70690-03 stoichiometric conditions. Concentrations that are given as percentages refer to mass ratios, unless indicated differently. The term “agent” is used herein to denote a chemical compound (such as an organic or inorganic compound, a mixture of chemical compounds), a biological macromolecule (such as a nucleic acid, an antibody, including parts thereof as well as humanized, chimeric and human antibodies and monoclonal antibodies, a protein or portion thereof, e.g., a peptide, a lipid, a carbohydrate), or an extract made from biological materials such as bacteria, plants, fungi, or animal (particularly mammalian) cells or tissues. Agents include, for example, agents whose structure is known, and those whose structure is not known. A “patient,” “subject,” or “individual” are used interchangeably and refer to either a human or a non-human animal. These terms include mammals, such as humans, primates, livestock animals (including bovines, porcines, etc.), companion animals (e.g., canines, felines, etc.) and rodents (e.g., mice and rats). “Treating” a condition or patient refers to taking steps to obtain beneficial or desired results, including clinical results. As used herein, and as well understood in the art, “treatment” is an approach for obtaining beneficial or desired results, including clinical results. Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of disease, stabilized (i.e. not worsening) state of disease, preventing spread of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. “Treatment” can also mean prolonging survival as compared to expected survival if not receiving treatment. The term “preventing” is art-recognized, and when used in relation to a condition, such as a local recurrence (e.g., pain), a disease such as cancer, a syndrome complex such as heart failure or any other medical condition, is well understood in the art, and includes administration of a composition which reduces the frequency of, or delays the onset of, symptoms of a medical condition in a subject relative to a subject which does not receive the composition. Thus, prevention of cancer includes, for example, reducing the number of detectable cancerous growths in a population of patients receiving a prophylactic treatment relative to an untreated control population, and / or delaying the appearance of detectable cancerous growths in a treated population versus an untreated control population, e.g., by a statistically and / or clinically significant amount. “Administering” or “administration of” a substance, a compound or an agent to a subject can be carried out using one of a variety of methods known to those skilled in the art. 3220-421482 70690-03 For example, a compound or an agent can be administered, intravenously, arterially, intradermally, intramuscularly, intraperitoneally, subcutaneously, ocularly, sublingually, orally (by ingestion), intranasally (by inhalation), intraspinally, intracerebrally, and transdermally (by absorption, e.g., through a skin duct). A compound or agent can also appropriately be introduced by rechargeable or biodegradable polymeric devices or other devices, e.g., patches and pumps, or formulations, which provide for the extended, slow or controlled release of the compound or agent. Administering can also be performed, for example, once, a plurality of times, and / or over one or more extended periods. As used herein, the phrase “conjoint administration” refers to any form of administration of two or more different therapeutic agents such that the second agent is administered while the previously administered therapeutic agent is still effective in the body (e.g., the two agents are simultaneously effective in the patient, which may include synergistic effects of the two agents). For example, the different therapeutic compounds can be administered either in the same formulation or in separate formulations, either concomitantly or sequentially. Thus, an individual who receives such treatment can benefit from a combined effect of different therapeutic agents. A “therapeutically effective amount” or a “therapeutically effective dose” of a drug or agent is an amount of a drug or an agent that, when administered to a subject will have the intended therapeutic effect. The full therapeutic effect does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses. Thus, a therapeutically effective amount may be administered in one or more administrations. The precise effective amount needed for a subject will depend upon, for example, the subject's size, health and age, and the nature and extent of the condition being treated, such as cancer. The skilled worker can readily determine the effective amount for a given situation by routine experimentation. As used herein, the terms “optional” or “optionally” mean that the subsequently described event or circumstance may occur or may not occur, and that the description includes instances where the event or circumstance occurs as well as instances in which it does not. For example, “optionally substituted alkyl” refers to the alkyl may be substituted as well as where the alkyl is not substituted. It is understood that substituents and substitution patterns on the compounds of the present disclosure can be selected by one of ordinary skilled person in the art to result chemically stable compounds which can be readily synthesized by techniques known in the art, as well as those methods set forth below, from readily available starting materials. If a 3220-421482 70690-03 substituent is itself substituted with more than one group, it is understood that these multiple groups may be on the same carbon or on different carbons, so long as a stable structure results. The term “modulate” as used herein includes the inhibition or suppression of a function or activity (such as cell proliferation) as well as the enhancement of a function or activity. The term “Log of solubility”, “LogS” or “logS” as used herein is used in the art to quantify the aqueous solubility of a compound. The aqueous solubility of a compound significantly affects its absorption and distribution characteristics. A low solubility often goes along with a poor absorption. LogS value is a unit stripped logarithm (base 10) of the solubility measured in mol / liter. In treatment methods according to the disclosure, an “effective amount” means an amount or dose sufficient to generally bring about the desired therapeutic benefit in subjects needing such treatment. Effective amounts or doses of the compounds of the disclosure may be ascertained by routine methods, such as modeling, dose escalation, or clinical trials, taking into account routine factors, e.g., the mode or route of administration or drug delivery, the pharmacokinetics of the agent, the severity and course of the infection, the subject’s health status, condition, and weight, and the judgment of the treating physician. An exemplary dose is in the range of about from about 0.1 mg to 1 g daily, or about 1 mg to 50 mg daily, or about 50 to 250 mg daily, or about 250 mg to 1 g daily. The total dosage may be given in single or divided dosage units (e.g., BID, TID, QID). As used herein, the term “medium” or “media” includes any culture medium, solution, solid, semi-solid, or rigid support that may support or contain any host cell, including bacterial host cells, yeast host cells, insect host cells, plant host cells, eukaryotic host cells, mammalian host cells, CHO cells, prokaryotic host cells, E. coli, or Pseudomonas host cells, and cell contents. Thus, the term may encompass medium in which the host cell has been grown. REPRESENTATIVE EMBODIMENTS The present disclosure describes a vascularized neuroimmune organoid model that comprises multiple cell types, including a vascular network. In some embodiments, the organoid model is a 3D model. In some embodiments, the organoids are on a matrix, but preferably the organoids described herein are not on a matrix. In some aspects, the neuroimmune organoid body includes multiple cell types such as neurons, microglia, astrocytes, and a vascular network (e.g., blood vessels). In certain 3220-421482 70690-03 embodiments, the multiple cell types are derived from neural progenitor cells, primitive macrophage progenitors, and vascular progenitors. In some embodiments, the model stains positive for MAP2, NeuN, S100B, CD45, IBA1, Collagen IV, or PDGFRB, or any combination thereof. The organoid model includes a vascular network such as blood vessels, that extend through the organoid. The vascular network can include endothelial cells, pericytes, and others. The vascular network may also include Collagen IV formed vascular basement membranes. The vascular network lumen-like structures. In some embodiments, the multiple cell types of the organoid model are cells from hPSC which were derived from healthy individuals and Alzheimer’s Disease patients. In another aspect, the organoid model is prepared according to a process described herein. In some embodiments, the process comprises co-culturing hPSCs-derived neural progenitor cells (NPCs), primitive macrophage progenitors (PMPs), and vascular progenitors (VPs) under 3D conditions. For example, the organoids are floating in culture media and a plate. The cells can grow in three dimensions, and organoids have complex cell-cell, cell-cell matrix interactions, and organoids can have a preliminary brain architecture. In some embodiments, growing in these conditions is not like traditional cell culture, where cells grow in two dimensions. In some embodiments, one or more of the human cell types are cells from hPSC which were derived from healthy individuals and Alzheimer’s Disease patients. In some embodiments, the process comprises combining the NPCs, PMPs, and VPs to generate brain organoids. In some embodiments, the process comprises generating NPCs. The generated NPCs (i.e., hPSCs-derived NPCs) may be confirmed by co-expression of neural progenitor cell markers, PAX6, and NESTIN. In some embodiments, the process comprises generating PMPs. The generated PMPs may be confirmed by co-expression of CD235 and CD43. In some embodiments, the process comprises generating VPs. In some embodiments, VP identity can be assessed by examining the expression of blood cell lineage markers, such as those for endothelia, pericytes, and mural cells. Proper expression of these markers would confirm correct VP identity. In some embodiments, the initial number of cells (e.g., NPCs, PMPs, and VPs) can be present at particular ratio. In some embodiments, the initial number of cells is co-cultured at a ratio of about 20-40 NPC: about 10-15 PMP: about 5-15 VP. In some embodiments, the initial 3220-421482 70690-03 number of cells is co-cultured at a ratio of about 30:12:7 NPC:PMP:VP. In some embodiments, the initial number of cells is around 30,000 for NPCs, 12,000 for PMPs, and 7,000 for VPs. In some embodiments, the desired organoids can be constructed from starting cell rations (NPC:PMP:VC) of around 15:12:7, to 60:12:7; around 30:6:7 to 30:24:7; around 30:12:3 to 30:12:14, or variations thereof. In some embodiments, about 5% to about 40% of the total progenitor cell population are PMPs. In some embodiments, about 5% to about 60% of the total progenitor cell population are VPs. In some embodiments, about 5% to about 40% of the total progenitor cells are PMPs and about 5% to about 60% of the total progenitor cells are VPs. In some embodiments, the culture of the organoids was supplemented with mitogen fibroblast growth factor (bFGF) for about 5 days to promote cellular proliferation. In some embodiments, the method provides for a proliferation phase which lasts from about 1 day to about 14 days or more, depending upon the amount of proliferation desired. It is within the scope of the embodiments that the culture of organoids can be maintained in culture for prolonged periods of time as per cell culture technology. It is contemplated that the appropriate conditions can be used to maintain continuous organoid culture. In some embodiments, organoids were transitioned to a neural differentiation medium which contained neurotrophic factors, interleukin-34 (IL-34), vascular endothelial growth factor (VEGF), and other supplements for long-term culture to support neuronal, microglial, and vascular maturation. In some embodiments, the organoids were transitioned to a neural differentiation medium which contained neurotrophic factors, interleukin-34 (IL-34), vascular endothelial growth factor (VEGF), and other supplements for long-term culture to support neuronal, microglial, and vascular maturation. In some aspects, a method for screening for effective therapeutic treatment of Alzheimer's Disease pathologies includes administering a target treatment to an organoid model as described herein, and assessing resultant effects. In some embodiments, the method comprises comparing efficacy of the test treatment as compared to a control sample. In some aspects, a system for Alzheimer's Disease drug discovery comprises an organoid model as described herein, and systematic screening of target treatments