Growth factor-free stem cell expansion and differentiation

The GERALT method enables cost-effective and reproducible differentiation of pluripotent stem cells into mature cells by using a modified stem cell line with a genetic switch, overcoming the limitations of growth factors in existing technologies.

WO2025257695A1PCT designated stage Publication Date: 2025-12-18UNIV DEGLI STUDI DI TORINO

Patent Information

Application Number
PCT/IB2025/055837
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-10
Filing Date
2025-06-06
Publication Date
2025-12-18

AI Technical Summary

Technical Problem

Existing methods for pluripotent stem cell (PSC) expansion and differentiation are hindered by the need for costly and variable growth factors, leading to high production costs, batch-to-batch variability, and logistical challenges, which are unsuitable for large-scale and reproducible applications such as in vitro drug screening, toxicology, and cultivated meat production.

Method used

A genetic programming method, GERALT, which uses a modified stem cell line with constitutive expression of pluripotency factors and an inducible molecular switch to bypass the need for growth factors, allowing for cost-effective and reproducible differentiation into defined mature cells through the administration of a molecule like doxycycline.

Benefits of technology

The method significantly reduces costs by up to 95% and increases reproducibility, achieving faster differentiation (1 week vs. 4 weeks) with high purity (>99%) of mature cells, suitable for scalable applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000047_0001
    Figure IMGF000047_0001
  • Figure IMGF000050_0001
    Figure IMGF000050_0001
  • Figure IMGF000051_0001
    Figure IMGF000051_0001
Patent Text Reader

Abstract

The present invention relates to a modified stem cell and an ex vivo method for preparing defined mature cells from genetic programming of said modified stem cell which can be carried out in absence of certain growth factors, as well as a kit allowing to transform stem cells, and the different uses of the mature cells, for example for in vitro drug screening and toxicology or as cultivated meat. The genetic programming involves a molecular switch between two mutually exclusive programs of stem cell expansion and differentiation. The invention may be used for stem cells or other progenitors cells of any type, from any eukaryotic organism, but finds particular application in pluripotent stem cells from humans and livestock animals.
Need to check novelty before this filing date? Find Prior Art