for efficacy using the organoid model. In some embodiments, the system is adapted to automated testing and monitoring. In some embodiments, the target treatment is an antibody of a small molecule. In some embodiments, the target treatment is an antibody. In some embodiments, the antibody is 3220-421482 70690-03 Lecanemab or Donanemab. In some embodiments, administering a target treatment (e.g., an antibody such as Lecanemab or Donanemab) to the model decreases amyloid along with an elevated vascular inflammation response. In some aspects, a method for inducing Alzheimer's Disease pathologies in an in vitro method that comprises constructing a neurological organoid model as described herein, and introducing a brain extract from Alzheimer’s Disease patient to the in vitro organoid model. In some embodiments, the method comprises treating the organoids with sAD individual postmortem tissue-derived brain extracts. In some embodiments, the method comprises treating the organoids with fAD individual postmortem tissue-derived brain extracts. In some embodiments, homogenates (e.g., brain homogenates) can be used as extracts. In some aspects, a method for inducing Alzheimer's Disease pathologies in the in vitro organoid model as described herein comprises introducing a brain extract from Alzheimer’s Disease patient to the organoid model. In some embodiments, the method comprises treating organoids with sAD individual postmortem tissue-derived brain extracts to model sAD. In some embodiments, the method comprises treating organoids with fAD individual postmortem tissue-derived brain extracts to model fAD. In some embodiments, the organoids after about 10 days of neuronal differentiation are exposed to AD brain extracts or the vehicle for about two days. In some embodiments, the exposure to brain extract is about 1 day, about 2 days, about 3 or more days, up to 1 week or more depending on the level of pathologies desired. It is further contemplated that continuous exposure of organoid culture to brain extract can be maintained in an environment for long-term study and testing. In some embodiments, samples are collected at about 2 weeks or 4 weeks post-exposure. In some embodiments, homogenates (e.g., brain homogenates) can be used as extracts. In some embodiments, in a method as described herein, one or more of the human cell types are cells from hPSC which were derived from healthy individuals and Alzheimer’s Disease patients. The present embodiment further provides for the described method comprising the co-culture of hPSCs-derived neural progenitor cells (NPCs), primitive macrophage progenitors (PMPs), and vascular progenitors (VPs) under 3D conditions. The present embodiment also provides for the method as described comprising: generating NPCs and PMPs; generating VPs; combining to generate brain organoids, the initial number of cells was calibrated and co-cultured at 30,000 for NPCs, 12,000 for PMPs, and 7,000 for VPs. It is within the scope of the present embodiment to vary the number of cells and cell ratios. For example, a ratio of NPC’s to PMP’s to VPs is recommended to be around 30:12:7. This ratio can be adjusted depending upon the desired composition of differentiated cell type desired in 3220-421482 70690-03 the resultant organoid. Cell types in the final model include neurons, microglia or blood vessels. The initial number of cells can also be adjusted depending on how long a period of time is desired for keeping the organoids in the proliferative stage / mode to all the progenitor cells to expand. Thus, the actual number of cells utilized with fall within a ratio of initial cells, which can vary within a range that yields the desired organoids. Thus, it is within the scope of the present embodiment to construct the desired organoids from starting cell rations (NPC:PMP:VC) of around 15:12:7, to 60:12:7; around 30:6:7 to 30:24:7; around 30:12:3 to 30:12:14, or variations thereof. The present embodiment further provides for the described method where identifying hPSCs-derived NPCs was confirmed by co-expression of neural progenitor cell markers, PAX6 and NESTIN. The present embodiment provides for the described method where PMPs were confirmed by co-expression of CD235 and CD43. The present embodiment provides for the method as described where culture of the organoids was supplemented with mitogen fibroblast growth factor (bFGF) for about 5 days to promote cellular proliferation. The present embodiment provides for a proliferation phase which lasts from about 1 day to about 14 days or more, depending upon the amount of proliferation desired. It is within the scope of the embodiment that the culture of organoids can be maintained in culture for prolonged periods of time as per cell culture technology. It is contemplated that the appropriate conditions can be used to maintain continuous organoid culture. The embodiment provides for the method where organoids, after proliferation, are transitioned to a neural differentiation medium which contained neurotrophic factors, interleukin-34 (IL-34), vascular endothelial growth factor (VEGF), and other necessary supplements for long-term culture to support neuronal, microglial, and vascular maturation. The present embodiment provides for a method for screening for effective therapeutic treatment of Alzheimer's Disease pathologies comprising administering target treatment to the organoid model as above and assessing resultant effects. The present embodiment provides for the method as above, further comprising comparing efficacy of the test treatment as compared to a control sample. The present embodiment provides for a system for Alzheimer's Disease drug discovery comprising an organoid model as described, and systematic screening of target treatments for efficacy using the organoid model. The present embodiment provides for a system as described above, adapted to automated testing and monitoring. 3220-421482 70690-03 The present embodiment provides for a method for inducing Alzheimer's Disease pathologies in an organoid model, comprising; constructing a neurological organoid model, introducing a brain extract from Alzheimer’s Disease patient to the organoid model. The present embodiment provides for the method for inducing Alzheimer's Disease pathologies in a vascularized organoid model as described above, comprising introducing brain extracts from Alzheimer’s Disease patients to the organoid model. The present embodiment provides for a method as described comprising treating organoids with sAD individual postmortem tissue-derived brain extracts to model sAD. The present embodiment provides for the method as described where the organoids undergo 10 days of neuronal differentiation, exposed to AD brain extracts for two days, and samples collected 2 to 4 weeks after exposure. The present disclosure provides for a differentiation phase can last from less than about 1 day to about 28 days or more, depending upon the amount of differentiation is desired. It is within the scope of the embodiment that the culture of organoids can be maintained in culture for prolonged periods of time as per cell culture technology. It is within the scope of the embodiment that longer term culture and exposure to AD brain extract is advantageous for AD pathologies to accumulate in the system. Thus, it is contemplated that exposure of organoids can take place in the time frame of less than 1 day to 2 days or much longer, for example several days, or even weeks, depending on the level of pathology desired. Thus, the present embodiment contemplates exposure to brain extract of about 1 day, about 2 days, about 3 or more days, up to 1 week or more depending on the level of pathologies desired. It is further contemplated that continuous exposure of organoid culture to brain extract can be maintained in an environment for long-term study and testing. In some embodiments, a method for preparing a 3D organoid comprises: co-culturing neural progenitor cells (NPCs), primitive macrophage progenitor cells (PMPs), and vascular progenitor cells (VPs) in an assembly media thereby forming a self- assembled organoid; and differentiating the self-assembled organoid by transferring the self-assembled organoid to differentiation media thereby forming a differentiated organoid comprising neurons, microglia, astrocytes, and blood vessels. As described herein, differentiated organoid stains can stain positive for MAP2, NeuN, S100B, CD45, IBA1, Collagen IV, or PDGFRB, or any combination thereof. The differentiated organoid can include endothelial cells, pericytes, Collagen IV formed vascular basement membranes, lumen-like structures, or any combination thereof. 3220-421482 70690-03 In some embodiments of the step of co-culturing, the PMPs can be added so that they are present at about 5% to about 40% of the total progenitor cells. In some embodiments, the VPs are present at about 5% to about 60% of the total progenitor cells. In some embodiments, the method may further allow that the ratio of NPCs:PMPs:VPs is about 30:12:7. In some embodiments, the assembly media can comprise a blend of NPC medium (e.g., medium and neuronal supplements) and PMP medium (e.g., medium comprising interleukin- 3). In some embodiments, the step of co-culturing can be referred to as the Proliferation Stage. In some embodiments, mitogen fibroblast growth factor (bFGF) is added to the media. In some embodiments, the step of co-culturing is performed for about 3 days to about 10 days (e.g., about 5 days). In some embodiments, the assembly media is a mixture, preferably a 1:1 mixture, of NPC medium (1:1 mixture of Neurobasal and DMEM / F12, supplemented with 1 × N2, 1 × B27-RA, FGF2 (20 ng / mL) and PMP medium. In some embodiments, the step of differentiating preferably occurs after the step of co- culturing. In some embodiments, the step of differentiating is referred to as the Differentiation Stage. In some embodiments, the differentiation media comprises neuronal supplements, neurotrophic factors, ascorbic acid, c-AMP, IL-34, macrophage colony stimulating factor (MCSF), TGF-β1, or any combination thereof. In some embodiments, the differentiation media comprises neuronal supplements, neurotrophic factors, ascorbic acid, c-AMP, IL-34, macrophage colony stimulating factor (MCSF), and TGF-β1. In some embodiments, the step of differentiating is performed for about 5 days to about 15 days (e.g., about 10 days). In some embodiments, differentiation media comprises a 1:1 mixture of Neurobasal and DMEM / F12, supplemented with 1 × N2, 1 × B27-RA, BDNF (10 ng / mL), GDNF (10 ng / mL), L-Ascrobic acid (200 nM), c-AMP (1 μM), IL-34 (100 ng / mL), M-CSF (25 ng / mL), and TGF-β1 (50 ng / mL). In some embodiments, the method further comprises contacting the differentiated organoid with brain extracts (e.g., Alzheimer’s Disease extract such as from sAD or fAD patients). In some embodiments, the brain extracts are homogenates from brain tissue. In some embodiments, the method includes contacting the organoid with healthy extracts to form a control organoid. In some embodiments, the step of contacting is performed for about 1 day to about 5 days. In some embodiments, the organoids are collected about 1 week to about 5 weeks after the step of contacting. For example the organoids can be collected at about 2 weeks or about 4 weeks after the step of contacting. The organoids can then be used for evaluating therapeutics (e.g., antibodies or small molecule therapeutics) for a disease (e.g., Alzheimer’s Disease) or for other studies of the disease. For example, antibodies being evaluated for 3220-421482 70690-03 therapeutic purposes for a disease (e.g., Alzheimer’s Disease) can be evaluated using the organoids described herein. The systems and methods of the present disclosure can be described as embodiments if any of the following enumerated clauses. It will be understood that any of the embodiments described herein can be used in connection with any other embodiment described herein to the extent that the embodiments do not contradict one another. 1. A human pluripotent stem cell (hPSC)-based in vitro vascularized neuroimmune organoid model, comprising neurons, microglia, astrocytes, and blood vessels. 2. The in vitro organoid model of clause 1, wherein the organoid model comprises cells derived from neural progenitor cells, primitive macrophage progenitors, and vascular progenitors. 3. The in vitro organoid model of clause 1 or 2, wherein the model is a 3D model (e.g., floating in culture media). 4. The in vitro organoid model of any one of the preceding clauses, wherein the model stains positive for MAP2, NeuN, S100B, CD45, IBA1, Collagen IV, or PDGFRB, or any combination thereof. 5. The in vitro organoid model of any one of the preceding clauses, wherein the organoid model includes endothelial cells and pericytes. 6. The in vitro organoid model of any one of the preceding clauses, wherein the model includes Collagen IV formed vascular basement membranes. 7. The in vitro organoid model of any one of the preceding clauses, wherein the model includes lumen-like structures. 8. The in vitro organoid model of any one of the preceding clauses, wherein the multiple cell types are cells from hPSC which were derived from healthy individuals and Alzheimer’s Disease patients. 9. A method for constructing the in vitro organoid model of any one of the preceding clauses, comprising co-culturing hPSCs-derived neural progenitor cells (NPCs), primitive macrophage progenitors (PMPs), and vascular progenitors (VPs) under 3D conditions (e.g., floating in culture media). 10. The method of clause 9, wherein one or more of the cell types are cells from hPSC which were derived from healthy individuals and Alzheimer’s Disease patients. 11. The method of clause 9 or 10, comprising: generating NPCs and PMPs; generating VPs; and 3220-421482 70690-03 combining the NPCs, PMPs, and VPs to generate brain organoids. 12. The method of any one of clauses 9-11, wherein the NPCs, PMPs, and VPs are co- cultured at a ratio of about 30:12:7 NPC:PMP:VP. 13. The method of any one of clauses 9-12, wherein the initial number of cells is about 30,000 NPCs, about 12,000 PMPs, and about 7,000 VPs. 14. The method of any one of clauses 9-13, wherein identifying hPSCs-derived NPCs was confirmed by co-expression of neural progenitor cell markers, PAX6 and NESTIN. 15. The method of any one of clauses 9-14, where PMPs were confirmed by co- expression of CD235 and CD43. 16. The method of clause any one of clauses 9-14, wherein the culture of the organoids was supplemented with mitogen fibroblast growth factor (bFGF) for about 5 days to promote cellular proliferation. 17. The method of clause 16, where organoids were transitioned to a neural differentiation medium which contained neurotrophic factors, interleukin-34 (IL-34), vascular endothelial growth factor (VEGF), and other supplements for long-term culture to support neuronal, microglial, and vascular maturation. 18. A method for screening for effective therapeutic treatment of Alzheimer's Disease pathologies comprising administering target treatment to the organoid model of any one of clauses 1-8 or prepared by the process of any one of clauses 9-17 and assessing resultant effects. 19. The method of clause 18, further comprising comparing efficacy of the test treatment as compared to a control sample. 20. A system for Alzheimer's Disease drug discovery comprising the in vitro organoid model of any one of clauses 1-8, or one prepared by the process of any one of clauses 9-17, and systematic screening of target treatments for efficacy using the organoid model. 21. The system of clause 20, adapted to automated testing and monitoring. 22. A method for inducing Alzheimer's Disease pathologies in an in vitro organoid model, comprising: constructing a neurological organoid model, and introducing a brain extract from Alzheimer’s Disease patient to the in vitro organoid model. 23. The method of clause 22, wherein the in vitro organoid model is an in vitro organoid model according to any one of clauses 1-8, or one prepared by the process of any one of clauses 9-17. 3220-421482 70690-03 24. The method of clause 22 or 23, comprising treating the organoids with sporadic AD (sAD) individual postmortem tissue-derived brain extracts. 25. The method of clause 22 or 23, comprising treating the organoids with familial AD (fAD) individual postmortem tissue-derived brain extracts. 26. A method for inducing Alzheimer's Disease (AD) pathologies in the in vitro organoid model according to any one of clauses 1-8, or one prepared by the process of any one of clauses 9-17, comprising introducing a brain extract from an Alzheimer’s Disease patient to the organoid model. 27. The method of clause 26, comprising treating organoids with sporadic AD (sAD) individual postmortem tissue-derived brain extracts to model sAD. 28. The method of clause 26, comprising treating the organoids with familial AD (fAD) individual postmortem tissue-derived brain extracts. 29. The method of any one of clauses 26-28, where organoids after about 10 days of neuronal differentiation are exposed to AD brain extracts or the vehicle for about two days, and samples were collected at about 2 weeks or 4 weeks post-exposure. 30. A method for preparing a 3D organoid comprising: co-culturing neural progenitor cells (NPCs), primitive macrophage progenitor cells (PMPs), and vascular progenitor cells (VPs) in an assembly media thereby forming a self- assembled organoid; and differentiating the self-assembled organoid by transferring the self-assembled organoid to differentiation media thereby forming a differentiated organoid comprising neurons, microglia, astrocytes, and blood vessels. 31. The method of clause 30, wherein the differentiated organoid stains positive for MAP2, NeuN, S100B, CD45, IBA1, Collagen IV, or PDGFRB, or any combination thereof. 32. The method of clause 30 or 31, wherein the organoid model includes endothelial cells, pericytes, Collagen IV formed vascular basement membranes, lumen-like structures, or any combination thereof. 33. The method of any one of clauses 30-32, wherein the PMPs are present at about 5% to about 40% of the total progenitor cells. 34. The method of any one of clauses 30-33, wherein the VPs are present at about 5% to about 60% of the total progenitor cells. 35. The method of any one of clauses 30-34, wherein the ratio of NPCs:PMPs:VPs is about 30:12:7. 3220-421482 70690-03 36. The method of any one of clauses 30-35, wherein the assembly media comprises a blend of NPC medium (e.g., media and neuronal supplements) and PMP medium (e.g., medium comprising interleukin-3). 37. The method of any one of clauses 30-36, wherein the step of co-culturing is performed for about 3 days to about 10 days (e.g., about 5 days). 38. The method of any one of clauses 30-37, wherein the differentiation media comprises neuronal supplements, neurotrophic factors, ascorbic acid, c-AMP, IL-34, macrophage colony stimulating factor (MCSF), TGF-β1, or any combination thereof. 39. The method of any one of clauses 30-38, wherein the step of differentiating is performed for about 5 days to about 15 days (e.g., about 10 days). 40. The method of any one of clauses 30-39, further comprising contacting the differentiated organoid with brain extracts (e.g., Alzheimer’s Disease extract such as from sporadic AD (sAD) or familial AD (fAD) patients). 41. The method of clause 40, wherein the step of contacting is performed for about 1 day to about 5 days. EXAMPLES Exemplary materials and systems useful in methods of the description will now be described by reference to illustrative examples for their general preparation below and the specific examples that follow. Artisans will recognize that, to obtain the various systems herein, starting materials may be suitably selected so that the ultimately desired components will be carried through the scheme with or without protection as appropriate to yield the desired product. Alzheimer’s Disease (AD) is a devastating neurodegenerative disorder and the most common cause of dementia, affecting more than 55 million individuals globally. Despite extensive efforts, most therapeutics have failed in clinical trials till now, with only limited effective treatments currently available. AD is manifested with progressive cognitive decline and is characterized by multiple pathological hallmarks, including extracellular amyloid beta (Aβ) plaques, intracellular microtube-associated tau neurofibrillary tangles (NFTs), neuroinflammation, synapse / neuronal loss, and brain atrophy. To understand the mechanisms and develop therapeutics for AD, various animal models have been developed and significantly advanced the understanding of the disease mechanism. However, most existing models focus on dominantly inherited familial AD (fAD), which is caused by genetic mutations in genes 3220-421482 70690-03 identified in individuals with fAD, including amyloid precursor protein (APP), presenilin1 (PSEN1), and presenilin2 (PSEN2). In contrast, models for sporadic AD (sAD), which do not involve highly penetrating genetic mutations and account for 95% of all AD cases, are severely limited. While both fAD and sAD share similar pathological hallmarks, such as Aβ plaques and NFTs, the etiology of sAD is still largely unknown and may involve more complicated genetic and environmental interactions. Thus, developing appropriate models for sAD without genetic mutations is critically needed. Moreover, significant species difference exists between humans and rodents. For instance, many repeat sequences in the genome and gene splicing patterns are unique to humans. These species differences may have profound impacts when modeling neurological disorders, particularly for AD, and may significantly contribute to the failures of many AD therapeutics that succeeded in pre-clinical animal studies but failed in clinical trials. Therefore, it is critical to use human samples and develop human AD models that could recapitulate sAD features to advance the understanding of the disease mechanism and facilitate the development of therapeutic interventions. Given the challenge of accessing and manipulating functional human brain tissues, human pluripotent stem cells (hPSCs), which include human embryonic stem cells (hESCs) and induced pluripotent stem cells (iPSCs), have emerged as valuable tools to utilize human cells for studying human neurological disorders, including AD. The hPSC-based in vitro models, including two-dimensional (2D) and 3D models with pure human neural cells, are easy to manipulate and enable a high throughput for screening making them valuable for modeling AD. The hPSC 2D model is useful for dissecting the impact of genetic and other factors on the individual cell types involved in AD at a basic functional level. On the other hand, recent studies have also highlighted the value of hPSC 3D models, such as brain organoids and multiple cell type co-culture-based models, which incorporate various neural cell types and intricate cell-cell and cell-matrix interactions and preliminary neural structures, offering a more physiologically relevant environment to model diverse aspects of AD. For example, fAD iPSC-derived brain organoids have successfully replicated AD pathological events, including Aβ aggregates and hyperphosphorylated tau, and facilitated the understanding of AD, such as the roles of APOE4 and C3 complement in AD. However, critical limitations persist, impeding these 3D models from effectively modeling AD. (1) Most research used simple organoids composed mainly of neurons and astrocytes. Although some studies have integrated microglia into organoids, or incorporated blood vessels into 3D neural culture, it is still a challenge to integrate multiple cell types, particularly microglia and blood vessels simultaneously within one organoid to reflect the 3220-421482 70690-03 complex pathophysiological environment of AD brains. (2) The current organoid models for AD study mainly focused on fAD, and these models usually take three to six months to exhibit AD pathologies. An intriguing recent study induced sAD-like phenotypes by exposing healthy organoids to serum to mimic the condition of blood-brain barrier (BBB) leakage, a risk factor for sAD. However, a brain organoid model that contains multiple cell types affected in AD brains, capable of effectively recapitulating key AD pathological hallmarks of sAD within a relatively short time frame induced by an efficient trigger for modeling sAD, is still lacking. To circumvent these limitations, a vascularized neuroimmune organoid model was developed for studying AD, particularly for sAD. This organoid model contains multiple cell types that are affected in human AD brains, including human neurons, astrocytes, microglia, and blood vessels. Since AD postmortem brain tissues contain proteopathic seeds, including Aβ and tau, that have the prion-like seeding activity to induce counterpart normal protein aggregate in animal models, it was hypothesized that sAD postmortem tissues-derived brain extracts that contain both Aβ and tau seeds, can induce multiple AD pathologies in human cells in organoids, mirroring observations in sAD. Remarkably, the results demonstrated that organoids exposed to AD brain extracts successfully recapitulated multiple AD-like pathologies, including Aβ plaque-like aggregates, tau tangle-like aggregates, neuroinflammation, elevated microglial synaptic pruning, synapse / neuronal loss, but not organoids treated with vehicle control. Furthermore, the organoids for drug discovery were validated using Lecanemab, an FDA-approved anti-Aβ antibody for AD treatment, and observed a significant alleviation of Aβ burden after treatment in the organoids that have been exposed to AD brain extracts. Thus, this vascularized neuroimmune organoid model presents a unique opportunity to study sAD and holds great promise to facilitate AD drug development. Material and Methods Culture and quality control of hPSC lines Five different hiPSC lines, KOLF2.1, ND2, GCaMP, ApoE4 / 4 C112R and UTY1, as well as one hESC cell line CAGG, were used in this study (Supplementary Table S1). The hiPSCs were maintained under feeder-free conditions and cultured on hESC-qualified Matrigel (Corning) coated dish in mTeSR plus media (STEMCELL Technologies). The hiPSCs were passaged at approximately 70% confluency with ReLeSR media (STEMCELL Technologies). 