Description

[0001]- 1 - SIB BW1353R GROWTH FACTOR-FREE STEM CELL EXPANSION AND DIFFERENTIATION TECHNICAL FIELD OF THE INVENTION The present invention relates to a modified stem cell and an ex vivo method for preparing defined mature cells from genetic programming of said modified stem cell which can be carried out in absence of certain growth factors, as well as a kit allowing to transform stem cells, and the different uses of the mature cells, for example for in vitro drug screening and toxicology or as cultivated meat. The genetic programming involves a molecular switch between two mutually exclusive programs of stem cell expansion and differentiation. The invention may be used for stem cells or other progenitor cells of any type, from any eukaryotic organism, but finds particular application in pluripotent stem cells from humans and livestock animals. BACKGROUND OF THE INVENTION The ability of Pluripotent Stem Cells (PSCs) to differentiate into any somatic cell type makes them extremely promising not only for use in drug discovery, toxicology, disease modeling, and regenerative medicine, but also emerging applications in the cultivated meat industry. Nevertheless, the disruptive research, therapeutic, and industrial potential of these cells is limited by their need for supplementation of culture media of serum, for instance fetal bovine serum (FBS), and / or of recombinant growth factors to maintain the pluripotent state, which is defined by the combination of proliferation and self-renewal. Differentiation also requires the step-wise addition of serum and / or several growth factors over a period of weeks. Large-scale production and differentiation of PSCs is therefore logistically and economically difficult due to the significant drawbacks associated with these growth factors, which include high costs, batch-to-batch variability, and potential immunogenicity. Therefore, it is imperative to investigate alternative approaches to PSC expansion and subsequent differentiation in culture conditions that do not involve the use of serum and / or growth factors. This necessity is not only motivated by economic factors but also needs to be pursued to guarantee a more sustainable and reproducible approach to accelerate the translation of PSCs to the market. Three principal signaling pathways are responsible for maintaining pluripotency in undifferentiated human, bovine, porcine, and ovine cells: insulin / insulin-like growth factor 1 (IGF) signalling, which activates PI3K-AKT to promote proliferation and survival; - 2 - SIB BW1353R fibroblast growth factor (FGF) signaling, which activates cRAF and thus MEK1 / 2-ERK1 / 2 signalling further contributing to cell growth; wingless / integrated (WNT) signalling, which activates β-catenin to promote expression of certain pluripotency factors; and transforming growth factor β (TGF) superfamily signalling (which also includes ligands such as Activin A and Nodal), that results in the activation of SMAD2 / 3 that transcriptionally maintains expression of NANOG and other pluripotency genes. Pluripotent stem cells must be continuously cultured in the presence of one or more of these growth factors, performing media changes daily or every few days as several growth factors are unstable at body temperature. Delays in media changes or errors in supplementation of growth factors can lead to irreversible degradation of pluripotent stem cell cultures and to their spontaneous differentiation. Batch-to-batch variation in growth factors can have similar detrimental effects. Large numbers of pluripotent stem cells need to be generated for several applications, particularly those that involve the differentiation into defined mature cells that do not proliferate, such as skeletal muscle. In these cases large scale pluripotent stem cell expansion is the bottleneck to obtaining sufficient final material. Overall, there is a need to have methods for maintaining pluripotency without supplying growth factors. In particular, since TGFβ superfamily growth factors are among the most expensive cytokines used in pluripotency maintenance for human, bovine, porcine, and ovine cells, with a cost that exceeds 3.000.000 € / g, there is a specific need to have methods for maintaining pluripotency without supplying TGFβ. Pluripotent stem cell differentiation can be induced by plethora of signalling pathways. Taking skeletal muscle differentiation as an example, published differentiation protocols rely on insulin / IGF, FGF, TGFβ, WNT, hepatocyte growth factor (HGF), Notch, sonic hedgehog (Shh), and vascular endothelial growth factor (VEGF) signalling. Differentiation protocols involve the step-wise addition of one or more growth factors, sometimes in combination with serum and / or small molecules that modulate growth factor pathways. Media is changed daily or every few days, and differentiation can take from a few weeks to several months, depending on the lineage and the degree of cellular maturation required. Protocols developed using a specific stem cell line often do not work immediately when applied to a different stem cell line, requiring extensive optimization of growth factor dose, combination, timing of addition, cell density, and several other variables. Due to growth factor batch-to-batch variation, even optimized protocols do not always work in the same way when performed by those skilled in the art, resulting in a rate of failed differentiation runs that can be substantial, depending on the cell lineage. Successful differentiation runs rarely achieve homogeneous purity of the desired lineage. - 3 - SIB BW1353R Taking skeletal muscle differentiation as an example, published differentiation protocols typically require 4-6 weeks, have a variable success rate of 50-70%, and can reach 60- 80% purity of skeletal myocytes. There is therefore a need to have methods for differentiating stem cells without supplying growth factors and / or serum to decrease the duration of differentiation, increase its reproducibility, and increase the purity. In vitro drug screening and toxicology are pivotal steps in the drug discovery pipeline. As it is well established that animal models often fail to recapitulate human-specific drug effects and / or toxic side effects, there is increasing interest in developing predictive in vitro human models. Pluripotent stem cells are ideally suited for this task. A typical pharmaceutical company is only willing to consider an in vitro human model for drug screening and toxicology if the cost of a single data point (i.e., well or organoid) is 0.25 € or less. The model must also be exceedingly reproducible, allowing to measure significant effects as low as 10% with 5 or less data points, and easy to implement for those non experts in the arts, ideally suitable for robotic automation in most steps. There are important challenges in generating such scalable models using pluripotent stem cells due to the aforementioned cost, reproducibility, and time constraints in growth-factor based stem cell differentiation. Accordingly, there is a need to provide cells and methods to overcome the disadvantages of the prior art. The production of meat through cell cultivation in bioreactors - so-called "cultivated meat" - is an emerging technological process that in the last ~10 years has attracted investments of around 3 billion dollars in approximately than 200 startups on 5 continents. Nonetheless, to date the products available on the market globally can be counted on the fingers of one hand, they are sold at a scale of less than one billionth of "traditional" meat and at non-competitive prices, and generally require the use of FBS for cell growth. Using FBS for cultivated meat production is not scalable (there is no sufficient supply), creates zoonotic risks, and poses ethical concerns; as such, most stakeholders have committed to produce cultivated meat without FBS or other serum types, which so far has been difficult to achieve at scale. Alternative methods based on the use of recombinant growth factors are extremely expensive: these molecules contribute up to 95% of the cost of serum-free culture media. It is estimated that feeding a million people a single portion of cultivated meat requires at least 64 stem cell doublings to produce 17 quintillion starter cells. This monumental scale requires a massive cost reduction, most notably using less growth factors and speeding up differentiation to produce more batches of cultivated meat with the same costly infrastructure. Accordingly, there is a need to provide cells and methods to overcome the disadvantages of the prior art. - 4 - SIB BW1353R SUMMARY OF THE INVENTION The Authors of the present invention developed a kit allowing to transform stem cells and applied said kit to obtain a modified human pluripotent stem cell line capable of being expanded and then induced to differentiate into defined mature cells, for example skeletal myocytes, in the absence of certain growth factors. First, a modified stem cell line realized through the present invention is capable of maintaining pluripotency in the absence of certain growth factors from the culture media, for example TGFβ superfamily growth factors that account for almost half of the media costs. This is achieved through the constitutive expression of one or more pluripotency factors, for example NANOG that is normally activated downstream of TGFβ signalling. The invention allows the elimination of one of the main costs in the production process of in vitro human model for drug screening and toxicology and cultivated meat: growth factors. Without having carried out further optimization of the culture medium, the reported example of the invention has the advantage of making it possible to reduce the costs of growth and differentiation of skeletal myocytes by more than 70% compared to traditional protocols. A cost reduction of this type is far superior to those achievable with alternative approaches under development which generally aim to (1) reduce the production costs of growth factors, for example through their production in plants; (2) increase the efficacy and / or stability of growth factors through protein engineering; and / or (3) amortize production costs through economies of scale. The invention is generalizable to other growth factors that account for similar costs of culture media, most notably FGFs, but also insulin / IGFs and WNTs. Indeed, it is possible to identify and constitutively express other pluripotency factors that are activated downstream of these signalling pathways. Thus, the invention is ultimately expected to result in the full removal of growth factors from the culture media, reducing costs by up to 95% without further optimization. Second, a modified stem cell realized through the present invention is capable of differentiating into defined mature cells in response to the simple administration of a molecule activating a transcriptional regulator protein in the modified stem cell, for example by administration of nanomolar doses of an antibiotic, such as doxycycline. The transcriptional regulator protein, after activation with the molecule, activates an inducible promoter operatively linked to a genetic sequence in an inducible cassette, and initiates the transcription of a one or more messenger RNAs encoding both one or more differentiation factors, which are able to induce differentiation into defined mature cells, for example MYOD1 for skeletal muscle differentiation, and one or more non-coding - 5 - SIB BW1353R RNA, which suppress the transcription or translation of the pluripotency factors, for instance a micro RNA against NANOG, to terminate its constitutive expression at the end of the cell expansion phase and allow the induction of a differentiation phase. The genetic programming triggered during differentiation bypasses the need for growth factors to induce the specification of defined mature cell types, further reducing costs and increasing reproducibility compared to traditional directed differentiation protocols used for the production process of in vitro human models for drug screening and toxicology or for making cultivated meat. The process is also much faster (i.e., 1 week or less compared to at least 4 weeks for directed differentiation of skeletal myocytes), compounding on cost reduction due to improved infrastructure usage, and reducing the risks of microbial contaminations when performed at large scale. The process also allows to generate highly pure differentiated cells (i.e., >99% skeletal myocytes), eliminating the need for subsequent cell type selection and improving the production yield. The invention is generalizable to other mature lineages needed for the production of cultivated meat (i.e., adipocytes, fibroblasts, and blood cells), or in vitro human models for drug screening and toxicology (i.e., neurons, cardiomyocytes, and hepatocytes). Indeed, it is possible to identify and express in an inducible manner one or more differentiation factors that are able to induce differentiation of stem cells into these lineages. Overall, the concept developed by the Authors, named by them GERALT (Genetically Enhanced Renewal and Autonomous Lineage Transdifferentiation) is a genetic programming method that allows growth factor-independent stem cell expansion and differentiation through a molecular switch between two mutually exclusive programs. Indeed by applying GERALT it is possible to regulate the expansion of a cell culture comprising the modified stem cell of the invention, and, by simple administration of a molecule activating the transcriptional regulator protein, such as doxycycline, it is possible, at the same time, to stop the expansion and start the differentiation into a defined mature cell. Therefore, object of the present invention is: a stem cell with a modified genome that comprises: i) an inserted gene encoding one or more pluripotency factors operably linked to a first constitutive promoter; ii) an inserted gene encoding a transcriptional regulator protein operably linked to said first constitutive promoter or a second constitutive promoter; iii) an inserted inducible cassette comprising one or more genetic sequences operably linked to an inducible promoter, wherein said inducible promoter is regulated by said - 6 - SIB BW1353R transcriptional regulator protein and wherein said genetic sequences encode one or more differentiation factors inducing differentiation into defined mature cells, and one or more non-coding RNAs suppressing the transcription or translation of said pluripotency factors, an ex vivo method for preparing defined mature cells from programming of stem cells comprising the following steps: a) culturing a modified stem cell according to any one of the embodiments herein disclosed to expand said stem cell b) culturing a modified stem cell according to any one of the embodiments herein disclosed in the presence of a molecule activating said transcriptional regulator protein in said modified stem cell; c) culturing said induced cells to have defined mature cells, a cultivated meat comprising at least one defined mature cell obtained from the method according to the present invention, use of a stem cell or defined mature cell of the invention for in vitro drug screening, toxicology, or diagnostics, tissue engineering, in therapy, as in vitro model or as cultivated meat, a kit for transforming a stem cell comprising: i) a gene encoding one or more pluripotency factors operably linked to a constitutive promoter; ii) a gene encoding a transcriptional regulator protein operably linked to a constitutive promoter; iii) one or more genetic sequences operably linked to an inducible promoter, wherein said inducible promoter is regulated by said transcriptional regulator protein and wherein said genetic sequences encode one or more differentiation factors inducing differentiation into defined mature cells, and one or more non-coding RNA which suppresses the transcription or translation of said pluripotency factor, use of the kit of the present invention for the preparation of modified stem cells according to the present invention, a method for the preparation of a modified stem cell comprising a step of transformation of a stem cell with the kit according to the present invention. DETAILED DESCRIPTION OF THE FIGURES Fig.1 Abstraction of an embodiment of the key inventive concept: a gene regulatory network consisting of a constitutively expressed pluripotency master differentiation factor that supports growth factor-free pluripotent stem cell expansion and is subsequently - 7 - SIB BW1353R silenced in parallel to the inducible overexpression of a myogenic master differentiation factor that drives growth factor-free differentiation. Fig. 2 Schematic of an exemplary genome editing strategy to implement the gene regulatory network depicted in Figure 1. Top construct: our chosen master pluripotency factor, NANOG, placed under the control of a constitutive CAG promoter and expressed together with an mCherry fluorescent reporter linked through a self-splicing T2A-P2A sequence, inserted in the CLYBL locus. Middle construct: Tet-On 3G (dox-inducible transactivator) under the control of a constitutive CAG promoter, inserted in the hROSA26 locus. Bottom construct: our chosen master myogenic differentiation factor, MYOD1, operatively linked to an artificial microRNA against the NANOG pluripotency factor, all under the control of a doxycycline inducible promoter and inserted in the AAVS1 locus. Fig.3 On the left, genotyping of TTN-mEGFP WTC11 re-engineered with the CAG-Tet- On 3G construct in the hROSA26 locus. After preliminary screening, four different clones were re-screened for correct integration through genomic PCR and clone 6 was selected (TT hiPSCs). The first primer pair (LOCUS ROSA26) amplifies the wild type hROSA26 locus; the band is absent if the construct is inserted in both alleles, as the CAG promoter does not permit amplification. The subsequent two primer pairs (5’ INT and 3’ INT) amplify HDR junctional products at the 5’ and 3’ end of the construct, respectively. Lastly, 5’BB and 3’BB primers determine potential random integrations of the construct. On the right: qRT-PCR validation of transgenic Tet-On 3G and endogenous NANOG expression in TT hiPSCs. Fig. 4 Genotyping of TT hiPSCs re-engineered with the CAG-NANOG-2A-mCherry construct in the CLYBL locus. After preliminary screening, we selected two clones, 12 (TTN) and 18 (TTN2), that were re-screened for correct integration through genomic PCR, employing strategies conceptually identical to those described for Figure 3. Fig.5 Flow cytometry for mCherry expression in TTN (NANOG + / -) and TTN2 (NANOG + / +) hiPSCs. Fig.6 qRT-PCR analysis on TT hiPSCs (WT), TTN hiPSCs (NANOG HET), and TTN2 hiPSCs (NANOG HOM) kept in control medium (E6FT) - time zero, or after culture in TGFβ-inhibiting medium (E6FSB) - used for all remaining timepoints (in hours). N = 3 independent biological replicates. Fig. 7 Flow cytometry for OCT4 and NANOG pluripotency markers in TT hiPSCs (CONTROL), TTN hiPSCs (NANOG HET), and TTN2 hiPSCs (NANOG HOM), cultured in different conditions for 4 days: control medium (E6FT, +TGFβ), TGFβ-deprived - 8 - SIB BW1353R medium (E6F, -TGFβ), and TGFβ-inhibiting medium (E6FSB, +TGFβi). Iso = isotype negative control staining. Fig.8. Same experiment described in Figure 7, but performed after 8 days of culture. Fig.9. qRT-PCR analysis of cells from the experiment described in Figures 8. N = 3 independent biological replicates. Fig.10. Flow cytometry for OCT4 and NANOG in TTN2 hiPSCs kept in TGFβ-deprived medium (E6F) for a total of 10 passages (~40 days; >40 population doublings). Representative data from 3 independent adaptations. Fig. 11. Uniform Manifold Approximation and Projection (UMAP) dimensionality reduction of single-cell RNA sequencing data for TTN2 (NANOG OVER) and TT (WT) hiPSCs cultured in control conditions (E8) or TGFβ-deprived medium (E6 FGF) for 10 passages (except for WT E6 FGF, analyzed after 6 passages since proliferating cultures could not maintained any longer). Data aggregated from 3 independent biological replicates. Fig.12. Heatmaps of gene expression plotted on the UMAP clusters described in Figure 11. Fig.13. Violin plot of OCT4 expression in individual replicates of the same sc-RNA-seq data described in Figure 11. Fig.14. On the left, schematic of the AAVS1 targeting construct engineered in TT iPSCs to enable dox-inducible expression of EGFP operatively linked to an artificial miRNA against surface protein CD46 or CD151. On the right, experimental strategy to test the functionality of inducible artificial miRNAs in TT iPSC lines. Fig.15. Flow cytometry for CD46 or CD151 of the experiment described in Figure 14. Genome edited pools of cells were subsetted by EGFP expression (GFP+, encoding also the miRNA, versus GFP-, not encoding the miRNA) and compared to untransfected (NT) positive control TT hiPSCs. Fig. 16. Schematics of the construct inserted in the AAVS1 locus to study the downregulation of NANOG through the use of an artificial miRNA in TTN2 cells, employing a strategy analogous to the one described in Figure 14 Fig.17. Flow cytometry for NANOG of the experiment described in Figure 16, analyzed as described in Figure 15 Fig.18. Representative fluorescence microphotographs of TTN2 cells genome edited in pool with construct depicted in Figure 16 and analyzed after 5 days of doxycycline treatment. miRNA expression: EGFP; NANOG expression: mCherry. - 9 - SIB BW1353R Fig.19. Schematics of the construct inserted in the AAVS1 locus of TT iPSCs to obtain TTM hiPSCs and test the forward reprogramming protocol induced by MYOD1 overexpression. Fig. 20. Representative fluorescence microphotographs of TTN-EGFP signal in TTM cells forward programmed in skeletal myocytes. Cells were analyzed after 7 days of differentiation induced by doxycycline administration in a supportive culture media. Fig.21. On the top, schematics of AAVS1 targeting constructs engineered in TT hiPSCs (TTN-GFP) and TTN2 hiPSCs (Nanog-OVER). In the latter, inducible NANOG artificial miRNA was expressed together with MYOD1 (TTN2MN). As a control, an artificial miRNA against CD151 was employed (TTN2MC). On the bottom: genotyping of a TTN2MN hiPSC clone, performed using genomic PCR strategies analogous to those described in Figures 3-4 but for the AAVS1 locus. Fig.22. Representative phase contrast microphotographs TTN2MN cells (left, MYOD1 + NANOG miRNA) and TTN2MC cells (right, MYOD1 + CD151 miRNA) following 7 days of forward programming in dox-containing supportive culture media. Fig.23. Flow cytometry quantification of TTN-mEGFP expression in cells engineered with the constructs depicted in Figure 21 and analyzed after 7 days of doxyxcycline administration. From left to right: TTM cells; TTN2MN cells; TTN2MC cells. Fig.24. Microphotographs of 3D engineered muscle tissues (EMT) derived from forward programmed TTN2MN hiPSCs, and functional characterization of their contractile properties in response to electrical stimulation at increasing frequencies (top right), which demonstrate a comparable performance to EMTs derived from forward programmed TTM hiPSCs (bottom right). Fig. 25. Schematics of constructs with alternative molecular strategies for artificial miRNA expression. On the top, the amiRNA is placed inside a chimeric intron derived from CAG promoter, in the pre-mRNA of MYOD1. On the bottom, utilization of a bidirectional dox-inducible promoter which drives on one side a EGFP reporter followed by the artificial miRNA and on the other side MYOD1 alone. Fig.26. Bright field microphotographs of three different clones for each strategy at day 7 of differentiation. From top to bottom: TTM cells; TTN2MC cells; TTN2 cells with MYOD1 and NANOG miRNA using bidirectional promoter (TTN2MNb); TTN2 cells with MYOD1 and NANOG miRNA in an intron (TTN2MNi); TTN2MN cells. - 10 - SIB BW1353R Fig.27. qRT-PCR analysis of cells from the experiment described in Figure 26. N = 2 independent biological replicates, 3 independent clones for each strategy. Dotted line represents gene expression of TTM control cells. Fig.28. Bulk RNA-seq analyses of the experiment described in Figure 26; hiPSCs were included as negative control. N = 2-4 independent biological replicates. On the left, PCA (Principal Component Analysis) dimensionality reduction of all data. On the right, Gene Set Enrichment Analyses (GSEA) comparing expression of muscle cell differentiation genes in pairs of conditions. Fig. 29. Microphotographs of TTN2MNi hiPSCs cultivated in suspension in TGFβ- deprived medium (E6 FGF): brightfield (left, top) and mCherry fluorescence indicating transgenic NANOG expression (left, bottom). On the right (top), flow cytometry analyses of after 10 passages (~40 days, >40 population doublings). On the bottom, the percentage of OCT4 and NANOG double positive cells after 10 passages in three independent experiments. Fig.30. On the left, brightfield, fluorescence, and merged microphotographs of TTN2MNi cell aggregates differentiated in suspension for 7 days. On the right, matched flow cytometry quantification of TTN-mEGFP expression (solid line) versus undifferentiated controls (dashed line). Fig. 31. Media formulations tested for testing growth factor removal and glucose tolerance. Fig.32. Flow cytometry quantification of TTN-mEGFP for TTN2MNi cells and TTM cells after 4 days of differentiation in different media (Fig. 31) supplemented with various glucose levels. Fig.33. Bright field microphotographs of cells from the experiment described of Figure 32. Fig.34. Flow cytometry quantification of TTN-mEGFP of TTN2MN cells and TTM cells after 7 days of differentiation in different media (Fig. 31) supplemented with various glucose levels. Fig.35. qRT-PCR analysis of cells from the experiment described in Figures 32-34. N = 2 independent biological replicates. * = p< 0.05 by two-way ANOVA followed by post- hoc Bonferroni-corrected pairwise comparisons. Fig.36. Crystal violet assay of TTM and TTN2MNi pluripotent cells kept into homemade Essential 8 and homemade Essential 7 media, respectively supplemented with various glucose levels for 72h. Fig.37. pR26-Bst_CAG-Tet-On-3G Fig.38. pCLYBL-Neo_CAG-NANOG_2A_mCherry - 11 - SIB BW1353R Fig.39. pAAV-Puro_TRE-EGFP-(miR-E) Fig.40. pAAV-Puro_TRE-MYOD1 Fig.41. pAAV-Puro_TRE-MYOD1-(miR-E-NANOG) Fig.42. pAAV-Puro_TRE-(intron-miR-E-NANOG)-MYOD1 Fig.43. pAAV-Puro_TREbi-EGFP-(miR-E-NANOG)_MYOD1 Fig.44. pCLYBL-Puro_CAG_Tet-On-3G_TRE-(intron-miR-E-NANOG)-MYOD1 Fig. 45. pCLYBL-Puro_CAGbi-NANOG-Tet-On-3G_TRE-(intron-miR-E-NANOG)- MYOD1 GLOSSARY As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural reference unless the context clearly dictates otherwise. In any part of the description the term “comprise / comprising” can be replaced by “consists / consisting of”. The term “nucleic acid” or “polynucleotide” refers to deoxyribonucleic acids (DNA) or ribonucleic acids (RNA) and polymers thereof in either single- or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)). The term nucleic acid is used interchangeably with gene, cDNA, and mRNA encoded by a gene. The term “gene” means the segment of DNA involved in producing a polypeptide chain. It may include regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons). The term “transgene” indicates a gene that has been introduced into the genome of an organism from another species, through the process of “transgenesis”. The term “cisgene” indicates a gene that has been transferred from one organism to another within the same species or between closely related species, and the gene originates from the same gene pool, through the process of “cisgenesis”. - 12 - SIB BW1353R An ”inserted gene” according to the present invention refers to a cisgene or a transgene. A “promoter” is defined as an array of nucleic acid control sequences that direct transcription of a nucleic acid. As used herein, a promoter includes necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element. A promoter also optionally includes distal enhancer or repressor elements, which can be located as much as several thousand base pairs from the start site of transcription. The promoter can be a heterologous promoter. “Constitutive promoters” ensure sustained and high-level gene expression. Commonly used constitutive promoters include the human β-actin promoter (ACTB), cytomegalovirus (CMV), elongation factor 1-alpha, (EF1α), phosphoglycerate kinase (PGK), and ubiquitin C (UbC). The CAG promoter is a strong synthetic promoter frequently used to drive high levels of gene expression and was constructed from the following sequences: (C) the cytomegalovirus (CMV) early enhancer element, (A) the promoter, the first exon and the first intron of chicken beta-actin gene, and (G) the splice acceptor of the rabbit beta-globin gene. An "inducible promoter" is a nucleotide sequence where expression of a genetic sequence operably linked to the promoter is controlled by an analyte, co-factor, regulatory protein, etc. In the case of the present invention, the control is exerted by the transcriptional regulator protein. An “expression cassette” is a nucleic acid construct, generated recombinantly or synthetically, with a series of specified nucleic acid elements that permit transcription of a particular polynucleotide sequence in a host cell. An expression cassette may be part of a plasmid, viral genome, or nucleic acid fragment. Typically, an expression cassette includes a polynucleotide to be transcribed, operably linked to a promoter. The promoter can be a heterologous promoter. In the context of promoters operably linked to a polynucleotide, a “heterologous promoter” refers to a promoter that would not be so operably linked to the same polynucleotide as found in a product of nature (e.g., in a wild-type organism). A “reporter gene” encodes proteins that are readily detectable due to their biochemical characteristics, such as enzymatic activity or chemifluorescent features. One specific example of such a reporter is green fluorescent protein. Fluorescence generated from this protein can be detected with various commercially available fluorescent detection systems. Other reporters can be detected by staining. The reporter can also be an enzyme that generates a detectable signal when contacted with an appropriate substrate. The reporter can be an enzyme that catalyzes the formation of a detectable product. Suitable enzymes include, but are not limited to, proteases, nucleases, lipases, - 13 - SIB BW1353R phosphatases and hydrolases. The reporter can encode an enzyme whose substrates are substantially impermeable to eukaryotic plasma membranes, thus making it possible to tightly control signal formation. Specific examples of suitable reporter genes that encode enzymes include, but are not limited to, CAT (chloramphenicol acetyl transferase; Alton and Vapnek (1979) Nature 282: 864-869); luciferase (lux); β- galactosidase; LacZ; β.-glucuronidase; and alkaline phosphatase (Toh, et al. (1980) Eur. J. Biochem.182: 231-238; and Hall et al. (1983) J. Mol. Appl. Gen.2: 101), each of which are incorporated by reference herein in its entirety. Other suitable reporters include those that encode for a particular epitope that can be detected with a labeled antibody that specifically recognizes the epitope. The term “amino acid” refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, γ-carboxyglutamate, and O-phosphoserine. Amino acid analogs refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. “Amino acid mimetics” refers to chemical compounds having a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid. There are various known methods in the art that permit the incorporation of an unnatural amino acid derivative or analog into a polypeptide chain in a site-specific manner, see, e.g., WO 02 / 086075. Amino acids may be referred to herein by either the commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes. “Polypeptide,” “peptide,” and “protein” are used interchangeably herein to refer to a polymer of amino acid residues. All three terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymers. As used herein, the terms encompass - 14 - SIB BW1353R amino acid chains of any length, including full-length proteins, wherein the amino acid residues are linked by covalent peptide bonds. As to amino acid sequences, one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a “conservatively modified variant” where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles of the invention. In the present application, amino acid residues are numbered according to their relative positions from the left most residue, which is numbered 1, in an unmodified wild-type polypeptide sequence. A “non-coding RNA” (ncRNA) is a functional RNA molecule that is not translated into a protein. A “genetic safe harbour” (GSH) site is a locus within the genome wherein a gene or other genetic material may be inserted without any deleterious effects on the cell or on the inserted genetic material. Most beneficial is a GSH site in which expression of the inserted gene sequence is not perturbed by any read-through expression from neighbouring genes and expression of the inducible cassette minimizes interference with the endogenous transcription programme. More formal criteria have been proposed that assist in the determination of whether a particular locus is a bona fide GSH site. These criteria include a site that is (i) 50 kb or more from the 5' end of any gene, (ii) 300 kb or more from any gene related to cancer, (iii) 300 kb or more from any microRNA (miRNA), (iv) located outside a transcription unit and (v) located outside ultra-conserved regions (UCR). It may not be necessary to satisfy all of these proposed criteria, since GSH already identified do not fulfil all of the criteria. It is thought that a suitable GSH will satisfy at least 2, 3, 4, or all of these criteria. Any suitable GSH site may be used in the method of the invention, on the basis that the site allows insertion of genetic material without deleterious effects to the cell and permits transcription of the inserted genetic material. Those skilled in the art may use these simplified criteria to identify a suitable GSH, and / or the more formal criteria set out above. For the human genome, several GSH sites have been identified, and these include the AAVS1 locus, the hROSA26 locus, and the CLYBL gene. The adeno-associated virus integration site 1 locus (AAVS1) is located within intro 1 of the gene encoding the protein phosphatase 1, regulatory subunit 12C (PPP1R12C) gene - 15 - SIB BW1353R on human chromosome 19, which is expressed uniformly and ubiquitously in human tissues. This site serves as a specific integration locus for AAV serotype 2, and thus was identified as a possible GSH. AAVS1 has been shown to be a favourable environment for transcription, since it comprises an open chromatin structure and native chromosomal insulators that enable resistance of the inducible cassettes against silencing. There are no known adverse effects on the cell resulting from disruption of the PPP1R12C gene. Moreover, an inducible cassette inserted into this site remains transcriptionally active in many diverse cell types. AAVS1 is thus considered to be a GSH and has been widely utilized for targeted transgenesis / cisgenesis in the human genome. The hROSA26 site has been identified on the basis of sequence analogy with a GSH from mice (ROSA26-reverse oriented splice acceptor site #26). Although the orthologue site has been identified in humans, this site is not commonly used for inducible cassette insertion. The present inventors have developed a targeting kit specifically for the hROSA26 site and thus were able to insert genetic material into this locus. The hROSA26 locus is on chromosome 3 (3p25.3), and can be found within the Ensembl database (GenBank:CR624523). The exact genomic coordinates of the integration site are chr3:9396280-9396303: Ensembl (GRCh38 / hg38). The integration site lies within the open reading frame (ORF) of the THUMPD3 long non-coding RNA (reverse strand). Since the hROSA26 site has an endogenous promoter, the inserted genetic material may take advantage of that endogenous promoter, or alternatively may be inserted operably linked to a promoter. Intron 2 of the Citrate Lyase Beta-like (CLYBL) gene, on the long arm of Chromosome 13, was identified as a suitable GSH since it is one of the identified integration hot-spots of the phage derived phiC31 integrase. Studies have demonstrated that randomly inserted inducible cassettes into this locus are stable and expressed. It has been shown that insertion of inducible cassettes at this GSH does not perturb local gene expression. CLYBL thus provides a GSH that may be suitable for use in the present invention. GSHs have been defined previously as "intragenic or extragenic regions of the human genome that are able to accommodate the predictable expression of newly integrated DNA without adverse effects on the host cell or organism. A useful safe harbour must permit sufficient transcription of the inserted genetic sequence to yield desired levels of the protein (via further translation) or non-coding RNA. A GSH also must not predispose cells to malignant transformation nor alter cellular functions" GSH in other organisms have been identified and include ROSA26, HPRT and Hipp11 (H11) loci in mice. Mammalian genomes may include GSH sites based upon pseudo attP sites. For such sites, hiC31 integrase, the Streptomyces phage-derived - 16 - SIB BW1353R recombinase, has been developed as a non-viral insertion tool, because it has the ability to integrate a inducible cassette-containing plasmid carrying an attB site into pseudo attP sites. GSH in livestock animals that may be suitable for use in the present invention, and include: cow (Bos taurus) Rosa26 analog locus (which is well-characterized in mice and has been identified in cows as a potential reliable site for transgene / cisgene insertion in bovine cells); pig (Sus scrofa) Rosa26 analog locus, PigtA locus (analogous to the human AAVS1 site and used for stable transgene / cisgene expression in various genetic engineering studies), and insulin locus (which has been used for transgene / cisgene insertion in pigs, particularly for the production of biopharmaceutical proteins in their milk); sheep (Ovis aries) Rosa26 analog locus, collagen type I alpha 1 (Col1A1) locus (which has been suggested as a potential safe harbor for the stable expression of inserted genes in ovine cells); chicken (Gallus gallus domesticus), Rosa26 locus, ovalbumin (OVA) locus (which has expression in the oviduct, making it a potential site for transgene / cisgene insertion for biopharmaceutical production in eggs), locus control regions (LCRs; which regulate the expression of linked gene and have been considered for their potential to act as safe harbors in poultry). GSH in zebrafish (Danio rerio) may also be suitable for use in the present invention and include: Rosa26 analog, β-actin2 locus, EF1α locus, and zpc1 locus. Analogous loci in other fish species may be suitable for use in the present invention. In some embodiments of the present invention, transposons may be used to insert genetic material as an alternative to GSH. The skilled person knows to design and use transposons for this purpose in the constructs of the present invention. “Pluripotent stem cells” are cells that have the ability to become any of the three germ layers (endoderm, ectoderm, mesoderm) and thus are capable of giving rise to all cell types in the body, making them invaluable in regenerative medicine and developmental biology. It is for this reason that understanding the mechanisms that maintain a cell's pluripotency is critical for researchers to understand how stem cells work and may lead to future advances in treating a variety of diseases. A “pluripotency factor” is a protein that plays a crucial role in maintaining the pluripotent state of stem cells. These can be transcriptional regulators but also other protein types as well as non-coding RNAs, for instance those involved in controlling signalling pathways activity. One of the most well-known pluripotency factors is NANOG, which is a pluripotency factor that helps regulate the expression of genes involved in maintaining pluripotency. Other key pluripotency factors include SOX2, POU5F1 (also known as OCT4), and KLF4, among others. These factors work together to regulate the expression of genes - 17 - SIB BW1353R that are characteristic of pluripotent cells while suppressing genes associated with differentiation into specific cell lineages. By maintaining