3220-421482 70690-03 NPC generation and culture Small molecule-based protocols were applied when generating NPCs as in previous studies. Neural differentiation in the embryoid bodies (EBs) was induced by dual inhibition of SMAD signaling. In summary, EBs were cultured in neural induction medium composed of DMEM / F12 (HyClone) and 1 × N2 Supplement (Thermo Fisher Scientific) supplied with inhibitor SB431542 (2 μM, Stemgent) and noggin (50 ng / mL, Peprotech) for 6 days before plating on growth factor-reduced Matrigel (BD Biosciences) coated plates. EBs were cultured with neural induction medium supplied with laminin (1 μg / mL, Corning) for 7 days, and then NPCs in the form of neural rosette were manually isolated from surrounding cells. Isolated NPCs were expanded for 5 to 7 days, depending on the confluency, in NPC medium, which is composed of a 1:1 mixture of Neurobasal (Thermo Fisher Scientific) and DMEM / F12, supplemented with 1×N2, 1×B27-RA (Thermo Fisher Scientific), FGF2 (20 ng / mL, Peprotech), human leukemia inhibitory factor (hLIF, 10 ng / mL, Millipore), CHIR99021 (3 μM, Biogems), SB431542 (2 μM), and ROCK inhibitor Y-27632 (10 μM, Tocris). PMP generation and culture PMPs were generated as previous studies. Briefly, embryoid bodies (EBs) were generated from hiPSCs and induced to yolk sac EBs (YS-EBs) by adding bone morphogenetic protein 4 (BMP4, 50 ng / mL, Peprotech; to induce mesoderm), vascular endothelial growth factor (VEGF, 50 ng / mL, Peprotech; endothelial precursors), and stem cell factor (SCF, 20 ng / mL, Miltenyi Biotech; Hematopoietic precursors) into mTeSR1 media (STEMCELL Technologies) for 5 days. Next, YS-EBs were plated into dishes and cultured with PMP medium composed of interleukin-3 (IL-3, 25 ng / mL, Peprotech) and macrophage colony- stimulating factor (M-CSF, 100ng / mL, Peprotech) in XVIVO media (Lonza). Human PMPs emerged into the supernatant 2 to 3 weeks after plating and were continuously produced for more than 3 months. VP generation and culture VPs were generated using a published protocol with minor modifications. In brief, hiPSCs were dissociated to form aggregates in a low-attachment plate and differentiated into mesoderm with CHIR99021 (12 μM, Peprotech) and BMP4 (30 ng / mL) in a 1:1 mixture of Neurobasal and DMEM / F12, supplemented with 1×N2, 1×B27-RA for 3 days. Then, vascular lineage induction was performed with VEGF (100 ng / mL) and forskolin (2 μM) for 2 days. 3220-421482 70690-03 Cell aggregates were then embedded into growth factor-reduced Matrigel, cultured with VEGF (100 mg / mL), FGF2 (100 ng / mL), and 15% FBS (Gibco) in XVIVO media for 5 days to allow vessel sprouting. Cell aggregates were dissociated by TrypLE into single cells, which served as the VP for the following organoid generation. Brain extract preparation and tau seeding activity confirmation To obtain 10% (w / v) brain extracts, frozen temporal cortex tissues of histopathologically confirmed AD cases with Braak Stages V-VI from the Brain Tissue Resource Center, McLean Hospital, Belmont, MA, USA, were prepared in homogenization buffer (20 mM Tris–HCl, pH 8.0, 0.32 M sucrose, 10 mMβ-mercaptoethanol (β-ME), 5 mM MgSO 4, 1 mM EDTA,10 mM glycerophosphate, 1 mM Na3VO4, 50 mM NaF, 2 mM benzamidine, 1 mM 4-(2-aminoethyl) benzenesulfonyl fluoride hydrochloride (AEBSF), and 10 μg / ml each aprotinin, leupeptin, and pepstatin), and centrifuged at 10,000×g for 30 min, as previously reported. Tau seeding activity of brain extracts was confirmed (Figs.11A-B), using in vitro seeded tau aggregation assay, in which HEK-293T cells expressing HA-tau151-391 was treated with brain extracts and lysed in RIPA buffer. Seeded HA-tau151-391 aggregates were yielded by ultracentrifugation and analyzed by immuno-blots, as previously reported. Organoid assembly, culture, brain extract treatment, and drug treatment To generate vascularized immune-brain organoids, 30,000 NPCs, 12,000 PMPs, and 7,000 VPs were co-cultured for organoid self-assembly. Organoids were cultured in a 1:1 mixture of NPC medium (1:1 mixture of Neurobasal and DMEM / F12, supplemented with 1×N2, 1×B27-RA, FGF2 (20 ng / mL)) and PMP medium for 5 days to allow proliferation, and were transferred to ND medium, which is composed of a 1:1 mixture of Neurobasal and DMEM / F12, supplemented with 1×N2, 1×B27-RA, BDNF (10 ng / mL, Peprotech), GDNF (10 ng / mL, Peprotech), L-Ascrobic acid (200 nM, Sigma Aldrich), c-AMP (1 μM, Sigma Aldrich), IL-34 (100 ng / mL, Peprotech), M-CSF (25 ng / mL), TGF-β1 (50 ng / mL, Peprotech). After 10 days of differentiation, vehicle or brain extracts derived from AD patients, or age-matched healthy individuals (2 mg / ml), were added to the culture medium (10 μL / mL) for two days. The organoids were collected at 2 weeks or 4 weeks post-exposure to brain extracts or the vehicle. Four weeks post exposure to brain extracts, Lecanemab (Sellekchem, Cat#A3112) was added to medium at a concentration of 10 μg / mL. Samples were collected after 2 weeks of Lecanemab treatment. 3220-421482 70690-03 Table S1. Cell lines used to generate NPCs, PMPs, and VPs. Cell line Gender Donor APOE Type Source allele . g. Antibodies Source Dilution 3220-421482 70690-03 Antibodies Source Dilution PHF-1 From Dr. Peter Davies 1:500 Forward primer Reverse primer Human IL6 ACTCACCTCTTCAGAACGAATTG CCATCTTTGGAAGGTTCAGGTTG G G Table S4. Upregulated proteins in AD group organoids compared with control group NDUFAB1 3220-421482 70690-03 CD63 IFITM3 NHSL1 3220-421482 70690-03 OR5AC2 MANF CNN2 Table S5. Downregulated proteins in AD group organoids compared with control group 3220-421482 70690-03 ECD FGFBP3 . p gulated proteins in AD organoids consistent with patient data FXYD6 3220-421482 70690-03 HMGB2 COX6B1 emistry and cell counting Organoids were fixed with 4% paraformaldehyde and then cryo-sectioned at 15 μm thickness for immunostaining. The tissues were blocked with a blocking solution (5% goat or donkey serum in PBS with 0.2% Triton X-100) at room temperature for 1 hr. Primary antibodies were diluted in the same blocking solution and incubated at 4 °C overnight. Sections were washed with PBS and incubated with secondary antibodies for 1 hr at room temperature. Sections were then washed with PBS and were mounted with anti-fade Fluoromount-G medium containing 1,40,6-diamidino-2-phenylindole dihydrochloride (DAPI) (Southern Biotechnology). Antibodies used were listed in Table S2. For Thioflavin-S staining, sections were washed with 70% and 80% ethanol for 1 minute, respectively, followed by 15 minutes of incubation of 0.05% freshly prepared and filtered Thioflavin-S solution. Samples were then washed with 80% and 70% ethanol sequentially for 1 minute, and finally rinsed with water. Images were captured with a Zeiss LSM 900 confocal microscopy. Image analysis was performed using Fiji (NIH). Relative fluorescence intensity was presented as normalized value to the vehicle group. Cells, plaques, or synapses were counted with Fiji. At least three fields of each organoid were chosen randomly to count after Z projection. The data are repeated three to four times (n=3 or 4) from 3 hPSC lines, each experiment used one hPSC line and contained 4-6 organoids. Gallyas Silver Staining The Gallyas silver staining method was used to stain the Tau tangles. Slides were washed in distilled water for one minute and transferred immediately to alkali silver iodide for 15 minutes. Next, slides were washed for 1 minute in 2% oxalic acid, followed by three washes in distilled water for 1 minute. Then the slides were incubated in alkaline silver iodide solution 3220-421482 70690-03 for 2-5 minutes followed by three rinsing in 0.5% acetic acid for 1 minute each. Then slides were incubated in physical developer solution for 15 -20 minutes. The developer was made fresh before use in a 1:1 ratio (solution A: solution B). Next, the samples were washed in 0.5% acetic acid and 1% sodium thiosulfate for 5 minutes each. Subsequently, samples were washed in distilled water for five minutes, and incubated in 0.5% gold chloride solution, and sodium thiosulfate for 5 minutes each. Finally, the samples were washed in distilled water for five minutes, counterstained with nuclear fast red, and mounted using Permount solution. RNA isolation and qPCR Total RNA isolation was performed with TRIzol Reagent (Invitrogen) and complementary DNA was prepared with SuperScript IV First-Strand Synthesis System (Invitrogen). The qPCR assays were performed with SYBR Green PCR Master Mix in QuantStudio 3 (Applied Biosystems), primers used were listed in Table S3. The 2–ΔΔCtmethod was used to calculate relative gene expression after normalization to the β-actin internal control. Microelectrode Arrays (MEA) Organoids at around 21 days were seeded into 48-well transparent MEA plates (Axion Biosystems) at one organoid per well. MEA assays were performed with Maestro Pro platform (Axion Biosystems) and recorded using AxIS software. Organoids were fed with BrainPhys media (STEMCELL Technologies) supplemented with 1×N2, 1×B27, 20 ng / mL BDNF, 20 ng / mL GDNF, as well as brain extract or vehicle. For recording, following a 5 min resting time in the instrument, each plate was recorded for 10 min to calculate the spike per well. Experiments were repeated for four times, each experiment used one hPSC line and contained 3-4 organoids. MEA analysis was performed using the Axion Biosystems NeuralMetrics Tool. Proteomics sample preparation and data analysis Organoid proteins were extracted following a previously described pipeline with modifications. Specifically, the organoids were solubilized using 1X RIPA buffer supplemented with 1X protease inhibitor and 1X phosphatase inhibitor. Next, the organoids tissue as disrupted in a tissue homogenizer and subjected to a 3x cycle sonication in a water bath. The protein concentration in the lysate was measured using a BCA assay. Proteins (~5 µg) were denatured by mixing with 4x LDS sample buffer and boiling at 95 °C for 10 min. The 3220-421482 70690-03 protein mixture was loaded into a 1 mm x 12-well NuPAGETM12% Bis-Tris gel (ThermoFisher, NP0322BOX) and run at 200 V for 5 min using MOPS Running Buffer (ThermoFisher). Gel slices were placed in deionized water and washed on a rocker. The cleaned gel slices were proceeded to digest and extract peptides. Proteins were digested with trypsin / LysC (PierceTM) (1 µg trypsin / sample), and digested peptides were extracted and passed through Peptide Cleanup C18 Spin Tubes for desalting. Desalted and dried peptides obtained from in-gel preparations were reconstituted in 5% (v / v) ACN and 0.1% (v / v) formic acid (FA) before being analyzed by HPLC-MS / MS using a 480-Exploris MS (ThermoFisher) equipped with an Ultimate 3000 HPLC (ThermoFisher) and an AuroraTMUltimate analytical column (IonOpticks). 500 ng of peptides for each sample were loaded on a trap column and separated on a 25 cm nanoflow UHPLC IonOpticks C18 column. Peptides were analyzed in a 130 min gradient of 12%-45% buffer B (buffer A: 0.1% FA; buffer B: 80% ACN, 0.1% FA). All the data were acquired in a data-independent acquisition mode. The integrity and performance of the MS instrument were monitored using HeLa standards before and after the experimental runs. MS raw data files were processed using Spectronaut software (version 18.4, Biognosys) using a Direct DIA mode. In silico spectral libraries were constructed using the latest version of the human proteome file downloaded from UniProt. The BGS factory settings were applied as a default for analyzing the data and selecting the candidates. The raw output files were subjected to multivariate analysis. Biognosys’s default package was used for the analysis and for sorting the DEPs using the criteria of FC≥1.5, adjusted p<0.05. The volcano plot was generated using default Biognosys settings. Pathway enrichment analysis was performed using the online tool Enrichr, with the Enrichr background library for the analysis. Statistics and reproducibility All data represent mean ± SEM. Significance is determined using a two-tailed unpaired t-test with Welch's correction for comparing two independent groups, or a one-way ANOVA test with Bonferroni post-hoc test for comparing three or more groups. A p value < 0.05 was considered significant. Analyses were performed with GraphPad Prism 10. All experiments were independently performed at least three times. To develop a brain organoid model that contains major cell types affected in human AD brains, building upon previously established microglia-containing brain organoid model, blood vessels were introduced into these organoids and develop a vascularized neuroimmune organoid model by co-culture of hPSCs-derived 3220-421482 70690-03 neural progenitor cells (NPCs), primitive macrophage progenitors (PMPs), and vascular progenitors (VPs) under 3D condition. To achieve this goal, NPCs and PMPs were first generated following previous studies (Fig. 1A). The identity of hPSCs-derived NPCs was confirmed by co-expression of neural progenitor cell markers, PAX6 and NESTIN. PMPs were confirmed by co-expression of CD235, a marker for YS primitive hematopoietic progenitors, and CD43, a marker for hematopoietic progenitor-like cells (Fig. 1B). VPs were generated using a published protocol with slight modifications described herein. To generate brain organoids, the initial number was calibrated and co-cultured at 30,000 for NPCs, 12,000 for PMPs, and 7,000 for VPs. These cells spontaneously assembled and formed organoids on day 1. Subsequent culture of the organoids was supplemented with mitogen fibroblast growth factor (bFGF) for 5 days to promote cellular proliferation (referred to as proliferation stage). Thereafter, organoids were transitioned to a neural differentiation medium which contained neurotrophic factors, interleukin-34 (IL-34), vascular endothelial growth factor (VEGF), and other necessary supplements for long-term culture to support neuronal, microglial, and vascular maturation (referred to as Differentiation stage) (Fig. 1A). To ensure genetic diversity and robustness of the findings, three different hPSC lines (two iPSC lines, and one hESC line) from healthy individuals were used to derive progenitor cells. To visualize the formation of blood vessels in living organoids, VPs from an additional GFP-expressing hESC line (CAGG line) were incorporated. This allows tracking the vascular lineage cells by GFP signal. Under live cell imaging, clear and distinct branching structures were revealed in organoids on day 12 of culture (Fig. 1C, left panel). Organoid sections without immunostaining also displayed lumen-like structures (Fig. 1C, middle panel, and Fig. 7). The organoids were further stained with CD31, an endothelial cell marker, and observed CD31- expressing cells in organoids. The results confirmed the establishment of vascular structures within organoids (Fig. 1C, right panel). At day 12, ventricular zone-like regions were seen in organoids, which contained PAX6+progenitors and βIII-Tubulin+ immature neurons (Fig.1D), mimicking the proliferative region in the developing cortical brain. To confirm PMPs differentiate into microglia at the differentiation stage, the expression of CD45 at day 12 was examined, which is a marker for all nucleated hematopoietic cells. CD45+cells exhibited a relatively even spatial distribution in organoids (Fig. 1E, left panel). Microglial identity was further confirmed by double staining of CD45 and IBA1, a canonical macrophage / microglia marker. CD45 and IBA1 double staining showed ramified morphology, indicating healthy and functional microglia residing in organoids (Fig.1E, right panel). Previous studies have shown that NPCs can mature into neuronal lineage cells, including neurons and astrocytes in brain 3220-421482 70690-03 organoids. To confirm neural maturation in the organoids, MAP2, a marker for neuronal dendrite, was first stained and robust expression of MAP2 at Day 45 was observed (Fig. 1F), suggesting NPCs efficiently differentiated into neurons. Further staining with NeuN, a mature neuron marker, and S100β, an astrocyte marker, revealed robust NeuN+cells and S100β+cells, demonstrating that NPCs differentiated into mature neurons and astrocytes during the differentiation stage (Fig. 1G). Taken together, a vascularized neuroimmune organoids incorporating mature neurons, microglia, and vascular networks was developed, which allows modeling of the complex human brain environment. Example A vascularized neuroimmune organoids to efficiently recapitulate key AD pathological features for studying sAD without genetic mutations was desired to be enabled. Prior studies have shown that human misfolded proteopathic seeds, such as Aβ or tau, can induce corresponding pathologies in transgenic mice engineered to express these human proteins. Notably, recent studies suggested that Aβ seeds may also be able to transmit among humans, for instance, individuals who received Aβ contaminated cadaver-derived pituitary growth hormone (c-hGH) during childhood developed Aβ pathologies and cerebral amyloid angiopathy (CAA) later in their life. Based on these findings, it was hypothesized that AD individual-derived brain extracts that contain proteopathic seeds, including Aβ or tau, will induce AD pathologies in organoids as seen in human AD brains. To test this hypothesis and model sAD, organoids were treated with sAD individual postmortem tissue-derived brain extracts (henceforth, the AD group) to model sAD. The corresponding vehicle (buffer) was used as control (henceforth, the vehicle group). In addition, age-matched healthy individual- derived brain extracts were also included. Organoids after 10 days of neuronal differentiation were exposed to AD brain extracts or the vehicle for two days, and samples were collected at 2 weeks or 4 weeks post-exposure. Subsequently, AD pathological hallmark expression was examined, including Aβ and tau pathologies, inflammation, and synapse / neuronal loss in organoids (Fig.2A). To examine Aβ pathology characterized by extracellular Aβ aggregates in organoids, 6E10 and 4G8 antibodies were used, which can detect the amino acid residues 3-8 or 17-24 of Aβ, respectively. Two weeks post brain extract or vehicle exposure, a modest number of weakly diffuse 6E10 and 4G8 signals were detected in both the AD and vehicle groups (Fig. 2B and 8). Interestingly, only the AD group exhibited intraneuronal Aβ aggregates, as indicated by the presence of discrete, punctate 6E10 signals around nuclei (Fig. 2B, top panel). To 3220-421482 70690-03 exclude the possibility that aggregates were caused by other components contained in the brain extracts other than toxic protein seeds, age-matched healthy individual-derived brain extracts were included as the healthy control group. Similar to the vehicle group, diffuse but not aggregated signals were observed in healthy control brain extract-treated organoids (Fig. 9). Since 6E10 can detect both Aβ and intraneuronal amyloid precursor protein (APP), the diffuse 6E10 and 4G8 signals might represent the endogenous APP. To confirm the presence of intraneuronal Aβ aggregates in the AD group, organoids were stained with MOAB-2 antibody, which can specifically label intraneuronal Aβ, but not APP. MOAB-2-expressing cells were only detected in the AD group, confirming the formation of intraneuronal Aβ aggregates (Fig. 10). Remarkably, after 4 weeks post AD brain extract exposure, multiple dense extracellular plaque-like aggregates were detected in the AD group but not the vehicle group (Fig. 2B) or healthy control brain extract treated organoids (Figs. 9A-B). These extracellular aggregates were consistently identified in the AD group by 4G8 staining (Fig. 2C). Quantitative analysis showed that compared to the vehicle group, the AD group demonstrates a significant escalation of Aβ burden, as indicated by the positive areas of 6E10 (AD vs Vehicle, 1.24 ± 0.28 vs 0.21 ± 0.03) and 4G8 (AD vs Vehicle, 0.78 ± 0.20 vs 0.13 ± 0.02) (Fig. 2D). To confirm the composition of extracellular Aβ aggregates, double staining of organoids with 6E10 with another antibody Αβ42, which primarily targets Aβ42 was performed. The overlapped punctate signals of 6E10 and Αβ42 were observed from extracellular regions in the AD group, suggesting that extracellular Aβ aggregates contain Aβ42 (Fig. 2E). Moreover, to assess Aβ plaque formation, double staining of organoids was conducted with 6E10 with a dye, Thioflavin-S, which binds to β-sheet structure in protein aggregates, including plaques and tangles. Consistently, the vehicle group showed some diffuse intraneuronal 6E10 signals, which were Thioflavin-S negative; only the AD group exhibited the co-localization of strong extracellular 6E10 and Thioflavin-S signals, reinforcing the presence of plaque-like aggregates in AD group (Fig. 2F, top panel). Collectively, these findings demonstrated that AD brain extracts containing proteopathic Aβ seeds can induce Αβ pathology, including Aβ plaque-like aggregates, in healthy brain organoids within a 4-week post-exposure time frame. Example Sporadic AD (sAD)patient-derived Brain extracts induce tau pathology in organoids Tau pathology, caused by the abnormal accumulation of the microtubule-associated protein tau, is a major pathological hallmark of AD. In human AD brains, tau undergoes 3220-421482 70690-03 abnormal hyperphosphorylation and other modifications, which convert it into a pathological protein with prion-like seeding activity and form neurofibrillary tangles (NFTs). Given that the AD brain extracts applied in this study contained tau seeds (Figs. 11A-B), whether the AD brain extract can induce tau pathology in the organoid model was evaluated. To examine tau pathology, antibody AT8 that can detect phosphorylated tau was used. Notably, 2 weeks post- exposure, the AD group presented with puncta-like, AT8-positive intraneuronal signals (Fig. 3A, top panel), potentially indicating the formation of aggregates in neurons. Notably, 4 weeks post-AD brain extract exposure, the intensity and quantity of condensed AT8 signals increased significantly, suggesting further formation of tau aggregates (Fig. 3A, top panel). In contrast, the vehicle group displayed no such phosphorylated tau aggregates at either time point (Fig. 3A, bottom panel), nor did healthy control brain extract treated organoids (Figs. 12A-B). Additionally, different from the condensed AT8 signals after AD brain extract exposure, weak and diffuse axonal AT8 positive signals were observed in organoids at 2 weeks post-exposure to the vehicle and healthy control brain extracts (Fig. 3A, 12, and 13), aligning with prior studies that identified transient phosphorylated tau in neurons during development. Quantification revealed a substantial increase in AT8-positive areas in the AD group compared to the vehicle group (AD vs Vehicle, 0.88 ± 0.15 vs 0.10 ± 0.04) (Fig.3B), suggesting that AD brain extract was sufficient to induce tau pathology in organoids. Confirmation of tau pathology was further achieved through staining of hyperphosphorylated tau marker, pThr217 —a widely used clinical diagnostic marker. Results showed significant overlap and pathology- related morphology, suggesting that the current model recapitulates the tau phosphorylation at multiple sites (Fig. 3C). Confirmation of tau aggregate was further achieved through Thioflavin-S and AT8 co-staining, which marked Thioflavin-S+and AT-8+double-positive cells exclusively in the AD group (Fig. 3D). To further confirm the formation of tau tangle- like structures, Gallyas Silver Staining was performed, a commonly used method for detecting tau tangles, and observed the formation of NFT-like structures in the AD group at four weeks post-exposure (Fig. 3D). In all, these findings demonstrate that sAD brain extract can successfully induce tau pathology, including tau tangle-like aggregates, in healthy brain organoids. Example The AD neuroimmune organoids recapitulate neuroinflammation, phagocytosis of Αβ, and excessive microglial synaptic pruning 3220-421482 70690-03 In the AD environment, accumulating amyloid aggregates trigger the activation of microglia and astrocytes, and stimulate neuroinflammation by releasing inflammatory factors. Since neuroimmune organoids contain microglia and astrocytes, to determine whether neuroimmune organoids can replicate neuroinflammation in AD brains, mRNA expression of the pro-inflammatory cytokine, IL-6, and chemokine, CCL2, was measured by qRT-PCR in the organoids at four to six weeks post the exposure of AD brain extracts or vehicle treatments. As shown in Fig. 4A, compared to the vehicle group, the AD group exhibits a significant increase in mRNA levels of IL-6 (AD vs. Vehicle, 5.68 ± 0.37 vs.1.03 ± 0.03) and CCL2 (AD vs. Vehicle, 1.46 ± 0.10 vs. 1.01 ± 0.01), demonstrating that AD neuroimmune organoids recapitulated neuroinflammation. In addition, microglia play a beneficial role in AD by phagocytosis and removal Aβ. To examine whether microglia in the AD group display this function, double staining of organoids with 6E10 and IBA1 was done. 3D-reconstructive images from the Imaris software confirmed microglial engulfment of Aβ in the AD group, aligning with previous evidence of microglial involvement in Aβ clearance in AD (Fig.4B). One significant detrimental role of microglia in AD is the abnormal removal of synaptic materials. Whether human microglia in AD neuroimmune organoids could recapitulate this phenomenon was evaluated. Organoids were stained with CD45 and Homer1 (a post-synaptic marker) at four weeks post-exposure to AD brain extracts or vehicles. The 3D-reconstructed images revealed that microglia pruned synaptic materials (Fig. 4C). Quantification of the volume of Homer1 puncta within the volume of CD45 indicated a significant increase of microglial pruning in the AD group (AD vs. Vehicle., 