the expression of pluripotency factors, stem cells can continue to self-renew and retain their ability to differentiate into various cell types. Homeobox protein NANOG is a pluripotency factor that helps embryonic stem cells (ESCs) maintain pluripotency by suppressing cell determination factors, particularly those involved in ectoderm development. NANOG is thought to function in concert with other factors such as POU5F1 / OCT4 and SOX2 to establish ESC identity. NANOG has been described to be expressed particularly in the posterior side of the epiblast at the onset of gastrulation. There, NANOG has been implicated in inhibiting embryonic hematopoiesis by repressing the expression of the differentiation factor Tal1. In this embryonic stage, NANOG represses Pou3f1, a differentiation factor crucial for the anterior-posterior axis formation. A “differentiation factor” is a protein that plays a crucial role in driving the differentiation of stem cells. These can be transcription regulators but also other protein types as well as non-coding RNAs, for instance those involved in epigenetic or epitranscriptomic modifications (i.e., DNA, histone, and RNA post-transcriptional modifiers), or those controlling signalling pathways activity. An example of a differentiation factor is MYOD1, which is a transcriptional regulator that when overexpressed in a non-muscle cell induces a myogenic gene program that in some cases can lead to the conversion of said cell into skeletal muscle. A “transcriptional regulator protein” is a protein that binds to DNA, preferably sequence- specifically to a DNA site located in or near a promoter, and either facilitating the binding of the transcription machinery to the promoter, and thus transcription of the DNA sequence (a transcriptional activator) or blocks this process (a transcriptional repressor). The DNA sequence that a transcriptional regulator protein binds to is called a transcription factor-binding site or response element, and these are found in or near the promoter of the regulated DNA sequence. Transcriptional activator proteins bind to a response element and promote gene expression. Such proteins are preferred in the methods of the present invention for controlling inducible cassette expression. An example is the reverse tetracycline- controlled transactivator (rtTA) or one of its modified embodiments (i.e., Tet-On 3G). Transcriptional repressor proteins bind to a response element and prevent gene expression. Transcriptional regulator proteins may be activated or deactivated by a number of mechanisms including binding of a substance, interaction with other transcription factors - 18 - SIB BW1353R (e.g., homo- or hetero-dimerization) or coregulatory proteins, phosphorylation, and / or methylation. The transcriptional regulator may be controlled by activation or deactivation. If the transcriptional regulator protein is a transcriptional activator protein, it is preferred that the transcriptional activator protein requires activation. This activation may be through any suitable means, including physical stimuli such as light, electricity, magnetism, and mechanical forces, but it is preferred that the transcriptional regulator protein is activated through the addition to the cell of an exogenous substance. The supply of an exogenous substance to the cell can be controlled, and thus the activation of the transcriptional regulator protein can be controlled. Alternatively, an exogenous substance can be supplied in order to deactivate a transcriptional regulator protein, and then supply withdrawn in order to activate the transcriptional regulator protein. Any suitable transcriptional regulator protein may be used, preferably one that is activatable or deactivatable. It is preferred that an exogenous substance may be supplied to control the transcriptional regulator protein. The inducible cassette includes a genetic sequence operably linked to an inducible promoter. In the case of the present invention, the control is exerted by the transcriptional regulator protein. Tetracycline-regulated gene expression is a method of inducible gene expression where transcription is reversibly activated in the presence of the antibiotic tetracycline or one of its derivatives (e.g. doxycycline which is bound at higher affinity). In this system, the transcriptional regulator protein is the tetracycline-responsive transcriptional repressor protein (TetR) or a conservatively modified variant. The TetR protein is able to bind to DNA at specific tetO operator sequences located on a promoter, and by sterically preventing binding of DNA Polymerase or other transcriptional activators it represses gene expression. In the presence of tetracycline or a derivative thereof, TetR binds to the antibiotic, undergoes a conformational change, and releases from the tetO sites, allowing transcription to occur. Inducible promoters controlled by TetR include both those used by DNA polymerase II and those used by DNA polymerase III. Tet-inducible DNA polymerase II-dependent promoters include CMV and SV40 promoters with one or more tetO sequences. Tet- inducible DNA polymerase III-dependent promoters include U6 and H1promoters with one or two tetO sequences, before and after the TATA box. There are two derivative forms of tetracycline-regulated gene expression based on TetR variants, called Tet-On or Tet-Off, depending on whether the addition of tetracycline or a derivative thereof activates or deactivates gene expression, respectively. In both cases - 19 - SIB BW1353R several repeats of tetO sequences are placed upstream of a minimal promoter (such as the CMV promoter), which together form a tetracycline response element (TRE). In a Tet-Off system, the transcriptional regulator protein is the tetracycline-controlled transactivator (tTA) protein, a fusion of TetR with the transcriptional activation domain of the herpes simplex virus protein VP16. In this system, tTA binds to tetO and activates transcription in the absence of any inducer, while binding of tTA to tetracycline or a derivative thereof deactivates the tTA, rendering it incapable of binding to TRE sequences, thereby preventing transcription of TRE-controlled genes. This system was first described in Bujard, et al (1992). Proc. Natl. Acad. Sci. U.S.A.89 (12): 5547-51. In a Tet-On system, the transcriptional regulator protein is the reverse tetracycline- controlled transcriptional activator (rtTa) protein, a modified tTA containing specific mutations that reverse the behavior of tTA, causing it to no longer bind to the tet operator (tetO) sequences in the absence of an inducer. In this system, rtTa binds to tetO and activates transcription only in the presence of tetracycline or a derivative thereof, allowing it to bind to TRE sequences and inducing expression of TRE-controlled genes. Variants and modified rtTa proteins may be used in the methods of the invention, these include Tet-On Advanced transactivator (also known as rtTA2S-M2) and Tet-On 3G (also known as rtTA-V16, derived from rtTA2S-S2. Tet-On 3G is the preferred transcriptional regulator protein for this invention. The tetracycline response element (TRE) generally consists of 7 repeats of the 19bp bacterial tetO sequence separated by spacer sequences, together with a minimal promoter. Variants and modifications of the TRE sequence are possible, since the minimal promoter can be any suitable promoter. Preferably the minimal promoter shows no or minimal expression levels in the absence of rtTa binding. TRE based on a minimal CMV promoter is the preferred inducible promoter for this invention. Other examples of inducible promoters, that do not require chemical activation comprise temperature-inducible promoters, magnetic-inducible promoters, and light-inducible promoters. Temperature-inducible promoters can be induced by heat or cold exposure and are normally derived from heat-shock protein promoters, for example HSP90 and HSP70, which are activated when a heat-shock is applied to the system. They contain heat-shock response elements (HSE) that are essential for the binding of heat shock transcription factors (HSFs), for example HSF1, which following binding to HSE initiate transcription. Some temperature-induced promoters can be activated by magnetism, for instance when cells are exposed to ferromagnetic nanoparticles that vibrate when exposed to an appropriate magnetic field, increasing local temperature. This class of inducible promoters represents an example of a wider range of promoters that could be - 20 - SIB BW1353R activated by magnetogenetics, i.e., the action of magnetic fields on cells to modulate gene expression. Light-induced promoters rely on light-sensitive transcriptional regulator proteins that are activated by specific light wavelengths. There are different types of systems relying on this so-called optogenetic mechanism. All of these inducible promoters could find use in this invention. In another embodiment, the inducible promoter is a temperature-inducible promoter. Temperature inducible promoters are engineered from elements derived from heat-shock proteins, and are composed of two components: (1) heat shock promoters, derived from heat-shock proteins genes, which contain heat- shock response elements (HSE) that are essential for the binding of (2) heat shock transcription factors (HSFs) which following binding to HSE initiate transcription. Examples include HSP70 and HSP90 derived promoters, and Heat Shock Transcription Factor 1 (HSF1) as endogenous activator. In another embodiment, the inducible promoter is a light-inducible promoter. Light- inducible promoters involve the usage of light-sensitive proteins and are activated by specific light wavelengths. There are different types of systems relying on this so-called optogenetic systems, some examples being Cry2 - CIB1; TULIPs; oLID / iLID; VVD; Magnet; FKF1 / GI; EL222, PhyB / PIF3; Phyb / Pif6; BphP1 / PpsR2; BphP1 / Q-PAS1. It is intended that the term "promoter" or "control element" includes full-length promoter regions and functional (e.g., controls transcription or translation) segments of these regions. "Operably linked" refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function. Thus, a given promoter operably linked to a genetic sequence is capable of effecting the expression of that sequence when the proper enzymes are present. The promoter need not be contiguous with the sequence, so long as it functions to direct the expression thereof. Thus, for example, intervening untranslated yet transcribed sequences can be present between the promoter sequence and the genetic sequence and the promoter sequence can still be considered "operably linked" to the genetic sequence. Thus, the term "operably linked" is intended to encompass any spacing or orientation of the promoter element and the genetic sequence in the inducible cassette which allows for initiation of transcription of the inducible cassette upon recognition of the promoter element by a transcription complex. DETAILED DESCRIPTION OF THE INVENTION The present invention relates to a stem cell with a modified genome, hence a modified stem cell, that comprises: - 21 - SIB BW1353R i) an inserted gene encoding one or more pluripotency factors operably linked to a constitutive promoter; ii) an inserted gene encoding a transcriptional regulator protein operably linked to a constitutive promoter; iii) an inserted inducible cassette comprising one or more genetic sequences operably linked to an inducible promoter, wherein said inducible promoter is regulated by said transcriptional regulator protein and wherein said genetic sequence encode one or more differentiation factor inducing differentiation into defined mature cells and one or more non-coding RNAs suppressing the transcription or translation of said pluripotency factors. The modified stem cell of the present invention is capable of (1) proliferating and maintaining stemness in the absence of growth factors normally essential for this process, for instance belonging to the TGFβ superfamily, and (2) differentiating into defined mature cells in response to the simple administration of a molecule activating the transcriptional regulator protein (i.e., Tet-On 3G) in the modified stem cell, for example by administration of nanomolar doses of an antibiotic, such as doxycycline. The transcriptional regulator protein, after activation with the molecule, activates the inducible promoter operatively linked to the genetic sequences in the inducible cassette and initiates the transcription of one or more messenger RNAs encoding both one or more differentiation factors (i.e. MYOD1), which are able to induce differentiation into defined mature cells and, at the same time, and one or more non-coding RNA (i.e. miRNA), which suppress the transcription or translation of the pluripotency factors (i.e. NANOG), the latter being constitutively expressed in the cell during the proliferation phase. In this way it is possible to regulate the expansion of a cell culture comprising the modified stem cell of the invention, and, by simple administration of a molecule activating the transcriptional regulator protein, such as doxycycline, it is possible, at the same time, to stop the expansion and start the differentiation into a defined mature cell. For the modified stem cell of the invention, it was so far demonstrated the first aspect (1) for at least 10 cycles of cell passaging and growth to confluence in adhesion (~40 cell divisions, sufficient to generate a trillion cells for each initial cell), but considering the excellent results (Figure 9), it is possible to foresee similar behavior for a very large number greater than cell divisions and also in suspension cultures. As regards the second aspect, it was demonstrated efficiency and differentiation speed similar to that previously obtained with a method purely focused on differentiation, i.e. the homogeneous acquisition of morphology and gene expression typical of skeletal myocytes in approximately 7 days (Figures 21-22). The invention has been exemplified - 22 - SIB BW1353R using human cells, but considering the strong evolutionary conservation of early embryonic development it is possible to foresee similar result using pluripotent stem cells of other mammalian species (i.e., cow, pig, and sheep), as well as avian species (i.e., chicken, goose) and fish species (i.e. cod, trout, salmon). In one embodiment the stem cell of the invention comprises one, two or more of said inserted gene encoding one or more pluripotency factor operably linked to a first constitutive promoter and / or one, two or more of said inserted gene encoding a transcriptional regulator protein operably linked to said first constitutive promoter or a second constitutive promoter and / or one, two or more of said inserted inducible cassette comprising one or more genetic sequences operably linked to an inducible promoter, wherein said inducible promoter is regulated by said transcriptional regulator protein and wherein said genetic sequences encode one or more differentiation factors inducing differentiation into defined mature cells, and one or more non-coding RNAs suppressing the transcription or translation of said pluripotency factors. Where the aim is to produce mature cell types from progenitor cells, the cell that is modified is a stem cell, preferably a pluripotent stem cell. Pluripotent stem cells have the potential to differentiate into almost any cell in the body. There are several sources of pluripotent stem cells. Embryonic stem cells (ESCs) are pluripotent stem cells derived from the inner cell mass of a blastocyst, an early-stage preimplantation embryo. Induced pluripotent stem cells (iPSCs) are adult cells that have been genetically reprogrammed to an embryonic stem cell-like state by being forced to express genes and factors important for maintaining the defining properties of embryonic stem cells. Other sources of stem cells that could be foreseeably used for the invention are adult stem cells and progenitors. For instance, myoblasts, myosatellite cells, pericytes, mesenchymal stem / stromal cells (MSCs), fibroadipogenic progenitors (FAPs), which could all be immortalized and / or expanded in the absence of certain growth factors and then induced to differentiate into mature cells such as skeletal muscle, fat, or fibrous tissue. In an embodiment, the gene i) inserted in the modified stem cell of the invention, encoding a pluripotency factor operably linked to a constitutive promoter, is inserted in a first genetic safe harbour site. Furthermore, in an embodiment the gene ii) inserted in the modified stem cell of the invention, encoding a transcriptional regulator protein operably linked to a constitutive promoter, is inserted in a second genetic safe harbour site. In another embodiment, the inducible cassette iii) inserted in the modified stem cell of the - 23 - SIB BW1353R invention, comprising a genetic sequence operably linked to an inducible promoter, is inserted in a third genetic safe harbour site. In an embodiment, the first, second, and third genetic safe harbour site is the same genetic safe harbour site. In a further embodiment, the first and the third genetic safe harbour site is the same genetic safe harbour site. In another embodiment, the first and the second genetic safe harbour site is the same genetic safe harbour site. In another embodiment, the second and the third genetic safe harbour site is the same genetic safe harbour site. Any suitable GSH site can be used in the stem cell of the invention, on the basis that the site allows insertion of genetic material without deleterious effects to the cell and permits transcription of the inserted genetic material. Those skilled in the art may use these simplified criteria to identify a suitable GSH, and / or the more formal criteria set out above. In a preferred embodiment, said first, second, and third genomic safe harbour sites are selected from any one of the hROSA26 locus, the AAVS1 locus or the CLYBL gene. In an embodiment, the stem cell according to the present invention is a eukaryotic pluripotent stem cell. If the cells modified by insertion of an inducible cassette are to be used in a human patient, it may be preferred that the cell is an iPSC derived from that individual. Such use of autologous cells would remove the need for matching cells to a recipient. Alternatively, commercially available iPSC may be used, such as those available from WiCell® (WiCell Research Institute, Inc, Wisconsin, US). Alternatively, the cells may be a tissue-specific stem cell which may also be autologous or donated. Suitable cells include epiblast stem cells, induced neural stem cells and other tissue- specific stem cells. In certain embodiments, it may be preferred that the cell used is an embryonic stem cell or stem cell line. Numerous embryonic stem cell lines are now available, for example, WA01 (H1) and WA09 (H9) can be obtained from WiCell, and KhES-1, KhES-2, and KhES-3 can be obtained from Institute for Frontier Medical Sciences, Kyoto University (Kyoto, Japan). It may be preferred that the embryonic stem cell is derived without destruction of the embryo, particularly where the cells are human since such techniques are readily available (Chung, Young et al., Cell Stem Cell , Volume 2, Issue 2,113 - 117.) Stem cell lines which have been derived without destroying an embryo are also available. In one aspect, the invention does not extend to any methods which involve the destruction of human embryos. - 24 - SIB BW1353R The cell used in the method of the invention may be any human or animal cell. It is preferably a mammalian, avian, or fish cell, such as a cell from: rodents such as mice and rats; marsupials such as kangaroos and koalas; non-human primates such as a bonobos, chimpanzees, lemurs, gibbons, and apes; camelids such as camels and llamas; livestock animals such as horses, pigs, cattles, buffalos, bisons, goats, sheeps, deers, reindeers, donkeys, bantengs, yaks, chickens, ducks and turkeys; domestic animals such as cats, dogs, rabbits and guinea pigs; fishes such as salmons, tunas, cods, trouts, sardines, mackerels, haddocks, anchovies, tilapia and groupers. In certain aspects, the cell is preferably one from a livestock animal. The inserted genes and / or inducible cassette can be designed to be reversible and the inserted genetic material may be removed and / or replaced with and alternative transcriptional regulator / inducible cassette as appropriate. Methods of replacing the transcriptional regulator and / or inducible cassette form part of the invention. Such replacement may be useful where a culture of cells has been modified successfully with the genes and / or one inducible cassette, and it is desirable to replace the genes and / or inducible cassette. This takes advantage of the already successful insertion and may allow for larger insertions to be made. In order to perform this aspect of the invention, the insertions may include cleavable sequences to allow for the removal of all or part of the insertion from the GSH, such as a portion of the insertion. Preferred methods of removal or replacement include recombinational approaches. In an embodiment, said pluripotency factor is NANOG. Preferably NANOG is modified in order to comprise silent point mutations to eliminate potential N6-methyladenosine (m6A) sites. In a preferred embodiment, said NANOG is human NANOG cDNA (RefSeq NM_024865.4). In an embodiment, the inducible promoter is a bidirectional inducible promoter. A bidirectional inducible promoter refers to a regulatory sequence of DNA that controls the expression of two adjacent genes in opposite directions. This means that the promoter region can initiate the transcription of two genes simultaneously, with each gene being transcribed in opposite directions along the DNA strand. Any suitable transcriptional regulator protein may be used, preferably one that is activatable or deactivatable. It is preferred that an exogenous substance or physical stimulus may be supplied to control the transcriptional regulator protein. Such - 25 - SIB BW1353R transcriptional regulator proteins are also called inducible transcriptional activator proteins. In another embodiment, said transcriptional regulator protein is selected from any of: rtTa, VgEcR synthetic receptor of the Gene Switch hybrid transcriptional regulator protein, and derivatives of any thereof. In another embodiment is selected from LacI- IPTG, AraC-arabinose, Ga4-galactose, ecdysone-inducible system. In another embodiment is selected from HSF1, CIB1, ePDZ, SspB, dGI, PIF3, PIF6, PpsR2, Q- PAS1. In an embodiment, the transcriptional regulator protein is rtTA and the inducible promoter, inserted into the same GSH site or in another GSH site, includes the tetracycline response element (TRE). The exogenously supplied substance is the antibiotic tetracycline or one of its derivatives, preferably doxycyline. Variants and modified rtTa proteins may be used in the methods of the invention, these include Tet-On Advanced transactivator (also known as rtTA2S-M2) and Tet-On 3G (also known as rtTA-V16, derived from rtTA2S-S2). The use of Tet-On 3G is preferred in the method of the invention. The inducible cassette may include a genetic sequence encoding a key lineage specific differentiation factor acting as master regulator, abbreviated here are master regulator. Master regulators may be one or more of transcription factors, transcriptional regulators, cytokine receptors or signaling molecules, and the like. A master regulator is an expressed gene that influences the lineage of the cell expressing it. It may be that a network of master regulators is required for the lineage of a cell to be determined. As used herein, a master regulator gene that is expressed at the inception of a developmental lineage or cell type, participates in the specification of that lineage by regulating multiple downstream genes either directly or through a cascade of gene expression changes. If the master regulator is expressed, it has the ability to re-specify the fate of cells destined to form other lineages. Examples of master regulators include the myogenic differentiation factor MYOD1 and the hematopoietic differentiation factor SCL. Particularly, master regulators include, but are not limited to: Neural lineages - oligodendrocytes: NKX2-2, NKX6-2, OLIG2, SOX10; astrocytes: NFIA, NFIB, and SOX9; neurons: ASCL1, DLX2, NEUROD1, NEUROG1, NEUROG2, PAX6; Haematopoetic cells, including erythrocytes and megakaryocytes: FLI1, GATA1, TAL1; Mesenchymal lineages - skeletal muscle: MYOD1; cardiomyocytes: BAF60C, GATA4, MEF2C, TBX5; bone: MYCL1, POU5F1, RUNX2, SP7; cartilage: KLF4, MYC, SOX9; and brown adipocytes: CEBPB, MYC; - 26 - SIB BW1353R Pancreatic cell types: GATA4, PDX1; Stem cells: KLF4, MYC, POU5F1, SOX2 Hence, in an embodiment, said differentiation factors inducing cell differentiation, which are encoded by the genetic sequence operatively linked to the inducible promoter in the inserted inducible cassette are selected from ASCL1, BAF60C, CEBPA, CEBPB, DLX2, DPPA3, FLI1, FOXC1, FOXC2, FOXA2, FOS, GATA1, GATA4, GATA6, GRHL3, HAND1, HAND2, HNF3B, JUN, KLF4, MEF2, MEF2C, MYC, MYOD1, NANOG, NANOS9, NEUROD1, NEUROG1, NEUROG2, NFIA, NFIB, NKX2-2, NKX2-5, NKX6-2, OLIG2, PAX6, PDX1, POU5F1, PRDM1, RUNX1, RUNX2, SOX2, SOX9, SPI1, TBX5, TBXT, TAL1, TP63, TWIST1. The skilled person is able to identify other differentiation factors inducing cell differentiation. The inducible promoter can comprise elements that are suitable for binding or interacting with the transcriptional regulator protein. The interaction of the transcriptional regulator protein with the inducible promoter is preferably controlled by the exogenously supplied substance or physical stimulus. The exogenously supplied substance can be any suitable substance that binds to or interacts with the transcriptional regulator protein. Suitable substances include tetracycline, ponasterone A, and mifepristone. Thus, the insertion of the gene encoding a transcriptional activator protein into the third GSH provides the control mechanism for the expression of the inducible cassette which is operably linked to the inducible promoter and inserted into the second GSH site, which in an embodiment corresponds to the first GSH site. Such a promoter enables transcription only when correctly induced by the transcriptional activator protein. The transcriptional activator protein may be controlled by a substance that is exogenously supplied to the cell or by a physical stimulus applied to the cell. Thus, the presence of the exogenous substance or said physical stimulus may permit or block expression from the inducible promoter. An example of such controllable expression is the Tet-On system which is described further herein. One or more genetic sequences may be controllably transcribed from within the GSH(s). Indeed, the inducible cassette may contain 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 genetic sequences which it is desired to insert into the GSH and the transcription of which be controllably induced. The genetic sequence or sequences which it is inserted into the GSH or GSHs are present within the inducible cassette, operably linked to an inducible promoter. These - 27 - SIB BW1353R genetic sequences can be any suitable sequence, which are capable of being transcribed into RNA once the activity of the promoter has been induced. Suitable genetic sequences include but are not limited to transgenes / cisgenes (protein coding genes, in which the RNA produced is messenger RNA (mRNA) translated into a polypeptide), non-coding RNA (ncRNA-including but not limited to shRNA, antisense RNA (asRNA), guide RNA (gRNA), microRNA (miRNA), small interfering RNA (siRNA), trans-acting RNA (tasiRNA), antagomirs, aptamers, miRNA sponges, and any other functional RNA). The inducible cassettes may include additional genetic material to be inserted into a second or further GSH. Such additional genetic material may include one or markers such as green fluorescent protein (GFP) to indicate that the transcription is occurring. Alternatively, or additionally, genes such as antibiotic or drug resistance genes may allow for the selection of successfully inserted inducible cassettes. Moreover, the inducible expression of a particular gene to study its function or of sequences that will interfere with its function may be desirable. Technically, the insertions into the first and / or second and / or third GSH may occur on one chromosome, or on both chromosomes. The GSH exists at the same genetic loci on both chromosomes of diploid organisms. Insertion within both chromosomes is advantageous since it may enable an increase in the level of transcription from the inserted genetic material within the inducible cassette, thus achieving particularly high levels of transcription. In the stem cell invention, insertions can also occur at different GSH, thus in that case at least two GSH are required for the method of the invention. The genetic sequence operably linked to an inducible promoter within the inducible cassette is preferably a DNA sequence. The genetic sequence(s) of the inducible cassette preferably encode an RNA molecule and are thus capable of being transcribed. The transcription is controlled using the inducible promoter. The RNA molecule may be of any sequence but is preferably a mRNA encoding a protein, a shRNA or a gRNA. The transcriptional regulator protein gene may be provided for insertion with other genetic material. Such material includes genes for markers or reporter molecules. Such markers or reporter genes are useful, since the presence of the reporter protein confirms protein expression from the first GSH, indicating successful insertion. Selectable markers may further include resistance genes to antibiotics or other drugs. Markers or reporter gene sequences can also be introduced that enable studying the expression of endogenous (or exogenous genes). This includes Cas proteins, including CasL, Cas9 proteins that enable excision of genes of interest, as well as Cas fusion proteins that - 28 - SIB BW1353R mediate changes in the expression of other genes, e.g. by acting as transcriptional enhancers or repressors. Moreover, non-inducible expression of molecular tools may be desirable, including optogenetic tools, nuclear receptor fusion proteins, such as tamoxifen-inducible systems ERT, and designer receptors exclusively activated by designer drugs. Furthermore, sequences that code signalling factors that alter the function of the same cell or of neighbouring or even distant cells in an organism, including hormones autocrine or paracrine factors may be co-expressed from the same GSH as the transcriptional regulator protein. Additionally, the further genetic material may include sequences coding for non-coding RNA, as discussed herein. Examples of such genetic material include genes for miRNA, which may function as a genetic switch. Further, the transcriptional regulator, plus any further genetic material may be provided together with cleavable sequences. Such sequences are sequences that are recognized by an entity capable of specifically cutting DNA, and include restriction sites, which are the target sequences for restriction enzymes or sequences for recognition by other DNA cleaving entities, such as nucleases, recombinases, ribozymes or artificial constructs. At least one cleavable sequence may be included, but preferably two or more are present. These cleavable sequences may be at any suitable point in the insertion, such that a selected portion of the insertion, or all of the insertion, can be selectively removed from the GSH. The method can thus extend to removal and / or replacement of the insertion or a portion thereof from the GSH. The cleavable sites may thus flank the part / all of the insertion that it may be desired to remove. The transcriptional regulator and / or the further genetic material may be removed using this method. A portion of the insertion may be any part up to 99% of the insertion - i.e.1-99%, 90%., 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10% or less than 10%. It may be preferred that the portion of the insertion flanked by the cleavable sites includes the constitutive promoter. Alternatively, the constitutive promoter is not included in the portion flanked by the cleavable sequences. A preferred cleavable sequence is the IoxP site for Cre recombinase as it allows direct replacement of the removed insertion. Alternatively, or additionally, the cleavable sequence is the rox site for Dre recombinase. Alternatively, the cleavable sequence is recognized by a transposase such as piggyBac or sleeping beauty. It is preferred that the insertion at the GSH occurred at both loci in the genome, thus each allele is modified by insertion. This permits greater expression from the gene encoding the transcriptional regulator and any associated genetic material. - 29 - SIB BW1353R It will be understood that further GSH sites could be used to introduce further transcriptional regulators, inducible cassettes or any other genetic material including, but not limited to selectable markers, antibiotic or drug resistance genes, genes relating to the CRISPR / Cas9 system or genes of unknown function. Further genetic material including genes may be inserted into the first GSH with the transcriptional regulator protein. Such genes may include one or more markers such as green fluorescent protein (GFP) which can be used to show, for example, that the transcriptional regulator protein has been successfully inserted. Other options include genes that allow gene editing, for example Cas9 and derivatives or CasL and derivatives, and reporter sequences that can be used to assay endogenous or exogenous expression of specific genes in the cell. The inducible cassette comprises a genetic sequence, preferably a DNA sequence, that is to be transferred into a cell. The introduction of an inducible cassette into the genome has the potential to change the phenotype of that cell, either by addition of a genetic sequence that permits gene expression and / or knockdown / knockout of endogenous expression. The genetic sequence for insertion is preferably a DNA sequence that encodes an RNA molecule. The RNA molecule may be of any sequence but is preferably coding or non-coding RNA. Coding or messenger RNA codes for polypeptide sequences, and transcription of such RNA leads to expression of a protein within the cell. Non-coding RNA may be functional and may include without limitation: MicroRNA, Small interfering RNA, Piwi-interacting RNA, Antisense RNA, Small nuclear RNA, Small nucleolar RNA, Small Cajal Body RNA, Y RNA, Enhancer RNAs, Guide RNA, Ribozymes, Small hairpin RNA, Small temporal RNA, Trans-acting RNA, small interfering RNA and sub-genomic messenger RNA. Non-coding RNA may also be known as functional RNA. Several types of RNA are regulatory in nature, and, for example, can downregulate gene expression by being complementary to a part of an mRNA or a gene’s DNA. MicroRNAs (miRNA; 21-22 nucleotides) are found in eukaryotes and act through RNA interference (RNAi), where an effector complex of miRNA and enzymes can cleave complementary mRNA, block the mRNA from being translated, or accelerate its degradation. Another type of RNA, small interfering RNAs (siRNA; 20-25 nucleotides) act through RNA interference in a fashion similar to miRNAs. Some miRNAs and siRNAs can cause genes they target to be methylated, thereby decreasing or increasing transcription of those genes. Animals have Piwi-interacting RNAs (piRNA; 29-30 nucleotides) that are active in germline cells and are thought to be a defense against - 30 - SIB BW1353R transposons. Many prokaryotes have CRISPR RNAs, a regulatory system similar to RNA interference, and such a system includes guide RNA (gRNA). Antisense RNAs are widespread; most downregulate a gene, but a few are activators of transcription. Antisense RNA can act by binding to an mRNA, forming double-stranded RNA that is enzymatically degraded. There are many long noncoding RNAs that regulate genes in eukaryotes, one such RNA is Xist, which coats one X chromosome in female mammals and inactivates it. Thus, there are a multitude of functional RNAs that can be employed in the stem cell of the present invention. Thus, the inducible cassette may include a genetic sequence that is a protein-coding gene. This gene may be not naturally present in the cell, or may naturally occur in the cell, but the controllable expression of that gene is required. Alternatively, the inducible cassette may be a mutated, modified, or correct version of a gene present in the cell, particularly for gene therapy purposes or the derivation of disease models. The inducible cassette may thus include a cisgene from a different organism of the same species (i.e. a diseased / mutated version of a gene from a human, or a wild-type gene from a human) or be from a different species (transgene). In any aspect or embodiment, the genetic sequence comprised within the inducible cassette may be a synthetic sequence. The inducible cassette may include any suitable genetic sequence that it is desired to insert into the genome of the cell, or into a GSH. Therefore, the genetic sequence may be a gene that codes for a protein product or a sequence that is transcribed into ribonucleic acid (RNA) which has a function (such as small nuclear RNA (snRNA), antisense RNA, micro RNA (miRNA), small interfering RNA (siRNA), transfer RNA (tRNA) and other non-coding RNAs (ncRNA), including CRISPR-RNA (crRNA) and guide RNA (gRNA). The inducible cassette may thus include any genetic sequence, the transcription of which it is desired to be controlled within the cell. In an embodiment, said non-coding RNA translated by the genetic sequence in the inducible cassette is a miRNA. In a preferred embodiment, said miRNA is an artificial miRNA (amiRNA). The miRNA is placed preferably, but not limited to: (i) in the 3’ UTR of the mRNA of the master differentiation factor, and / or (ii) embedded inside a chimeric intron in the pre-mRNA of the master differentiation factor, and / or (iii) downstream of a bidirectional promoter, opposite to the master differentiation factor - 31 - SIB BW1353R More preferably, said differentiation factor is MYOD1, and therefore said miRNA is placed in the 3’ UTR of MYOD1, or in a chimeric intron of MYOD1, or in a mRNA transcribed in the opposite direction to MYOD1. In a preferred embodiment, the stem cell of the present invention comprises: i) an inserted gene encoding a pluripotency factor operably linked to a constitutive promoter, wherein said pluripotency factor is NANOG and said constitutive promoter is a CAG promoter, ii) an inserted gene encoding a transcriptional regulator protein operably linked to a constitutive promoter, wherein said transcriptional regulator protein is Tet-On 3G and said constitutive promoter is a CAG promoter, wherein the activity of Tet-On 3G is controlled by doxycycline. iii) an inserted inducible cassette comprising a genetic sequence operably linked to an inducible promoter, wherein said inducible promoter is regulated by said transcriptional regulator protein and wherein said genetic sequence encodes a differentiation factor inducing differentiation into defined mature cells and suppressing the transcription or translation of said pluripotency factor, wherein said inducible promoter is a Tet Responsive Element (TRE), and wherein said differentiation factor is selected from but not limited to ASCL1, BAF60C, CEBPA, CEBPB, DLX2, DPPA3, FLI1, FOXC1, FOXC2, FOXA2, FOS, GATA1, GATA4, GATA6, GRHL3, HAND1, HAND2, HNF3B, JUN, KLF4, MEF2, MEF2C, MYC, MYOD1, NANOG, NANOS9, NEUROD1, NEUROG1, NEUROG2, NFIA, NFIB, NKX2-2, NKX2-5, NKX6-2, OLIG2, PAX6, PDX1, POU5F1, PRDM1, RUNX1, RUNX2, SOX2, SOX9, SPI1, TBX5, TBXT, TAL1, TP63, TWIST1., preferably wherein said inserted gene i) encoding a pluripotency factor operably linked to a constitutive promoter is inserted in a first genetic safe harbour site, said inserted gene ii) encoding a transcriptional regulator protein operably linked to a constitutive promoter is inserted in a second genetic safe harbour site, said inserted inducible cassette comprising a genetic sequence operably linked to an inducible promoter is inserted in a third genetic safe harbour harbor site, preferably wherein said first, said second and said third genetic harbour site is the same genetic harbour site preferably wherein said first, second and third genomic safe harbour sites are selected from any one of the hROSA26 locus, the AAVS1 locus or the CLYBL gene. In a further embodiment, the first and the third genetic safe harbour site is the same genetic safe harbour site. In another embodiment, the first and the second genetic safe - 32 - SIB BW1353R harbour site is the same genetic safe harbour site. In another embodiment, the second and the third genetic safe harbour site is the same genetic safe harbour site. In one embodiment said pluripotency factor has SEQ ID NO: 66. In one embodiment said first, second, or third constitutive promoter has SEQ ID NO: 67. In one embodiment said transcriptional regulator protein has SEQ ID NO: 68. In one embodiment said genetic sequences encoding one or more differentiation factors inducing differentiation into defined mature cells and one or more non-coding RNAs suppressing the transcription or translation of said pluripotency factors has SEQ ID NO: 69-71. In one embodiment said differentiation factor inducing differentiation into defined mature cells has SEQ ID NO: 72. In one embodiment said non-coding RNA suppressing the transcription or translation of said pluripotency factor has SEQ ID NO: 73. In one embodiment said inducible promoter has SEQ ID NO: 74-75. In one embodiment said anchoring sequence for entering a genomic safe harbour site has SEQ ID NO: 76-81. Object of the present invention is an ex vivo method for preparing defined mature cells from programming of stem cells comprising the following steps: i) culturing a modified stem cell according to the present invention to expand said stem cell; ii) culturing a modified stem cell according to the present invention in the presence of a molecule activating said transcriptional regulator protein in said modified stem cell; iii) culturing said induced cells to have defined mature cells. In an embodiment of the invention, the method is carried out in absence of specific growth factors. In other words, the method comprises a step of “exploitation” of the pluripotency factor, i.e. a step of expansion of the modified stem cell, which is interrupted by the administration of a molecule or physical stimulus activating the transcriptional activator protein in the modified stem cell. The activation of the transcriptional activator protein activates the inducible promoter in the inserted cassette, thereby obtaining differentiation factors that induce the differentiation into a defined mature cell, and suppress the transcription or translation of the pluripotency factor. In this way the pluripotency is silenced, and the differentiation is possible and highly efficient. - 33 - SIB BW1353R Thus, the method of the invention can be used for the manufacture of mature cell types from stem cells. In this aspect of the invention, the inducible cassette for insertion into the GSH is preferably one or more master regulators together with a pluripotency repressor, as discussed previously. These inducible cassettes may enable the cell to be programmed into a particular lineage, and different inducible cassettes will be used in order to direct differentiation into mature cell types. Any type of mature cell is contemplated, including but not limited to nerve cells, myocytes, cardiomyocytes, hepatocytes, osteocytes, chondrocytes, epithelial cells, secretory cells, and / or blood cells. As the cell used in the methods of the invention can be pluripotent, the resultant cell may be a lineage restricted-specific stem cell, progenitor cell, or a mature cell type with the desired properties, by expression of a master regulator. These lineage-specific stem cells, progenitors, or mature cells may be used in any suitable fashion. For example, the mature cells may be used directly for transplantation into a human or animal body, as appropriate for the cell type. Alternatively, the cells may form a test material for research, including the effects of drugs on gene expression and the interaction of drugs with a particular gene. Moreover, the cells or the defined mature cells of the present invention can be used as an in vitro model. As a non-limiting example, the cells or the defined mature cells of the present invention can be used to prepare engineered muscle tissues (EMTs) composed of skeletal myocytes and stromal cells in a hydrogel. EMTs can be used as a potent and reliable alternative to animal models to study pathogenesis and to model diseases, but also as a platform for drug discovery, screening and testing. The cells for research can involve the use of an inducible cassette with a genetic sequence of unknown function, in order to study the controllable expression of that genetic sequence. Additionally, it may enable the cells to be used to produce large quantities of desirable materials. In an embodiment, said molecule activating the inducible promoter is tetracycline or a derivative thereof, preferably doxycycline. In a different aspect, the cells may be used in tissue engineering. Tissue engineering requires the generation of tissue that could be used to replace tissues or even whole organs of a human or animal. Methods of tissue engineering are known to those skilled in the art but include the use of a scaffold (an extracellular matrix) upon which the cells are applied in order to generate tissues / organs. These methods can be used to generate an "artificial" windpipe, bladder, liver, pancreas, stomach, intestines, blood vessels, heart - 34 - SIB BW1353R tissue, bone, bone marrow, mucosal tissue, nerves, muscle, skin, kidneys, or any other tissue or organ. Methods of generating tissues may include additive manufacturing, otherwise known as three-dimensional (3D) printing, which can involve directly printing cells to make tissues. The present invention thus provides a method for generating tissues using the cells produced as described in any aspect of the invention. Tissues generated using cells made according to the methods of the present invention may be used for transplantation into the human or animal body. Alternatively, if the cells are from an animal, the tissues may be used for in vitro / cultivated meat. The primary cell type for cultivated meat is myocytes. Such tissue may, however, involve the use of a combination of cell types made according to the methods of the invention. These may be myocytes (muscle cells), blood vessel cells, blood cells, fibroblasts, and adipocytes (fat cells). If the aim of the engineered tissue is for cultivated meat, then the cell may be taken from a livestock animal. The cells produced according to any of the methods of the invention have applications in diagnostic and therapeutic methods. The cells may be used in vitro to study cellular development, provide test systems for new drugs, enable screening methods to be developed, scrutinise therapeutic regimens, provide diagnostic tests, and the like. These uses form part of the present invention. Alternatively, the cells may be transplanted into a human or animal patient for diagnostic or therapeutic purposes. The use of the cells in therapy is also included in the present invention. The cells may be allogeneic (i.e. mature cells removed, modified, and returned to the same individual) or from a donor (including a stem cell line). Furthermore, the cells produced according to any of the methods of the invention can be used for in vitro drug screening and toxicology, and in particular for 3D muscle models for drug screening and toxicology. The present invention also relates to a kit for transforming a stem cell comprising: i) a gene encoding one or more pluripotency factors operably linked to a constitutive promoter; ii) a gene encoding a transcriptional regulator protein operably linked to a constitutive promoter; iii) one or two genetic sequences operably linked to an inducible promoter, wherein said inducible promoter is regulated by said transcriptional regulator protein and wherein said genetic sequences encode one or more differentiation factors inducing differentiation - 35 - SIB BW1353R into defined mature cells, and one or more non-coding RNA which suppresses the transcription or translation of said pluripotency factor. In a preferred embodiment, said stem cell is a pluripotent stem cell. The gene encoding one or more pluripotency factor operably linked to a constitutive promoter, the gene encoding the transcriptional regulator protein operatively linked to the constitutive promoter, and the inducible cassette may be supplied as the kit of the invention on separate vectors (first, second and third vector), or in one single vector. A "vector" is a nucleic acid molecule, such as a DNA molecule, which is used as a vehicle to artificially carry genetic material into a cell. The vector is generally a nucleic acid sequence that consists of an insert (such as an inducible cassette or gene for a transcriptional regulator protein) and a larger sequence that serves as the "backbone" of the vector. The vector may be in any suitable format, including plasmids, minicircle, or linear DNA. The vector comprises at least the gene for the transcriptional regulator or inducible cassette operably linked to an inducible promoter, together with the minimum sequences to enable insertion of the genes into the relevant GSH, also called herein anchoring sequence for entering a genomic safe harbour site. Optionally, the vectors also possess an origin of replication (ori) which permits amplification of the vector, for example in bacteria. Additionally, or alternatively, the vector includes selectable markers such as antibiotic resistance genes, genes for coloured markers, and suicide genes. In a preferred embodiment, said genomic safe harbour site is selected from any one of the hROSA26 locus, the AAVS1 locus or the CLYBL gene. In an embodiment, said first vector comprises an anchoring sequence for entering hROSA26 locus. In an embodiment, said second vector comprises an anchoring sequence for entering AAVS1 locus. In an embodiment, said third vector comprises an anchoring sequence for entering the CLYBL gene. In an embodiment, when the genes and the genetic sequence are supplied in one single vector, said vector comprises an anchoring sequence for entering hROSA26 locus, AAVS1 locus or CLYBL gene. Examples of the vectors used in the Examples are depicted in Figures 28 to 34. In an embodiment, said pluripotency factor is NANOG, preferably comprising silent point mutations to eliminate potential m6A sites. In another embodiment, said constitutive promoter is selected from human β-actin promoter (ACTB), cytomegalovirus (CMV), elongation factor 1-alpha, (EF1α), phosphoglycerate kinase (PGK) and ubiquitinC (UbC), CAG promoter, wherein said CAG promoter comprises the following sequences: (C) the cytomegalovirus (CMV) early - 36 - SIB BW1353R enhancer element, (A) the promoter, the first exon and the first intron of chicken beta- actin gene, and (G) the splice acceptor of the rabbit beta-globin gene. In an embodiment, said transcriptional regulator protein is selected from any of: tetracycline-responsive transcriptional activator protein (rtTa), Tet-On 3G, tetracycline repressor (TetR), tetracycline-controlled transactivator (tTA), VgEcR synthetic receptor of the Gene Switch hybrid transcriptional regulator protein, LacI-IPTG, AraC-arabinose, Ga4-galactose, ecdysone-inducible system HSF1, CIB1, ePDZ, SspB, dGI, PIF3, PIF6, PpsR2, Q-PAS1 and derivatives of any thereof. Preferably, said transcriptional activator protein is Tet-On 3G or any derivative thereof, and in one embodiment the activity of Tet- On 3G is controlled by tetracycline or a derivative thereof, optionally doxycyline. In an embodiment, said inducible promoter is a bidirectional inducible promoter. Preferably, the inducible promoter comprises a Tet Responsive Element (TRE). In an embodiment, said differentiation factor inducing cell differentiation can be selected from, but not limited to, ASCL1, BAF60C, CEBPA, CEBPB, DLX2, DPPA3, FLI1, FOXC1, FOXC2, FOXA2, FOS, GATA1, GATA4, GATA6, GRHL3, HAND1, HAND2, HNF3B, JUN, KLF4, MEF2, MEF2C, MYC, MYOD1, NANOG, NANOS9, NEUROD1, NEUROG1, NEUROG2, NFIA, NFIB, NKX2-2, NKX2-5, NKX6-2, OLIG2, PAX6, PDX1, POU5F1, PRDM1, RUNX1, RUNX2, SOX2, SOX9, SPI1, TBX5, TBXT, TAL1, TP63, TWIST1. In another embodiment, said genetic sequence encoding a differentiation factor inducing differentiation into defined mature cells, translates a non-coding RNA which suppresses the transcription or translation of said pluripotency factor. In an embodiment, said non-coding RNA translated by the genetic sequence in the inducible cassette is a miRNA. In a preferred embodiment, said miRNA is an artificial miRNA (amiRNA). Preferably, the miRNA is placed (i) in the 3’ UTR of the mRNA of the differentiation factor, and / or (ii) embedded inside a chimeric intron in the pre-mRNA of the differentiation factor, and / or (iii) downstream of a bidirectional promoter, opposite to the differentiation factor. More preferably, said differentiation factor is MYOD1, and therefore said miRNA is placed in the 5’UTR of the genetic sequence encoding MYOD1, inside a chimeric intron. In one embodiment said pluripotency factor has SEQ ID NO: 66. In one embodiment said first, second, or third constitutive promoter has SEQ ID NO: 67. In one embodiment said transcriptional regulator protein has SEQ ID NO: 68. - 37 - SIB BW1353R In one embodiment said genetic sequences encoding one or more differentiation factors inducing differentiation into defined mature cells and one or more non-coding RNAs suppressing the transcription or translation of said pluripotency factors has SEQ ID NO: 69-71. In one embodiment said differentiation factor inducing differentiation into defined mature cells has SEQ ID NO: 72. In one embodiment said non-coding RNA suppressing the transcription or translation of said pluripotency factor has SEQ ID NO: 73. In one embodiment said inducible promoter has SEQ ID NO: 74-75. In one embodiment said anchoring sequence for entering a genomic safe harbour site has SEQ ID NO: 76-81. The present invention also relates to the use of the kit according to the present invention for the preparation of a modified stem cell according to any of the embodiment of the present invention. Object of the present invention is also a method for the preparation of a modified stem cell comprising a step of transformation of a stem cell with the kit according to the present invention. In compliance with Art. 170bis paragraph 2 C.P.I and in accordance with Art. 21 paragraph 2 of the C.P.I. Implementation Regulation adopted with Ministerial Decree 13.1.2010 n.33, it is declared that the invention does not concern plant material. The biological material of human origin used in the present invention has been obtained by express, free and informed consent in accordance with current legislation. The human cells have been obtained in compliance with Art.170bis paragraph 3 of the C.P.I. EXAMPLES Generation and characterization of an iPSC line capable of growing in the absence of TGFβ We set out to assess the hypothesis that growth factor-independent stem cell pluripotency and differentiation could be achieved through a gene regulatory network consisting of constitutively expressed pluripotency transcription factors subsequently silenced in parallel to the inducible overexpression of master regulators of differentiation (Figure 1). To test of this concept, we designed a strategy consisting of three regulatory cassettes sequentially integrated in as many genomic safe harbours (GSHs) of human - 38 - SIB BW1353R induced pluripotent stem cells (hiPSCs), so as to enable efficient modular testing of each element: (1) constitutively expressed Tet-On 3G from the hROSA26 locus; (2) constitutively expressed pluripotency factors from the CLYBL locus; (3) doxycycline- inducible master regulators of differentiation operatively linked to artificial microRNA against pluripotency factors, expressed from the AAVS1 locus (Figure 2). In order to facilitate subsequent assessment of myogenic differentiation efficiency, we built this platform starting from a healthy donor male hiPSC line (WTC11) previously engineered with mEGFP knocked-in in frame at the end of the TTN cDNA, so as to encode a titin- mEGFP myogenic reporter (Allen Institute for Cell Science #AICS-0048 cl.39). We first re-engineered the TTN-mEGFP line to constitutively express Tet-On 3G from the hROSA26 locus by modifying a previously published method (using Casn9n pairs to facilitate site-specific homologous directed recombination (HDR); employing blasticidin resistance instead of neomycin resistance for selection of genome edited cells), isolating a heterozygous targeted clone that expressed consistently the Tet-On 3G molecule, hereby referred to as “TT” (TTN-mEGFP & Tet-On 3G) hiPSCs (Figure 3). After having ruled out numerous other candidates for the second step of our strategy, we focused on NANOG, a key pluripotency factor activated by SMAD2 / 3 downstream of TGFβ signalling. Specifically, we designed a construct containing human NANOG cDNA (RefSeq NM_024865.4) engineered with silent point mutations to eliminate all potential N6-methyladenosine (m6A) sites, so as to remove a negative post-transcriptional feedback on NANOG expression. This engineered cDNA was placed downstream of a CAG constitutive promoter for expression as a polycistronic mRNA also encoding an mCherry reporter (linked to NANOG through a self-splicing T2A-P2A sequence; Figure 4). The cassette was included in a plasmid containing homology arms to facilitate TALEN-facilitated HDR at the CLYBL GSH and subsequent selection of engineered cells through a gene trap neomycin resistance strategy. We engineered TT hiPSCs through this strategy and selected two clones: one homozygous and one heterozygous for the modification, hereby referred to as “TTN” and “TTN2” (TT & NANOG single / double copy) hiPSCs (Figure 4). Both clones homogeneously expressed the NANOG overexpressed cisgene as determined by flow cytometry for the mCherry reporter (Figure 5), TTN2 hiPSCs expressing ~2-fold higher levels than TTN hiPSCs, as expected. TTN2 hiPSC line was also tested for normal karyotype as described in the dedicated methods section. To test whether transgenic NANOG was expressed independently of TGFβ signalling, we compared TTN and TTN2 hiPSCs cultured in control conditions (Essential 6 supplemented with FGF2 and TGFβ1; E6FT) or after TGFβ inhibition (Essential 6 supplemented with FGF2 and the ALK5 - 39 - SIB BW1353R inhibitor SB-431542; E6FSB). qRT-PCR indicated that transgenic NANOG was stably expressed up to 48 hours after TGFβ inhibition, confirming TGFβ-independence (Figure 6). We then assessed whether transgenic NANOG supported pluripotency in absence or even following the inhibition TGFβ signaling, by comparing TT, TTN, and TTN2 hiPSCs cultured for 4 and 8 days in E6FT, Essential 6 supplemented only with FGF2 (E6F), and E6FSB. Flow cytometry for NANOG and POU5F1 (also known as OCT4) indicated that both markers were stably expressed in TTN and TTN2 hiPSCs in all conditions and time points, while these markers were rapidly lost in TT hiPSCs (Figures 7-8). qRT-PCR analyses after 8 days of culture confirmed that expression of both transgenic NANOG and OCT4 were maintained by TTN and TTN2 hiPSCs, but impaired in TT hiPSCs (Figure 9). Moreover, neuroectodermal markers SOX1, PAX6, and GBX2 were upregulated in TTN hiPSCs but not in TTN and TTN2 hiPSCs. This is consistent with the expected outcome of TGFβ deprivation / inhibition in hiPSCs, which is known to induce neuroectoderm specification, and with an inhibition of this process by NANOG overexpression. To test whether TGFβ independency could be maintained long-term, we compared TTN2 and TT hiPSCs cultured in E6F for a total of 10 passages (50 days of culture, corresponding to ~40-50 doublings). As expected, TT hiPSCs lost the typical pluripotent morphology, lost proliferative potential, and could not be passaged for more than 4 passages. In contrast TTN2 hiPSCs maintained a stable morphology and growth rate throughout the experiment. Most importantly, flow cytometry demonstrated homogeneous maintenance of NANOG and OCT4 expression, consistent with pluripotency maintenance (Figure 10). We repeated this experiment three times, observing the same result and banking E6F-adapted TTN2 cells to collect a total of 3 biological replicates. To more rigorously assess the phenotype of these cells we performed a large single cell RNA sequencing experiment comparing TTN2 hiPSCs adapted to E6F (at passage 12) or maintained in Essential 8 (E8 analogous to E6FT), as well as TT cells maintained in E8 or cultured in E6F for 3 passages (all analysed as biological triplicates). The four groups clustered separately, as could be expected, but the transcriptional shift in TTN2 hiPSCs was much less marked (Figure 11). Most crucially, NANOG expression was homogeneous and stable in all clusters except for the cluster of TT cells cultured in E6F, which instead showed a specific upregulation of neuroectoderm genes, such as MAP2, PTN, and NRP2 (Figure 12). Finally, expression of pluripotency markers such as POU5F1 / OCT4 was decreased in TT cells cultured in E6F, but maintained in E6F-adapted TTN2 (Figure 13). Collectively, these results - 40 - SIB BW1353R establish that NANOG-overexpression confers long-term TGFβ-independence in hiPSCs, preventing neuroectoderm differentiation in the absence of TGFβ signaling. Establishment of an artificial miRNA system to silence pluripotency factors in iPSCs After discarding other approaches to conditionally silence transgenic NANOG in order to allow the transition from pluripotency to differentiation, we focused on the artificial micro RNA (miRNA ) “miR-E”. Artificial miRNAs are potent RNAi structures that can be expressed from DNA Pol II promoters and consist of a synthetic shRNA stem-loop inserted into a pre-miRNA backbone optimized from an endogenous miRNA. To test this strategy in hiPSCs, we designed a construct containing a miR-E backbone in the 3’ UTR of an inducible EGFP mRNA, placed under the control of the tetracycline responsive element (TRE) and thus activatable by Tet-On 3G in presence of dox (Figure 14). We designed and cloned miR-E structures against two different surface protein, CD151 and CD46, and included a Renilla luciferase miR-E as control. We then transfected TT hiPSCs with an AAVS1 gene targeting vector to insert the miR-E cassette through ZFN-facilitated HDR (Figure 14), and after puromycin selection we treated edited cells in pool with dox for 5 and 10 days. At the end of the experiment, we performed flow cytometry analyses for CD151 / CD46 and EGFP, verifying that the miR- E targets were successfully downregulated 10-100-fold specifically in EGFP-expressing hiPSCs the target protein (Figure 15). Encouraged by these results we tested various in silico predicted miR-E structures against NANOG using the same construct and experimental strategy but implemented in TTN2 hiPSCs (Figure 16) and performing flow cytometry for NANOG and EGFP. Through these experiments, we identified a specific miR-E able to robustly and homogeneously downregulate transgenic NANOG, efficiently counteracting for its overexpression by CAG constitutive promoter (Figure 17). This was readily appreciable by fluorescence microscopy, as EGFP positive cells, thus expressing the NANOG- specific miR-E, showed a marked downregulation of the mCherry reporter encoded by the same mRNA as transgenic NANOG (Figure 18). Deterministic inducible forward programming of TGFB-independent iPSCs into skeletal myocytes Optimized inducible overexpression of MYOD1, a master regulator of myogenesis, can result in deterministic differentiation of hiPSCs into skeletal myocytes. We reproduced these findings in TT hiPSCs re-engineered with TRE-MYOD1 in the AAVS1 GSH, hereby - 41 - SIB BW1353R referred to as “TTM” (TT &M MYOD1; Figure 19), as 7 days of dox treatment in supportive culture conditions with minimal growth factors resulted in homogeneous TTN- mEGFP expression (Figure 20). Having established all of the necessary pieces independently, we assembled them to finally test the gene regulatory network we had designed (Figure 2). For this, we re- engineered TTN2 hiPSCs with a dox-inducible MYOD1 cassette also encoding a NANOG-specific miR-E in the 3’UTR (Figure 21). We isolated clones with homozygous AAVS1 editing with this constrict, hereby referred to as “TTN2MN” (TTN2 & MYOD1 & NANOG miR-E) hiPSCs (Figure 21). As a negative control, we generated identical lines except for including a CD151-specific miR-E, hereby referred to as “TTN2MC” (TTN2 & MYOD1 & CD151 miR-E). In three independent clones per condition, dox treatment for 7 days in supportive culture resulted in homogeneous forward programming into TTN- mEGFP-expressing cells with the typical elongated and multinucleated morphology of skeletal muscle specifically for TTN2MN cells, while TTN2MC controls were characterized by large clusters of undifferentiated cells positive for NANOG-mCherry (Figure 22). Flow cytometry analyses quantified the presence of ~33% undifferentiated, TTN-mEGFP negative cells in TTN2MC controls, while >98% of TTN2MN hiPSCs proved to be TTN-mEGFP positive (Figure 23). We put to the test TTN2MN hiPSCs for their ability to assemble into 3D engineered muscle tissues (3D EMTs) composed of forward programmed skeletal myocytes, stromal cells, and a fibrin gel, all suspended to two silicone posts to impart directional resistance to contraction and promote alignment and maturation. Remarkably, EMT generation using TTN2MN cells at day 6 of forward programming resulted in compact and well- structure EMTs able to spontaneously contract (Figure 24). We benchmarked these EMTs to those obtained from TTM cells, utilizing the Mantarray system to electrically pace the tissues at increasing frequencies (1-30 Hz) while measuring the resulting contractile force: this demonstrated a comparable performance of the two strategies (Figure 24). In all, TTN2MN can be forward programmed into 2D and 3D skeletal muscle models rivaling efficiency and performance of state-of-the-art models. Refinement of the genetic circuit While TTN2MN hiPSCs proved extremely capable, possibly due to the impressive potency of MYOD1 as a master differentiation regulators, we reasoned that in other contexts the co-expression of master regulators of differentiation and artificial miRNAs from the same mRNA could be detrimental, as miRNA processing could destabilize the mRNA and reduce the expression of the master regulators. Therefore, we tested two - 42 - SIB BW1353R additional strategies to achieve the same goal while bypassing this limitation. First, we designed a construct where miR-E is inserted into a chimeric intron in the pre-mRNA of the master regulator. Secondly, we cloned a bidirectional dox-inducible promoter to express miR-E in the 3’ UTR of EGFP transcribed on the opposite strand as the master regulator (Figure 25). We tested both strategies by re-engineering TTN2 hiPSCs with this type of constructs encoding for MYOD1 and the NANOG-specific miR-E, obtaining three clones for each strategy (TTN2MNi and TTN2MNb, respectively). Remarkably, both strategies support efficient skeletal myocyte forward programming after 7 days of dox treatment (Figure 26). We analyzed the gene expression of derived myocytes through qRT-PCR, and confirmed that all strategies generate cells expressing myogenic factors such an MYOG and TTN at levels comparable to those observed with TTM control conditions (Figure 27). Importantly, all strategies completely suppressed exogenous NANOG expression (Figure 27). Bulk-RNA-seq analyses confirmed that all strategies supported very comparable differentiation, demonstrated by remarkably close clustering in a Principal Component Analysis (PCA) dimensionality reduction (Figure 28). The same analysis indicated that TTN2MN(b / i) clustered closely to TTM on the first Eigenvector (PC1), capturing the majority of variance within the data and separating forward programmed cells from undifferentiated hiPSCs. Gene Set Enrichment Analysis for muscle cell differentiation confirmed that the three strategies are able to differentiate with at least the same efficiency as TTM cells (Figure 28). All considered, we selected the TTN2Mi design for all subsequent experiments, as this provides the greatest flexibility and results in comparable efficiency to the more complex and / or potentially less robust designs. Growth factor-free expansion and differentiation in suspension cultures Robust proliferation and differentiation in suspension using inexpensive media is crucial for industrial bioprocessing. We could readily adapt the TTN2MNi hiPSCs to suspension culture in self-assembling clusters for at least 10 passages in TGFβ-free home-made medium (hE7), maintaining full NANOG and OCT4 expression and undifferentiated morphology. (Figure 29). These cells could be efficiently differentiated through dox induction for 7 days in the same media used for 2D experiments, resulting in clusters with distinct morphology containing >95% of cells expressing TTN-mEGFP (Figure 30). Since the differentiation media used so far contained expensive growth additives (retinoic acid, FGF2, and CHIR99021), we tested weather it could be simplified. Specifically, we investigated weather TTN2MNi hiPSCs could be differentiated by simply adding doxycycline to the same media used for expansion, hE7, or to an even simpler - 43 - SIB BW1353R version without FGF2, hE6 (Figure 31). In parallel, we evaluated glucose tolerance as a key characteristic for cells intended for industrial bioproduction. Indeed, cells capable of sustaining growth under high glucose concentrations are preferred, as glucose tolerance is indicative of enhanced metabolic robustness. Such robustness enables improved resistance to operational stresses commonly encountered in bioreactor conditions, including high cell density, shear forces, and variations in pH and dissolved oxygen. Furthermore, the use of glucose-tolerant cells reduces the need for continuous glucose monitoring and regulation, thereby simplifying process control and enhancing production efficiency. Overall, we formulated hE7 and hE6 with (i) baseline amounts of glucose, 3.15 g / L (i) medium glucose supplementation to 5 g / L, and (iii) high glucose supplementation to 6.5 g / L. Remarkably, and to our surprise, TNN2MN cells differentiated most efficiently in hE6 and tolerated even the highest glucose concentration, resulting in TTN-mEGFP expression in 89-94% of cells already at day 4 (Figure 32). In contrast, TTM cells, which we used as benchmark, only tolerated the lowest glucose concentration (Figure 32). Cell morphology also proved very different, as TTN2MNi cells were more elongated and muscle-like compared to TTM ones (Figure 33). Interestingly, TTN-mEGFP levels in TTN2MNi cells were substantially higher in hE6 / hE7, both at day 4 and at day 7 compared to the original induction media (Figures 32, 34), indicating that some of the growth supplements were actually counterproductive. qRT-PCR analyses validated this observation for TTN and extended it to MYOG, and confirmed that TTM cells were unable to differentiate at medium or high glucose concentrations (Figure 35). These results suggested that TTN2MNi cells could tolerate higher levels of glucose also in the pluripotent expansion phase, so we tested both TTM and TTN2MNi cells with standard hE7 and hE8, containing 3.15 g / L glucose, or the same media supplemented to 6.5 g / L or 10 g / L. While TTM cells did not tolerate more than the basal levels of glucose, resulting in a growth arrest and cell death, TTN2MNi thrived, proliferating even faster in higher glucose conditions (Figure 36). Intriguingly, TTN2MNi cells proliferated faster than TTM cells even in basal glucose levels, suggesting an intrinsic proliferative advantage possibly as a result of faster cell cycle, and other sought- after characteristic of cells for bioprocessing applications. These results indicate that TTN2MNi hiPSCs are more suitable for suspension culture bioprocessing in a simple, inexpensive media. Simplified gene editing strategy involving a single genomic safe harbor After constructing the TTN2MNi circuit through sequential integration into three distinct genomic safe harbors—a strategy chosen to maximize design flexibility (Figures 37- - 44 - SIB BW1353R 43)—we aimed to streamline the approach to enable more straightforward implementation across different PSC lines. For this reason, we developed genome editing strategies that rely on a single genomic safe harbor. As an example we selected the CLYBL locus, which can be safely targeted since knockout of this gene in humans does not cause any disease; moreover, this gene and the surrounding genomic context (synteny) are strongly conserved across mammals such as pigs and cows. First, we developed a two in one vector (Figure 44), which encodes both a constitutive CAG-Tet-On 3G cassette and a dox-inducible TRE-MYOD1 construct including an intronic miRNA against NANOG. We also added a UCOE (Ubiquitous Chromatin Opening Element) before the TRE to promote its activity and prevent silencing. This plasmid is used in combination with the established vector carrying the constitutive CAG- NANOG transgene (pCLYBL-Neo_CAG-NANOG_2A_mCherry; Figure 38), to generate a combined heterozygous where each construct is integrated on one of the two alleles of the CLYBL locus. Secondly, we developed a three in one vector (Figure 45), which uses a bidirectional CAG to constitutively co-express Tet-On 3G and NANOG on opposite DNA strands, while also encoding the dox-inducible UCOE-TRE-MYOD1 plus intronic anti-NANOG miRNA cassette. This plasmid can be integrated in one or both CLYBL alleles, with homozygous targeting maximizing copy number of each element of the genetic circuit. Conclusions We demonstrated that constitutive overexpression of master pluripotency factor NANOG supports hiPSC proliferation and self-renewal in the absence of TGFβ signaling; this state can be switched off and cells can be induced to differentiate at will into muscle thanks to the activation of a specific artificial microRNA and the master differentiation factor MYOD1. Crucially, the approach scales to suspension cultures. This demonstrates the general principle that can be applied to create cells that can drastically reduce the costs linked to PSCs scale-up and subsequent differentiation into a variety of adult cell types. This technology can tremendously impact different applications, spanning from the generation of patient-specific and disease-specific in vitro models to the cultivated meat industry. Materials and Methods hPSC culture Healthy male hiPSCs with a TTN-mEGFP knock-in reporter (Allen Institute for Cell Science #AICS-0048 cl.39) were cultured on hESC-qualified Geltrex-coating using - 45 - SIB BW1353R Essential 8 (both from Gibco). Cells were passaged every 4-5 days as small clumps after treatment with 0.5mM EDTA in PBS (without calcium and magnesium). For TGFβ independency assays, hiPSCs were cultured in Essential 6 (Gibco) supplemented only with 100 ng / mL FGF2-145aa (Qkine Qk040) – E6F, and compared with the same media also supplemented with 2 ng / mL TGFβ1 (Qkine Qk010) – E6FT. TGFβ inhibition was performed in E6F supplemented with 10 µM SB-431542 – E6FSB. Plasmids Unless stated otherwise, cut and paste cloning was performed using restriction enzymes from NEB / ThermoScientific and T4 DNA ligase from ThermoScientific, while Gibson cloning was performed using NEBuilder HiFi DNA Assembly Master Mix (NEB). Blunt ending was done with Fast DNA End Repair Kit (Thermo Scientific). PCR was performed using Q5 Hot Start High-Fidelity DNA Polymerase (NEB). Vectors were dephosphorylated before ligation using Fast Alkaline Phosphatase (Thermo Scientific). All oligonucleotides were ordered from Eurofins Genomics as desalted lyophilized products. QIAEX II Gel Extraction Kit (QIAGEN) was used for DNA extraction from agarose gels, and Nucleospin Gel and PCR Clean-up (MACHERY-NAGEL) for purification of PCR products. Recombinant plasmids were transformed into chemically competent E. Coli. QIAGEN Plasmid Miniprep, Midiprep, and Maxiprep Kits were used for plasmid preparations (using endotoxin free protocols for plasmids to be used for genome editing). All these procedures were performed according to the manufacturer’s instructions. Additional molecular biology procedures, such as electrophoresis and E. Coli culture, were performed according to standard protocols. All the plasmids were fully sequence-verified by Plasmidsaurus. hROSA26 locus gRNA / Cas9n expression plasmids pSpCas9n(BB)_R26-L and pSpCas9n(BB)_R26-R were previously described (Bertero et al., 2016). AAVS1 locus ZFN expression plasmids and CLYBL locus TALEN expression plasmids were obtained from Addgene (#159297, #159298, # 62196 and #62197). pR26-Bst_CAG-Tet-On-3G (Figure 37) was generated starting by replacing the EGFPd2 cDNA of pR26-Bst_CAG-EGFPd2 with a synthetic Tet-On® 3G cDNA fragment using MluI and BamHI. pCLYBL-Neo_CAG-NANOG_2A_mCherry (Figure 38) was generated by cloning two synthetic fragments in pC13N-iCAG.copGFP (Addgene #66578) cut with BsrGI and MluI: (1) a BsrGI and BamHI-cut fragment encoding for human NANOG cDNA (RefSeq NM_024865.4) but containing silent point mutations to eliminate potential m6A sites and (2) a BsrGI and MluI-cut fragment encoding T2A-P2A-mCherry. - 46 - SIB BW1353R pAAV-Puro_TRE-EGFP and pAAV-Puro_TRE-MYOD1 (Figure 40) were synthetized based on the published sequences of pAAV_TRE-EGFP and pAAV_TRE-MYOD1 pAAV-Puro_TRE-EGFP-(miR-E) (Figure 39) was generated by cloining a miR-E cassette from LT11GFP_Ren.713 (a kind gift of Johannes Zuber) in the 3’ UTR of EGFP in pAAV-Puro_TRE-EGFP. miR-E was amplified as two fragments to insert paired AarI restriction sites for subsequent cloning of seed sequence hairpins (SEQ ID NO. 84: fragment 1: 5’- CATGGACGAGCTGTACAAGTAAGCGTACGGCGGCCGCCTC-3’ and SEQ ID NO: 855’-CAGGTGAGTCAGTCCACCTGCACCACGCTCACTGCCAACAGC- 3’; SEQ ID NO: 86 fragment 2: 5’- CAGGTGGACTGACTCACCTGCACCTTGCCTACTGCCTCGG-3’ and SEQ ID NO.87: 5’-GATTATGATCCTCTAGAGATATCAATTACGCGTCAATTGATGCATTC-3’). pAAV- Puro_TRE-EGFP was cut with EcoRI and EcoRV, and the three fragments were Gibson assembled. Seed sequence hairpins were synthetized as complementary pairs of single stranded oligonucleotides (Table 1), annealed, phosphorylated, and ligated into AarI-cut pAAV- Puro_TRE-EGFP-(miR-E) , all according to our published protocol. Table 1. Oligonucleotides for miRNA cloning. - 47 - SIB BW1353R pAAV-Puro_TRE-MYOD1-(miR-E-NANOG) (Figure 41) was obtained by inserting miR- E-NANOG from pAAV-Puro_TRE EGFP-(miR-E-NANOG) in pAAV-Puro_TRE-MYOD1 using EcoRV and EcoRI. pAAV-Puro_TRE-(intron-miR-E-NANOG)-MYOD1 (Figure 42) was obtained in three steps: (1) insertion of BssHI and PacI-digested and blunt-ended chimeric intron from pAAV-Puro_siKO ( Addgene # 86696) in SpeI-cut pAAV-Puro_TRE-MYOD1; (2) insertion of EcoRV and NotI-digested and blunt-ended miR-E from pAAV-Puro_TRE- EGFP-(miR-E) in MreI-cut plasmid from step 1; and (3) insertion of NANOG seed sequence in AarI-cut plasmid from step 2 according to the procedure described above. pAAV-Puro_TREbi-EGFP-(miR-E-NANOG)_MYOD1 (Figure 43) was obtained by Gibson assembly of two fragments in SpeI and PspXI-cut pAAV-Puro_TRE-MYOD1: (1) PCR-amplified EGFP and miR-E-NANOG cassette from pAAV-Puro_TRE-EGFP-(miR- E-NANOG) (SEQ ID NO. 9: fw: 5’- GTGAACCGTCAGATCGCCTAGTGCCACCATGGTGAGCAAGG-3’; SEQ ID NO. 10: rev: 5’-GTGGGCTCTATGGTCACTCGAATGCATTCAGCTTTG-3’); (2) PCR-amplified bi-directional TRE3G promoter from Ptre3G-bi-α-chain (Addgene # 133730) (SEQ ID NO.11: fw: 5’-CCTTGCTCACCATGGTGGCACTAGGCGATCTGACGGTTCAC-3’; SEQ ID NO.12: rev: 5’- ACAGTAGCTCCATGGTGGCACTAGTTTACGAGGGTAGGAAG-3’). pCLYBL-Puro_CAG_Tet-On-3G_TRE-(intron-miR-E-NANOG)-MYOD1 (Figure 44) was obtained in two steps: (1) amplification of plasmid backbone, CLYBL homology arms and UCOE from CLYBL hOMP (Addgene #112499) and insertion of TRE-(intron-miR-E- NANOG)-MYOD1 from plasmid pAAV-Puro_TRE-(intron-miR-E-NANOG)-MYOD1 digested with PsPxI and SpeI; (2) digestion of the intermediate vector with SwaI followed by blunt ligation of SpeI and SalI restriction fragment,Tet-On 3G, from plasmid pR26- Bst_CAG-Tet-On-3G. pCLYBL-Puro_CAGbi-NANOG-Tet-On-3G_TRE-(intron-miR-E-NANOG)-MYOD1 (Figure 45) was obtained in two steps: (1) Gibson Assembly of four fragments in SalI and MluI-cut MSX_BidirectionalCAG (Addgene # 78175): (1.1) PCR-amplified NANOG cDNA from pCLYBL-Neo_CAG-NANOG_2A_mCherry; (1.2) PCR-amplified beta globin Poly(A) from pCLYBL-Neo_CAG-NANOG_2A_mCherry; (1.3) PCR-amplified plasmid backbone, CLYBL homology harms, and UCOE fragment from CLYBL hOMP (Addgene #112499): (1.4) PCR-amplified Tet-On 3G from pR26-Bst_CAG-Tet-On-3G; (2) digestion of the intermediate plasmid with KpnI and blunt ligation of PsPxI and AflII restriction fragment, TRE-(intron-miR-E-NANOG)-MYOD1, from pAAV-Puro_TRE- (intron-miR-E-NANOG)-MYOD1. - 48 - SIB BW1353R Gene editing Targeting of the hROSA26 (Irion et al.2007) and AAVS1 (Hockemeyer et al.2009) loci was performed by lipofection. hiPSCs were passaged in 6-well plates at a density of 200,000 cells / well and transfected 24 h after seeding. Transfection was performed for 4 hours in Opti-MEM (Gibco) supplemented with Lipofectamine Stem Transfection Reagent (2 µl / well, ThermoScientific) and a total of 2 µg of DNA (a ratio 2:1:1 of targeting vector and the two locus-specific nucleases). After ~3 days, genome-edited hPSCs were selected for ~4 days by adding 4 µg / mL Blasticidin S (Sigma-Aldrich) or 1 µg / mL Puromycin Dihydrochloride (Gibco), for hROSA26 and AAVS1 targeting, respectively. Targeting of the CLYBL locus15was done by nucleofection. hiPSCs were single cell dissociated using StemPro Accutase (Gibco), and 1 x 106cells were nucleofected (100 µl reaction volume; 10 µg of total DNA, with a ratio 2:1:1 for the targeting vector and the two nucleases) using the Lonza P3 Primary Cell 4D-Nucleofector X kit and program CA137 of the Lonza 4D-Nucleofector System. Nucleofected cells were placed in recovery media composed of Essential 8 plus CEPT cocktail [polyamine supplement (Sigma-Aldrich), 50 nM Chroman 1 (Medchem biochem), 5 µM Emricasan (Sigma- Aldrich), and 0.7 uM trans-ISRBB (Sigma-Aldrich); (Chen, Y., Tristan, C.A., Chen, L. et al 2021)}, and replated in a 24-well plate.24 h post nuclefection, recovery medium was changed to Essential 8. At ~70% confluency, cells were passaged in a 10 cm petri dish, grown for ~3 days, and selected for ~5 days with 50 µg / mL Geneticin (Gibco). Genotyping Individual pseudo-clones were manually picked, expanded, and analyzed by genotyping (Table 2). Briefly, hPSC clones were screened by genomic PCR to verify site-specific on-target integration of the genetic cassette and to detect random integrations of the targeting plasmid elsewhere in the genome. Site-specific cassette integration (INT) is detected by 5’INT and 3’INT PCRs. For this purpose, one primer is located on the cassette 5’ or 3’ end while the second primer maps to the genomic locus outside of the homology arm. Wild type (WT) PCR is then performed using the two primers mapping to the genomic locus outside of the homology arms to determine if only one or both two alleles have been edited (PCR fails for alleles containing large cassettes, particularly those containing the GC-rich CAG promoter used in most of our targeting plasmids). For monitoring possible off-target random integration, two additional backbone (BB) PCRs are performed: 5’BB and 3’BB PCRs. For BB PCRs a primer is specific to the cassette and the second primer located on the plasmid backbone outside of the homology arms. - 49 - SIB BW1353R Upon successful HDR only the homology arms are be incorporated in the GSH, while the rest of the plasmid backbone is be lost; therefore, BB PCRs reveal other events of random integration of the linearized plasmid. PCRs were performed with LongAmp Taq DNA Polymerase (New England Biolabs, Ref#BM0323L), according to manufacturer instructions. All the primers combinations are listed in Table 2. Table 2 – Genotyping primers - 50 - SIB BW1353R Skeletal myocyte forward programming hiPSCs expressing Tet-On 3G and inducible MYOD1 were single-cell dissociated with SemPro Accutase (Gibco) and plated onto hESC-qualified Geltrex-coated dishes at a density of 200,000 cells per well of a 12-well plate. Unless stated otherwise, the induction was performed in DMEM high Glucose supplemented with GlutaMAX (Gibco), 1X insulin- transferrin-selenium (ITS-G, Gibco), 40 ng / mL FGF2-145aa (Qkine), 1 µM retinoic acid (Sigma-Aldrich), 3 µM CHIR99021 (Cayman Chemicals), and 1 µg / mL doxycycline hyclate (Sigma-Aldrich). Induction was started 24 h after seeding, and media was replaced every day. Suspension culture expansion and differentiation Human pluripotent stem cells (hPSCs) were expanded in suspension culture using 125 mL Erlenmeyer flasks containing 20 mL of in-house hE7 medium, seeded at an initial density of 150,000–300,000 cells / mL and maintained on an orbital shaker at 70 rpm (37°C, 5% CO₂). Cells were passaged every 4-5 days as small clumps after treatment with 0.5 mM EDTA in PBS (without calcium and magnesium) and incubation at 37°C for 10 minutes, with gentle pipetting every 5 minutes, followed by neutralization with DMEM / F12, centrifugation (100 g, 5 min) in conical tubes, and resuspension in fresh hE7 medium supplemented with Thiazovivin for immediate re-seeding. Thiazovivin was removed 24 hours post-splitting via complete medium exchange. For differentiation, cells were cultured for 3 days post-expansion before transitioning to differentiation media under continuous orbital agitation (70 rpm). Quantitative real-time PCR (qRT-PCR) Total RNA was extracted using Quick RNA extraction kit (Zymo), and cDNA synthesis was performed with High Capacity cDNA Reverse Transcription Kit (Invitrogen). PowerUp qPCR mix was used for qRT-PCR using 10 ng of cDNA and 0.3 µM of each primer (Table 3). Samples were run on the Applied Biosystems QuantStudio ™ 6 Flex Real-Time PCR System machine. All samples were analyzed in technical duplicates and - 51 - SIB BW1353R normalized to the housekeeping genes HPRT or RPLP1. Results were analyzed with the ΔΔCt method. Table 3. List of primers for quantitative PCR Flow cytometry For analysis of EGFP expression, cells were single cell dissociated with 0.5% trypsin at 37°C, washed with PBS, incubated 10 min at room temperature in PBS supplemented with fixable viability dye EF450 (Invitrogen), incubated, and washed twice in FACS Buffer (5% FBS in PBS). Cells were analyzed using BD FACSVerse™ Cell Analyzer to determine the levels of EGFP expression of viable cells (EF450 negative). EGFP levels in non-induced (not dox-treated) cells were indistinguishable from wildtype cells and served as negative control. FITC (EGFP) acquisition settings were set to enable plotting of the highest levels of EGFP expression. - 52 - SIB BW1353R For analysis of NANOG and OCT4 expression, cells where single cell dissociated with TrypLE Select (Gibco), washed with PBS, stained with viability dye EF450 as described above, and fixed with 4% PFA in PBS. Cells were permeabilized with PBS supplemented with 0.1% Triton X-100 for 30 min and stained for 1 h at room temperature with APC- conjugated and PE-conjugated antibodies for NANOG and OCT4 (BD #561300 used 1:50 and #560186 used 1:15, respectively), resuspended in FACS Buffer with 0.75% Saponin (Sigma-Aldrich). Cells were washed three times with FACS Buffer with 0.75% Saponin, resuspended in FACS Buffer, and analyzed using BD FACSVerse™ Cell Analyzer. All samples analyzed through this method were also separately stained with isotype control antibodies that served as negative control for gating purposes. Flow cytometry data analysis was performed with FlowJo (v10). Immunocytochemistry Cells were fixed for 20 min at room temperature in 4% PFA in PBS, washed three times with PBS, permeabilized for 20 minutes at room temperature with 0.1% Triton X-100 in PBS, washed once with PBS, and blocked for 1 h at room temperature with PBS 5% BSA. Cells were washed and stained at 4°C overnight with the primary antibody diluted in PBS 1% BSA. After three washes with PBS, cells were incubated for 1 hour at room temperature with corresponding species-specific fluorophore-conjugated secondary antibodies in 1% PBS BSA. Nuclei were visualized with 4',6-diamidino-2-phenylindole (DAPI, ThermoScientific). mEGFP, mCherry, and immunostainings were imaged using a Zeiss Apotome microscope (Leica). Bulk RNA sequencing Samples were prepared with TruSeq® Stranded mRNA Library Prep (20020594) and IDT for Illumina – TruSeq RNA UD Indexes (20020591) Illumina® Stranded mRNA Prep, according to the manufacturer’s instructions. The sequencing was performed on a NextSeq 1000 (Illumina, T7 flow cell PE100 V3 G400) with 100 cycles in paired-end. Raw reads were demultiplexed with the bcl2fastq Conversion Software v1.8.4 and then processed with the following pipeline: https: / / github.com / sara- bianchi / Bulk_RNA_seq_pipeline, in the complete version with all the steps set to TRUE. The trimming step was performed in paired-end mode, first to remove the adapter (SEQ ID NO.88: CTGTCTCTTATACACATCT), and then an additional removal of 5 bases at 5’ and 1 at 3’ was carried out to remove artifacts of the library. The alignment was performed with a custom genome generated with the addition of the exogenous sequences of Tet-On 3G, - 53 - SIB BW1353R NANOG, and MYOD1 with the cat command to both the reference GTF and FASTA files (ENSEMBL, version GRCh38.112). Batch correction was set to FALSE and the significance thresholds were set to 0.05 for the adjusted p-value and 2 for the logarithmic fold change. The Principal Component Analysis (PCA) was performed considering the 1000 most variable genes after the VST (Variance Stabilizing Transformation) normalization, which was carried out with the vst function of the DeSEQ2 R package. The dimensionality reduction was then computed with the plot_pca function of the RNAseqQC R package and the results were plotted using the ggplot2 library. Filtered raw counts were used for the differential gene expression analysis which was performed with the linear fitting model implemented in the limma R package. Genes were ranked by the resulting logarithmic fold change of the comparison of each pair of samples, and the subsequent GSEA (Gene Set Enrichment Analysis) was run with the gseGO function of the ClusterProfiler R package setting ontology to BP. The results were plotted with the gseaplot function of the enrichplot library. Single cell RNA sequencing Single cell suspensions were obtained using TrypLE (Gibco) for 5 minutes followed by four washes with PBS 1% BSA in PBS.1.5 x 106cells for each sample were labelled using cell multiplexing oligos (CMOs) using the 3’ CellPlex Kit set A (10X Genomics) following the manufacturer’s instructions. Cells were manually counted, pooled at equal amounts, and 26.000 cells were analyzed in a single reaction of Chromium Next GEM Single Cell 3ʹ GEM Kit v3.1 and a Chromium X microfluidics controller from 10X Genomics, all following the manufacturer’s instructions. The NGS library was paired-end sequenced on an Illumina NextSeq 1000 using P2 reagents (100 cycles). CMO libraries were loaded at 1:6 molar ratio to the gene expression libraries, resulting in ~57 M reads for CMOs and ~343M reads for gene expression libraries. Analyses were performed using CellRanger v7.0 and Loupe Browser (10X Genomics). 3D engineered muscle tissues (3D EMTs) For preparation of 3D EMTs, TTN2MN hiPSCs were seeded and cultivated as described in the “skeletal myocyte forward programming” section, harvested at day 6 of induction, and casted in 3D EMTs using the Mantarray system (Curi Bio), following the manufacturer’s protocol for tissue casting with myoblasts and fibroblasts. Briefly, casting plates were prepared by preparing thrombin (Sigma T4648, 100 U / mL) in DMEM medium, adding 3 µl of Thrombin in 47 µl DMEM per well, which was placed in prechilled wells and kept in the refrigerator for a maximum of 3 hours. For each EHT, 675,000 - 54 - SIB BW1353R myoblasts and 75,000 fibroblasts were detached and mixed in myogenic induction medium supplemented 2 g / L 6-aminocaproic acid (Sigma A2504), 33% Matrigel (Corning 356231). The cell suspension was then supplemented with 10 µl fibrinogen (Sigma F8630, 50 mg / mL), placed in thrombin-containing wells, and mixed by pipetting. Seeded cells were then transferred to the incubator for 80 minutes at 37°C to enable gelification. Silicon posts were then lifted and carefully transferred to a 24-well plate containing myogenic induction medium supplemented with 2 g / L aminocaproic acid. Medium was then changed every other day. Contractile measurements were taken at the end of the differentiation, measuring total force with a biphasic pulse program: briefly, tissues where stimulated in two phases, with phase 1 involving a stimulus of 5 milliseconds with a current of 100 mA, followed by a phase 2 involving a stimulus of 5 milliseconds with a current of -100 mA. Pulse frequency increased every cycle by 1 Hz, going from 1-30Hz. Crystal Violet Staining Cells were seeded into a 96 well plate at a density of 2,500 cells / well, in triplicate for every condition, and grown in hE8 (supplemented with TGFβ) or hE7 media (Figure 31, minus doxycycline) supplemented with varying glucose concentrations. Media was refreshed daily, and at 24 h, 48 h, and 72 h after seeding, cells were washed with PBS and fixed in 50 µl of 4% PFA in PBS for 10 minutes at RT. Samples were then washed once and stained with 0.5% crystal violet staining solution (Sigma 32675) for 20 min at room temperature under gentle rocking. Samples were then washed five times with PBS to eliminate excess dye. After drying for at least 2h, the dye was dissolved with 200 µl of a solution of 10% acetic acid 30 minutes under gentle rocking. Optical density was measured at 600 nm with GloMax (Promega). Plasmid Maps and FASTA sequences SEQ ID NO.57: pR26-Bst_CAG-Tet-On-3G FASTA: TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGA CGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCG CGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGC AGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAG GAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAA GGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGT GCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTA AAACGACGGCCAGTGAATTGGCTCGAAACCGGACGGAGCCATTGCTCTCGCAGA - 55 - SIB BW1353R GGGAGGAGCGCTTCCGGCTAGCCTCTTGTCGCCGATTGGCCGTTTCTCCTCCCG CCGTGTGTGAAAACACAAATGGCGTATTCTGGTTGGAGTAAAGCTCCTGTCAGTT ACGCCGTCGGGAGTACGCAGCCGCTTAGCGACTCTCGCGTTGCCCCCTGGGTGG GGCGGGTAGGTAGGTGGGGTGTAGAGATGCTGGGTGTGCGGGCGCGGCCGGC CTCCTGCGGCGGGAGGGGAGGGTCAGTGAAATCGGCTCTGGCGCGGGCGTCCT CCCACCCTCCCCTTCCTTCGGGGGAGTCGGTTTACCCGCCGCCTGCTTGTCTTCG ACACCTGATTGGCTGTCGAAGCTGTGGGACCGGGCCCTTGCTACTGGCTCGAGT CTCACATGAGCGAAACCACTGCGCGGGGCGCGGGGGTGGCGGGGAGGCGGGC GTTGGTACGGTCCTCCCCGAGGCCGAGCGCCGCAGTGTCTGGCCCCGCGCCCC TGCGCAACGTGGCAGGAAGCGCGCGCTGGAGGCGGGGGCGGGCTGCCGGCCG AGACTTCTGGATGGCGGCGGCCGCGGCTCCGCCCCGGGTTCCCACCGCCTGAA GGGCGAGACAAGCCCGACCTGCTACAGGCACTCGTGGGGGTGGGGGAGGAGCG GGGGTCGGTCCGGCTGGTTTGTGGGTGGGAGGCGCTTGTTCTCCAAAAACCGGC GCGAGCTGCAATCCTGAGGGAGCTGCGGTGGAGGAGGTGGAGAGAAGGCCGCA CCCTTCTGGGCAGGGGGAGGGGAGTGCCGCAATACCTTTATGGGAGTTCTCTGC TGCCTCCCGTCTTGTAAGGACCGCCCTGGGCCTGGAAGAAGCCCTCCCTCCTTTC CTCCTCGCGTGATCGGTACCTAGGGCGCAGTAGTCCAGGGTTTCCTTGATGATGT CATACTTATCCTGTCCCTTTTTTTTCCACAGCTCGCGGTTGAGGACAAACTCTTCG CGGTCTTTCCAGTTTCGAACGGGAGATCTGCCACCATGGCCAAGCCTTTGTCTCA AGAAGAATCCACCCTCATTGAAAGAGCAACGGCTACAATCAACAGCATCCCCATC TCTGAAGACTACAGCGTCGCCAGCGCAGCTCTCTCTAGCGACGGCCGCATCTTCA CTGGTGTCAATGTATATCATTTTACTGGGGGACCTTGTGCAGAACTCGTGGTGCT GGGCACTGCTGCTGCTGCGGCAGCTGGCAACCTGACTTGTATCGTCGCGATCGG AAATGAGAACAGGGGCATCTTGAGCCCCTGCGGACGGTGCCGACAGGTGCTTCT CGATCTGCATCCTGGGATCAAAGCCATAGTGAAGGACAGTGATGGACAGCCGAC GGCAGTTGGGATTCGTGAATTGCTGCCCTCTGGTTATGTGTGGGAGGGCTAAGG GGATCAATTCTCTAGCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCAT CTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCAC TGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATT CTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGAC AATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGA ACCAGCTGGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCC ATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCG CCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGC CAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCA CTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATG - 56 - SIB BW1353R ACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCC TACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCC CCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTAT TTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGC GCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGA GAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGG CGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGG GAGTCGCTGCGACGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCG CCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGG ACGGCCCTTCTCCTCCGGGCTGTAATTAGCGCTTGGTTTAATGACGGCTTGTTTCT TTTCTGTGGCTGCGTGAAAGCCTTGAGGGGCTCCGGGAGGGCCCTTTGTGCGGG GGGAGCGGCTCGGGGGGTGCGTGCGTGTGTGTGTGCGTGGGGAGCGCCGCGT GCGGCTCCGCGCTGCCCGGCGGCTGTGAGCGCTGCGGGCGCGGCGCGGGGCT TTGTGCGCTCCGCAGTGTGCGCGAGGGGAGCGCGGCCGGGGGCGGTGCCCCG CGGTGCGGGGGGGGCTGCGAGGGGAACAAAGGCTGCGTGCGGGGTGTGTGCG TGGGGGGGTGAGCAGGGGGTGTGGGCGCGTCGGTCGGGCTGCAACCCCCCCT GCACCCCCCTCCCCGAGTTGCTGAGCACGGCCCGGCTTCGGGTGCGGGGCTCC GTACGGGGCGTGGCGCGGGGCTCGCCGTGCCGGGCGGGGGGTGGCGGCAGGT GGGGGTGCCGGGCGGGGCGGGGCCGCCTCGGGCCGGGGAGGGCTCGGGGGA GGGGCGCGGCGGCCCCCGGAGCGCCGGCGGCTGTCGAGGCGCGGCGAGCCG CAGCCATTGCCTTTTATGGTAATCGTGCGAGAGGGCGCAGGGACTTCCTTTGTCC CAAATCTGTGCGGAGCCGAAATCTGGGAGGCGCCGCCGCACCCCCTCTAGCGG GCGCGGGGCGAAGCGGTGCGGCGCCGGCAGGAAGGAAATGGGCGGGGAGGGC CTTCGTGCGTCGCCGCGCCGCCGTCCCCTTCTCCCTCTCCAGCCTCGGGGCTGT CCGCGGGGGGACGGCTGCCTTCGGGGGGGACGGGGCAGGGCGGGGTTCGGCT TCTGGCGTGTGACCGGCGGCTCTAGAGCCTCTGCTAACCATGTTCATGCCTTCTT CTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTATTGTGCTGTCTCATCATTTTG GCAAAGAATTAATTCGGATCCACCATGTCTAGACTGGACAAGAGCAAAGTCATAAA CTCTGCTCTGGAATTACTCAATGGAGTCGGTATCGAAGGCCTGACGACAAGGAAA CTCGCTCAAAAGCTGGGAGTTGAGCAGCCTACCCTGTACTGGCACGTGAAGAACA AGCGGGCCCTGCTCGATGCCCTGCCAATCGAGATGCTGGACAGGCATCATACCC ACTCCTGCCCCCTGGAAGGCGAGTCATGGCAAGACTTTCTGCGGAACAACGCCA AGTCATACCGCTGTGCTCTCCTCTCACATCGCGACGGGGCTAAAGTGCATCTCGG CACCCGCCCAACAGAGAAACAGTACGAAACCCTGGAAAATCAGCTCGCGTTCCTG TGTCAGCAAGGCTTCTCCCTGGAGAACGCACTGTACGCTCTGTCCGCCGTGGGC CACTTTACACTGGGCTGCGTATTGGAGGAACAGGAGCATCAAGTAGCAAAAGAGG - 57 - SIB BW1353R AAAGAGAGACACCTACCACCGATTCTATGCCCCCACTTCTGAAACAAGCAATTGA GCTGTTCGACCGGCAGGGAGCCGAACCTGCCTTCCTTTTCGGCCTGGAACTAATC ATATGTGGCCTGGAGAAACAGCTAAAGTGCGAAAGCGGCGGGCCGACCGACGCC CTTGACGATTTTGACTTAGACATGCTCCCAGCCGATGCCCTTGACGACTTTGACCT TGATATGCTGCCTGCTGACGCTCTTGACGATTTTGACCTTGACATGCTCCCCGGG TAAACGCGTAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCT GTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTG TCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCT ATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGAGAA TAGCAGGCATGCTGGGGGTCGACGCTTCTCGATTATGGGCGGGATTCTTTTGCCT AGGCTTAAGGGGCTAACTTGGTCCCTGGGCGTTGCCCTGCAGGGGAGTGAGCAG CTGTAAGATTTGAGGGGCGACTCCGATTAGTTTATCTTCCCACGGACTAGAGTTG GTGTCGAGGTTATTGTAATAAGGGTGGGGTAGGGAAATGGAGCTTAGTCATTCAC CTGGGGCTGATTTTATGCAACGAGACTGCGGATTATCACTACTTATCATTTTTGGA GCATTTTTCTAGAGACAGACATAAAGCATGATCACCTGAGTTTTATACCATTTGAG ACCCTTGCTGCACCACCAAAGTGTAGCATCAGGTTAAATCTTAATAGAAAAATTTT AGCTTTTGCTTGAGAAACCAGTGCTTCCCTCCCTCACCCTCTCTCCCCAGGCTCT CTACCCCTTTGCATCCCTACCAGGCATCTTAGCAACTCTCACTCATACTTGATCCC ATTTTCCATTTGTTGTACTTGCTCCTCTAGTATTCAGACATAGCACTAGCTTTCTCC CTCTCTTGATCTTGGGTAGCCTGGTGTCTCGCGAAACCAGACAGATTGGTTCCAC CACAAATTAAGGCTTGAGCTGGGGCTTGACTCTTACCCAGCAGTGCTTTTATTCCT CCCTAGTTCACGTTCTTAAATGTTTATCTTGATTTTCATTTTATCCTTTTTCCTTAGC TGGGATTCTGTCCCTGACCGTCTTCACAGTCCAGGTGATCTTGACTACTGCTTTAC AGAGAATTGGATCTGAGGTTAGGCAACATCTCCCTTTTTCTTCCTCTAAATACCTC TCATTTCTGTTCTTACCAGTTAGTAACTGATCTCAGATGCCTGTGTGATAGCTTCCA AGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCAC AATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAA TGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGG GAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCG GTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGT CGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATC CACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAA GGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCC CCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGAC AGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCT GTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCG - 58 - SIB BW1353R TGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCG CTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTT ATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTG GCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACA GAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTAT CTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCC GGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTA CGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGA CGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAA GGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTAT ATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCT CAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATA ACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGA GACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGG GCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATT GTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGT TGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTC AGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAA AAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGT GTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCG TAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGT ATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCA CATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACT CTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCC AACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGG AAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTC ATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGC GGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATT TCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCT ATAAAAATAGGCGTATCACGAGGCCCTTTCGTC SEQ ID NO.58: pCLYBL-Neo_CAG-NANOG_2A_mCherry FASTA: TGCAGCTCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAAT ATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTT ATGAGCCATATTCAACGGGAAACGTCGAGGCCGCGATTAAATTCCAACATGGATG - 59 - SIB BW1353R CTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGAC AATCTATCGCTTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGC AAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGA CGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCA TGGTTACTCACCACTGCGATCCCCGGAAAAACAGCATTCCAGGTATTAGAAGAAT ATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTT GCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCG CTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGA CGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTG CCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATT TTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAG ACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCA TTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTG CAGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGAATTGGTTAATTGGTTGTAA CATTATTCAGATTGGGCTTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGT GAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCA CTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTC TGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTG TTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGA GCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAA GAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCT GCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTAC CGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGC TTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAA GCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGG GTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTT TATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTC GTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTT CCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATT CTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCG AACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATAC GCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACA GGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCT CACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTG GAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGC CGCGGCCGCAGCAGGAGAATCATGCCAATGGGCCAATATACATTCTGACCCACA - 60 - SIB BW1353R GTTTCATAATAAAATAAAATGGTTGTGGTTGTAAGCCACTATGTTTCAGAGTGGTTT GTTACACAGCAATAAATAACTAATATAGTAGGCATACCATCAAGTCCAAAGTAGGT AGAGAAGAATGTAAATAGCAGAGCAAAACAGCATGACTGGTGGCTGGGAGGCTTA AAACTGGGACAGGATCAGAGTCATGAAAGAAGTCAAAGAAATGGTTCAGAAGTAA GGCTGAGACTGACTTACAAAAGCTGAAAGTCCCTTTAAGTTGGTGTTTGGTGCATT GGCAGGGGCAGGTATGGTGACTTAAAAGAGCCATGCTCAACAAGATCAAGCACAA CACAATCACGGGTCACCCCAGCAGACCTTAGCGAGTCTAGCCATTTCTTTGGTGG TGGTCACAGTCATGCTTCAGCCCAGTTTCCACTTGGACAAATGGTACATATTTTCA ATGAGATGAAAATTAAGATACAATCCATGTGCTCAGAGAGTGATCACAGCTCTGAC TAAACACTGTGCCCCAAAGTGTTGAGGAATTGGGAAAACCTAGCTGAGTTAGTGG TCTCTTTTCTGTTACAATAAAGCTCATAATGAAAATTAGCCTTCTTTGTTCTTCCCC AAGTCTTTCTTTCTAGACGAAACTACTTTCAACTGTTTTAACTTCCTTACTGTTAACT TCCATATTTCTAGATAGTATGGTCAGACTGTTATTTCTTGACTTTTAAATGTAAGAT ATTATCTACTGACTTCCTTCTATGTAAGATGAGGATTGAGCTCTCTTACCCTTCTCC CAGCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCTGACCTCTTCT CTTCCTCCCACAGGGCCTCGAGAGATCTGGCAGCGGAGAGGGCAGAGGAAGTCT TCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCTAGGATTGAACAAGATGG ATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTG GGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCA GGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACT GCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCG CAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCG AAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATC CATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCC ATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGC CGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGC CGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGT GACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCT GGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCG TTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTC CTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCC TTCTTGACGAGTTCTTCTAACACCTGGTGCATGACCCGCAAGCCCGGTGCCTGAC TGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGA CCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATC GCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAG CAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCT - 61 - SIB BW1353R CTATGGATAACTTCGTATAGCATACATTATACGAAGTTATGAGCTCACGGGGACAG CCCCCCCCCAAAGCCCCCAGGGATGTAATTACGTCCCTCCCCCGCTAGGGGGCA GCAGCGAGCCGCCCGGGGCTCCGCTCCGGTCCGGCGCTCCCCCCGCATCCCCG AGCCGGCAGCGTGCGGGGACAGCCCGGGCACGGGGAAGGTGGCACGGGATCG CTTTCCTCTGAACGCTTCTCGCTGCTCTTTGAGCCTGCAGACACCTGGGGGGATA CGGGGAAAAAGCTTTAGGCTGAAAGAGAGATTTAGAATGACAGAATCATAGAACG GCCTGGGTTGCAAAGGAGCACAGTGCTCATCCAGATCCAACCCCCTGCTATGTGC AGGGTCATCAACCAGCAGCCCAGGCTGCCCAGAGCCACATCCAGCCTGGCCTTG AATGCCTGCAGGGATGGGGCATCCACAGCCTCCTTGGGCAACCTGTTCAGTGCG TCACCACCCTCTGGGGGAAAAACTGCCTCCTCATATCCAACCCAAACCTCCCCTG TCTCAGTGTAAAGCCATTCCCCCTTGTCCTATCAAGGGGGAGTTTGCTGTGACATT GTTGGTCTGGGGTGACACATGTTTGCCAATTCAGTGCATCACGGAGAGGCAGATC TTGGGGATAAGGAAGTGCAGGACAGCATGGACGTGGGACATGCAGGTGTTGAGG GCTCTGGGACACTCTCCAAGTCACAGCGTTCAGAACAGCCTTAAGGATAAGAAGA TAGGATAGAAGGACAAAGAGCAAGTTAAAACCCAGCATGGAGAGGAGCACAAAAA GGCCACAGACACTGCTGGTCCCTGTGTCTGAGCCTGCATGTTTGATGGTGTCTGG ATGCAAGCAGAAGGGGTGGAAGAGCTTGCCTGGAGAGATACAGCTGGGTCAGTA GGACTGGGACAGGCAGCTGGAGAATTGCCATGTAGATGTTCATACAATCGTCAAA TCATGAAGGCTGGAAAAGCCCTCCAAGATCCCCAAGACCAACCCCAACCCACCCA CCGTGCCCACTGGCCATGTCCCTCAGTGCCACATCCCCACAGTTCTTCATCACCT CCAGGGACGGTGACCCCCCCACCTCCGTGGGCAGCTGTGCCACTGCAGCACCG CTCTTTGGAGAAGGTAAATCTTGCTAAATCCAGCCCGACCCTCCCCTGGCACAAC GTAAGGCCATTATCTCTCATCCAACTCCAGGACGGAGTCAGTGAGAATATTGGCG CGCCGAATTCTCGCGACGATCGGTCGACATAACTTCGTATAGGATACTTTATACGA AGTTATCAATTCAGGCTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATA GCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTG ACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTA ACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTG CCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGT CAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGAC TTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGT GAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATT TTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGG GGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCG AGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCC TTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGC - 62 - SIB BW1353R GGGCGGGGAGTCGCTGCGACGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCG CCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCG GGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCGCTTGGTTTAATGACGGC TTGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTGAGGGGCTCCGGGAGGGCCCTTT GTGCGGGGGGAGCGGCTCGGGGGGTGCGTGCGTGTGTGTGTGCGTGGGGAGC GCCGCGTGCGGCTCCGCGCTGCCCGGCGGCTGTGAGCGCTGCGGGCGCGGCG CGGGGCTTTGTGCGCTCCGCAGTGTGCGCGAGGGGAGCGCGGCCGGGGGCGG TGCCCCGCGGTGCGGGGGGGGCTGCGAGGGGAACAAAGGCTGCGTGCGGGGT GTGTGCGTGGGGGGGTGAGCAGGGGGTGTGGGCGCGTCGGTCGGGCTGCAAC CCCCCCTGCACCCCCCTCCCCGAGTTGCTGAGCACGGCCCGGCTTCGGGTGCG GGGCTCCGTACGGGGCGTGGCGCGGGGCTCGCCGTGCCGGGCGGGGGGTGGC GGCAGGTGGGGGTGCCGGGCGGGGCGGGGCCGCCTCGGGCCGGGGAGGGCT CGGGGGAGGGGCGCGGCGGCCCCCGGAGCGCCGGCGGCTGTCGAGGCGCGG CGAGCCGCAGCCATTGCCTTTTATGGTAATCGTGCGAGAGGGCGCAGGGACTTC CTTTGTCCCAAATCTGTGCGGAGCCGAAATCTGGGAGGCGCCGCCGCACCCCCT CTAGCGGGCGCGGGGCGAAGCGGTGCGGCGCCGGCAGGAAGGAAATGGGCGG GGAGGGCCTTCGTGCGTCGCCGCGCCGCCGTCCCCTTCTCCCTCTCCAGCCTCG GGGCTGTCCGCGGGGGGACGGCTGCCTTCGGGGGGGACGGGGCAGGGCGGGG TTCGGCTTCTGGCGTGTGACCGGCGGCTCTAGAGCCTCTGCTAACCATGTTCATG CCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTATTGTGCTGTCTCAT CATTTTGGCAAAGAATTGTGTACAACCATGAGTGTAGATCCAGCTTGTCCCCAAAG CTTGCCTTGCTTTGAAGCATCCGACTGTAAAGAATCTTCACCTATGCCTGTGATTT GTGGGCCTGAAGAAAACTATCCATCCTTGCAAATGTCTTCTGCTGAGATGCCTCA CACGGAGACTGTCTCTCCTCTTCCCTCCTCCATGGATCTGCTTATTCAGGACAGC CCTGATTCTTCCACCAGTCCCAAAGGCAAACAACCCACTTCTGCAGAGAATAGTG TCGCAAAAAAGGAAGACAAGGTCCCAGTCAAGAAACAGAAGACCAGAACTGTGTT CTCTTCCACCCAGCTGTGTGTACTCAATGATAGATTTCAGAGACAGAAATACCTCA GTCTCCAGCAGATGCAAGAACTCTCCAACATCCTGAACCTCAGCTACAAACAGGT GAAGACCTGGTTCCAGAACCAGAGAATGAAATCTAAGAGGTGGCAGAAAAACAAC TGGCCGAAGAATAGCAATGGTGTGACGCAGAAGGCCTCAGCACCTACCTACCCC AGCCTCTACTCTTCCTACCACCAGGGATGCCTGGTGAACCCGACTGGGAACCTTC CAATGTGGAGCAACCAGACCTGGAACAATTCAACCTGGAGCAACCAGACCCAGAA CATCCAGTCCTGGAGCAACCACTCCTGGAACACTCAGACCTGGTGCACCCAATCC TGGAACAATCAGGCCTGGAACAGTCCCTTCTATAACTGTGGAGAGGAATCTCTGC AGTCCTGCATGCAGTTCCAGCCAAATTCTCCTGCCAGTGACTTGGAGGCTGCTTT GGAAGCTGCTGGGGAAGGCCTTAATGTAATACAGCAGACCACTAGGTATTTTAGT - 63 - SIB BW1353R ACTCCACAAACCATGGATTTATTCCTAAACTACTCCATGAACATGCAACCTGAAGA CGTGGGATCCGGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGA CGTGGAGGAGAACCCTGGACCTGGAAGCGGAGAGGGCAGAGGAAGTCTGCTAA CATGCGGTGACGTCGAGGAGAATCCTGGACCTATGGTGAGCAAGGGCGAGGAG GATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCT CCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTAC GAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTT CGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAG CACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGT GGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGAC TCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAAC TTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCC TCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAG GCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAA GGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGA CATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGA GGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAAACGCGTGAATT CACTCCTCAGGTGCAGGCTGCCTATCAGAAGGTGGTGGCTGGTGTGGCCAATGC CCTGGCTCACAAATACCACTGAGATCTTTTTCCCTCTGCCAAAAATTATGGGGACA TCATGAAGCCCCTTGAGCATCTGACTTCTGGCTAATAAAGGAAATTTATTTTCATTG CAATAGTGTGTTGGAATTTTTTGTGTCTCTCACTCGGAAGGACATATGGGAGGGC AAATCATTTAAAACATCAGAATGAGTATTTGGTTTAGAGTTTGGCAACATATGCCCA TATGCTGGCTGCCATGAACAAAGGTTGGCTATAAAGAGGTCATCAGTATATGAAAC AGCCCCCTGCTGTCCATTCCTTATTCCATAGAAAAGCCTTGACTTGAGGTTAGATT TTTTTTATATTTTGTTTTGTGTTATTTTTTTCTTTAACATCCCTAAAATTTTCCTTACA TGTTTTACTAGCCAGATTTTTCCTCCTCTCCTGACTACTCCCAGTCATAGCTGTCC CTCTTCTCTTATGGAGATCACCGGTATAACTTCGTATAATGTATACTATACGAAGTT ATGGTACCTTAATTAAGTTAACATGCATAGTACTGAGCTCACGGGGACAGCCCCC CCCCAAAGCCCCCAGGGATGTAATTACGTCCCTCCCCCGCTAGGGGGCAGCAGC GAGCCGCCCGGGGCTCCGCTCCGGTCCGGCGCTCCCCCCGCATCCCCGAGCCG GCAGCGTGCGGGGACAGCCCGGGCACGGGGAAGGTGGCACGGGATCGCTTTCC TCTGAACGCTTCTCGCTGCTCTTTGAGCCTGCAGACACCTGGGGGGATACGGGG AAAAAGCTTTAGGCTGAAAGAGAGATTTAGAATGACAGAATCATAGAACGGCCTG GGTTGCAAAGGAGCACAGTGCTCATCCAGATCCAACCCCCTGCTATGTGCAGGGT CATCAACCAGCAGCCCAGGCTGCCCAGAGCCACATCCAGCCTGGCCTTGAATGC CTGCAGGGATGGGGCATCCACAGCCTCCTTGGGCAACCTGTTCAGTGCGTCACC - 64 - SIB BW1353R ACCCTCTGGGGGAAAAACTGCCTCCTCATATCCAACCCAAACCTCCCCTGTCTCA GTGTAAAGCCATTCCCCCTTGTCCTATCAAGGGGGAGTTTGCTGTGACATTGTTG GTCTGGGGTGACACATGTTTGCCAATTCAGTGCATCACGGAGAGGCAGATCTTGG GGATAAGGAAGTGCAGGACAGCATGGACGTGGGACATGCAGGTGTTGAGGGCTC TGGGACACTCTCCAAGTCACAGCGTTCAGAACAGCCTTAAGGATAAGAAGATAGG ATAGAAGGACAAAGAGCAAGTTAAAACCCAGCATGGAGAGGAGCACAAAAAGGC CACAGACACTGCTGGTCCCTGTGTCTGAGCCTGCATGTTTGATGGTGTCTGGATG CAAGCAGAAGGGGTGGAAGAGCTTGCCTGGAGAGATACAGCTGGGTCAGTAGGA CTGGGACAGGCAGCTGGAGAATTGCCATGTAGATGTTCATACAATCGTCAAATCA TGAAGGCTGGAAAAGCCCTCCAAGATCCCCAAGACCAACCCCAACCCACCCACC GTGCCCACTGGCCATGTCCCTCAGTGCCACATCCCCACAGTTCTTCATCACCTCC AGGGACGGTGACCCCCCCACCTCCGTGGGCAGCTGTGCCACTGCAGCACCGCT CTTTGGAGAAGGTAAATCTTGCTAAATCCAGCCCGACCCTCCCCTGGCACAACGT AAGGCCATTATCTCTCATCCAACTCCAGGACGGAGTCAGTGAGAATATTGTTTAAA CTCCTCATCCTTCCAACATAAATATATTTTGGGATTATATCAACATTCAATGTTACTT AAAGTGACCTTGTAAATATTTTCACAACTGAGCCATGTTTGATTTGTATACTTATGT TTACTTTACTGTTTTTCCTGAAGTTAATAATTGCCTTGAATTTATTTATTTCTTTAAAA ATGTTTCATTACTCAGGACTGTAGTTTACATTACGATTCTTTGTGTTATACAGTTGA TGGGTTTCTTTTCTTTCTTAATTTCTTTAAAAAATAGAGATGGGGTCTTACTATATTA CCCAGGCTGGTCTTGAAGTCCTGGGCTCAAGTGATCTTCCTGTCTCAGCCTACCA AGTAGCTGAGACTATAGGTGCAAAAAAGCCACTATACCTGGCTAGTTTACAGGTTT TAACAAATGCATTATGCCACGTATCCATTATTACAGGATCACACAAGATATTTTCAT TACCCTGAAAGCATCCCTGTGTTCCACCAATTCATCCTGCCTCCATGAGCCGCTG GCAACCACTGATCTCTATAGTTTTGCCTTTTCTAAAATGTCATATAATTGGAATCAT ACAGTCTGTAGCATTTTCAGACTAGCTTTTAAAATTTGGCAATATGCATTTAAGGTT CCTCCTTAAATGTGAAGGGCATAGCCAATGTGGCTTGATAGCTCATTTCTTTTTATT GGTGAATATTTCATTGTCTGGATGTTCCACAGTTTGTTTATCCATTCACCTATTCAA TTTGCTTTTTTTCTGTGTATCTATCACTAATTCAATACTGGACTCTCCAACAGAGCC GTTTAAACACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTA CCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGA AGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATG GCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATAT GGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACA CCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGC TTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCG TCATCACCGAAACGCGCGA - 65 - SIB BW1353R SEQ ID NO.59: pAAV-Puro_TRE-EGFP-(miR-E) FASTA: TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGA CGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCG CGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGC AGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAG GAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAA GGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGT GCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTA AAACGACGGCCAGTGAATTGTGCTTTCTCTGACCAGCATTCTCTCCCCTGGGCCT GTGCCGCTTTCTGTCTGTAGCTTGTGGCCTGGGTCACCTCTACGGCTGGCCCAGA TCCTTCCCTGCCGCCTCCTTCAGGTTCCGTCTTCCTCCACTCCCTCTTCCCCTTGC TCTCTGCTGTGTTGCTGCCCAAGGATGCTCTTTCCGGAGCACTTCCTTCTCGGCG CTGCACCACGTGATGTCCTCTGAGCGGATCCTCCCCGTGTCTGGGTCCTCTCCG GGCATCTCTCCTCCCTCACCCAACCCCATGCCGTCTTCACTCGCTGGGTTCCCTT TTCCTTCTCCTTCTGGGGCCTGTGCCATCTCTCGTTTCTTAGGATGGCCTTCTCCG ACGGATGTCTCCCTTGCGTCCCGCCTCCCCTTCTTGTAGGCCTGCATCATCACCG TTTTTCTGGACAACCCCAAAGTACCCCGTCTCCCTGGCTTTAGCCACCTCTCCATC CTCTTGCTTTCTTTGCCTGGACACCCCGTTCTCCTGTGGATTCGGGTCACCTCTCA CTCCTTTCATTTGGGCAGCTCCCCTACCCCCCTTACCTCTCTAGTCTGTGCTAGCT CTTCCAGCCCCCTGTCATGGCATCTTCCAGGGGTCCGAGAGCTCAGCTAGTCTTC TTCCTCCAACCCGGGCCCCTATGTCCACTTCAGGACAGCATGTTTGCTGCCTCCA GGGATCCTGTGTCCCCGAGCTGGGACCACCTTATATTCCCAGGGCCGGTTAATGT GGCTCTGGTTCTGGGTACTTTTATCTGTCCCCTCCACCCCACAGTGGGGCAAGCT TCTGACCTCTTCTCTTCCTCCCACAGGGCCTCGAGAGATCTGGCAGCGGAGAGG GCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCTAGGC TCGAGATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCC CCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGC CACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTC TTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGG CGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTG TTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGC GCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGT GGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGC AGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCG - 66 - SIB BW1353R CCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCT TCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGA CCCGCAAGCCCGGTGCCTGATCTAGAGGGCCCGTTTAAACCCGCTGATCAGCCT CGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTC CTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTG CATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGG ACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTG GGCTCTATGGTCACTCGAGTTTACTCCCTATCAGTGATAGAGAACGTATGAAGAGT TTACTCCCTATCAGTGATAGAGAACGTATGCAGACTTTACTCCCTATCAGTGATAG AGAACGTATAAGGAGTTTACTCCCTATCAGTGATAGAGAACGTATGACCAGTTTAC TCCCTATCAGTGATAGAGAACGTATCTACAGTTTACTCCCTATCAGTGATAGAGAA CGTATATCCAGTTTACTCCCTATCAGTGATAGAGAACGTATGTCGAGGTAGGCGT GTACGGTGGGCGCCTATAAAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTG GAGCAATTCCACAACACTTTTGTCTTATACTTACTAGTGCCACCATGGTGAGCAAG GGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGA CGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTA CGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTG GCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCC CGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTC CAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAG GTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGAC TTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGC CACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCA AGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGC AGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGA GCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCC TGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACA AGTAAGCGTACGGCGGCCGCCTCGACTAGGGATAACAGGGTAATTGTTTGAATGA GGCTTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAAACACTTGCTGGGAT TACTTCGACTTCTTAACCCAACAGAAGGCTCGAGAAGGTATATTGCTGTTGGCAGT GAGCGTGGTGCAGGTGGACTGACTCACCTGCACCTTGCCTACTGCCTCGGACTT CAAGGGGCTAGAATTCGAGCAATTATCTTGTTTACTAAAACTGAATACCTTGCTAT CTCTTTGATACATTTTTACAAAGCTGAATGCATCAATTGACGCGTAATTGATATCTC TAGAGGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAAC CTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAA CTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCAC - 67 - SIB BW1353R AAATAAAGCATTTTTTTCACTGCCTTGACAGTACTCTTAAGTCGACTTACTAGGGAC AGGATTGGTGACAGAAAAGCCCCATCCTTAGGCCTCCTCCTTCCTAGTCTCCTGA TATTGGGTCTAACCCCCACCTCCTGTTAGGCAGATTCCTTATCTGGTGACACACCC CCATTTCCTGGAGCCATCTCTCTCCTTGCCAGAACCTCTAAGGTTTGCTTACGATG GAGCCAGAGAGGATCCTGGGAGGGAGAGCTTGGCAGGGGGTGGGAGGGAAGG GGGGGATGCGTGACCTGCCCGGTTCTCAGTGGCCACCCTGCGCTACCCTCTCCC AGAACCTGAGCTGCTCTGACGCGGCTGTCTGGTGCGTTTCACTGATCCTGGTGCT GCAGCTTCCTTACACTTCCCAAGAGGAGAAGCAGTTTGGAAAAACAAAATCAGAAT AAGTTGGTCCTGAGTTCTAACTTTGGCTCTTCACCTTTCTAGTCCCCAATTTATATT GTTCCTCCGTGCGTCAGTTTTACCTGTGAGATAAGGCCAGTAGCCAGCCCCGTCC TGGCAGGGCTGTGGTGAGGAGGGGGGTGTCCGTGTGGAAAACTCCCTTTGTGAG AATGGTGCGTCCTAGGTGTTCACCAGGTCGTGGCCGCCTCTACTCCCTTTCTCTT TCTCCATCCTTCTTTCCTTAAAGAGTCCCCAGTGCTATCTGGGACATATTCCTCCG CCCAGAGCAGGGTCCCGCTTCCCTAAGGCCCTGCTCTGGGCTTCTGGGTTTGAG TCCTTGGCAAGCCCAGGAGAGGCGCTCAGGCTTCCCTGTCCCCCTTCCTCGTCC ACCATCTCATGCCCCTGGCTCTCCTGCCCCTTCCCTACAGGGGTTCCTGGCTCTG CTCTAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCG CTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTG CCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAG TCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGA GGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCT CGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGT TATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCA AAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCG CCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCC GACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCT CCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAA GCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGT TCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGC CTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCA CTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCT ACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTG GTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTG ATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAG ATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTC TGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAA - 68 - SIB BW1353R AAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAA GTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCT ATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTA GATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCG CGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAA GGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAA TTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTT GTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCAT TCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAA AAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCA GTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATC CGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGT GTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGC CACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAA CTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCAC CCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACA GGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATA CTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGA GCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACA TTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAAC CTATAAAAATAGGCGTATCACGAGGCCCTTTCGTC SEQ ID NO.60: pAAV-Puro_TRE-MYOD1 FASTA: TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGA CGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCG CGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGC AGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAG GAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAA GGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGT GCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTA AAACGACGGCCAGTGAATTGTGCTTTCTCTGACCAGCATTCTCTCCCCTGGGCCT GTGCCGCTTTCTGTCTGTAGCTTGTGGCCTGGGTCACCTCTACGGCTGGCCCAGA TCCTTCCCTGCCGCCTCCTTCAGGTTCCGTCTTCCTCCACTCCCTCTTCCCCTTGC TCTCTGCTGTGTTGCTGCCCAAGGATGCTCTTTCCGGAGCACTTCCTTCTCGGCG CTGCACCACGTGATGTCCTCTGAGCGGATCCTCCCCGTGTCTGGGTCCTCTCCG - 69 - SIB BW1353R GGCATCTCTCCTCCCTCACCCAACCCCATGCCGTCTTCACTCGCTGGGTTCCCTT TTCCTTCTCCTTCTGGGGCCTGTGCCATCTCTCGTTTCTTAGGATGGCCTTCTCCG ACGGATGTCTCCCTTGCGTCCCGCCTCCCCTTCTTGTAGGCCTGCATCATCACCG TTTTTCTGGACAACCCCAAAGTACCCCGTCTCCCTGGCTTTAGCCACCTCTCCATC CTCTTGCTTTCTTTGCCTGGACACCCCGTTCTCCTGTGGATTCGGGTCACCTCTCA CTCCTTTCATTTGGGCAGCTCCCCTACCCCCCTTACCTCTCTAGTCTGTGCTAGCT CTTCCAGCCCCCTGTCATGGCATCTTCCAGGGGTCCGAGAGCTCAGCTAGTCTTC TTCCTCCAACCCGGGCCCCTATGTCCACTTCAGGACAGCATGTTTGCTGCCTCCA GGGATCCTGTGTCCCCGAGCTGGGACCACCTTATATTCCCAGGGCCGGTTAATGT GGCTCTGGTTCTGGGTACTTTTATCTGTCCCCTCCACCCCACAGTGGGGCAAGCT TCTGACCTCTTCTCTTCCTCCCACAGGGCCTCGAGAGATCTGGCAGCGGAGAGG GCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCTAGGC TCGAGATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCC CCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGC CACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTC TTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGG CGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTG TTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGC GCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGT GGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGC AGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCG CCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCT TCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGA CCCGCAAGCCCGGTGCCTGATCTAGAGGGCCCGTTTAAACCCGCTGATCAGCCT CGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTC CTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTG CATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGG ACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTG GGCTCTATGGTCACTCGAGTTTACTCCCTATCAGTGATAGAGAACGTATGAAGAGT TTACTCCCTATCAGTGATAGAGAACGTATGCAGACTTTACTCCCTATCAGTGATAG AGAACGTATAAGGAGTTTACTCCCTATCAGTGATAGAGAACGTATGACCAGTTTAC TCCCTATCAGTGATAGAGAACGTATCTACAGTTTACTCCCTATCAGTGATAGAGAA CGTATATCCAGTTTACTCCCTATCAGTGATAGAGAACGTATGTCGAGGTAGGCGT GTACGGTGGGCGCCTATAAAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTG GAGCAATTCCACAACACTTTTGTCTTATACTTACTAGTGCCACCATGGAGCTACTG TCGCCACCGCTCCGCGACGTAGACCTGACGGCCCCCGACGGCTCTCTCTGCTCC - 70 - SIB BW1353R TTTGCCACAACGGACGACTTCTATGACGACCCGTGTTTCGACTCCCCGGACCTGC GCTTCTTCGAAGACCTGGACCCGCGCCTGATGCACGTGGGCGCGCTCCTGAAAC CCGAAGAGCACTCGCACTTCCCCGCGGCGGTGCACCCGGCCCCGGGCGCACGT GAGGACGAGCATGTGCGCGCGCCCAGCGGGCACCACCAGGCGGGCCGCTGCCT ACTGTGGGCCTGCAAGGCGTGCAAGCGCAAGACCACCAACGCCGACCGCCGCA AGGCCGCCACCATGCGCGAGCGGCGCCGCCTGAGCAAAGTAAATGAGGCCTTTG AGACACTCAAGCGCTGCACGTCGAGCAATCCAAACCAGCGGTTGCCCAAGGTGG AGATCCTGCGCAACGCCATCCGCTATATCGAGGGCCTGCAGGCTCTGCTGCGCG ACCAGGACGCCGCGCCCCCTGGCGCCGCAGCCGCCTTCTATGCGCCGGGCCCG CTGCCCCCGGGCCGCGGCGGCGAGCACTACAGCGGCGACTCCGACGCGTCCAG CCCGCGCTCCAACTGCTCCGACGGCATGATGGACTACAGCGGCCCCCCGAGCG GCGCCCGGCGGCGGAACTGCTACGAAGGCGCCTACTACAACGAGGCGCCCAGC GAACCCAGGCCCGGGAAGAGTGCGGCGGTGTCGAGCCTAGACTGCCTGTCCAG CATCGTGGAGCGCATCTCCACCGAGAGCCCTGCGGCGCCCGCCCTCCTGCTGG CGGACGTGCCTTCTGAGTCGCCTCCGCGCAGGCAAGAGGCTGCCGCCCCCAGC GAGGGAGAGAGCAGCGGCGACCCCACCCAGTCACCGGACGCCGCCCCGCAGTG CCCTGCGGGTGCGAACCCCAACCCGATATACCAGGTGCTCTGAGAATTCGAGCT CGGTACCCGGGGATCCTCTAGTCAGCTGACGCGTGCTAGCGCGGCCGCATCGAT AAGCTTGTCGACGATATCTCTAGAGGATCATAATCAGCCATACCACATTTGTAGAG GTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAAT GAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAG CAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCCTTGACAGTACTC TTAAGTCGACTTACTAGGGACAGGATTGGTGACAGAAAAGCCCCATCCTTAGGCC TCCTCCTTCCTAGTCTCCTGATATTGGGTCTAACCCCCACCTCCTGTTAGGCAGAT TCCTTATCTGGTGACACACCCCCATTTCCTGGAGCCATCTCTCTCCTTGCCAGAAC CTCTAAGGTTTGCTTACGATGGAGCCAGAGAGGATCCTGGGAGGGAGAGCTTGG CAGGGGGTGGGAGGGAAGGGGGGGATGCGTGACCTGCCCGGTTCTCAGTGGCC ACCCTGCGCTACCCTCTCCCAGAACCTGAGCTGCTCTGACGCGGCTGTCTGGTG CGTTTCACTGATCCTGGTGCTGCAGCTTCCTTACACTTCCCAAGAGGAGAAGCAG TTTGGAAAAACAAAATCAGAATAAGTTGGTCCTGAGTTCTAACTTTGGCTCTTCAC CTTTCTAGTCCCCAATTTATATTGTTCCTCCGTGCGTCAGTTTTACCTGTGAGATAA GGCCAGTAGCCAGCCCCGTCCTGGCAGGGCTGTGGTGAGGAGGGGGGTGTCCG TGTGGAAAACTCCCTTTGTGAGAATGGTGCGTCCTAGGTGTTCACCAGGTCGTGG CCGCCTCTACTCCCTTTCTCTTTCTCCATCCTTCTTTCCTTAAAGAGTCCCCAGTG CTATCTGGGACATATTCCTCCGCCCAGAGCAGGGTCCCGCTTCCCTAAGGCCCTG CTCTGGGCTTCTGGGTTTGAGTCCTTGGCAAGCCCAGGAGAGGCGCTCAGGCTT - 71 - SIB BW1353R CCCTGTCCCCCTTCCTCGTCCACCATCTCATGCCCCTGGCTCTCCTGCCCCTTCC CTACAGGGGTTCCTGGCTCTGCTCTAAGCTTGGCGTAATCATGGTCATAGCTGTT TCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCA TAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTG CGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAA TCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCT CGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTC ACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAA CATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCT GGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCA AGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCT GGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGT CCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTA TCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCC CGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCG GTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAG CGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTA CACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGA AAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTT TTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCT TTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGA TTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAAT GAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAAT GCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTT GCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCC CCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGC AATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATC CGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCA GTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCT CGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTAC ATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTT GTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATA ATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCA ACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGT CAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGA AAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTT - 72 - SIB BW1353R CGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGC GTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGG GCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATT TATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAA CAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAA CCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGT C SEQ ID NO.61: pAAV-Puro_TRE-MYOD1-(miR-E-NANOG) FASTA: TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGA CGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCG CGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGC AGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAG GAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAA GGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGT GCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTA AAACGACGGCCAGTGAATTGTGCTTTCTCTGACCAGCATTCTCTCCCCTGGGCCT GTGCCGCTTTCTGTCTGTAGCTTGTGGCCTGGGTCACCTCTACGGCTGGCCCAGA TCCTTCCCTGCCGCCTCCTTCAGGTTCCGTCTTCCTCCACTCCCTCTTCCCCTTGC TCTCTGCTGTGTTGCTGCCCAAGGATGCTCTTTCCGGAGCACTTCCTTCTCGGCG CTGCACCACGTGATGTCCTCTGAGCGGATCCTCCCCGTGTCTGGGTCCTCTCCG GGCATCTCTCCTCCCTCACCCAACCCCATGCCGTCTTCACTCGCTGGGTTCCCTT TTCCTTCTCCTTCTGGGGCCTGTGCCATCTCTCGTTTCTTAGGATGGCCTTCTCCG ACGGATGTCTCCCTTGCGTCCCGCCTCCCCTTCTTGTAGGCCTGCATCATCACCG TTTTTCTGGACAACCCCAAAGTACCCCGTCTCCCTGGCTTTAGCCACCTCTCCATC CTCTTGCTTTCTTTGCCTGGACACCCCGTTCTCCTGTGGATTCGGGTCACCTCTCA CTCCTTTCATTTGGGCAGCTCCCCTACCCCCCTTACCTCTCTAGTCTGTGCTAGCT CTTCCAGCCCCCTGTCATGGCATCTTCCAGGGGTCCGAGAGCTCAGCTAGTCTTC TTCCTCCAACCCGGGCCCCTATGTCCACTTCAGGACAGCATGTTTGCTGCCTCCA GGGATCCTGTGTCCCCGAGCTGGGACCACCTTATATTCCCAGGGCCGGTTAATGT GGCTCTGGTTCTGGGTACTTTTATCTGTCCCCTCCACCCCACAGTGGGGCAAGCT TCTGACCTCTTCTCTTCCTCCCACAGGGCCTCGAGAGATCTGGCAGCGGAGAGG GCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCTAGGC TCGAGATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCC CCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGC - 73 - SIB BW1353R CACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTC TTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGG CGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTG TTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGC GCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGT GGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGC AGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCG CCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCT TCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGA CCCGCAAGCCCGGTGCCTGATCTAGAGGGCCCGTTTAAACCCGCTGATCAGCCT CGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTC CTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTG CATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGG ACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTG GGCTCTATGGTCACTCGAGTTTACTCCCTATCAGTGATAGAGAACGTATGAAGAGT TTACTCCCTATCAGTGATAGAGAACGTATGCAGACTTTACTCCCTATCAGTGATAG AGAACGTATAAGGAGTTTACTCCCTATCAGTGATAGAGAACGTATGACCAGTTTAC TCCCTATCAGTGATAGAGAACGTATCTACAGTTTACTCCCTATCAGTGATAGAGAA CGTATATCCAGTTTACTCCCTATCAGTGATAGAGAACGTATGTCGAGGTAGGCGT GTACGGTGGGCGCCTATAAAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTG GAGCAATTCCACAACACTTTTGTCTTATACTTACTAGTGCCACCATGGAGCTACTG TCGCCACCGCTCCGCGACGTAGACCTGACGGCCCCCGACGGCTCTCTCTGCTCC TTTGCCACAACGGACGACTTCTATGACGACCCGTGTTTCGACTCCCCGGACCTGC GCTTCTTCGAAGACCTGGACCCGCGCCTGATGCACGTGGGCGCGCTCCTGAAAC CCGAAGAGCACTCGCACTTCCCCGCGGCGGTGCACCCGGCCCCGGGCGCACGT GAGGACGAGCATGTGCGCGCGCCCAGCGGGCACCACCAGGCGGGCCGCTGCCT ACTGTGGGCCTGCAAGGCGTGCAAGCGCAAGACCACCAACGCCGACCGCCGCA AGGCCGCCACCATGCGCGAGCGGCGCCGCCTGAGCAAAGTAAATGAGGCCTTTG AGACACTCAAGCGCTGCACGTCGAGCAATCCAAACCAGCGGTTGCCCAAGGTGG AGATCCTGCGCAACGCCATCCGCTATATCGAGGGCCTGCAGGCTCTGCTGCGCG ACCAGGACGCCGCGCCCCCTGGCGCCGCAGCCGCCTTCTATGCGCCGGGCCCG CTGCCCCCGGGCCGCGGCGGCGAGCACTACAGCGGCGACTCCGACGCGTCCAG CCCGCGCTCCAACTGCTCCGACGGCATGATGGACTACAGCGGCCCCCCGAGCG GCGCCCGGCGGCGGAACTGCTACGAAGGCGCCTACTACAACGAGGCGCCCAGC GAACCCAGGCCCGGGAAGAGTGCGGCGGTGTCGAGCCTAGACTGCCTGTCCAG CATCGTGGAGCGCATCTCCACCGAGAGCCCTGCGGCGCCCGCCCTCCTGCTGG - 74 - SIB BW1353R CGGACGTGCCTTCTGAGTCGCCTCCGCGCAGGCAAGAGGCTGCCGCCCCCAGC GAGGGAGAGAGCAGCGGCGACCCCACCCAGTCACCGGACGCCGCCCCGCAGTG CCCTGCGGGTGCGAACCCCAACCCGATATACCAGGTGCTCTGAGAATTCGAGCT CGGTACCCGGGGATCCTCTAGTCAGCTGACGCGTGCTAGCGCGGCCGCCTCGAC TAGGGATAACAGGGTAATTGTTTGAATGAGGCTTCAGTACTTTACAGAATCGTTGC CTGCACATCTTGGAAACACTTGCTGGGATTACTTCGACTTCTTAACCCAACAGAAG GCTCGAGAAGGTATATTGCTGTTGGCAGTGAGCGCTCCGACTGTAAAGAATCTTC ATAGTGAAGCCACAGATGTATGAAGATTCTTTACAGTCGGATTGCCTACTGCCTCG GACTTCAAGGGGCTAGAATTCGAGCAATTATCTTGTTTACTAAAACTGAATACCTT GCTATCTCTTTGATACATTTTTACAAAGCTGAATGCATCAATTGACGCGTAATTGAT ATCTCTAGAGGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAA AAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTT GTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAAT TTCACAAATAAAGCATTTTTTTCACTGCCTTGACAGTACTCTTAAGTCGACTTACTA GGGACAGGATTGGTGACAGAAAAGCCCCATCCTTAGGCCTCCTCCTTCCTAGTCT CCTGATATTGGGTCTAACCCCCACCTCCTGTTAGGCAGATTCCTTATCTGGTGACA CACCCCCATTTCCTGGAGCCATCTCTCTCCTTGCCAGAACCTCTAAGGTTTGCTTA CGATGGAGCCAGAGAGGATCCTGGGAGGGAGAGCTTGGCAGGGGGTGGGAGGG AAGGGGGGGATGCGTGACCTGCCCGGTTCTCAGTGGCCACCCTGCGCTACCCTC TCCCAGAACCTGAGCTGCTCTGACGCGGCTGTCTGGTGCGTTTCACTGATCCTGG TGCTGCAGCTTCCTTACACTTCCCAAGAGGAGAAGCAGTTTGGAAAAACAAAATCA GAATAAGTTGGTCCTGAGTTCTAACTTTGGCTCTTCACCTTTCTAGTCCCCAATTTA TATTGTTCCTCCGTGCGTCAGTTTTACCTGTGAGATAAGGCCAGTAGCCAGCCCC GTCCTGGCAGGGCTGTGGTGAGGAGGGGGGTGTCCGTGTGGAAAACTCCCTTTG TGAGAATGGTGCGTCCTAGGTGTTCACCAGGTCGTGGCCGCCTCTACTCCCTTTC TCTTTCTCCATCCTTCTTTCCTTAAAGAGTCCCCAGTGCTATCTGGGACATATTCCT CCGCCCAGAGCAGGGTCCCGCTTCCCTAAGGCCCTGCTCTGGGCTTCTGGGTTT GAGTCCTTGGCAAGCCCAGGAGAGGCGCTCAGGCTTCCCTGTCCCCCTTCCTCG TCCACCATCTCATGCCCCTGGCTCTCCTGCCCCTTCCCTACAGGGGTTCCTGGCT CTGCTCTAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTAT CCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGG GTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTC CAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGG AGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGC GCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATAC GGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCA - 75 - SIB BW1353R GCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTC CGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAAC CCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCT CTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGG AAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTC GTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGC GCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGC CACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTG CTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTT GGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTT GATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCA GATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGT CTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCA AAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAA GTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCT ATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTA GATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCG CGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAA GGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAA TTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTT GTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCAT TCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAA AAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCA GTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATC CGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGT GTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGC CACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAA CTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCAC CCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACA GGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATA CTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGA GCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACA TTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAAC CTATAAAAATAGGCGTATCACGAGGCCCTTTCGTC SEQ ID NO.62: pAAV-Puro_TRE-(intron-miR-E-NANOG)-MYOD1 - 76 - SIB BW1353R FASTA: TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGA CGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCG CGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGC AGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAG GAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAA GGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGT GCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTA AAACGACGGCCAGTGAATTGTGCTTTCTCTGACCAGCATTCTCTCCCCTGGGCCT GTGCCGCTTTCTGTCTGTAGCTTGTGGCCTGGGTCACCTCTACGGCTGGCCCAGA TCCTTCCCTGCCGCCTCCTTCAGGTTCCGTCTTCCTCCACTCCCTCTTCCCCTTGC TCTCTGCTGTGTTGCTGCCCAAGGATGCTCTTTCCGGAGCACTTCCTTCTCGGCG CTGCACCACGTGATGTCCTCTGAGCGGATCCTCCCCGTGTCTGGGTCCTCTCCG GGCATCTCTCCTCCCTCACCCAACCCCATGCCGTCTTCACTCGCTGGGTTCCCTT TTCCTTCTCCTTCTGGGGCCTGTGCCATCTCTCGTTTCTTAGGATGGCCTTCTCCG ACGGATGTCTCCCTTGCGTCCCGCCTCCCCTTCTTGTAGGCCTGCATCATCACCG TTTTTCTGGACAACCCCAAAGTACCCCGTCTCCCTGGCTTTAGCCACCTCTCCATC CTCTTGCTTTCTTTGCCTGGACACCCCGTTCTCCTGTGGATTCGGGTCACCTCTCA CTCCTTTCATTTGGGCAGCTCCCCTACCCCCCTTACCTCTCTAGTCTGTGCTAGCT CTTCCAGCCCCCTGTCATGGCATCTTCCAGGGGTCCGAGAGCTCAGCTAGTCTTC TTCCTCCAACCCGGGCCCCTATGTCCACTTCAGGACAGCATGTTTGCTGCCTCCA GGGATCCTGTGTCCCCGAGCTGGGACCACCTTATATTCCCAGGGCCGGTTAATGT GGCTCTGGTTCTGGGTACTTTTATCTGTCCCCTCCACCCCACAGTGGGGCAAGCT TCTGACCTCTTCTCTTCCTCCCACAGGGCCTCGAGAGATCTGGCAGCGGAGAGG GCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCTAGGC TCGAGATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCC CCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGC CACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTC TTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGG CGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTG TTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGC GCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGT GGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGC AGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCG CCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCT TCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGA - 77 - SIB BW1353R CCCGCAAGCCCGGTGCCTGATCTAGAGGGCCCGTTTAAACCCGCTGATCAGCCT CGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTC CTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTG CATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGG ACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTG GGCTCTATGGTCACTCGAGTTTACTCCCTATCAGTGATAGAGAACGTATGAAGAGT TTACTCCCTATCAGTGATAGAGAACGTATGCAGACTTTACTCCCTATCAGTGATAG AGAACGTATAAGGAGTTTACTCCCTATCAGTGATAGAGAACGTATGACCAGTTTAC TCCCTATCAGTGATAGAGAACGTATCTACAGTTTACTCCCTATCAGTGATAGAGAA CGTATATCCAGTTTACTCCCTATCAGTGATAGAGAACGTATGTCGAGGTAGGCGT GTACGGTGGGCGCCTATAAAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTG GAGCAATTCCACAACACTTTTGTCTTATACTTACTAGCGCGCGGCGGGCGGGGAG TCGCTGCGACGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCG CCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACG GCCCTTCTCCTCCGGGCTGTAATTAGCGCTTGGTTTAATGACGGCTTGTTTCTTTT CTGTGGCTGCGTGAAAGCCTTGAGGGGCTCCGGGAGGGCCCTTTGTGCGGGGG GAGCGGCTCGGGGGGTGCGTGCGTGTGTGTGTGCGTGGGGAGCGCCGCGTGC GGCTCCGCGCTGCCCGGCGGCTGTGAGCGCTGCGGGCGCGGCGCGGGGCTTT GTGCGCTCCGCAGTGTGCGCGAGGGGAGCGCGGCCGGGGGCGGTGCCCCGCG GTGCGGGGGGGGCTGCGAGGGGAACAAAGGCTGCGTGCGGGGTGTGTGCGTG GGGGGGTGAGCAGGGGGTGTGGGCGCGTCGGTCGGGCTGCAACCCCCCCTGC ACCCCCCTCCCCGAGTTGCTGAGCACGGCCCGGCTTCGGGTGCGGGGCTCCGT ACGGGGCGTGGCGCGGGGCTCGCCGTGCCGGGCGGGGGGTGGCGGCTGGTGG GGGTGCCGGGCGGGGCGGGGCCGCCTCGGGCCGGGGAGGGCTCGGGGGAGG GGCGCGGCGGCCCCCGGAGCGCCGGGGCCGCCTCGACTAGGGATAACAGGGT AATTGTTTGAATGAGGCTTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAA ACACTTGCTGGGATTACTTCGACTTCTTAACCCAACAGAAGGCTCGAGAAGGTATA TTGCTGTTGGCAGTGAGCGCTCCGACTGTAAAGAATCTTCATAGTGAAGCCACAG ATGTATGAAGATTCTTTACAGTCGGATTGCCTACTGCCTCGGACTTCAAGGGGCTA GAATTCGAGCAATTATCTTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGATAC ATTTTTACAAAGCTGAATGCATCAATTGACGCGTAAttGATCCGGCGGCTGTCGAG GCGCGGCGAGCCGCAGCCATTGCCTTTTATGGTAATCGTGCGAGAGGGCGCAGG GACTTCCTTTGTCCCAAATCTGTGCGGAGCCGAAATCTGGGAGGCGCCGCCGCA CCCCCTCTAGCGGGCGCGGGGCGAAGCGGTGCGGCGCCGGCAGGAAGGAAAT GGGCGGGGAGGGCCTTCGTGCGTCGCCGCGCCGCCGTCCCCTTCTCCCTCTCC AGCCTCGGGGCTGTCCGCGGGGGGACGGCTGCCTTCGGGGGGGACGGGGCAG - 78 - SIB BW1353R GGCGGGGTTCGGCTTCTGGCGTGTGACCGGCGGCTCTAGAGCCTCTGCTAACCA TGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTATTGTGC TGTCTCATCATTTTGGCAAAGAATTAATTCGGATCATTTACTAGTGCCACCATGGA GCTACTGTCGCCACCGCTCCGCGACGTAGACCTGACGGCCCCCGACGGCTCTCT CTGCTCCTTTGCCACAACGGACGACTTCTATGACGACCCGTGTTTCGACTCCCCG GACCTGCGCTTCTTCGAAGACCTGGACCCGCGCCTGATGCACGTGGGCGCGCTC CTGAAACCCGAAGAGCACTCGCACTTCCCCGCGGCGGTGCACCCGGCCCCGGG CGCACGTGAGGACGAGCATGTGCGCGCGCCCAGCGGGCACCACCAGGCGGGCC GCTGCCTACTGTGGGCCTGCAAGGCGTGCAAGCGCAAGACCACCAACGCCGACC GCCGCAAGGCCGCCACCATGCGCGAGCGGCGCCGCCTGAGCAAAGTAAATGAG GCCTTTGAGACACTCAAGCGCTGCACGTCGAGCAATCCAAACCAGCGGTTGCCC AAGGTGGAGATCCTGCGCAACGCCATCCGCTATATCGAGGGCCTGCAGGCTCTG CTGCGCGACCAGGACGCCGCGCCCCCTGGCGCCGCAGCCGCCTTCTATGCGCC GGGCCCGCTGCCCCCGGGCCGCGGCGGCGAGCACTACAGCGGCGACTCCGAC GCGTCCAGCCCGCGCTCCAACTGCTCCGACGGCATGATGGACTACAGCGGCCCC CCGAGCGGCGCCCGGCGGCGGAACTGCTACGAAGGCGCCTACTACAACGAGGC GCCCAGCGAACCCAGGCCCGGGAAGAGTGCGGCGGTGTCGAGCCTAGACTGCC TGTCCAGCATCGTGGAGCGCATCTCCACCGAGAGCCCTGCGGCGCCCGCCCTCC TGCTGGCGGACGTGCCTTCTGAGTCGCCTCCGCGCAGGCAAGAGGCTGCCGCC CCCAGCGAGGGAGAGAGCAGCGGCGACCCCACCCAGTCACCGGACGCCGCCCC GCAGTGCCCTGCGGGTGCGAACCCCAACCCGATATACCAGGTGCTCTGAGAATT CGAGCTCGGTACCCGGGGATCCTCTAGTCAGCTGACGCGTGCTAGCGCGGCCG CATCGATAAGCTTGTCGACGATATCTCTAGAGGATCATAATCAGCCATACCACATT TGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAAC ATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACA AATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCCTTGAC AGTACTCTTAAGTCGACTTACTAGGGACAGGATTGGTGACAGAAAAGCCCCATCC TTAGGCCTCCTCCTTCCTAGTCTCCTGATATTGGGTCTAACCCCCACCTCCTGTTA GGCAGATTCCTTATCTGGTGACACACCCCCATTTCCTGGAGCCATCTCTCTCCTTG CCAGAACCTCTAAGGTTTGCTTACGATGGAGCCAGAGAGGATCCTGGGAGGGAG AGCTTGGCAGGGGGTGGGAGGGAAGGGGGGGATGCGTGACCTGCCCGGTTCTC AGTGGCCACCCTGCGCTACCCTCTCCCAGAACCTGAGCTGCTCTGACGCGGCTG TCTGGTGCGTTTCACTGATCCTGGTGCTGCAGCTTCCTTACACTTCCCAAGAGGA GAAGCAGTTTGGAAAAACAAAATCAGAATAAGTTGGTCCTGAGTTCTAACTTTGGC TCTTCACCTTTCTAGTCCCCAATTTATATTGTTCCTCCGTGCGTCAGTTTTACCTGT GAGATAAGGCCAGTAGCCAGCCCCGTCCTGGCAGGGCTGTGGTGAGGAGGGGG - 79 - SIB BW1353R GTGTCCGTGTGGAAAACTCCCTTTGTGAGAATGGTGCGTCCTAGGTGTTCACCAG GTCGTGGCCGCCTCTACTCCCTTTCTCTTTCTCCATCCTTCTTTCCTTAAAGAGTC CCCAGTGCTATCTGGGACATATTCCTCCGCCCAGAGCAGGGTCCCGCTTCCCTAA GGCCCTGCTCTGGGCTTCTGGGTTTGAGTCCTTGGCAAGCCCAGGAGAGGCGCT CAGGCTTCCCTGTCCCCCTTCCTCGTCCACCATCTCATGCCCCTGGCTCTCCTGC CCCTTCCCTACAGGGGTTCCTGGCTCTGCTCTAAGCTTGGCGTAATCATGGTCAT AGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCC GGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAA TTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCA TTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTC CGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGT ATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCA GGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCC GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATC GACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGT TTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGG ATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGC TGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACG AACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTC CAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATT AGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAAC TACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTA CCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAG CGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAA GAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCAC GTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAA ATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACA GTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCA TCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTAC CATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAG ATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTG CAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGT AGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGG TGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAG GCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCT CCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAG - 80 - SIB BW1353R CACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGT GAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTT GCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCT CATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTG AGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTAC TTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAG GGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTAT TGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAG AAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACG TCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGG CCCTTTCGTC SEQ ID NO.63 : pAAV-Puro_TREbi-EGFP-(miR-E-NANOG)_MYOD1 FASTA: TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGA CGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCG CGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGC AGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAG GAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAA GGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGT GCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTA AAACGACGGCCAGTGAATTGTGCTTTCTCTGACCAGCATTCTCTCCCCTGGGCCT GTGCCGCTTTCTGTCTGTAGCTTGTGGCCTGGGTCACCTCTACGGCTGGCCCAGA TCCTTCCCTGCCGCCTCCTTCAGGTTCCGTCTTCCTCCACTCCCTCTTCCCCTTGC TCTCTGCTGTGTTGCTGCCCAAGGATGCTCTTTCCGGAGCACTTCCTTCTCGGCG CTGCACCACGTGATGTCCTCTGAGCGGATCCTCCCCGTGTCTGGGTCCTCTCCG GGCATCTCTCCTCCCTCACCCAACCCCATGCCGTCTTCACTCGCTGGGTTCCCTT TTCCTTCTCCTTCTGGGGCCTGTGCCATCTCTCGTTTCTTAGGATGGCCTTCTCCG ACGGATGTCTCCCTTGCGTCCCGCCTCCCCTTCTTGTAGGCCTGCATCATCACCG TTTTTCTGGACAACCCCAAAGTACCCCGTCTCCCTGGCTTTAGCCACCTCTCCATC CTCTTGCTTTCTTTGCCTGGACACCCCGTTCTCCTGTGGATTCGGGTCACCTCTCA CTCCTTTCATTTGGGCAGCTCCCCTACCCCCCTTACCTCTCTAGTCTGTGCTAGCT CTTCCAGCCCCCTGTCATGGCATCTTCCAGGGGTCCGAGAGCTCAGCTAGTCTTC TTCCTCCAACCCGGGCCCCTATGTCCACTTCAGGACAGCATGTTTGCTGCCTCCA GGGATCCTGTGTCCCCGAGCTGGGACCACCTTATATTCCCAGGGCCGGTTAATGT GGCTCTGGTTCTGGGTACTTTTATCTGTCCCCTCCACCCCACAGTGGGGCAAGCT - 81 - SIB BW1353R TCTGACCTCTTCTCTTCCTCCCACAGGGCCTCGAGAGATCTGGCAGCGGAGAGG GCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCTAGGC TCGAGATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCC CCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGC CACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTC TTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGG CGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTG TTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGC GCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGT GGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGC AGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCG CCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCT TCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGA CCCGCAAGCCCGGTGCCTGATCTAGAGGGCCCGTTTAAACCCGCTGATCAGCCT CGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTC CTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTG CATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGG ACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTG GGCTCTATGGTCACTCGACTCGACTAGGGATAACAGGGTAATTGTTTGAATGAGG CTTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAAACACTTGCTGGGATTA CTTCGACTTCTTAACCCAACAGAAGGCTCGAGAAGGTATATTGCTGTTGGCAGTG AGCGCTCCGACTGTAAAGAATCTTCATAGTGAAGCCACAGATGTATGAAGATTCTT TACAGTCGGATTGCCTACTGCCTCGGACTTCAAGGGGCTAGAATTCGAGCAATTA TCTTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGATACATTTTTACAAAGCTGA ATGCATGCGGCCGCCGTACGCTTACTTGTACAGCTCGTCCATGCCGAGAGTGATC CCGGCGGCGGTCACGAACTCCAGCAGGACCATGTGATCGCGCTTCTCGTTGGGG TCTTTGCTCAGGGCGGACTGGGTGCTCAGGTAGTGGTTGTCGGGCAGCAGCACG GGGCCGTCGCCGATGGGGGTGTTCTGCTGGTAGTGGTCGGCGAGCTGCACGCT GCCGTCCTCGATGTTGTGGCGGATCTTGAAGTTCACCTTGATGCCGTTCTTCTGC TTGTCGGCCATGATATAGACGTTGTGGCTGTTGTAGTTGTACTCCAGCTTGTGCC CCAGGATGTTGCCGTCCTCCTTGAAGTCGATGCCCTTCAGCTCGATGCGGTTCAC CAGGGTGTCGCCCTCGAACTTCACCTCGGCGCGGGTCTTGTAGTTGCCGTCGTC CTTGAAGAAGATGGTGCGCTCCTGGACGTAGCCTTCGGGCATGGCGGACTTGAA GAAGTCGTGCTGCTTCATGTGGTCGGGGTAGCGGCTGAAGCACTGCACGCCGTA GGTCAGGGTGGTCACGAGGGTGGGCCAGGGCACGGGCAGCTTGCCGGTGGTGC AGATGAACTTCAGGGTCAGCTTGCCGTAGGTGGCATCGCCCTCGCCCTCGCCGG - 82 - SIB BW1353R ACACGCTGAACTTGTGGCCGTTTACGTCGCCGTCCAGCTCGACCAGGATGGGCA CCACCCCGGTGAACAGCTCCTCGCCCTTGCTCACCATGGTGGCACTAGGCGATC TGACGGTTCACTAAACGAGCTCTGCTTATATAGGCCTCCCACCGTACACGCCACC TCGACATACTCGAGTTTACTCCCTATCAGTGATAGAGAACGTATGAAGAGTTTACT CCCTATCAGTGATAGAGAACGTATGCAGACTTTACTCCCTATCAGTGATAGAGAAC GTATAAGGAGTTTACTCCCTATCAGTGATAGAGAACGTATGACCAGTTTACTCCCT ATCAGTGATAGAGAACGTATCTACAGTTTACTCCCTATCAGTGATAGAGAACGTAT ATCCAGTTTACTCCCTATCAGTGATAGAGAACGTATAAGCTTTAGGCGTGTACGGT GGGCGCCTATAAAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGCAAT TCCACAACACTTTTGTCTTATACCAACTTTCCGTACCACTTCCTACCCTCGTAAACT AGTGCCACCATGGAGCTACTGTCGCCACCGCTCCGCGACGTAGACCTGACGGCC CCCGACGGCTCTCTCTGCTCCTTTGCCACAACGGACGACTTCTATGACGACCCGT GTTTCGACTCCCCGGACCTGCGCTTCTTCGAAGACCTGGACCCGCGCCTGATGC ACGTGGGCGCGCTCCTGAAACCCGAAGAGCACTCGCACTTCCCCGCGGCGGTG CACCCGGCCCCGGGCGCACGTGAGGACGAGCATGTGCGCGCGCCCAGCGGGC ACCACCAGGCGGGCCGCTGCCTACTGTGGGCCTGCAAGGCGTGCAAGCGCAAG ACCACCAACGCCGACCGCCGCAAGGCCGCCACCATGCGCGAGCGGCGCCGCCT GAGCAAAGTAAATGAGGCCTTTGAGACACTCAAGCGCTGCACGTCGAGCAATCCA AACCAGCGGTTGCCCAAGGTGGAGATCCTGCGCAACGCCATCCGCTATATCGAG GGCCTGCAGGCTCTGCTGCGCGACCAGGACGCCGCGCCCCCTGGCGCCGCAGC CGCCTTCTATGCGCCGGGCCCGCTGCCCCCGGGCCGCGGCGGCGAGCACTACA GCGGCGACTCCGACGCGTCCAGCCCGCGCTCCAACTGCTCCGACGGCATGATG GACTACAGCGGCCCCCCGAGCGGCGCCCGGCGGCGGAACTGCTACGAAGGCGC CTACTACAACGAGGCGCCCAGCGAACCCAGGCCCGGGAAGAGTGCGGCGGTGT CGAGCCTAGACTGCCTGTCCAGCATCGTGGAGCGCATCTCCACCGAGAGCCCTG CGGCGCCCGCCCTCCTGCTGGCGGACGTGCCTTCTGAGTCGCCTCCGCGCAGG CAAGAGGCTGCCGCCCCCAGCGAGGGAGAGAGCAGCGGCGACCCCACCCAGTC ACCGGACGCCGCCCCGCAGTGCCCTGCGGGTGCGAACCCCAACCCGATATACCA GGTGCTCTGAGAATTCGAGCTCGGTACCCGGGGATCCTCTAGTCAGCTGACGCG TGCTAGCGCGGCCGCATCGATAAGCTTGTCGACGATATCTCTAGAGGATCATAAT CAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCC CCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAG CTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTT TTTCACTGCCTTGACAGTACTCTTAAGTCGACTTACTAGGGACAGGATTGGTGACA GAAAAGCCCCATCCTTAGGCCTCCTCCTTCCTAGTCTCCTGATATTGGGTCTAACC CCCACCTCCTGTTAGGCAGATTCCTTATCTGGTGACACACCCCCATTTCCTGGAG - 83 - SIB BW1353R CCATCTCTCTCCTTGCCAGAACCTCTAAGGTTTGCTTACGATGGAGCCAGAGAGG ATCCTGGGAGGGAGAGCTTGGCAGGGGGTGGGAGGGAAGGGGGGGATGCGTG ACCTGCCCGGTTCTCAGTGGCCACCCTGCGCTACCCTCTCCCAGAACCTGAGCT GCTCTGACGCGGCTGTCTGGTGCGTTTCACTGATCCTGGTGCTGCAGCTTCCTTA CACTTCCCAAGAGGAGAAGCAGTTTGGAAAAACAAAATCAGAATAAGTTGGTCCT GAGTTCTAACTTTGGCTCTTCACCTTTCTAGTCCCCAATTTATATTGTTCCTCCGTG CGTCAGTTTTACCTGTGAGATAAGGCCAGTAGCCAGCCCCGTCCTGGCAGGGCT GTGGTGAGGAGGGGGGTGTCCGTGTGGAAAACTCCCTTTGTGAGAATGGTGCGT CCTAGGTGTTCACCAGGTCGTGGCCGCCTCTACTCCCTTTCTCTTTCTCCATCCTT CTTTCCTTAAAGAGTCCCCAGTGCTATCTGGGACATATTCCTCCGCCCAGAGCAG GGTCCCGCTTCCCTAAGGCCCTGCTCTGGGCTTCTGGGTTTGAGTCCTTGGCAAG CCCAGGAGAGGCGCTCAGGCTTCCCTGTCCCCCTTCCTCGTCCACCATCTCATGC CCCTGGCTCTCCTGCCCCTTCCCTACAGGGGTTCCTGGCTCTGCTCTAAGCTTGG CGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCA CACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGA GCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCT GTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCG TATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGG CTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAAT CAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGA ACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGA GCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAA AGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCC TGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTC TCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTG GGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAAC TATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCA CTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAA GTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTG CTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAA CCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAA AAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGA ACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACC TAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAA CTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGT CTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACG - 84 - SIB BW1353R GGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTC ACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAG AAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAG CTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACA GGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCC AACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTC CTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATG GTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTC TGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCG AGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTT TAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTA CCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAG CATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCC GCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTT TCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGA ATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGC CACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTA TCACGAGGCCCTTTCGTC SEQ ID NO 64: pCLYBL-Puro_CAG_Tet-On-3G_TRE-(intron-miR-E-NANOG)- MYOD1 FASTA: TCGAGTctccgcgcctacagctcaagccacatccgaagggggagggagccgggagctgcgcgcggggccgcc ggggggaggggtggcaccgcccacgccgggcggccacgaagggcggggcagcgggcgcgcgcccggcggggg gaggggccgcgcgccgcgcccgctgggaattggggccctagggggagggcggaggcgccgacgaccgcggcact taccgttcgcggcgtggcgcccggtggtccccaaggggagggaagggggaggcggggcgaggacagtgaccgga gtctcctcagcggtggcttttctgcttggcagcctcagcggctggcgccaaaaccggactccgcccacttcctcgcccctg cggtgcgagggtgtggaatcctccagacgctgggggagggggagttgggagcttaaaaactagtacccctttgggacc actttcagcagcgaactctcctgtacaccaggggtcagttccacagacgcgggccaggggtgggtcattgcggcgtgaa caataatttgactagaagttgattcgggtgtttccggaaggggccgagtcaatccgccgagttggggcacggaaaacaa aaagggaaggctactaagatttttctggcgggggttatcattggcgtaactgcagggaccacctcccgtactcGAGTG ACCATAGAGATTTTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCAT ATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCC CAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCA ATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTT GGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGAC - 85 - SIB BW1353R GGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTA CTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCC CACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATT TATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGC GCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGA GAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGG CGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGG GAGTCGCTGCGACGCTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCG CCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGG ACGGCCCTTCTCCTCCGGGCTGTAATTAGCGCTTGGTTTAATGACGGCTTGTTTCT TTTCTGTGGCTGCGTGAAAGCCTTGAGGGGCTCCGGGAGGGCCCTTTGTGCGGG GGGAGCGGCTCGGGGGGTGCGTGCGTGTGTGTGTGCGTGGGGAGCGCCGCGT GCGGCTCCGCGCTGCCCGGCGGCTGTGAGCGCTGCGGGCGCGGCGCGGGGCT TTGTGCGCTCCGCAGTGTGCGCGAGGGGAGCGCGGCCGGGGGCGGTGCCCCG CGGTGCGGGGGGGGCTGCGAGGGGAACAAAGGCTGCGTGCGGGGTGTGTGCG TGGGGGGGTGAGCAGGGGGTGTGGGCGCGTCGGTCGGGCTGCAACCCCCCCT GCACCCCCCTCCCCGAGTTGCTGAGCACGGCCCGGCTTCGGGTGCGGGGCTCC GTACGGGGCGTGGCGCGGGGCTCGCCGTGCCGGGCGGGGGGTGGCGGCAGGT GGGGGTGCCGGGCGGGGCGGGGCCGCCTCGGGCCGGGGAGGGCTCGGGGGA GGGGCGCGGCGGCCCCCGGAGCGCCGGCGGCTGTCGAGGCGCGGCGAGCCG CAGCCATTGCCTTTTATGGTAATCGTGCGAGAGGGCGCAGGGACTTCCTTTGTCC CAAATCTGTGCGGAGCCGAAATCTGGGAGGCGCCGCCGCACCCCCTCTAGCGG GCGCGGGGCGAAGCGGTGCGGCGCCGGCAGGAAGGAAATGGGCGGGGAGGGC CTTCGTGCGTCGCCGCGCCGCCGTCCCCTTCTCCCTCTCCAGCCTCGGGGCTGT CCGCGGGGGGACGGCTGCCTTCGGGGGGGACGGGGCAGGGCGGGGTTCGGCT TCTGGCGTGTGACCGGCGGCTCTAGAGCCTCTGCTAACCATGTTCATGCCTTCTT CTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTATTGTGCTGTCTCATCATTTTG GCAAAGAATTAATTCGGATCCATTCGAATGTCTAGACTGGACAAGAGCAAAGTCAT AAACTCTGCTCTGGAATTACTCAATGGAGTCGGTATCGAAGGCCTGACGACAAGG AAACTCGCTCAAAAGCTGGGAGTTGAGCAGCCTACCCTGTACTGGCACGTGAAGA ACAAGCGGGCCCTGCTCGATGCCCTGCCAATCGAGATGCTGGACAGGCATCATA CCCACTCCTGCCCCCTGGAAGGCGAGTCATGGCAAGACTTTCTGCGGAACAACG CCAAGTCATACCGCTGTGCTCTCCTCTCACATCGCGACGGGGCTAAAGTGCATCT CGGCACCCGCCCAACAGAGAAACAGTACGAAACCCTGGAAAATCAGCTCGCGTT CCTGTGTCAGCAAGGCTTCTCCCTGGAGAACGCACTGTACGCTCTGTCCGCCGT GGGCCACTTTACACTGGGCTGCGTATTGGAGGAACAGGAGCATCAAGTAGCAAAA - 86 - SIB BW1353R GAGGAAAGAGAGACACCTACCACCGATTCTATGCCCCCACTTCTGAAACAAGCAA TTGAGCTGTTCGACCGGCAGGGAGCCGAACCTGCCTTCCTTTTCGGCCTGGAACT AATCATATGTGGCCTGGAGAAACAGCTAAAGTGCGAAAGCGGCGGGCCGACCGA CGCCCTTGACGATTTTGACTTAGACATGCTCCCAGCCGATGCCCTTGACGACTTT GACCTTGATATGCTGCCTGCTGACGCTCTTGACGATTTTGACCTTGACATGCTCCC CGGGTAAACGCGTAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCC ATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCC ACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCA TTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAG AGAATAGCAGGCATGCTGGGGGTCGAAAATattaaatctcctcatccttccaacataaatatattttgg gattatatcaacattcaatgttacttaaagtgaccttgtaaatattttcacaactgagccatgtttgatttgtatacttatgtttacttt actgtttttcctgaagttaataattgccttgaatttatttatttctttaaaaatgtttcattactcaggactgtagtttacattacgattct ttgtgttatacagttgatgggtttcttttctttcttaatttctttaaaaaatagagatggggtcttactatattacccaggctggtcttg aagtcctgggctcaagtgatcttcctgtctcagcctaccaagtagctgagactataggtgcaaaaaagccactatacctgg ctagtttacaggttttaacaaatgcattatgccacgtatccattattacaggatcacacaagatattttcattaccctgaaagc atccctgtgttccaccaattcatcctgcctccatgagccgctggcaaccactgatctctatagttttgccttttctaaaatgtcat ataattggaatcatacagtctgtagcattttcagactagcttttaaaatttggcaatatgcatttaaggttcctccttaaatgtga agggcatagccaatgtggcttgatagctcatttctttttattggtgaatatttcattgtctggatgttccacagtttgtttatccattc acctattcaatttgctttttttctgtgtatctatcactaattcaatactggactctccaacagagccgtcccgcttccctaaggccc tgctctgggcttctgggtttgagtccttggcaagcccaggagaggcgctcaggcttccctgtcccccttcctcgtccaccatc tcatgcccctggctctcctgccccttccctacaggggttcctggctctgctctaagggcgaattcgccaggaaccgtaaaa aggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtg gcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgc cgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggt gtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcg tcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtat gtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgc tgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtt tgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtg gaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatga agttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagc gatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccc cagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaaggg ccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttc gccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagc tccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatc - 87 - SIB BW1353R gttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgta agatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggc gtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaa ctctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttca ccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgtt gaatactcatactcttcctttttcaatagcaggagaatcatgccaatgggccaatatacattctgacccacagtttcataata aaataaaatggttgtggttgtaagccactatgtttcagagtggtttgttacacagcaataaataactaatatagtaggcatac catcaagtccaaagtaggtagagaagaatgtaaatagcagagcaaaacagcatgactggtggctgggaggcttaaaa ctgggacaggatcagagtcatgaaagaagtcaaagaaatggttcagaagtaaggctgagactgacttacaaaagctg aaagtccctttaagttggtgtttggtgcattggcaggggcaggtatggtgacttaaaagagccatgctcaacaagatcaag cacaacacaatcacgggtcaccccagcagaccttagcgagtctagccatttctttggtggtggtcacagtcatgcttcagc ccagtttccacttggacaaatggtacatattttcaatgagatgaaaattaagatacaatccatgtgctcagagagtgatcac agctctgactaaacactgtgccccaaagtgttgaggaattgggaaaacctagctgagttagtggtctcttttctgttacaata aagctcataatgaaaattagccttctttgttcttccccaagtctttctttctagacgaaactactttcaactgttttaacttccttact gttaacttccatatttctagatagtatggtcagactgttatttcttgacttttaaatgtaagatattatctactgacttccttctatgta agatgaggattgagctctcttacccttctcccaTTAATTAActgacctcttctcttcctcccacagggcctcgagagatct ggcagcggagagggcagaggaagtcttctaacatgcggtgacgtggaggagaatcccggccctaggctcgagatga ccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccccagggccgtacgcaccctcgccgccgcgttc gccgactaccccgccacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaagaactctt cctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgc cggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggcc gcgcagcaacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggcg tctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccgg ggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgac gtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctgatctagagggcccgtttaaacc tgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtccttt cctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagca agggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatggatgcatgatctgcgatAAGT CGggGCGATCGCGAGTACTGTCAAGGCAGTGAAAAAAATGCTTTATTTGTGAAATT TGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAAC AACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTA AAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTATGATCCTCTAGAGATAT CGTCGACAAGCTTATCGATGCGGCCGCGCTAGCACGCGTCAGCTGACTAGAGGA TCCCCGGGTACCGAGCTCGAATTCttacttgtacagctcgtccatgccgccggtggagtggcggccctcg gcgcgttcgtactgttccacgatggtgtagtcctcgttgtgggaggtgatgtccaacttgatgttgacgttgtaggcgccggg cagctgcacgggcttcttggccttgtaggtggtcttgacctcagcgtcgtagtggccgccgtccttcagcttcagcctctgctt - 88 - SIB BW1353R gatctcgcccttcagggcgccgtcctcggggtacatccgctcggaggaggcctcccagcccatggtcttcttctgcattac ggggccgtcggaggggaagttggtgccgcgcagcttcaccttgtagatgaactcgccgtcctgcagggaggagtcctg ggtcacggtcaccacgccgccgtcctcgaagttcatcacgcgctcccacttgaagccctcggggaaggacagcttcaa gtagtcggggatgtcggcggggtgcttcacgtaggccttggagccgtacatgaactgaggggacaggatgtcccaggc gaagggcagggggccacccttggtcaccttcagcttggcggtctgggtgccctcgtaggggcggccctcgccctcgccc tcgatctcgaactcgtggccgttcacggagccctccatgtgcaccttgaagcgcatgaactccttgatgatggccatgttat cctcctcgcccttgctcaccatGGTGGCGGCGACTAGTAAATGATCCGAATTAATTCTTTGCC AAAATGATGAGACAGCACAATAACCAGCACGTTGCCCAGGAGCTGTAGGAAAAAG AAGAAGGCATGAACATGGTTAGCAGAGGCTCTAGAGCCGCCGGTCACACGCCAG AAGCCGAACCCCGCCCTGCCCCGTCCCCCCCGAAGGCAGCCGTCCCCCCGCGG ACAGCCCCGAGGCTGGAGAGGGAGAAGGGGACGGCGGCGCGGCGACGCACGA AGGCCCTCCCCGCCCATTTCCTTCCTGCCGGCGCCGCACCGCTTCGCCCCGCGC CCGCTAGAGGGGGTGCGGCGGCGCCTCCCAGATTTCGGCTCCGCACAGATTTGG GACAAAGGAAGTCCCTGCGCCCTCTCGCACGATTACCATAAAAGGCAATGGCTGC GGCTCGCCGCGCCTCGACAGCCGCCGGATCaattacgcgtcaattgatgcattcagctttgtaaaa atgtatcaaagagatagcaaggtattcagttttagtaaacaagataattgctcgaattctagccccttgaagtccgaggca gtaggcaagGTGCAGGTGagtcagtcCACCTGCACcAcgctcactgccaacagcaatataccttctcgag ccttctgttgggttaagaagtcgaagtaatcccagcaagtgtttccaagatgtgcaggcaacgattctgtaaagtactgaa gcctcattcaaacaattaccctgttatccctagtcgaggcggccCCGGCGCTCCGGGGGCCGCCGCGC CCCTCCCCCGAGCCCTCCCCGGCCCGAGGCGGCCCCGCCCCGCCCGGCACCCC CACCAGCCGCCACCCCCCGCCCGGCACGGCGAGCCCCGCGCCACGCCCCGTAC GGAGCCCCGCACCCGAAGCCGGGCCGTGCTCAGCAACTCGGGGAGGGGGGTG CAGGGGGGGTTGCAGCCCGACCGACGCGCCCACACCCCCTGCTCACCCCCCCA CGCACACACCCCGCACGCAGCCTTTGTTCCCCTCGCAGCCCCCCCCGCACCGCG GGGCACCGCCCCCGGCCGCGCTCCCCTCGCGCACACTGCGGAGCGCACAAAGC CCCGCGCCGCGCCCGCAGCGCTCACAGCCGCCGGGCAGCGCGGAGCCGCACG CGGCGCTCCCCACGCACACACACACGCACGCACCCCCCGAGCCGCTCCCCCCG CACAAAGGGCCCTCCCGGAGCCCCTCAAGGCTTTCACGCAGCCACAGAAAAGAA ACAAGCCGTCATTAAACCAAGCGCTAATTACAGCCCGGAGGAGAAGGGCCGTCC CGCCCGCTCACCTGTGGGAGTAACGCGGTCAGTCAGAGCCGGGGCGGGCGGCG CGAGGCGGCGGCGGAGCGGGGCACGGGGCGAAGGCAGCGTCGCAGCGACTCC CCGCCCGCCGCGCGCTAGTAAGTATAAGACAAAAGTGTTGTGGAATTGCTCCAGG CGATCTGACGGTTCACTAAACGAGCTCTGCTTTTATAGGCGCCCACCGTACACGC CTACCTCGACATACGTTCTCTATCACTGATAGGGAGTAAACTGGATATACGTTCTC TATCACTGATAGGGAGTAAACTGTAGATACGTTCTCTATCACTGATAGGGAGTAAA CTGGTCATACGTTCTCTATCACTGATAGGGAGTAAACTCCTTATACGTTCTCTATC - 89 - SIB BW1353R ACTGATAGGGAGTAAAGTCTGCATACGTTCTCTATCACTGATAGGGAGTAAACTCT TCATACGTTCTCTATCACTGATAGGGAGTAAAC SEQ ID NO 65: pCLYBL-Puro_CAGbi-NANOG-Tet-On-3G_TRE-(intron-miR-E- NANOG)-MYOD1 FASTA: taacctcgagccatggaacgaattctttgccaaaatgatgagacagcacaataaccagcacgttgcccaggagctgta ggaaaaagaagaaggcatgaacatggttagcagaggctctagagccgccggtcacacgccagaagccgaacccc gccctgccccgtcccccccgaaggcagccgtccccccgcggacagccccgaggctggagagggagaaggggacg gcggcgcggcgacgcacgaaggccctccccgcccatttccttcctgccggcgccgcaccgcttcgccccgcgcccgct agagggggtgcggcggcgcctcccagatttcggctccgcacagatttgggacaaaggaagtccctgcgccctctcgca cgattaccataaaaggcaatggctgcggctcgccgcgcctcgacagccgccggcgctccgggggccgccgcgcccct cccccgagccctccccggcccgaggcggccccgccccgcccggcacccccacctgccgccaccccccgcccggca cggcgagccccgcgccacgccccgtacggagccccgcacccgaagccgggccgtgctcagcaactcggggaggg gggtgcagggggggttgcagcccgaccgacgcgcccacaccccctgctcacccccccacgcacacaccccgcacg cagcctttgttcccctcgcagccccccccgcaccgcggggcaccgcccccggccgcgctcccctcgcgcacactgcgg agcgcacaaagccccgcgccgcgcccgcagcgctcacagccgccgggcagcgcggagccgcacgcggcgctccc cacgcacacacacacgcacgcaccccccgagccgctccccccgcacaaagggccctcccggagcccctcaaggct ttcacgcagccacagaaaagaaacaagccgtcattaaaccaagcgctaattacagcccggaggagaagggccgtcc cgcccgctcacctgtgggagtaacgcggtcagtcagagccggggcgggcggcgcgaggcggcggcggagcgggg cacggggcgaaggcagcgcgcagcgactcccgcccgccgcgcgcttcgctttttatagggccgccgccgccgccgcc tcgccataaaaggaaactttcggagcgcgccgctctgattggctgccgccgcacctctccgcctcgcccgccccgcccct cgccccgccccgccccgcctggcgcgcgccccccccccccccccgcccccatcgctgcacaaaataattaaaaaata aataaatacaaaattgggggtggggaggggggggagatggggagagtgaagcagaacgtggggctcacctcgacc atggtaatagcgatgactaatacgtagatgtactgccaagtaggaaagtcccataaggtcatgtactgggcataatgcca ggcgggccatttaccgtcattgacgtcaatagggggcgtacttggcatatgatacacttgatgtactgccaagtgggcagtt taccgtaaatactccacccattgacgtcaatggaaagtccctattggcgttactatgggaacatacgtcattattgacgtca atgggcgggggtcgttgggcggtcagccaggcgggccatttaccgtaagttatgtaacgcggaactccatatatgggcta tgaactaatgaccccgtaattgattactattaataactagtcaataatcaatgtcgagaacccatggtaatagcgatgacta atacgtagatgtactgccaagtaggaaagtcccataaggtcatgtactgggcataatgccaggcgggccatttaccgtca ttgacgtcaatagggggcgtacttggcatatgatacacttgatgtactgccaagtgggcagtttaccgtaaatactccaccc attgacgtcaatggaaagtccctattggcgttactatgggaacatacgtcattattgacgtcaatgggcgggggtcgttggg cggtcagccaggcgggccatttaccgtaagttatgtaacgcggaactccatatatgggctatgaactaatgaccccgtaa ttgattactattaataactagtcaataatcaatgtcgagaacccatggtaatagcgatgactaatacgtagatgtactgcca agtaggaaagtcccataaggtcatgtactgggcataatgccaggcgggccatttaccgtcattgacgtcaatagggggc gtacttggcatatgatacacttgatgtactgccaagtgggcagtttaccgtaaatactccacccattgacgtcaatggaaag - 90 - SIB BW1353R tccctattggcgttactatgggaacatacgtcattattgacgtcaatgggcgggggtcgttgggcggtcagccaggcgggc catttaccgtaagttatgtaacgcggaactccatatatgggctatgaactaatgaccccgtaattgattactattaataactag tcaataatcaatgtcgagaacccatggtaatagcgatgactaatacgtagatgtactgccaagtaggaaagtcccataa ggtcatgtactgggcataatgccaggcgggccatttaccgtcattgacgtcaatagggggcgtacttggcatatgatacac ttgatgtactgccaagtgggcagtttaccgtaaatactccacccattgacgtcaatggaaagtccctattggcgttactatgg gaacatacgtcattattgacgtcaatgggcgggggtcgttgggcggtcagccaggcgggccatttaccgtaagttatgtaa cgcggaactccatatatgggctatgaactaatgaccccgtaattgattactattaataactagtcaataatcaatgtcgagc catggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttatttttta attattttgtgcagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggc ggggcgggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgagg cggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgcgctgccttcgccccgtgc cccgctccgccgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggac ggcccttctcctccgggctgtaattagcgcttggtttaatgacggcttgtttcttttctgtggctgcgtgaaagccttgaggggct ccgggagggccctttgtgcggggggagcggctcggggggtgcgtgcgtgtgtgtgtgcgtggggagcgccgcgtgcgg ctccgcgctgcccggcggctgtgagcgctgcgggcgcggcgcggggctttgtgcgctccgcagtgtgcgcgagggga gcgcggccgggggcggtgccccgcggtgcggggggggctgcgaggggaacaaaggctgcgtgcggggtgtgtgcg tgggggggtgagcagggggtgtgggcgcgtcggtcgggctgcaaccccccctgcacccccctccccgagttgctgagc acggcccggcttcgggtgcggggctccgtacggggcgtggcgcggggctcgccgtgccgggcggggggtggcggca ggtgggggtgccgggcggggcggggccgcctcgggccggggagggctcgggggaggggcgcggcggcccccgg agcgccggcggctgtcgaggcgcggcgagccgcagccattgccttttatggtaatcgtgcgagagggcgcagggactt cctttgtcccaaatctgtgcggagccgaaatctgggaggcgccgccgcaccccctctagcgggcgcggggcgaagcg gtgcggcgccggcaggaaggaaatgggcggggagggccttcgtgcgtcgccgcgccgccgtccccttctccctctcca gcctcggggctgtccgcggggggacggctgccttcgggggggacggggcagggcggggttcggcttctggcgtgtga ccggcggctctagagcctctgctaaccatgttcatgccttcttctttttcctacagctcctgggcaacgtgctggttattgtgctgt ctcatcattttggcaaagaattcgCcATCGATaccatgagtgtagatccagcttgtccccaaagcttgccttgctttgaa gcatccgactgtaaagaatcttcacctatgcctgtgatttgtgggcctgaagaaaactatccatccttgcaaatgtcttctgct gagatgcctcacacggagactgtctctcctcttccCtcctccatggatctgcttattcaggacagccctgattcttccaccagt cccaaaggcaaacaacccacttctgcagagaaTagtgtcgcaaaaaaggaagacaaggtcccAgtcaagaaaca gaagaccagaactgtgttctcttccacccagctgtgtgtactcaatgatagatttcagagacagaaatacctcagTctcca gcagatgcaagaactctccaacatcctgaacctcagctacaaacaggtgaagacctggttccagaaccagagaatga aatctaagaggtggcagaaaaacaactggccgaagaatagcaatggtgtgacgcagaaggcctcagcacctaccta ccccagcctCtactcttcctaccaccagggatgcctggtgaacccgactgggaaccttccaatgtggagcaaccagacc tggaacaattcaacctggagcaaccagacccagaacatccagtcctggagcaaccactcctggaacactcagacctg gtgcacccaatcctggaacaatcaggcctggaacagtcccttctataactgtggagaggaatctctgcagtcctgcatgc agttccagccaaattctcctgccagtgacttggaggctgcTttggaagctgctggggaaggccttaatgtaatacagcag accactaggtattttagtactccacaaaccatggatttattcctaaactactccatgaacatgcaacctgaagacgtgtgaG - 91 - SIB BW1353R GATCCacgcgtgaattcactcctcaggtgcaggctgcctatcagaaggtggtggctggtgtggccaatgccctggctc acaaataccactgagatctttttccctctgccaaaaattatggggacatcatgaagccccttgagcatctgacttctggctaa taaaggaaatttattttcattgcaatagtgtgttggaattttttgtgtctctcactcggaaggacatatgggagctgacgggcac cggagcgatcgcagatcatgcatccatagagcccaccgcatccccagcatgcctgctattgtcttcccaatcctccccctt gctgtcctgccccaccccaccccccagaatagaatgacacctactcagacaatgcgatgcaatttcctcattttattagga aaggacagtgggagtggcaccttccagggtcaaggaaggcacgggggaggggcaaacaacagatggctggcaac tagaaggcacaggtttaaacgggccctctagatcaggcaccgggcttgcgggtcatgcaccaggtgcgcggtccttcgg gcacctcgacgtcggcggtgacggtgaagccgagccgctcgtagaaggggaggttgcggggcgcggaggtctccag gaaggcgggcaccccggcgcgctcggccgcctccactccggggagcacgacggcgctgcccagacccttgccctgg tggtcgggcgagacgccgacggtggccaggaaccacgcgggctccttgggccggtgcggcgccaggaggccttcca tctgttgctgcgcggccagccgggaaccgctcaactcggccatgcgcgggccgatctcggcgaacaccgcccccgctt cgacgctctccggcgtggtccagaccgccaccgcggcgccgtcgtccgcgacccacaccttgccgatgtcgagcccg acgcgcgtgaggaagagttcttgcagctcggtgacccgctcgatgtggcggtccggatcgacggtgtggcgcgtggcg gggtagtcggcgaacgcggcggcgagggtgcgtacggccctggggacgtcgtcgcgggtggcgaggcgcaccgtg ggcttgtactcggtcatctcgagcctagggccgggattctcctccacgtcaccgcatgttagaagacttcctctgccctctcc gctgccagatctctcgaggccctgtgggaggaagagaagaggtcagaagcttataacttcgtataatgtatgctatacga agttattgccccactgtggggccgctgggagaagggtaagagagctcaatcctcatcttacatagaaggaagtcagtag ataatatcttacatttaaaagtcaagaaataacagtctgaccatactatctagaaatatggaagttaacagtaaggaagtt aaaacagttgaaagtagtttcgtctagaaagaaagacttggggaagaacaaagaaggctaattttcattatgagctttatt gtaacagaaaagagaccactaactcagctaggttttcccaattcctcaacactttggggcacagtgtttagtcagagctgt gatcactctctgagcacatggattgtatcttaattttcatctcattgaaaatatgtaccatttgtccaagtggaaactgggctga agcatgactgtgaccaccaccaaagaaatggctagactcgctaaggtctgctggggtgacccgtgattgtgttgtgcttga tcttgttgagcatggctcttttaagtcaccatacctgcccctgccaatgcaccaaacaccaacttaaagggactttcagctttt gtaagtcagtctcagccttacttctgaaccatttctttgacttctttcatgactctgatcctgtcccagttttaagcctcccagcca ccagtcatgctgttttgctctgctatttacattcttctctacctactttggacttgatggtatgcctactatattagttatttattgctgtg taacaaaccactctgaaacatagtggcttacaaccacaaccattttattttattatgaaactgtgggtcagaatgtatattggc ccattggcatgattctcctgctattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggc attttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggtt acatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaa agttctgctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattctcagaat gacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccat aaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcaca acatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgaca ccacgatgcctgtagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaa ttaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgata aatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagtt - 92 - SIB BW1353R atctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaag cattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaag atcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaa aggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttg ccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgt agccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgc tgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctga acggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatg agaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagc gcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgattt ttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggcgaattcgcc cttagagcagagccaggaacccctgtagggaaggggcaggagagccaggggcatgagatggtggacgaggaagg gggacagggaagcctgagcgcctctcctgggcttgccaaggactcaaacccagaagcccagagcagggccttaggg aagcgggacggctctgttggagagtccagtattgaattagtgatagatacacagaaaaaaagcaaattgaataggtga atggataaacaaactgtggaacatccagacaatgaaatattcaccaataaaaagaaatgagctatcaagccacattgg ctatgcccttcacatttaaggaggaaccttaaatgcatattgccaaattttaaaagctagtctgaaaatgctacagactgtat gattccaattatatgacattttagaaaaggcaaaactatagagatcagtggttgccagcggctcatggaggcaggatgaa ttggtggaacacagggatgctttcagggtaatgaaaatatcttgtgtgatcctgtaataatggatacgtggcataatgcattt gttaaaacctgtaaactagccaggtatagtggcttttttgcacctatagtctcagctacttggtaggctgagacaggaagatc acttgagcccaggacttcaagaccagcctgggtaatatagtaagaccccatctctattttttaaagaaattaagaaagaaa agaaacccatcaactgtataacacaaagaatcgtaatgtaaactacagtcctgagtaatgaaacatttttaaagaaataa ataaattcaaggcaattattaacttcaggaaaaacagtaaagtaaacataagtatacaaatcaaacatggctcagttgtg aaaatatttacaaggtcactttaagtaacattgaatgttgatataatcccaaaatatatttatgttggaaggatgaggagattt aattaagggaggtggtccctgcagttacgccaatgataacccccgccagaaaaatcttagtagccttccctttttgttttccgt gccccaactcggcggattgactcggccccttccggaaacacccgaatcaacttctagtcaaattattgttcacgccgcaat gacccacccctggcccgcgtctgtggaactgacccctggtgtacaggagagttcgctgctgaaagtggtcccaaaggg gtactagtttttaagctcccaactccccctcccccagcgtctggaggattccacaccctcgcaccgcaggggcgaggaa gtgggcggagtccggttttggcgccagccgctgaggctgccaagcagaaaagccaccgctgaggagactccggtcac tgtcctcgccccgcctcccccttccctccccttggggaccaccgggcgccacgccgcgaacggtaagtgccgcggtcgt cggcgcctccgccctccccctagggccccaattcccagcgggcgcggcgcgcggcccctccccccgccgggcgcgc gcccgctgccccgcccttcgtggccgcccggcgtgggcggtgccacccctccccccggcggccccgcgcgcagctcc cggctccctcccccttcggatgtggcttgagctgtaggcgcggaggTCGAGTTTACTCCCTATCAGTGAT AGAGAACGTATGAAGAGTTTACTCCCTATCAGTGATAGAGAACGTATGCAGACTTT ACTCCCTATCAGTGATAGAGAACGTATAAGGAGTTTACTCCCTATCAGTGATAGAG AACGTATGACCAGTTTACTCCCTATCAGTGATAGAGAACGTATCTACAGTTTACTC CCTATCAGTGATAGAGAACGTATATCCAGTTTACTCCCTATCAGTGATAGAGAACG - 93 - SIB BW1353R TATGTCGAGGTAGGCGTGTACGGTGGGCGCCTATAAAAGCAGAGCTCGTTTAGTG AACCGTCAGATCGCCTGGAGCAATTCCACAACACTTTTGTCTTATACTTACTAGCG CGCGGCGGGCGGGGAGTCGCTGCGACGCTGCCTTCGCCCCGTGCCCCGCTCCG CCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAG GTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCGCTTGGTTTAA TGACGGCTTGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTGAGGGGCTCCGGGAG GGCCCTTTGTGCGGGGGGAGCGGCTCGGGGGGTGCGTGCGTGTGTGTGTGCGT GGGGAGCGCCGCGTGCGGCTCCGCGCTGCCCGGCGGCTGTGAGCGCTGCGGG CGCGGCGCGGGGCTTTGTGCGCTCCGCAGTGTGCGCGAGGGGAGCGCGGCCG GGGGCGGTGCCCCGCGGTGCGGGGGGGGCTGCGAGGGGAACAAAGGCTGCGT GCGGGGTGTGTGCGTGGGGGGGTGAGCAGGGGGTGTGGGCGCGTCGGTCGGG CTGCAACCCCCCCTGCACCCCCCTCCCCGAGTTGCTGAGCACGGCCCGGCTTCG GGTGCGGGGCTCCGTACGGGGCGTGGCGCGGGGCTCGCCGTGCCGGGCGGGG GGTGGCGGCTGGTGGGGGTGCCGGGCGGGGCGGGGCCGCCTCGGGCCGGGG AGGGCTCGGGGGAGGGGCGCGGCGGCCCCCGGAGCGCCGGggccgcctcgactaggg ataacagggtaattgtttgaatgaggcttcagtactttacagaatcgttgcctgcacatcttggaaacacttgctgggattact tcgacttcttaacccaacagaaggctcgagaaggtatattgctgttggcagtgAGCGCTCCGACTGTAAAGA ATCTTCATAGTGAAGCCACAGATGTATGAAGATTCTTTACAGTCGGATtgcctactgcctc ggacttcaaggggctagaattcgagcaattatcttgtttactaaaactgaataccttgctatctctttgatacatttttacaaagc tgaatgcatcaattgacgcgtaattGATCCGGCGGCTGTCGAGGCGCGGCGAGCCGCAGCCA TTGCCTTTTATGGTAATCGTGCGAGAGGGCGCAGGGACTTCCTTTGTCCCAAATC TGTGCGGAGCCGAAATCTGGGAGGCGCCGCCGCACCCCCTCTAGCGGGCGCGG GGCGAAGCGGTGCGGCGCCGGCAGGAAGGAAATGGGCGGGGAGGGCCTTCGT GCGTCGCCGCGCCGCCGTCCCCTTCTCCCTCTCCAGCCTCGGGGCTGTCCGCG GGGGGACGGCTGCCTTCGGGGGGGACGGGGCAGGGCGGGGTTCGGCTTCTGG CGTGTGACCGGCGGCTCTAGAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTT CCTACAGCTCCTGGGCAACGTGCTGGTTATTGTGCTGTCTCATCATTTTGGCAAA GAATTAATTCGGATCATTTACTAGTGCCACCATGGAGCTACTGTCGCCACCGCTC CGCGACGTAGACCTGACGGCCCCCGACGGCTCTCTCTGCTCCTTTGCCACAACG GACGACTTCTATGACGACCCGTGTTTCGACTCCCCGGACCTGCGCTTCTTCGAAG ACCTGGACCCGCGCCTGATGCACGTGGGCGCGCTCCTGAAACCCGAAGAGCACT CGCACTTCCCCGCGGCGGTGCACCCGGCCCCGGGCGCACGTGAGGACGAGCAT GTGCGCGCGCCCAGCGGGCACCACCAGGCGGGCCGCTGCCTACTGTGGGCCTG CAAGGCGTGCAAGCGCAAGACCACCAACGCCGACCGCCGCAAGGCCGCCACCA TGCGCGAGCGGCGCCGCCTGAGCAAAGTAAATGAGGCCTTTGAGACACTCAAGC GCTGCACGTCGAGCAATCCAAACCAGCGGTTGCCCAAGGTGGAGATCCTGCGCA - 94 - SIB BW1353R ACGCCATCCGCTATATCGAGGGCCTGCAGGCTCTGCTGCGCGACCAGGACGCCG CGCCCCCTGGCGCCGCAGCCGCCTTCTATGCGCCGGGCCCGCTGCCCCCGGGC CGCGGCGGCGAGCACTACAGCGGCGACTCCGACGCGTCCAGCCCGCGCTCCAA CTGCTCCGACGGCATGATGGACTACAGCGGCCCCCCGAGCGGCGCCCGGCGGC GGAACTGCTACGAAGGCGCCTACTACAACGAGGCGCCCAGCGAACCCAGGCCC GGGAAGAGTGCGGCGGTGTCGAGCCTAGACTGCCTGTCCAGCATCGTGGAGCG CATCTCCACCGAGAGCCCTGCGGCGCCCGCCCTCCTGCTGGCGGACGTGCCTTC TGAGTCGCCTCCGCGCAGGCAAGAGGCTGCCGCCCCCAGCGAGGGAGAGAGCA GCGGCGACCCCACCCAGTCACCGGACGCCGCCCCGCAGTGCCCTGCGGGTGCG AACCCCAACCCGATATACCAGGTGCTCTGAGAATTCGAGCTCGGTACCCGGGGAT CCTCTAGTCAGCTGACGCGTGCTAGCGCGGCCGCATCGATAAGCTTGTCGACGA TATCTCTAGAGGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTA AAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGT TGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAA TTTCACAAATAAAGCATTTTTTTCACTGCCTTGACAGTACTCTTAAcCCAGCATGCC TGCTATTCTCTTCCCAATCCTCCCCCTTGCTGTCCTGCCCCACCCCACCCCCCAG AATAGAATGACACCTACTCAGACAATGCGATGCAATTTCCTCATTTTATTAGGAAA GGACAGTGGGAGTGGCACCTTCCAGGGTCAAGGAAGGCACGGGGGAGGGGCAA ACAACAGATGGCTGGCAACTAGAAGGCACAGTCGAGGCTGATCAGCGAGCTACG CGTTTACCCGGGGAGCATGTCAAGGTCAAAATCGTCAAGAGCGTCAGCAGGCAG CATATCAAGGTCAAAGTCGTCAAGGGCATCGGCTGGGAGCATGTCTAAGTCAAAA TCGTCAAGGGCGTCGGTCGGCCCGCCGCTTTCGCACTTTAGCTGTTTCTCCAGG CCACATATGATTAGTTCCAGGCCGAAAAGGAAGGCAGGTTCGGCTCCCTGCCGG TCGAACAGCTCAATTGCTTGTTTCAGAAGTGGGGGCATAGAATCGGTGGTAGGTG TCTCTCTTTCCTCTTTTGCTACTTGATGCTCCTGTTCCTCCAATACGCAGCCCAGT GTAAAGTGGCCCACGGCGGACAGAGCGTACAGTGCGTTCTCCAGGGAGAAGCCT TGCTGACACAGGAACGCGAGCTGATTTTCCAGGGTTTCGTACTGTTTCTCTGTTG GGCGGGTGCCGAGATGCACTTTAGCCCCGTCGCGATGTGAGAGGAGAGCACAG CGGTATGACTTGGCGTTGTTCCGCAGAAAGTCTTGCCATGACTCGCCTTCCAGGG GGCAGGAGTGGGTATGATGCCTGTCCAGCATCTCGATTGGCAGGGCATCGAGCA GGGCCCGCTTGTTCTTCACGTGCCAGTACAGGGTAGGCTGCTCAACTCCCAGCTT TTGAGCGAGTTTCCTTGTCGTCAGGCCTTCGATACCGACTCCATTGAGTAATTCCA GAGCAGAGTTTATGACTTTGCTCTTGTCCAGTCTAGACATGGTGGacgcg SEQ ID NO 66: NANOG-P2A-T2A-mCherry cDNA - 95 - SIB BW1353R ATGAGTGTAGATCCAGCTTGTCCCCAAAGCTTGCCTTGCTTTGAAGCATCCGACT GTAAAGAATCTTCACCTATGCCTGTGATTTGTGGGCCTGAAGAAAACTATCCATCC TTGCAAATGTCTTCTGCTGAGATGCCTCACACGGAGACTGTCTCTCCTCTTCCCTC CTCCATGGATCTGCTTATTCAGGACAGCCCTGATTCTTCCACCAGTCCCAAAGGC AAACAACCCACTTCTGCAGAGAATAGTGTCGCAAAAAAGGAAGACAAGGTCCCAG TCAAGAAACAGAAGACCAGAACTGTGTTCTCTTCCACCCAGCTGTGTGTACTCAAT GATAGATTTCAGAGACAGAAATACCTCAGTCTCCAGCAGATGCAAGAACTCTCCAA CATCCTGAACCTCAGCTACAAACAGGTGAAGACCTGGTTCCAGAACCAGAGAATG AAATCTAAGAGGTGGCAGAAAAACAACTGGCCGAAGAATAGCAATGGTGTGACGC AGAAGGCCTCAGCACCTACCTACCCCAGCCTCTACTCTTCCTACCACCAGGGATG CCTGGTGAACCCGACTGGGAACCTTCCAATGTGGAGCAACCAGACCTGGAACAAT TCAACCTGGAGCAACCAGACCCAGAACATCCAGTCCTGGAGCAACCACTCCTGGA ACACTCAGACCTGGTGCACCCAATCCTGGAACAATCAGGCCTGGAACAGTCCCTT CTATAACTGTGGAGAGGAATCTCTGCAGTCCTGCATGCAGTTCCAGCCAAATTCT CCTGCCAGTGACTTGGAGGCTGCTTTGGAAGCTGCTGGGGAAGGCCTTAATGTAA TACAGCAGACCACTAGGTATTTTAGTACTCCACAAACCATGGATTTATTCCTAAACT ACTCCATGAACATGCAACCTGAAGACGTGGGATCCGGAAGCGGAgctactaacttcagcc tgctgaagcaggctggagacgtggaggagaaccctggacctggaagcggagagggcagaggaagtctgctaacat gcggtgacgtcgaggagaatcctggacctatggtgagcaagggcgaggaggataacatggccatcatcaaggagttc atgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcc cctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtccc ctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgag ggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggac ggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccat gggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaa gctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccgg cgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcg ccgagggccgccactccaccggcggcatggacgagctgtacaagtaa SEQ ID NO 67: CAG promoter CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCG CCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCC ATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCA AGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCC GCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACAT CTACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCA - 96 - SIB BW1353R CTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAAT TATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGCGCGCGCCAGGCGG GGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGC AGCCAATCAGAGCGGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCG GCGGCGGCCCTATAAAAAGCGAAGCGCGCGGCGGGCGGGGAGTCGCTGCGACG CTGCCTTCGCCCCGTGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGC TCTGACTGACCGCGTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTC CGGGCTGTAATTAGCGCTTGGTTTAATGACGGCTTGTTTCTTTTCTGTGGCTGCGT GAAAGCCTTGAGGGGCTCCGGGAGGGCCCTTTGTGCGGGGGGAGCGGCTCGGG GGGTGCGTGCGTGTGTGTGTGCGTGGGGAGCGCCGCGTGCGGCTCCGCGCTGC CCGGCGGCTGTGAGCGCTGCGGGCGCGGCGCGGGGCTTTGTGCGCTCCGCAGT GTGCGCGAGGGGAGCGCGGCCGGGGGCGGTGCCCCGCGGTGCGGGGGGGGC TGCGAGGGGAACAAAGGCTGCGTGCGGGGTGTGTGCGTGGGGGGGTGAGCAGG GGGTGTGGGCGCGTCGGTCGGGCTGCAACCCCCCCTGCACCCCCCTCCCCGAG TTGCTGAGCACGGCCCGGCTTCGGGTGCGGGGCTCCGTACGGGGCGTGGCGCG GGGCTCGCCGTGCCGGGCGGGGGGTGGCGGCAGGTGGGGGTGCCGGGCGGG GCGGGGCCGCCTCGGGCCGGGGAGGGCTCGGGGGAGGGGCGCGGCGGCCCC CGGAGCGCCGGCGGCTGTCGAGGCGCGGCGAGCCGCAGCCATTGCCTTTTATG GTAATCGTGCGAGAGGGCGCAGGGACTTCCTTTGTCCCAAATCTGTGCGGAGCC GAAATCTGGGAGGCGCCGCCGCACCCCCTCTAGCGGGCGCGGGGCGAAGCGGT GCGGCGCCGGCAGGAAGGAAATGGGCGGGGAGGGCCTTCGTGCGTCGCCGCG CCGCCGTCCCCTTCTCCCTCTCCAGCCTCGGGGCTGTCCGCGGGGGGACGGCT GCCTTCGGGGGGGACGGGGCAGGGCGGGGTTCGGCTTCTGGCGTGTGACCGG CGGCTCTAGAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAG SEQ ID NO 68: Tet-On 3G cDNA ATGTCTAGACTGGACAAGAGCAAAGTCATAAACTCTGCTCTGGAATTACTCAATGG AGTCGGTATCGAAGGCCTGACGACAAGGAAACTCGCTCAAAAGCTGGGAGTTGA GCAGCCTACCCTGTACTGGCACGTGAAGAACAAGCGGGCCCTGCTCGATGCCCT GCCAATCGAGATGCTGGACAGGCATCATACCCACTCCTGCCCCCTGGAAGGCGA GTCATGGCAAGACTTTCTGCGGAACAACGCCAAGTCATACCGCTGTGCTCTCCTC TCACATCGCGACGGGGCTAAAGTGCATCTCGGCACCCGCCCAACAGAGAAACAG TACGAAACCCTGGAAAATCAGCTCGCGTTCCTGTGTCAGCAAGGCTTCTCCCTGG AGAACGCACTGTACGCTCTGTCCGCCGTGGGCCACTTTACACTGGGCTGCGTATT GGAGGAACAGGAGCATCAAGTAGCAAAAGAGGAAAGAGAGACACCTACCACCGA TTCTATGCCCCCACTTCTGAAACAAGCAATTGAGCTGTTCGACCGGCAGGGAGCC - 97 - SIB BW1353R GAACCTGCCTTCCTTTTCGGCCTGGAACTAATCATATGTGGCCTGGAGAAACAGC TAAAGTGCGAAAGCGGCGGGCCGACCGACGCCCTTGACGATTTTGACTTAGACAT GCTCCCAGCCGATGCCCTTGACGACTTTGACCTTGATATGCTGCCTGCTGACGCT CTTGACGATTTTGACCTTGACATGCTCCCCGGGTAA SEQ ID NO 69: MYOD1 cDNA + NANOG miRNA 3’UTR ACTAGTGCCACCATGGAGCTACTGTCGCCACCGCTCCGCGACGTAGACCTGACG GCCCCCGACGGCTCTCTCTGCTCCTTTGCCACAACGGACGACTTCTATGACGACC CGTGTTTCGACTCCCCGGACCTGCGCTTCTTCGAAGACCTGGACCCGCGCCTGA TGCACGTGGGCGCGCTCCTGAAACCCGAAGAGCACTCGCACTTCCCCGCGGCG GTGCACCCGGCCCCGGGCGCACGTGAGGACGAGCATGTGCGCGCGCCCAGCG GGCACCACCAGGCGGGCCGCTGCCTACTGTGGGCCTGCAAGGCGTGCAAGCGC AAGACCACCAACGCCGACCGCCGCAAGGCCGCCACCATGCGCGAGCGGCGCCG CCTGAGCAAAGTAAATGAGGCCTTTGAGACACTCAAGCGCTGCACGTCGAGCAAT CCAAACCAGCGGTTGCCCAAGGTGGAGATCCTGCGCAACGCCATCCGCTATATC GAGGGCCTGCAGGCTCTGCTGCGCGACCAGGACGCCGCGCCCCCTGGCGCCGC AGCCGCCTTCTATGCGCCGGGCCCGCTGCCCCCGGGCCGCGGCGGCGAGCACT ACAGCGGCGACTCCGACGCGTCCAGCCCGCGCTCCAACTGCTCCGACGGCATGA TGGACTACAGCGGCCCCCCGAGCGGCGCCCGGCGGCGGAACTGCTACGAAGGC GCCTACTACAACGAGGCGCCCAGCGAACCCAGGCCCGGGAAGAGTGCGGCGGT GTCGAGCCTAGACTGCCTGTCCAGCATCGTGGAGCGCATCTCCACCGAGAGCCC TGCGGCGCCCGCCCTCCTGCTGGCGGACGTGCCTTCTGAGTCGCCTCCGCGCA GGCAAGAGGCTGCCGCCCCCAGCGAGGGAGAGAGCAGCGGCGACCCCACCCAG TCACCGGACGCCGCCCCGCAGTGCCCTGCGGGTGCGAACCCCAACCCGATATAC CAGGTGCTCTGAGAATTCGAGCTCGGTACCCGGGGATCCTCTAGTCAGCTGACG CGTGCTAGCGCggccgcctcgactagggataacagggtaattgtttgaatgaggcttcagtactttacagaatcgt tgcctgcacatcttggaaacacttgctgggattacttcgacttcttaacccaacagaaggctcgagaaggtatattgctgttg gcagtgAGCGCTCCGACTGTAAAGAATCTTCATAGTGAAGCCACAGATGTATGAAGA TTCTTTACAGTCGGATtgcctactgcctcggacttcaaggggctagaattcgagcaattatcttgtttactaaaac tgaataccttgctatctctttgatacatttttacaaagctgaatgcatcaattgacgcgtaattGATATCTCTAGAGGA TCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCAC ACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTA TTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAG CATTTTTTTCACTGC SEQ ID NO 70: NANOG miRNA intron + MYOD1 cDNA - 98 - SIB BW1353R ACTAGCGCGCGGCGGGCGGGGAGTCGCTGCGACGCTGCCTTCGCCCCGTGCCC CGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACT CCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCGCTT GGTTTAATGACGGCTTGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTGAGGGGCTC CGGGAGGGCCCTTTGTGCGGGGGGAGCGGCTCGGGGGGTGCGTGCGTGTGTGT GTGCGTGGGGAGCGCCGCGTGCGGCTCCGCGCTGCCCGGCGGCTGTGAGCGC TGCGGGCGCGGCGCGGGGCTTTGTGCGCTCCGCAGTGTGCGCGAGGGGAGCG CGGCCGGGGGCGGTGCCCCGCGGTGCGGGGGGGGCTGCGAGGGGAACAAAGG CTGCGTGCGGGGTGTGTGCGTGGGGGGGTGAGCAGGGGGTGTGGGCGCGTCG GTCGGGCTGCAACCCCCCCTGCACCCCCCTCCCCGAGTTGCTGAGCACGGCCC GGCTTCGGGTGCGGGGCTCCGTACGGGGCGTGGCGCGGGGCTCGCCGTGCCG GGCGGGGGGTGGCGGCTGGTGGGGGTGCCGGGCGGGGCGGGGCCGCCTCGG GCCGGGGAGGGCTCGGGGGAGGGGCGCGGCGGCCCCCGGAGCGCCGGggccgc ctcgactagggataacagggtaattgtttgaatgaggcttcagtactttacagaatcgttgcctgcacatcttggaaacactt gctgggattacttcgacttcttaacccaacagaaggctcgagaaggtatattgctgttggcagtgAGCGCTCCGAC TGTAAAGAATCTTCATAGTGAAGCCACAGATGTATGAAGATTCTTTACAGTCGGATt gcctactgcctcggacttcaaggggctagaattcgagcaattatcttgtttactaaaactgaataccttgctatctctttgatac atttttacaaagctgaatgcatcaattgacgcgtaattGATCCGGCGGCTGTCGAGGCGCGGCGAGC CGCAGCCATTGCCTTTTATGGTAATCGTGCGAGAGGGCGCAGGGACTTCCTTTGT CCCAAATCTGTGCGGAGCCGAAATCTGGGAGGCGCCGCCGCACCCCCTCTAGCG GGCGCGGGGCGAAGCGGTGCGGCGCCGGCAGGAAGGAAATGGGCGGGGAGGG CCTTCGTGCGTCGCCGCGCCGCCGTCCCCTTCTCCCTCTCCAGCCTCGGGGCTG TCCGCGGGGGGACGGCTGCCTTCGGGGGGGACGGGGCAGGGCGGGGTTCGGC TTCTGGCGTGTGACCGGCGGCTCTAGAGCCTCTGCTAACCATGTTCATGCCTTCT TCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTATTGTGCTGTCTCATCATTTT GGCAAAGAATTAATTCGGATCATTTACTAGTGCCACCATGGAGCTACTGTCGCCA CCGCTCCGCGACGTAGACCTGACGGCCCCCGACGGCTCTCTCTGCTCCTTTGCC ACAACGGACGACTTCTATGACGACCCGTGTTTCGACTCCCCGGACCTGCGCTTCT TCGAAGACCTGGACCCGCGCCTGATGCACGTGGGCGCGCTCCTGAAACCCGAAG AGCACTCGCACTTCCCCGCGGCGGTGCACCCGGCCCCGGGCGCACGTGAGGAC GAGCATGTGCGCGCGCCCAGCGGGCACCACCAGGCGGGCCGCTGCCTACTGTG GGCCTGCAAGGCGTGCAAGCGCAAGACCACCAACGCCGACCGCCGCAAGGCCG CCACCATGCGCGAGCGGCGCCGCCTGAGCAAAGTAAATGAGGCCTTTGAGACAC TCAAGCGCTGCACGTCGAGCAATCCAAACCAGCGGTTGCCCAAGGTGGAGATCC TGCGCAACGCCATCCGCTATATCGAGGGCCTGCAGGCTCTGCTGCGCGACCAGG ACGCCGCGCCCCCTGGCGCCGCAGCCGCCTTCTATGCGCCGGGCCCGCTGCCC - 99 - SIB BW1353R CCGGGCCGCGGCGGCGAGCACTACAGCGGCGACTCCGACGCGTCCAGCCCGC GCTCCAACTGCTCCGACGGCATGATGGACTACAGCGGCCCCCCGAGCGGCGCC CGGCGGCGGAACTGCTACGAAGGCGCCTACTACAACGAGGCGCCCAGCGAACC CAGGCCCGGGAAGAGTGCGGCGGTGTCGAGCCTAGACTGCCTGTCCAGCATCGT GGAGCGCATCTCCACCGAGAGCCCTGCGGCGCCCGCCCTCCTGCTGGCGGACG TGCCTTCTGAGTCGCCTCCGCGCAGGCAAGAGGCTGCCGCCCCCAGCGAGGGA GAGAGCAGCGGCGACCCCACCCAGTCACCGGACGCCGCCCCGCAGTGCCCTGC GGGTGCGAACCCCAACCCGATATACCAGGTGCTCTGAGAATTCGAGCTCGGTAC CCGGGGATCCTCTAGTCAGCTGACGCGTGCTAGCGCGGCCGCATCGATAAGCTT GTCGACGATATCTCTAGAGGATCATAATCAGCCATACCACATTTGTAGAGGTTTTA CTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGC AATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAG CATCACAAATTTCACAAATAAAGCATTTTTTTCACTGC SEQ ID NO 71: EGFP + NANOG miRNA 3’ UTR CTAGTGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCA TCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCG AGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCA CCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCG TGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTC CGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGG CAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCG CATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAA GCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAG AACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTG CAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTG CTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAAC GAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACT CTCGGCATGGACGAGCTGTACAAGTAAGcgtacggcggccgcctcgactagggataacagggtaa ttgtttgaatgaggcttcagtactttacagaatcgttgcctgcacatcttggaaacacttgctgggattacttcgacttcttaacc caacagaaggctcgagaaggtatattgctgttggcagtgAGCGCTCCGACTGTAAAGAATCTTCATA GTGAAGCCACAGATGTATGAAGATTCTTTACAGTCGGATtgcctactgcctcggacttcaaggg gctagaattcgagcaattatcttgtttactaaaactgaataccttgctatctctttgatacatttttacaaagctgaatgcatTC GAGTGACCATAGAGCCCACCGCATCCCCAGCATGCCTGCTATTGTCTTCCCAATC CTCCCCCTTGCTGTCCTGCCCCACCCCACCCCCCAGAATAGAATGACACCTACTC AGACAATGCGATGCAATTTCCTCATTTTATTAGGAAAGGACAGTGGGAGTGGCAC - 100 - SIB BW1353R CTTCCAGGGTCAAGGAAGGCACGGGGGAGGGGCAAACAACAGATGGCTGGCAA CTAGAAGGCACAGTCG SEQ ID NO 72: MYOD1 cDNA ATGGAGCTACTGTCGCCACCGCTCCGCGACGTAGACCTGACGGCCCCCGACGGC TCTCTCTGCTCCTTTGCCACAACGGACGACTTCTATGACGACCCGTGTTTCGACTC CCCGGACCTGCGCTTCTTCGAAGACCTGGACCCGCGCCTGATGCACGTGGGCGC GCTCCTGAAACCCGAAGAGCACTCGCACTTCCCCGCGGCGGTGCACCCGGCCCC GGGCGCACGTGAGGACGAGCATGTGCGCGCGCCCAGCGGGCACCACCAGGCG GGCCGCTGCCTACTGTGGGCCTGCAAGGCGTGCAAGCGCAAGACCACCAACGC CGACCGCCGCAAGGCCGCCACCATGCGCGAGCGGCGCCGCCTGAGCAAAGTAA ATGAGGCCTTTGAGACACTCAAGCGCTGCACGTCGAGCAATCCAAACCAGCGGTT GCCCAAGGTGGAGATCCTGCGCAACGCCATCCGCTATATCGAGGGCCTGCAGGC TCTGCTGCGCGACCAGGACGCCGCGCCCCCTGGCGCCGCAGCCGCCTTCTATG CGCCGGGCCCGCTGCCCCCGGGCCGCGGCGGCGAGCACTACAGCGGCGACTC CGACGCGTCCAGCCCGCGCTCCAACTGCTCCGACGGCATGATGGACTACAGCGG CCCCCCGAGCGGCGCCCGGCGGCGGAACTGCTACGAAGGCGCCTACTACAACG AGGCGCCCAGCGAACCCAGGCCCGGGAAGAGTGCGGCGGTGTCGAGCCTAGAC TGCCTGTCCAGCATCGTGGAGCGCATCTCCACCGAGAGCCCTGCGGCGCCCGCC CTCCTGCTGGCGGACGTGCCTTCTGAGTCGCCTCCGCGCAGGCAAGAGGCTGCC GCCCCCAGCGAGGGAGAGAGCAGCGGCGACCCCACCCAGTCACCGGACGCCGC CCCGCAGTGCCCTGCGGGTGCGAACCCCAACCCGATATACCAGGTGCTCTGA SEQ ID NO 73: NANOG miRNA CTCGACTAGGGATAACAGGGTAATTGTTTGAATGAGGCTTCAGTACTTTACAGAAT CGTTGCCTGCACATCTTGGAAACACTTGCTGGGATTACTTCGACTTCTTAACCCAA CAGAAGGCTCGAGAAGGTATATTGCTGTTGGCAGTGAGCGCTCCGACTGTAAAGA ATCTTCATAGTGAAGCCACAGATGTATGAAGATTCTTTACAGTCGGATTGCCTACT GCCTCGGACTTCAAGGGGCTAGAATTCGAGCAATTATCTTGTTTACTAAAACTGAA TACCTTGCTATCTCTTTGATACATTTTTACAAAGCTGAATGCAT SEQ ID NO 74: TRE promoter GAGTTTACTCCCTATCAGTGATAGAGAACGTATGAAGAGTTTACTCCCTATCAGTG ATAGAGAACGTATGCAGACTTTACTCCCTATCAGTGATAGAGAACGTATAAGGAGT TTACTCCCTATCAGTGATAGAGAACGTATGACCAGTTTACTCCCTATCAGTGATAG AGAACGTATCTACAGTTTACTCCCTATCAGTGATAGAGAACGTATATCCAGTTTAC - 101 - SIB BW1353R TCCCTATCAGTGATAGAGAACGTATGTCGAGGTAGGCGTGTACGGTGGGCGCCT ATAAAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGCAATTCCACAAC ACTTTTGTCTTATACTT SEQ ID NO 75: Bidirectional TRE promoter GCGATCTGACGGTTCACTAAACGAGCTCTGCTTATATAGGCCTCCCACCGTACAC GCCACCTCGACATACTCGAGTTTACTCCCTATCAGTGATAGAGAACGTATGAAGA GTTTACTCCCTATCAGTGATAGAGAACGTATGCAGACTTTACTCCCTATCAGTGAT AGAGAACGTATAAGGAGTTTACTCCCTATCAGTGATAGAGAACGTATGACCAGTTT ACTCCCTATCAGTGATAGAGAACGTATCTACAGTTTACTCCCTATCAGTGATAGAG AACGTATATCCAGTTTACTCCCTATCAGTGATAGAGAACGTATAAGCTTTAGGCGT GTACGGTGGGCGCCTATAAAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTG GAGCAATTCCACAACACTTTTGTCTTATACCAACTTTCCGTACCACTTCCTACCCTC GTAAA SEQ ID NO 76: hROSA265’ HAR GCTCGAAACCGGACGGAGCCATTGCTCTCGCAGAGGGAGGAGCGCTTCCGGCTA GCCTCTTGTCGCCGATTGGCCGTTTCTCCTCCCGCCGTGTGTGAAAACACAAATG GCGTATTCTGGTTGGAGTAAAGCTCCTGTCAGTTACGCCGTCGGGAGTACGCAGC CGCTTAGCGACTCTCGCGTTGCCCCCTGGGTGGGGCGGGTAGGTAGGTGGGGT GTAGAGATGCTGGGTGTGCGGGCGCGGCCGGCCTCCTGCGGCGGGAGGGGAG GGTCAGTGAAATCGGCTCTGGCGCGGGCGTCCTCCCACCCTCCCCTTCCTTCGG GGGAGTCGGTTTACCCGCCGCCTGCTTGTCTTCGACACCTGATTGGCTGTCGAAG CTGTGGGACCGGGCCCTTGCTACTGGCTCGAGTCTCACATGAGCGAAACCACTG CGCGGGGCGCGGGGGTGGCGGGGAGGCGGGCGTTGGTACGGTCCTCCCCGAG GCCGAGCGCCGCAGTGTCTGGCCCCGCGCCCCTGCGCAACGTGGCAGGAAGCG CGCGCTGGAGGCGGGGGCGGGCTGCCGGCCGAGACTTCTGGATGGCGGCGGC CGCGGCTCCGCCCCGGGTTCCCACCGCCTGAAGGGCGAGACAAGCCCGACCTG CTACAGGCACTCGTGGGGGTGGGGGAGGAGCGGGGGTCGGTCCGGCTGGTTTG TGGGTGGGAGGCGCTTGTTCTCCAAAAACCGGCGCGAGCTGCAATCCTGAGGGA GCTGCGGTGGAGGAGGTGGAGAGAAGGCCGCACCCTTCTGGGCAGGGGGAGG GGAGTGCCGCAATACCTTTATGGGAGTTCTCTGCTGCCTCCCGTCTTGTAAGGAC CGCCCTGGGCCTGGAAGAAGCCCTCCCTCCTTTCCTCCTCGCGTGATC SEQ ID NO 77: hROSA263’ HAR - 102 - SIB BW1353R GCTTCTCGATTATGGGCGGGATTCTTTTGCCTAGGCTTAAGGGGCTAACTTGGTC CCTGGGCGTTGCCCTGCAGGGGAGTGAGCAGCTGTAAGATTTGAGGGGCGACTC CGATTAGTTTATCTTCCCACGGACTAGAGTTGGTGTCGAGGTTATTGTAATAAGGG TGGGGTAGGGAAATGGAGCTTAGTCATTCACCTGGGGCTGATTTTATGCAACGAG ACTGCGGATTATCACTACTTATCATTTTTGGAGCATTTTTCTAGAGACAGACATAAA GCATGATCACCTGAGTTTTATACCATTTGAGACCCTTGCTGCACCACCAAAGTGTA GCATCAGGTTAAATCTTAATAGAAAAATTTTAGCTTTTGCTTGAGAAACCAGTGCTT CCCTCCCTCACCCTCTCTCCCCAGGCTCTCTACCCCTTTGCATCCCTACCAGGCA TCTTAGCAACTCTCACTCATACTTGATCCCATTTTCCATTTGTTGTACTTGCTCCTC TAGTATTCAGACATAGCACTAGCTTTCTCCCTCTCTTGATCTTGGGTAGCCTGGTG TCTCGCGAAACCAGACAGATTGGTTCCACCACAAATTAAGGCTTGAGCTGGGGCT TGACTCTTACCCAGCAGTGCTTTTATTCCTCCCTAGTTCACGTTCTTAAATGTTTAT CTTGATTTTCATTTTATCCTTTTTCCTTAGCTGGGATTCTGTCCCTGACCGTCTTCA CAGTCCAGGTGATCTTGACTACTGCTTTACAGAGAATTGGATCTGAGGTTAGGCA ACATCTCCCTTTTTCTTCCTCTAAATACCTCTCATTTCTGTTCTTACCAGTTAGTAAC TGATCTCAGATGCCTGTGTGATAGCTTCC SEQ ID NO 78: AAVS15’ HAR TGCTTTCTCTGACCAGCATTCTCTCCCCTGGGCCTGTGCCGCTTTCTGTCTGTAG CTTGTGGCCTGGGTCACCTCTACGGCTGGCCCAGATCCTTCCCTGCCGCCTCCTT CAGGTTCCGTCTTCCTCCACTCCCTCTTCCCCTTGCTCTCTGCTGTGTTGCTGCCC AAGGATGCTCTTTCCGGAGCACTTCCTTCTCGGCGCTGCACCACGTGATGTCCTC TGAGCGGATCCTCCCCGTGTCTGGGTCCTCTCCGGGCATCTCTCCTCCCTCACCC AACCCCATGCCGTCTTCACTCGCTGGGTTCCCTTTTCCTTCTCCTTCTGGGGCCT GTGCCATCTCTCGTTTCTTAGGATGGCCTTCTCCGACGGATGTCTCCCTTGCGTC CCGCCTCCCCTTCTTGTAGGCCTGCATCATCACCGTTTTTCTGGACAACCCCAAA GTACCCCGTCTCCCTGGCTTTAGCCACCTCTCCATCCTCTTGCTTTCTTTGCCTGG ACACCCCGTTCTCCTGTGGATTCGGGTCACCTCTCACTCCTTTCATTTGGGCAGC TCCCCTACCCCCCTTACCTCTCTAGTCTGTGCTAGCTCTTCCAGCCCCCTGTCATG GCATCTTCCAGGGGTCCGAGAGCTCAGCTAGTCTTCTTCCTCCAACCCGGGCCC CTATGTCCACTTCAGGACAGCATGTTTGCTGCCTCCAGGGATCCTGTGTCCCCGA GCTGGGACCACCTTATATTCCCAGGGCCGGTTAATGTGGCTCTGGTTCTGGGTAC TTTTATCTGTCCCCTCCACCCCACAGTGG SEQ ID NO 79: AAVS13’ HAR - 103 - SIB BW1353R TGGTGACAGAAAAGCCCCATCCTTAGGCCTCCTCCTTCCTAGTCTCCTGATATTG GGTCTAACCCCCACCTCCTGTTAGGCAGATTCCTTATCTGGTGACACACCCCCAT TTCCTGGAGCCATCTCTCTCCTTGCCAGAACCTCTAAGGTTTGCTTACGATGGAG CCAGAGAGGATCCTGGGAGGGAGAGCTTGGCAGGGGGTGGGAGGGAAGGGGG GGATGCGTGACCTGCCCGGTTCTCAGTGGCCACCCTGCGCTACCCTCTCCCAGA ACCTGAGCTGCTCTGACGCGGCTGTCTGGTGCGTTTCACTGATCCTGGTGCTGCA GCTTCCTTACACTTCCCAAGAGGAGAAGCAGTTTGGAAAAACAAAATCAGAATAAG TTGGTCCTGAGTTCTAACTTTGGCTCTTCACCTTTCTAGTCCCCAATTTATATTGTT CCTCCGTGCGTCAGTTTTACCTGTGAGATAAGGCCAGTAGCCAGCCCCGTCCTGG CAGGGCTGTGGTGAGGAGGGGGGTGTCCGTGTGGAAAACTCCCTTTGTGAGAAT GGTGCGTCCTAGGTGTTCACCAGGTCGTGGCCGCCTCTACTCCCTTTCTCTTTCT CCATCCTTCTTTCCTTAAAGAGTCCCCAGTGCTATCTGGGACATATTCCTCCGCCC AGAGCAGGGTCCCGCTTCCCTAAGGCCCTGCTCTGGGCTTCTGGGTTTGAGTCC TTGGCAAGCCCAGGAGAGGCGCTCAGGCTTCCCTGTCCCCCTTCCTCGTCCACC ATCTCATGCCCCTGGCTCTCCTGCCCCTTCCCTACAGGGGTTCCTGGCTCTGCTC T SEQ ID NO 80: CLYBL 5’ HAR cagcaggagaatcatgccaatgggccaatatacattctgacccacagtttcataataaaataaaatggttgtggttgtaag ccactatgtttcagagtggtttgttacacagcaataaataactaatatagtaggcataccatcaagtccaaagtaggtaga gaagaatgtaaatagcagagcaaaacagcatgactggtggctgggaggcttaaaactgggacaggatcagagtcatg aaagaagtcaaagaaatggttcagaagtaaggctgagactgacttacaaaagctgaaagtccctttaagttggtgtttgg tgcattggcaggggcaggtatggtgacttaaaagagccatgctcaacaagatcaagcacaacacaatcacgggtcac cccagcagaccttagcgagtctagccatttctttggtggtggtcacagtcatgcttcagcccagtttccacttggacaaatgg tacatattttcaatgagatgaaaattaagatacaatccatgtgctcagagagtgatcacagctctgactaaacactgtgccc caaagtgttgaggaattgggaaaacctagctgagttagtggtctcttttctgttacaataaagctcataatgaaaattagcctt ctttgttcttccccaagtctttctttctagacgaaactactttcaactgttttaacttccttactgttaacttccatatttctagatagtat ggtcagactgttatttcttgacttttaaatgtaagatattatctactgacttccttctatgtaagatgaggattgagctctcttaccct tctccca SEQ ID NO 81: CLYBL 3’ HAR tcctcatccttccaacataaatatattttgggattatatcaacattcaatgttacttaaagtgaccttgtaaatattttcacaactg agccatgtttgatttgtatacttatgtttactttactgtttttcctgaagttaataattgccttgaatttatttatttctttaaaaatgtttcat tactcaggactgtagtttacattacgattctttgtgttatacagttgatgggtttcttttctttcttaatttctttaaaaaatagagatgg ggtcttactatattacccaggctggtcttgaagtcctgggctcaagtgatcttcctgtctcagcctaccaagtagctgagacta taggtgcaaaaaagccactatacctggctagtttacaggttttaacaaatgcattatgccacgtatccattattacaggatca - 104 - SIB BW1353R cacaagatattttcattaccctgaaagcatccctgtgttccaccaattcatcctgcctccatgagccgctggcaaccactgat ctctatagttttgccttttctaaaatgtcatataattggaatcatacagtctgtagcattttcagactagcttttaaaatttggcaat atgcatttaaggttcctccttaaatgtgaagggcatagccaatgtggcttgatagctcatttctttttattggtgaatatttcattgt ctggatgttccacagtttgtttatccattcacctattcaatttgctttttttctgtgtatctatcactaattcaatactggactctccaac agagccgt SEQ ID NO 82: UCOE gggaggtggtccctgcagttacgccaatgataacccccgccagaaaaatcttagtagccttccctttttgttttccgtgcccc aactcggcggattgactcggccccttccggaaacacccgaatcaacttctagtcaaattattgttcacgccgcaatgaccc acccctggcccgcgtctgtggaactgacccctggtgtacaggagagttcgctgctgaaagtggtcccaaaggggtacta gtttttaagctcccaactccccctcccccagcgtctggaggattccacaccctcgcaccgcaggggcgaggaagtgggc ggagtccggttttggcgccagccgctgaggctgccaagcagaaaagccaccgctgaggagactccggtcactgtcctc gccccgcctcccccttccctccccttggggaccaccgggcgccacgccgcgaacggtaagtgccgcggtcgtcggcgc ctccgccctccccctagggccccaattcccagcgggcgcggcgcgcggcccctccccccgccgggcgcgcgcccgct gccccgcccttcgtggccgcccggcgtgggcggtgccacccctccccccggcggccccgcgcgcagctcccggctcc ctcccccttcggatgtggcttgagctgtaggcgcggagg SEQ ID NO 83: BIDIRECTIONAL CAG ctgtaggaaaaagaagaaggcatgaacatggttagcagaggctctagagccgccggtcacacgccagaagccgaa ccccgccctgccccgtcccccccgaaggcagccgtccccccgcggacagccccgaggctggagagggagaaggg gacggcggcgcggcgacgcacgaaggccctccccgcccatttccttcctgccggcgccgcaccgcttcgccccgcgc ccgctagagggggtgcggcggcgcctcccagatttcggctccgcacagatttgggacaaaggaagtccctgcgccctct cgcacgattaccataaaaggcaatggctgcggctcgccgcgcctcgacagccgccggcgctccgggggccgccgcg cccctcccccgagccctccccggcccgaggcggccccgccccgcccggcacccccacctgccgccaccccccgccc ggcacggcgagccccgcgccacgccccgtacggagccccgcacccgaagccgggccgtgctcagcaactcgggg aggggggtgcagggggggttgcagcccgaccgacgcgcccacaccccctgctcacccccccacgcacacaccccg cacgcagcctttgttcccctcgcagccccccccgcaccgcggggcaccgcccccggccgcgctcccctcgcgcacact gcggagcgcacaaagccccgcgccgcgcccgcagcgctcacagccgccgggcagcgcggagccgcacgcggcg ctccccacgcacacacacacgcacgcaccccccgagccgctccccccgcacaaagggccctcccggagcccctca aggctttcacgcagccacagaaaagaaacaagccgtcattaaaccaagcgctaattacagcccggaggagaaggg ccgtcccgcccgctcacctgtgggagtaacgcggtcagtcagagccggggcgggcggcgcgaggcggcggcggag cggggcacggggcgaaggcagcgcgcagcgactcccgcccgccgcgcgcttcgctttttatagggccgccgccgccg ccgcctcgccataaaaggaaactttcggagcgcgccgctctgattggctgccgccgcacctctccgcctcgcccgcccc gcccctcgccccgccccgccccgcctggcgcgcgccccccccccccccccgcccccatcgctgcacaaaataattaa aaaataaataaatacaaaattgggggtggggaggggggggagatggggagagtgaagcagaacgtggggctcacc tcgaccatggtaatagcgatgactaatacgtagatgtactgccaagtaggaaagtcccataaggtcatgtactgggcata - 105 - SIB BW1353R atgccaggcgggccatttaccgtcattgacgtcaatagggggcgtacttggcatatgatacacttgatgtactgccaagtg ggcagtttaccgtaaatactccacccattgacgtcaatggaaagtccctattggcgttactatgggaacatacgtcattattg acgtcaatgggcgggggtcgttgggcggtcagccaggcgggccatttaccgtaagttatgtaacgcggaactccatatat gggctatgaactaatgaccccgtaattgattactattaataactagtcaataatcaatgtcgagaacccatggtaatagcg atgactaatacgtagatgtactgccaagtaggaaagtcccataaggtcatgtactgggcataatgccaggcgggccattt accgtcattgacgtcaatagggggcgtacttggcatatgatacacttgatgtactgccaagtgggcagtttaccgtaaatac tccacccattgacgtcaatggaaagtccctattggcgttactatgggaacatacgtcattattgacgtcaatgggcgggggt cgttgggcggtcagccaggcgggccatttaccgtaagttatgtaacgcggaactccatatatgggctatgaactaatgac cccgtaattgattactattaataactagtcaataatcaatgtcgagaacccatggtaatagcgatgactaatacgtagatgt actgccaagtaggaaagtcccataaggtcatgtactgggcataatgccaggcgggccatttaccgtcattgacgtcaata gggggcgtacttggcatatgatacacttgatgtactgccaagtgggcagtttaccgtaaatactccacccattgacgtcaat ggaaagtccctattggcgttactatgggaacatacgtcattattgacgtcaatgggcgggggtcgttgggcggtcagccag gcgggccatttaccgtaagttatgtaacgcggaactccatatatgggctatgaactaatgaccccgtaattgattactattaa taactagtcaataatcaatgtcgagaacccatggtaatagcgatgactaatacgtagatgtactgccaagtaggaaagtc ccataaggtcatgtactgggcataatgccaggcgggccatttaccgtcattgacgtcaatagggggcgtacttggcatatg atacacttgatgtactgccaagtgggcagtttaccgtaaatactccacccattgacgtcaatggaaagtccctattggcgtt actatgggaacatacgtcattattgacgtcaatgggcgggggtcgttgggcggtcagccaggcgggccatttaccgtaag ttatgtaacgcggaactccatatatgggctatgaactaatgaccccgtaattgattactattaataactagtcaataatcaat gtcgagccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatt tattttttaattattttgtgcagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcga ggggcggggcgggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatgg cgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgcgctgccttcgcc ccgtgccccgctccgccgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggc gggacggcccttctcctccgggctgtaattagcgcttggtttaatgacggcttgtttcttttctgtggctgcgtgaaagccttga ggggctccgggagggccctttgtgcggggggagcggctcggggggtgcgtgcgtgtgtgtgtgcgtggggagcgccgc gtgcggctccgcgctgcccggcggctgtgagcgctgcgggcgcggcgcggggctttgtgcgctccgcagtgtgcgcga ggggagcgcggccgggggcggtgccccgcggtgcggggggggctgcgaggggaacaaaggctgcgtgcggggtg tgtgcgtgggggggtgagcagggggtgtgggcgcgtcggtcgggctgcaaccccccctgcacccccctccccgagttg ctgagcacggcccggcttcgggtgcggggctccgtacggggcgtggcgcggggctcgccgtgccgggcggggggtg gcggcaggtgggggtgccgggcggggcggggccgcctcgggccggggagggctcgggggaggggcgcggcggc ccccggagcgccggcggctgtcgaggcgcggcgagccgcagccattgccttttatggtaatcgtgcgagagggcgca gggacttcctttgtcccaaatctgtgcggagccgaaatctgggaggcgccgccgcaccccctctagcgggcgcggggc gaagcggtgcggcgccggcaggaaggaaatgggcggggagggccttcgtgcgtcgccgcgccgccgtccccttctcc ctctccagcctcggggctgtccgcggggggacggctgccttcgggggggacggggcagggcggggttcggcttctggc gtgtgaccggcggctctagagcctctgctaaccatgttcatgccttcttctttttcctacag