5.08 ± 0.9 vs.1.00 ± 0.18) (Fig.4D). In summary, the results indicated that neuroimmune organoids can recapitulate neuroinflammation, as well as dynamic microglial functions in an AD-like 3D environment, which mirrors in vivo human microglia behaviors in the presence of AD pathologies. Example The AD neuroimmune organoids recapitulate synapse / neuronal loss and impaired neural activity Synapse / neuronal loss is the key feature of AD and AD animal models are often limited to recapitulating neuronal loss. To investigate whether brain organoids challenged by AD brain extracts could recapitulate this process, synaptic integrity was first examined by staining organoids with Homer1. Quantitative analysis of the number of Homer1 puncta per 2500 μm2revealed a reduction in the AD group (AD vs. Vehicle, 1336.30 ± 92.93 vs.6013.48 ± 449.32) (Fig. 5A and 5B), indicating synapse loss in the AD group. Subsequently, organoids were 3220-421482 70690-03 stained with active Caspase3 to assess neuronal death in organoids. Compared to the vehicle group, a significant increase in active Caspase3-expressing cells was detected in the AD group, demonstrating elevated neuronal death in the AD group (AD vs Vehicle, 14.11 ± 2.18 vs 2.66 ± 0.17) (Fig. 5C and 5D). To further understand whether synapse / neuronal loss causes functional defects, the neural activity in the organoids was measured using MEA assay (Fig.5E to 5G). Spontaneous neural activities were recorded and analyzed in organoids that were seeded on electrodes and cultured for two additional weeks after four weeks post-AD brain extract or vehicle treatment. The data revealed a reduced number of spikes, mean firing rate, and number of bursts in the AD group (Fig. 5H), suggestive of impaired neural activity in the AD group. Together, these results indicated an environment conducive to synapse / neuronal loss, accompanied by compromised neural activity in AD neuroimmune organoids. Example Proteomics analysis highlights disrupted pathways in AD neuroimmune organoids To obtain molecular features and more comprehensively characterize AD neuroimmune organoids, quantitative proteomics analysis was performed to compare organoids from the control and AD groups at four weeks post-treatment of either vehicle or AD brain extracts. Each group included three samples, with three to four organoids per sample. Around 5800 proteins across both sample groups were identified. Applying criteria of FC≥1.5 and adjusted p<0.05, 87 differentially expressed proteins (DEPs) in the AD organoids were identified, comprising 76 upregulated and 11 downregulated proteins compared to the vehicle group (Fig. 17A and Tables S4 and S5). Notably, proteins such as CD44, GFAP, and MAPT- previously recognized as significantly upregulated proteins in AD human brain tissues using proteomics analysis and are considered as potential biomarkers for AD were among the upregulated DEPs, suggesting AD organoids align with the established AD characteristics. To assess the functional pathways of the DEPs, a pathway enrichment analysis using the upregulated DEPs was performed. Jensen DISEASES analysis identified dementia as the top 1 annotated pathway (Fig. 17B), confirming the relevance of the findings. KEGG enrichment analysis further showed that the upregulated DEPs were enriched in pathways such as SNARE interactions in vesicular transport, synaptic vesicle cycle, Alzheimer’s Disease, adherens junction, pathways of neurodegeneration, consistent with previous findings on the molecular signature of AD patients (Fig. 17C). Additionally, MGI Mammalian Phenotype 3220-421482 70690-03 Enrichment analysis highlighted pathways, such as abnormal miniature excitatory currents, abnormal hippocampus CA3 region morphology, abnormal psychological neovascularization, increased macrophage cell number, and abnormal dendrite morphology (Fig.15), which is also consistent with AD features and the characterization of cellular dysfunction in AD neuroimmune organoids. Consistent with previous findings, GFAP levels were elevated, indicating astrocyte activation and neuroinflammation in the AD group organoids (Fig. 17A). The expression of CD44 and CD9 was upregulated (Fig.17A), suggesting a shift in the microglial profile toward an AD-associated phenotype. Upregulation of IFITM3 (Fig. 17A), a protein elevated in the brain tissue of a subset of late-onset AD patients, which is associated with increased neuroinflammation and correlated with enhanced γ-secretase activity and amyloid beta production was identified. Among the downregulated proteins, excluding those unreported in AD, many proteins have been reported to be decreased in AD in previous studies, such as HSP90AB4P, TH, TMEM70, and TGFBRAP1 (Fig. 17A). As an example, HSP90AB4P, as a member of the heat shock proteins (HSPs), which are molecular chaperones playing a crucial role in regulating protein aggregation, HSP90 genes were found to have reduced expression in AD patients. A smaller number of downregulated DEPs were identified compared to the upregulated DEPs. This may be due to a greater accumulation of proteins in AD organoids, consistent with observations from proteomics studies using human AD brain samples. To further evaluate how the molecular signature of AD neuroimmune organoids resembles that of patients, the 76 upregulated DEPs were compared with publicly available proteomics datasets from human AD brain tissues on the NeuroPro website. 28 out of 76 upregulated proteins overlapped with previously identified upregulated proteins in brain samples of pre-clinical / mild cognitive impairment / clinical stage AD patients (analyzed by https: / / bioinformatics.psb.ugent.be / webtools / Venn / ) (Table S6). The overlapping proteins are enriched in Jensen Disease Enrichment pathways, including Dementia, Multiple system atrophy and Brian disease (Fig. 16), highlighting the resemblance of AD neuroimmune organoids to the characteristics observed in patients. Overall, the proteomics data indicate that the AD neuroimmune organoids successfully replicate the major disrupted pathways and molecular signatures of AD observed in patients, corroborating the findings on cellular dysfunction in these organoids. Example 3220-421482 70690-03 Anti-Aβ antibody Lecanemab relieved amyloid burden in AD neuroimmune organoids Since AD organoids can recapitulate AD pathologies, whether the organoid model could be used for AD drug discovery was examined. Lecanemab, an FDA-approved humanized monoclonal Aβ antibody for treating early AD, targets and neutralizes toxic Aβ, facilitating their clearance from the brain. Given that the organoids displayed Aβ pathology after four weeks of AD brain extract exposure, these neuroimmune organoids were treated with Lecanemab for 2 consecutive weeks to evaluate their efficacy in the organoids. Staining with 6E10 and 4G8 post-treatment indicated that Lecanemab alleviated the amyloid burden in AD organoids (Fig. 6A and 6B). It has been suggested that Lecanemab may induce phagocytosis and removal of Aβ by microglia in human brains. Therefore, the involvement of microglia in Lecanemab-mediated Aβ clearance in the organoids was evaluated. Through staining with 6E10 and IBA1 and subsequent observation via 3D reconstructive images, it was noted that microglia appeared to phagocytize Aβ in the organoids. Interestingly, Lecanemab-treated organoids exhibited increased phagocytosis of Aβ (Figs.6C and 6D). Lecanemab is associated with side effects in some patients, such as amyloid-related imaging abnormalities (ARIA), which are characterized by brain swelling and vascular impairment-related bleeding detectable via MRI. To examine whether the organoid can recapitulate the potential side effects of Aβ antibody treatments, the impact of Lecanemab in the organoid on vascular integrity and the vascular immune response was assessed, which are disrupted in the case of Aβ antibody treatments and associated with ARIA Given the significantly higher risk of developing ARIA in patients carrying the ApoE ε4 allele, vascularized neuroimmune organoids using a ApoE4 / 4 hiPSC line were generated. The mRNA expression levels of VCAM-1 was first measured, a vascular-immune-related protein that has been shown to be upregulated in aged brains and cerebral microbleeds that contribute to an inflammatory profile. The qPCR results indicated a slight increase in VCAM-1 mRNA expression levels following treatment of the organoids with AD brain extracts. This expression level further increased in the Lecanemab-treated group, suggesting the activation of brain endothelial cells, and an elevated vascular inflammation response (Fig. 6E, left panel). Expression of VE-Cadherin, a critical transmembrane protein that maintains the junctions between endothelial cells and promotes vascular integrity, was measured. The mRNA expression level of VE-Cadherin exhibited a trend of downregulation in the AD group and the Lecanemab-treated group compared to the vehicle group organoids (Fig. 6E, right panel), suggesting a potential disruption of endothelial adherent junctions and vascular integrity. 3220-421482 70690-03 Overall, these results suggested that Lecanemab could relieve the Aβ burden in AD organoids, which might involve phagocytosis of Aβ by microglia. Lecanemab treatment can also partially recapitulate the side effects, such as impaired vascular integrity and altered vascular immune response. Consequently, the organoids demonstrated potential as a promising in vitro platform for testing AD therapeutics. Example Effectively modeling sAD to recapitulate multiple pathologies and developing platforms for drug discovery, has been challenging due to the complexity of the disease and the significant species differences between human and animal models. In this study, a vascularized neuroimmune organoid model composed of human neurons, astrocytes, microglia, and blood vessels has been developed. Upon exposure to sAD individual-derived extracts, the organoid successfully recapitulated multiple pathological features in sAD, including Aβ plaque-like aggregates, neurofibrillary tangle-like aggregates, neuroinflammation, microglial synaptic pruning, synapse / neuronal loss, and impaired neural network. Furthermore, by validating the FDA-approved anti-Aβ antibody Lecanemab, the organoid model demonstrates its potential as a platform for in vitro AD drug development, particularly for immunotherapies. In contrast to other hiPSC-based AD brain organoid models, the vascularized neuroimmune organoid model described herein has significant advantages to enable us to more efficiently model AD and test AD therapeutics. (1) The new organoid model incorporates multiple key cell types that are affected in human AD brains under a pathophysiological relevant 3D human cell-centric environment. The organoid simultaneously includes neurons, astrocytes, microglia, and vasculatures, which enables a more comprehensive understanding of cell-cell interactions and cell-type-associated pathological events in AD, such as neuroinflammation and microglial synaptic pruning, which are absent in most AD organoid models (Figs.4A-D). In addition to AD, the new organoid model also enables the study of the interactions of different cell types during neurodevelopment and other neurological disorders. (2) The new organoid model can effectively develop multiple AD pathologies within a relatively short time frame, suitable for studying AD, particularly sAD. Previous AD organoid models were usually derived from fAD iPSC lines, which need long-term culture to replicate the AD pathologies. For instance, previous studies indicated that it took at least 5 months to exhibit amyloid plaque-like and neurofibrillary tangles-like aggregates, or 90 days to observe Aβ aggregates and hyperphosphorylated tau protein, in fAD iPSC-derived brain organoids. 3220-421482 70690-03 Additionally, a recent study using healthy iPSC lines-derived organoids to model sAD through serum exposure required 3 to 4 months of culture to recapitulate Aβ aggregates and hyperphosphorylated tau. However, in the organoids described herein, 4 weeks post-exposure to AD brain extracts, multiple relatively mature AD pathologies were successfully recapitulated, including Aβ plaques-like aggregates and tau tangles-like aggregates, neuroinflammation, synapse / neuronal loss, in around 1.5-month-old organoids. This suggests that AD brain extracts can serve as a strong trigger to induce AD pathologies for studying AD, particularly sAD. In addition, complex cell types, particularly microglia and related neuroinflammation, absent in the previously mentioned organoids, may also contribute to efficiently recapitulating the AD pathologies in the organoids. With a similar strategy, it is possible to efficiently model fAD by exposing fAD-derived brain extracts to fAD iPSC-derived organoids. (3) The new organoid model is useful to serve as an in vitro platform to advance AD drug development, particularly antibody-based therapeutics (Figs. 6A-E), because the organoids contain microglia and can efficiently recapitulate multiple AD pathologies, and microglia are expected to be a major cell component to degrade the antibody-binding protein aggregates, such as Aβ. These results demonstrate that AD brain extracts can efficiently induce multiple AD pathologies in neuroimmune organoids, enabling the study of their interaction during disease progression of sAD. AD pathologies are known to occur at different stages of the disease, Aβ accumulation is generally considered an early event that triggers inflammation and contributes to tau pathology, occurring approximately two decades before clinical symptoms. Excessive microglial synaptic pruning is also critical in the early stages, while synapse / neuronal loss becomes more pronounced in the later stages, correlating with the emergence of clinical symptoms. A goal of the current study is to recapitulate multiple AD pathologies during disease progression, which will allow the future study of the interactions of these pathologies for AD to advance the understanding of disease mechanisms, particularly for sAD. To model sAD, neuroimmune organoids were generated from hPSC lines from healthy individuals without the need for familial AD mutations. Previous studies demonstrated that proteopathic seeds, such as Aβ or tau, have prion-like activity to induce corresponding pathologies in transgenic mice engineered to express these human proteins, and Aβ seeds also can induce Aβ pathologies in patients. However, it is unknown whether proteopathic seeds can induce pathologies in human brain organoids. It was hypothesized that AD individual-derived brain extracts that contain proteopathic seeds, including Aβ or tau, will induce AD pathologies in organoids as seen in human AD brains. Neuroimmune organoids were exposed to brain extracts derived from frozen 3220-421482 70690-03 temporal cortex tissues of sAD patients histopathologically confirmed to be at Braak Stages V- VI. The results demonstrated that four weeks after exposure, the organoids exhibited multiple pathologies associated with AD, including Aβ and tau pathologies, inflammation, microglial synaptic pruning, and synapse / neuronal loss. These pathologies in organoids span early-stage processes like microglial synaptic pruning and late-stage features such as synapse / neuronal loss at 4 weeks post-exposure to AD brain extracts. Thus, these organoids likely mimic the progression of sAD, transitioning from early / middle to late stages, allowing for the evaluation of therapeutic interventions targeting early stages; however, future studies are needed to more precisely define the associated disease stages. Neuroimmune organoids may recapitulate multiple pathologies for two main reasons. First, the proteopathic seeds in brain extracts from sAD patients (i.e., likely, a combination of Aβ and tau aggregates) may have high seeding activity, enabling the induction of Aβ and tau pathologies in the organoid model with high potency. Second, the complex cellular composition of the organoids, which include neurons, astrocytes, microglia, and blood vessels, further facilitates the development of these features, particularly microglia and related neuroinflammation, absent in the previously mentioned organoids. For instance, the buildup of the protein aggregates initiates an inflammatory response and microglial phagocytic function, mimicking the disease progression as seen in patients. While not all pathological changes occur simultaneously in every individual with sAD, the organoid model described herein provides a valuable platform to explore these interactions in a feasible manner. However, the variations in brain extracts derived from different patients, disease stages, and brain regions may result in discrepancies in the type, quantity, and activity of proteopathic seeds, which might influence the severity and types of pathologies induced in the organoids. To minimize variability, potential strategies in the future may include using extracts from multiple patients with consistent brain regions and disease stages or using controllable synthetic or recombinant seeds despite their potential for reduced seeding activity. The AD neuroimmune organoids can recapitulate Aβ and tau pathologies. Intraneuronal Aβ accumulation was observed, as indicated by punctate-like high-intensity 6E10+signals (Fig.2B), at 2 weeks post AD brain extract exposure. By the fourth week, these accumulations had progressed to extracellular Aβ plaque-like structures, indicated by the colocalization of 6E10 and Thioflavin-S (Fig.2B, C, and F), suggesting a developing pattern from intraneuronal aggregation to extracellular deposition. This pattern is in line with the findings in AD and Down Syndrome individuals, where intraneuronal amyloid aggregates were found in brain regions vulnerable to dementia, such as the hippocampus and entorhinal cortex, preceding the 3220-421482 70690-03 formation of extracellular plaques. Similarly, organoids demonstrated puncta-like aggregates of hyperphosphorylated tau 2 weeks post AD brain extract exposure and exhibited tangle-like structures by the fourth week post-exposure, indicated by the Thioflavin-S and Gallyas Silver Staining (Fig.3A, B, and D). The results provide direct evidence that proteopathic seeds, not only Aβ but tau, can spread among human cells and tissue-like 3D structures, and induce AD-like Aβ and tau pathologies. This aligns with the clinical observations that Aβ contaminated c-hGH can cause Aβ pathologies and CAA in humans over decades. This also corroborates the concept of the prion-like property of AD proteopathic proteins and the possible transmission of AD between humans by accidents in medical or surgical procedures, raising the awareness to prevent iatrogenic human transmission of AD. Neuroinflammation and synapse / neuronal loss are known to appear along the progression of AD. In the early stages of the disease, stimuli like extracellular Aβ activate neuroinflammatory responses that may recruit microglia for Aβ clearance. Consistent with this, in the organoids described herein, mRNA expression levels of inflammatory cytokines in the AD group (Fig. 4A). Furthermore, Aβ signals were detected inside of microglia, indicating microglial phagocytosis and clearance of Aβ in organoids (Fig. 4B). Additionally, align with previous studies showing that excessive microglia-mediated synaptic pruning in AD animal models, a significant microglia synaptic removal (Fig.4C and 4D), and a significant synaptic materials decrease in AD organoids was observed (Fig. 5A and 5B). Additionally, elevated neuronal death was confirmed by activated Caspase3 signaling increment in the AD group (Fig. 5C and 5D). Although studies have found neuronal hyperactivity in the presence of amyloid beta pathology, in vivo research has proved that tau dominated Aβ when both were present in transgenic mice models. In agreement with these observations, the MEA assay of organoids revealed impaired neuronal networks (Figs. 5E to 5H), with fewer spikes and bursts recorded compared to the vehicle group, corroborating previous research findings. The neuroimmune organoids, containing multiple cell types (including microglia) and exhibiting AD-like pathologies, are particularly valuable for testing AD therapeutics, especially immunotherapies. The recent FDA-approved anti-Aβ monoclonal antibody, Lecanemab and Donanemab, underscores the potential of antibody-based immunotherapies for tackling AD. However, species differences may hinder the translational efficacy of preclinical animal models in clinical trials, highlighting the urgent need for human models to test these immunotherapies before clinical trials. (1) Recent cryo-EM findings have uncovered species- specific aggregate structures of proteopathic proteins in AD. Aggregate structures observed in 3220-421482 70690-03 AD animal models are often not present in individuals with AD. This discrepancy potentially impedes the assessment of the efficacy of the therapeutics and contributes to translation failures. (2) Antibodies-based therapeutics targeting toxic proteins, such as targeting Aβ, are usually tested in animals. Before moving to clinical trials, successful antibody candidates undergo a humanization process to avoid immune rejection, such as by replacing the murine IgG with the human version. However, the humanization process may substantially compromise the efficacy of the antibodies and even cause side effects. Thus, direct testing of these human antibodies in human models may be important. (3) Antibody-targeted protein aggregates, such as Lecanemab-binding Aβ protofibrils, are hypothesized to be recognized and removed by microglia, the immune cells in the brain. However, there are no suitable human models available that can recapitulate AD pathologies and contain human microglia for directly testing these human versions of antibody-based therapeutics. The organoids described herein contain multiple cell types, including microglia, and develop AD-like pathologies that offer a unique platform to solve this limitation. To assess whether the organoid model described herein could serve as an ideal in vitro platform for testing AD drugs, it was validated with Lecanemab. Following a 4-week post-exposure to AD brain extracts, the AD organoids were treated with Lecanemab for two weeks and significant decrease in amyloid burden was observed. Notably, an increased microglial engulfment of Aβ in the Lecanemab-treated group (Figs. 6A-E) was observed, providing direct evidence that human microglia involved the Lecanemab-mediated Aβ removal. Although the current organoid model cannot fully recapitulate ARIA, qPCR results indicate an increase in VCAM-1 mRNA level and a trend towards a modestly decreased VE-Cadherin mRNA level after Lecanemab treatment (Fig. 6E), suggesting potential ARIA- associated vascular immune responses and impaired vascular integrity after treatment. These molecular-level insights may facilitate the prediction of potential side effects when the model is utilized for drug testing. Thus, the neuroimmune organoids not only model the efficacy of immunotherapies (Figs.6A to 6D) but also partially represent their potential side effects (Fig. 6E), highlighting their promise as an effective in vitro platform for testing AD therapeutics. Sex differences play a critical role in AD, with approximately two-thirds of AD individuals being female, and women exhibiting a faster AD pathology and cognitive decline. In this study, while the female iPSC-derived organoids showed a trend towards greater tau pathology, no statistical differences in Aβ and tau pathologies were observed when compared to organoids derived from male hiPSC lines (Fig. 11). This may be attributed to several factors: (1) an insufficient culture period for organoids to exhibit sex differences. Previous studies have indicated that sex differences have a more pronounced effect on functional impairment, 3220-421482 70690-03 particularly during the later stages of pathology development. A total culture duration of 4 weeks post-brain extract exposure might not be sufficient to reveal significant differences between female and male organoids. (2) In this study, one female and 3 male hiPSC lines were used to evaluate the impact of sex differences. The incorporation of additional female iPSC lines with diverse genetic backgrounds is warranted for future studies to evaluate sex differences. (3) Beyond sex chromosomes, sex hormones may also contribute to the different characteristics of disease progression in men and women. However, current organoid models lack the complexity required to account for the effects of sex hormones. Thus, incorporating multiple female iPSC lines, extending culture time, and introducing sex hormones will be beneficial in future studies aimed at evaluating the impact of sex differences on AD pathologies. While the inclusion of blood vessels improves the overall health of the organoids to better model the complexity of the brain environment, the presence of CAA, a common vascular pathology in AD where Aβ fibrils are deposited along the cerebral vasculatures, was not detected using iPSC lines carrying the APOE3 / 3 or APOE4 / 4 variants. In this study, all iPSC lines were from healthy donors. Additional sAD cell lines may be beneficial in future research, which might more efficiently recapitulate AD-like pathologies. In particular, using sAD iPSC lines from AD donors with CAA, along with an extended culture period post-AD extract exposure, might be beneficial in modeling CAA. In addition, a challenge for iPSC- based brain organoid models is the relatively immature state of human cells. Recent studies have developed chimeric brain models by transplanting iPSC-derived organoids or neural cells into animal brains, where human cells can survive and mature as animals age under the conducive physiological in vivo environment. Transplanting the organoids described herein into animal brains and test whether the organoids can better model AD features in the context of aged human cells within the host brain may be performed in the future.