Claims

- 106 - SIB BW1353R CLAIMS 1. A stem cell with a modified genome that comprises: i) an inserted gene encoding one or more pluripotency factors operably linked to a first constitutive promoter; ii) an inserted gene encoding a transcriptional regulator protein operably linked to said first constitutive promoter or a second constitutive promoter; iii) an inserted inducible cassette comprising one or more genetic sequences operably linked to an inducible promoter, wherein said inducible promoter is regulated by said transcriptional regulator protein and wherein said genetic sequences encode one or more differentiation factors inducing differentiation into defined mature cells and one or more non-coding RNAs suppressing the transcription or translation of said pluripotency factors.

2. The stem cell according to claim 1, wherein said stem cell is a pluripotent stem cell (PSC), an embryonic stem cell (ESC), an induced pluripotent stem cell (iPSC), an adult stem cell or progenitor, such as a myoblast, a myosatellite cell, a pericyte, a mesenchymal stem / stromal cell (MSC), a fibroadipogenic progenitor (FAP).

3. The stem cell according to any one of claims 1 or 2, wherein said inserted gene i) encoding a pluripotency factor operably linked to said first constitutive promoter is inserted in a first genetic safe harbour site.

4. The stem cell according to any one of claims 1 to 3, wherein said inserted gene ii) encoding a transcriptional regulator protein operably linked to said second constitutive promoter is inserted in a second genetic safe harbour site.

5. The stem cell according to any one of claims 1 to 4, wherein said inserted inducible cassette comprising a genetic sequence operably linked to an inducible promoter is inserted in a third genetic safe harbour site.

6. The stem cell according to any one of claims 2 to 4, wherein said first, said second and said third genetic safe harbour site is the same genetic safe harbour site, preferably wherein said first and second genetic safe harbour site is the same genetic safe harbour site, or wherein said first and third genetic safe harbour site is the same genetic safe- 107 - SIB BW1353R harbour site, or wherein said second and third genetic safe harbour site is the same genetic safe harbour site.

7. The stem cell according to any one of claims 3 to 6, wherein said first, second and third genomic safe harbour sites are selected from any one of the hROSA26 locus, the AAVS1 locus or the CLYBL gene.

8. The stem cell according to any one of claims 1 to 7, wherein said cell is a eukaryotic pluripotent stem cell.

9. The stem cell according to any one of claims 1 to 8, wherein said pluripotent stem cell is a human or animal pluripotent stem cell.

10. The stem cell according to claim 9, wherein said animal is a mammalian, avian, or fish cell, such as a cell from a rodent, such as mice and rats; a marsupial such as kangaroos and koalas; a non-human primate such as a bonobo, chimpanzee, lemurs, gibbons and apes; a camelid such as camels and llamas; a livestock animal such as horses, pigs, cattle, buffalo, bison, goats, sheep, deer, reindeer, donkeys, bantengs, yaks, chickens, ducks and turkeys; a domestic animal such as cats, dogs, rabbits and guinea pigs, a fish such as salmons, tunas, cods, trouts, sardines, mackerels, haddocks, anchovies, tilapia and groupers.

11. The stem cell according to any one of claims 1 to 10, wherein said inducible promoter is a bidirectional inducible promoter.

12. The stem cell according to any one of claims 1 to 11, wherein said transcriptional regulator protein is selected from any of: reverse tetracycline-controlled transactivator protein (rtTa), Tet-On 3G, tetracycline repressor (TetR), tetracycline-controlled transactivator (tTA), VgEcR synthetic receptor of the Gene Switch hybrid transcriptional regulator protein, LacI-IPTG, AraC-arabinose, Ga4-galactose, ecdysone-inducible system, HSF1, CIB1, ePDZ, SspB, dGI, PIF3, PIF6, PpsR2, Q-PAS1 and derivatives of any thereof.

13. The stem cell according to claim 11, wherein said transcriptional regulator protein is Tet-On 3G or any derivative thereof.- 108 - SIB BW1353R 14. The stem cell according to any one of claims 12 or 13, wherein the activity of Tet-On 3G is controlled by tetracycline or a derivative thereof, preferably doxycycline.

15. The stem cell according to any one of claims 1 to 14, wherein the inducible promoter comprises a Tet Responsive Element (TRE), preferably further comprising a Ubiquitous Chromatin Opening Element (UCOE) before said inducible promoter having SEQ ID NO:

82.

16. The stem cell according to any one of claims 1 to 15, wherein said pluripotency factor is NANOG, preferably comprising silent point mutations to eliminate potential N6- methyladenosine (m6A) sites.

17. The stem cell according to any one of claims 1 to 16, wherein said constitutive promoter is selected from human β-actin promoter (ACTB), cytomegalovirus (CMV), elongation factor 1-alpha, (EF1α), phosphoglycerate kinase (PGK), ubiquitin C (UbC), CAG promoter, wherein said CAG promoter comprises the following sequences: (C) the cytomegalovirus (CMV) early enhancer element, (A) the promoter, the first exon and the first intron of chicken beta-actin gene, and (G) the splice acceptor of the rabbit beta- globin gene.

18. The stem cell according to any one of claims 1 to 17, wherein said differentiation factor inducing cell differentiation is selected from ASCL1, BAF60C, CEBPA, CEBPB, DLX2, DPPA3, FLI1, FOXC1, FOXC2, FOXA2, FOS, GATA1, GATA4, GATA6, GRHL3, HAND1, HAND2, HNF3B, JUN, KLF4, MEF2, MEF2C, MYC, MYOD1, NANOG, NANOS9, NEUROD1, NEUROG1, NEUROG2, NFIA, NFIB, NKX2-2, NKX2-5, NKX6-2, OLIG2, PAX6, PDX1, POU5F1, PRDM1, RUNX1, RUNX2, SOX2, SOX9, SPI1, TBX5, TBXT, TAL1, TP63, TWIST1.

19. The stem cell according to any one of claims 1 to 18, wherein said genetic sequences encode a differentiation factor inducing differentiation into defined mature cells and translate a non-coding RNA which suppresses the transcription or translation of said pluripotency factor.

20. The stem cell according to claim 19, wherein said non-coding RNA is a shRNA, antisense RNA (asRNA), guide RNA (gRNA), microRNA (miRNA), small interfering RNA (siRNA), trans-acting RNA (tasiRNA), antagomir, aptamer or miRNA sponge.- 109 - SIB BW1353R 21. The stem cell according to claim 18, wherein said non-coding RNA is a miRNA, optionally said miRNA is placed: (i) in the 3’ UTR of the mRNA of the differentiation factor, and / or (ii) embedded inside a chimeric intron in the pre-mRNA of the differentiation factor, and / or (iii) downstream of a bidirectional promoter, opposite to the differentiation factor.

22. The stem cell according to any one of claims 1 to 21, wherein said pluripotency factor has SEQ ID NO:

66.

23. The stem cell according to any one of claims 1 to 2, wherein said first, second, or third constitutive promoter has SEQ ID NO:

67.

24. The stem cell according to any one of claims 1 to 21 wherein said transcriptional regulator protein has SEQ ID NO:

68.

25. The stem cell according to any one of claims 1 to 21 wherein said genetic sequences encoding one or more differentiate on factors inducing differentiation into defined mature cells and one or more non-coding RNAs suppressing the transcription or translation of said pluripotency factors has SEQ ID NO: 69-71.

26. The stem cell according to any one of claims 1 to 21 wherein said differentiation factor inducing differentiation into defined mature cells has SEQ ID NO:

72.

27. The stem cell according to any one of claims 1 to 21 wherein said non-coding RNA suppressing the transcription or translation of said pluripotency factor has SEQ ID NO:

73.

28. The stem cell according to any one of claims 1 to 21 wherein said inducible promoter has SEQ ID NO: 74-75 or 83.

29. The stem cell according to any one of claims 1 to 21, wherein an anchoring sequence for entering a genomic safe harbour site has SEQ ID NO: 76-81.

30. The stem cell according to any one of claims 1 to 29, comprising:- 110 - SIB BW1353R i) an inserted gene encoding one or more pluripotency factors operably linked to a constitutive promoter, wherein said pluripotency factor is NANOG and said constitutive promoter is a CAG promoter, ii) an inserted gene encoding a transcriptional regulator protein operably linked to a constitutive promoter, wherein said transcriptional regulator protein is Tet-On 3G and said constitutive promoter is a CAG promoter, wherein the activity of Tet-On 3G is controlled by doxycycline. iii) an inserted inducible cassette comprising one or more genetic sequences operably linked to an inducible promoter, wherein said inducible promoter is regulated by said transcriptional regulator protein and wherein said genetic sequences encode one or more differentiation factors inducing differentiation into defined mature cells and one or more non-coding RNAs suppressing the transcription or translation of said pluripotency factors, wherein said inducible promoter is a Tet Responsive Element (TRE), and wherein said differentiation factor is selected from ASCL1, BAF60C, CEBPA, CEBPB, DLX2, DPPA3, FLI1, FOXC1, FOXC2, FOXA2, FOS, GATA1, GATA4, GATA6, GRHL3, HAND1, HAND2, HNF3B, JUN, KLF4, MEF2, MEF2C, MYC, MYOD1, NANOG, NANOS9, NEUROD1, NEUROG1, NEUROG2, NFIA, NFIB, NKX2-2, NKX2-5, NKX6-2, OLIG2, PAX6, PDX1, POU5F1, PRDM1, RUNX1, RUNX2, SOX2, SOX9, SPI1, TBX5, TBXT, TAL1, TP63, TWIST1, preferably wherein said cell is a pluripotent stem cell, preferably wherein said inserted gene i) encoding a pluripotency factor operably linked to a constitutive promoter is inserted in a first genetic safe harbour site, said inserted gene ii) encoding a transcriptional regulator protein operably linked to a constitutive promoter is inserted in a second genetic safe harbour site, said inserted inducible cassette comprising a genetic sequence operably linked to an inducible promoter is inserted in a third genetic safe harbour site, preferably wherein said fist, said second and said third genetic harbour site is the same genetic harbour site, preferably wherein said first, second and third genomic safe harbour sites are selected from any one of the hROSA26 locus, the AAVS1 locus or the CLYBL gene.

31. An ex vivo method for preparing defined mature cells from programming of stem cells, preferably pluripotent stem cells, comprising the following steps: i) culturing a modified stem cell according to any one of the claims from 1 to 30 to expand said stem cell;- 111 - SIB BW1353R ii) culturing a said modified stem cell according to any one of the claims from 1 to 30 in the presence of a molecule or physical stimulus activating said transcriptional regulator protein in said modified pluripotent stem cell; iii) culturing said induced cells to have defined mature cells.

32. The ex vivo method according to claim 31, wherein said molecule activating the inducible promoter is tetracycline or a derivative thereof, preferably doxycycline.

33. The ex vivo method according to any one of claims 31 or 32, wherein said defined mature cells are selected from any one of the following cell types: nerve cells, myocytes, cardiomyocytes, hepatocytes, osteocytes, chondrocytes, epithelial cells, secretory cells, and / or blood cells.

34. The ex vivo method according to any one of claims 31 to 33, wherein said method is carried out in absence of growth factors.

35. A cultivated meat comprising at least one defined mature cell obtained from the method according to any one of claims 31 to 34.

36. Use of a stem cell according to any one of claims 1 to 30 or of a defined mature cell obtained by the method according to anyone of claims 31 to 34 for in vitro drug screening and toxicology or in diagnostics or as in vitro model.

37. Use of a stem cell according to any one of claims 1 to 30 or of a defined mature cell obtained by the method according to anyone of claims 31 to 34 for tissue engineering.

38. Use of a stem cell according to any one of claims 1 to 30 or of a defined mature cell obtained by the method according to anyone of claims 31 to 34 as cultivated meat.

39. A stem cell according to any one of claims 1 to 30 or a defined mature cell obtained by the method according to anyone of claims 31 to 34 for use in therapy.

40. A kit for transforming a stem cell, preferably a pluripotent stem cell, comprising: i) a gene encoding one or more pluripotency factors operably linked to a constitutive promoter;- 112 - SIB BW1353R ii) a gene encoding a transcriptional regulator protein operably linked to a constitutive promoter; iii) one or two genetic sequences operably linked to an inducible promoter, wherein said inducible promoter is regulated by said transcriptional regulator protein and wherein said genetic sequences encode one or more differentiation factors inducing differentiation into defined mature cells, and one or more non-coding RNA which suppresses the transcription or translation of said pluripotency factor.

41. The kit according to claim 40, wherein said gene i) encoding one or more pluripotency factors operably linked to a constitutive promoter, said gene ii) encoding a transcriptional regulator protein operably linked to a constitutive promoter and said one or two genetic sequences iii) operably linked to an inducible promoter are comprised in one vector.

42. The kit according to claim 40 or 41, wherein said gene i) encoding one or more pluripotency factors operably linked to a constitutive promoter is in a first vector; said gene ii) encoding a transcriptional regulator protein operably linked to a constitutive promoter is in a second vector; said one or two genetic sequences iii) operably linked to an inducible promoter is in a third vector.

43. The kit according to any one of claims 40 to 42, wherein said vector comprises an anchoring sequence for entering a genomic safe harbour site.

44. The kit according to claim 43, wherein said genomic safe harbour site is selected from any one of the hROSA26 locus, the AAVS1 locus or the CLYBL gene.

45. The kit according to any one of claims 42 to 44, wherein said first vector comprises an anchoring sequence for entering hROSA26 locus.

46. The kit according to any one of claims 42 to 45, wherein said second vector comprises an anchoring sequence for entering AAVS1 locus.

47. The kit according to any one of claims 42 to 46, wherein said third vector comprises an anchoring sequence for entering the CLYBL gene.

48. The kit according to any one of claims 42 to 47, wherein said inducible promoter is a bidirectional inducible promoter.- 113 - SIB BW1353R 49. The kit according to any one of claims 42 to 48, wherein said transcriptional regulator protein is selected from any of: tetracycline-responsive transcriptional activator protein (rtTa), Tet-On 3G, tetracycline repressor (TetR), tetracycline-controlled transactivator (tTA), VgEcR synthetic receptor of the Gene Switch hybrid transcriptional regulator protein, LacI-IPTG, AraC-arabinose, Ga4-galactose, ecdysone-inducible system, HSF1, CIB1, ePDZ, SspB, dGI, PIF3, PIF6, PpsR2, Q-PAS1 and derivatives of any thereof.

50. The kit according to any one of claims 42 to 49, wherein said transcriptional regulator protein is Tet-On 3G or any derivative thereof.

51. The kit according to claim 50, wherein the activity of Tet-On 3G is controlled by tetracycline or a derivative thereof, optionally doxycycline.

52. The kit according to any one of claims 42 to 51, wherein the inducible promoter comprises a Tet Responsive Element (TRE), preferably further comprising a Ubiquitous Chromatin Opening Element (UCOE) before said inducible promoter having SEQ ID NO:

82.

53. The kit according to any one of claims 42 to 52, wherein said pluripotency factor is NANOG, preferably comprising silent point mutations to eliminate potential N6- methyladenosine (m6A) sites.

54. The kit according to any one of claims 42 to 53, wherein said constitutive promoter is selected from human β-actin promoter (ACTB), cytomegalovirus (CMV), elongation factor 1-alpha, (EF1α), phosphoglycerate kinase (PGK) and ubiquitinC (UbC), CAG promoter, wherein said CAG promoter comprises the following sequences: (C) the cytomegalovirus (CMV) early enhancer element, (A) the promoter, the first exon and the first intron of chicken beta-actin gene, and (G) the splice acceptor of the rabbit beta- globin gene.

55. The kit according to any one of claims 42 to 54, wherein said differentiation factor inducing cell differentiation is selected from ASCL1, BAF60C, CEBPA, CEBPB, DLX2, DPPA3, FLI1, FOXC1, FOXC2, FOXA2, FOS, GATA1, GATA4, GATA6, GRHL3, HAND1, HAND2, HNF3B, JUN, KLF4, MEF2, MEF2C, MYC, MYOD1, NANOG, NANOS9, NEUROD1, NEUROG1, NEUROG2, NFIA, NFIB, NKX2-2, NKX2-5, NKX6-2,- 114 - SIB BW1353R OLIG2, PAX6, PDX1, POU5F1, PRDM1, RUNX1, RUNX2, SOX2, SOX9, SPI1, TBX5, TBXT, TAL1, TP63, TWIST1.

56. The kit according to any one of claims 42 to 55, wherein said genetic sequence encodes a differentiation factor inducing differentiation into defined mature cells and translates a non-coding RNA which suppresses the transcription or translation of said pluripotency factor.

57. The kit according to any one of claims 42 to 56, wherein said non-coding RNA is a shRNA, antisense RNA (asRNA), guide RNA (gRNA), microRNA (miRNA), small interfering RNA (siRNA), trans-acting RNA (tasiRNA), antagomirs, aptamers or miRNA sponges, preferably a miRNA.

58. The kit according to any one of claims 42 to 57, wherein said non-coding RNA is a miRNA, optionally said miRNA is placed: (i) in the 3’ UTR of the mRNA of the differentiation factor, and / or (ii) embedded inside a chimeric intron in the pre-mRNA of the differentiation factor, and / or (iii) downstream of a bidirectional promoter, opposite to the differentiation factor.

59. The kit according to any one of claims 42 to 58, wherein said pluripotency factor has SEQ ID NO:

66.

60. The kit according to any one of claims 42 to 59, wherein said first, second, or third constitutive promoter has SEQ ID NO:

67.

61. The kit according to any one of claims 42 to 60 wherein said transcriptional regulator protein has SEQ ID NO:

68.

62. The kit according to any one of claims 42 to 61 wherein said genetic sequences encoding one or more differentiate on factors inducing differentiation into defined mature cells and one or more non-coding RNAs suppressing the transcription or translation of said pluripotency factors has SEQ ID NO: 69-71.

63. The kit according to any one of claims 42 to 62 wherein said differentiation factor inducing differentiation into defined mature cells has SEQ ID NO: 72.- 115 - SIB BW1353R 64. The kit according to any one of claims 42 to 63 wherein said non-coding RNA suppressing the transcription or translation of said pluripotency factor has SEQ ID NO:

73.

65. The kit according to any one of claims 42 to 64 wherein said inducible promoter has SEQ ID NO: 74-75 or 83.

66. The kit according to any one of claims 42 to 65, wherein an anchoring sequence for entering a genomic safe harbour site has SEQ ID NO: 76-81.

67. Use of the kit according to any one of claims 42 to 66 for the preparation of a modified stem cell according to claim 1 to 22.

68. A method for the preparation of a modified stem cell comprising a step of transformation of a stem cell with the kit according to any one of claims 42 to 67.

Citation Information

Patent Citations

  • Methods and composition for the production of orthoganal trna-aminoacyltrna synthetase pairs

    WO2002086075A2

Cited By

  • Product, system and method of cell cultivation

    US12668774B2

  • Culture media based on protein hydrolysate and a process for preparing thereof

    US12686847B2