Claims

3220-421482 70690-03 WHAT IS CLAIMED:

1. A human pluripotent stem cell (hPSC)-based in vitro vascularized neuroimmune organoid model, comprising neurons, microglia, astrocytes, and blood vessels.

2. The in vitro organoid model of claim 1, wherein the organoid model comprises cells derived from neural progenitor cells, primitive macrophage progenitors, and vascular progenitors.

3. The in vitro organoid model of claim 1, wherein the model is a 3D model (e.g., floating in culture media).

4. The in vitro organoid model of claim 3, wherein the model stains positive for MAP2, NeuN, S100B, CD45, IBA1, Collagen IV, or PDGFRB, or any combination thereof.

5. The in vitro organoid model of claim 3, wherein the organoid model includes endothelial cells and pericytes.

6. The in vitro organoid model of claim 3, wherein the model includes Collagen IV formed vascular basement membranes.

7. The in vitro organoid model of claim 3, wherein the model includes lumen-like structures.

8. The in vitro organoid model of claim 1, wherein the organoid comprises cells from hPSC which were derived from healthy individuals and Alzheimer’s Disease patients.

9. A method for constructing the in vitro organoid model of claim 1, comprising co- culturing hPSCs-derived neural progenitor cells (NPCs), primitive macrophage progenitors (PMPs), and vascular progenitors (VPs) under 3D conditions (e.g., floating in culture media).

10. The method of claim 9, wherein one or more of the cell types are cells from hPSC which were derived from healthy individuals and Alzheimer’s Disease patients.

11. The method of claim 9, comprising: generating NPCs and PMPs; generating VPs; and combining the NPCs, PMPs, and VPs to generate brain organoids.3220-421482 70690-03 12. The method of claim 9, wherein the NPCs, PMPs, and VPs are co-cultured at a ratio of about 30:12:7 NPC:PMP:VP.

13. The method of claim 9, wherein the initial number of cells is about 30,000 NPCs, about 12,000 PMPs, and about 7,000 VPs.

14. The method of claim 9, wherein identifying hPSCs-derived NPCs are confirmed by co-expression of neural progenitor cell markers, PAX6 and NESTIN.

15. The method of claim 9, where the PMPs are confirmed by co-expression of CD235 and CD43.

16. The method of claim 9, wherein the culture of the organoids is supplemented with mitogen fibroblast growth factor (bFGF) for about 5 days to promote cellular proliferation.

17. The method of claim 16, where organoids are transitioned to a neural differentiation medium comprising neurotrophic factors, interleukin-34 (IL-34), vascular endothelial growth factor (VEGF), and other supplements for long-term culture to support neuronal, microglial, and vascular maturation.

18. A method for screening for effective therapeutic treatment of Alzheimer's Disease pathologies comprising administering a target treatment to the organoid model of claim 1 or prepared by the process of claim 9 and assessing resultant effects.

19. The method of claim 18, further comprising comparing efficacy of the test treatment as compared to a control sample.

20. A system for Alzheimer's Disease drug discovery comprising the in vitro organoid model of claim 1, or one prepared by the process of claim 9, and systematic screening of target treatments for efficacy using the organoid model.

21. The system of claim 20, adapted to automated testing and monitoring.

22. A method for inducing Alzheimer's Disease (AD) pathologies in an in vitro organoid model, comprising: constructing a neurological organoid model, and introducing a brain extract from an Alzheimer’s Disease patient to the in vitro organoid model.3220-421482 70690-03 23. The method of claim 22, wherein the in vitro organoid model is an in vitro organoid model according to claim 1, or one prepared by the process of claim 9.

24. The method of claim 22, comprising treating the organoids with sporadic AD (sAD) individual postmortem tissue-derived brain extracts.

25. The method of claim 22, comprising treating the organoids with familial AD (fAD) individual postmortem tissue-derived brain extracts.

26. A method for inducing Alzheimer's Disease pathologies in the in vitro organoid model according to claim 1, or one prepared by the process of claim 9, comprising introducing a brain extract from Alzheimer’s Disease patient to the organoid model.

27. The method of claim 26, comprising treating organoids with sporadic AD (sAD) individual postmortem tissue-derived brain extracts to model sAD.

28. The method of claim 26, comprising treating the organoids with familial AD (fAD) individual postmortem tissue-derived brain extracts.

29. The method of claim 26, wherein organoids after about 10 days of neuronal differentiation are exposed to AD brain extracts or the vehicle for about two days, and samples were collected at about 2 weeks or 4 weeks post-exposure.

30. A method for preparing a 3D organoid comprising: co-culturing neural progenitor cells (NPCs), primitive macrophage progenitor cells (PMPs), and vascular progenitor cells (VPs) in an assembly media, thereby forming a self- assembled organoid; and differentiating the self-assembled organoid by transferring the self-assembled organoid to differentiation media, thereby forming a differentiated organoid comprising neurons, microglia, astrocytes, and blood vessels.

31. The method of claim 30, wherein the differentiated organoid stains positive for MAP2, NeuN, S100B, CD45, IBA1, Collagen IV, or PDGFRB, or any combination thereof.

32. The method of claim 30, wherein the organoid model includes endothelial cells, pericytes, Collagen IV formed vascular basement membranes, lumen-like structures, or any combination thereof.3220-421482 70690-03 33. The method of claim 31, wherein the PMPs are present at about 5% to about 40% of the total progenitor cells.

34. The method of claim 31, wherein the VPs are present at about 5% to about 60% of the total progenitor cells.

35. The method of of claim 31, wherein the ratio of NPCs:PMPs:VPs is about 30:12:

7.

36. The method of claim 35, wherein the assembly media comprises a blend of NPC medium (e.g., medium comprising neuronal supplements) and PMP medium (e.g., medium comprising interleukin-3).

37. The method of claim 36, wherein the step of co-culturing is performed for about 3 days to about 10 days (e.g., about 5 days).

38. The method of claim 35, wherein the differentiation media comprises neuronal supplements, neurotrophic factors, ascorbic acid, c-AMP, IL-34, macrophage colony stimulating factor (MCSF), TGF-β1, or any combination thereof.

39. The method claim 38, wherein the step of differentiating is performed for about 5 days to about 15 days (e.g., about 10 days).

40. The method claim 30, further comprising contacting the differentiated organoid with brain extracts (e.g., Alzheimer’s Disease extract such as from sporadic AD (sAD) or familial AD (fAD) patients).

41. The method of claim 40, wherein the step of contacting is performed for about 1 day to about 5 days.

Images