Casein-derived active peptide capable of delaying telomere attrition and use thereof, and drug containing active peptide

Abstract

The present invention belongs to the technical field of bioactive peptides. Provided are a casein-derived active peptide capable of delaying telomere attrition and the use thereof, and a drug containing the active peptide. An active peptide having the sequence of FVAPFPE is selected from a casein hydrolysate prepared via a fermentation method. When ingested orally, the active peptide can stably cross the blood-brain barrier and exhibits anti-inflammatory, antioxidative and telomere attrition-protective effects. The active peptide can delay aging, and is thus expected to be used for preventing and / or treating aging-related diseases.

Description

A casein-derived active peptide capable of delaying telomere attrition, application thereof and a medicine containing the active peptide TECHNICAL FIELD

[0001] The present application belongs to the technical field of bioactive peptides, and particularly relates to a casein-derived active peptide capable of delaying telomere attrition, application thereof and a medicine containing the active peptide. BACKGROUND

[0002] Aging is a progressive, irreversible pathophysiological process characterized by the decline of tissue and cellular functions. It is an important risk factor for neurodegenerative diseases, cardiovascular diseases, metabolic diseases, musculoskeletal diseases and immune system diseases. Telomere shortening, inflammation and oxidative stress are closely related to the occurrence and development of aging and related diseases. Telomere length is widely used to assess aging, and telomeres are shortened during the aging process. Environmental factors can accelerate or delay this process, thereby accelerating or delaying aging. Mendelian randomization studies have confirmed the causal relationship between telomere length and cognitive function, and between telomere length and Alzheimer's disease. Experimental studies have shown that telomeres are key regulators of age-related neurogenesis and cognitive changes. Delaying telomere attrition helps to prevent or delay various diseases related to aging and related diseases.

[0003] There is a complex interaction between telomere shortening, inflammation and oxidative stress. Telomeres are quite sensitive to inflammation and oxidative stress. Direct oxidative stress at telomeres can promote DNA damage response activation and telomere fragility, activate the p53 pathway and accelerate cell aging. Oxidative stress and inflammation mutually promote each other: increased intracellular ROS levels can activate the NLRP3 inflammasome through the oxidative phosphorylation pathway, and can also promote the release of mtDNA by increasing mitochondrial permeability, thereby activating inflammation-related pathways and activating NF-κB to trigger inflammation cascades. Double-stranded DNA damage can up-regulate NF-κB to promote inflammation-related aging phenotypes at the transcriptional level. In addition to NF-κB, Wnt, RAP1, TERT and PARP proteins also have dual functions in inflammation and telomere maintenance. Therefore, it is necessary to explore effective intervention strategies from the initial event when understanding the aging process and developing new treatment methods.

[0004] A population study found that the telomeres of people in the southwest region who adhere to a vegetable-type dietary pattern are longer, and in this dietary pattern, the intake of yogurt contributes a lot. Animal experiments compared the effects of yogurt and milk intake on telomere length and found that the telomeres of the yogurt group were longer than those of the milk group, and even the telomeres of the milk group were worn out compared with the control group (Shan, S. F., Yogurt and Streptococcus thermophilus metabolites ameliorated telomere attrition in D-galactose-induced ageing mice and t-BHP-challenged HepG2 cells, INTERNATIONAL JOURNAL OF FOOD SCIENCE AND TECHNOLOGY, 55(6), 2509-2516). The above results suggest that the intake of fermented dairy products may delay aging by delaying telomere wear and tear, and thus may have a protective effect on aging-related diseases. There are a large number of studies on active peptides against aging, and fermentation can also hydrolyze the proteins contained in milk and thus produce a large number of active peptides. Therefore, there may be active peptides in fermented dairy products that are beneficial to cognitive function. In addition, screening active ingredients that can enter the brain from polypeptides is a direction worth exploring in view of the current difficulty that most drugs cannot cross the blood-brain barrier. SUMMARY

[0005] The purpose of the present application is to provide a casein-derived active peptide that can delay telomere wear and tear and its application.

[0006] The present application provides an active peptide, the amino acid sequence of which is FVAPFPE.

[0007] The present application also provides the use of the above-mentioned active peptide in the preparation of a drug for delaying telomere wear and tear.

[0008] Further, the drug is a drug for improving telomere wear and tear in the nervous system.

[0009] Further, the drug is an anti-inflammatory and / or antioxidant drug.

[0010] Further, the drug is a drug for improving oxidative stress and neuroinflammation.

[0011] Further, the drug is a drug for improving cognitive decline.

[0012] Further, the drug is a drug for delaying aging.

[0013] Further, the drug is a drug for preventing and / or treating diseases related to aging.

[0014] Further, the drug is a drug capable of crossing the blood-brain barrier to directly act on the brain.

[0015] The present application also provides a drug, which is a preparation prepared from the active peptide as described above as an active ingredient, and a pharmaceutically acceptable excipient or auxiliary ingredient.

[0016] The present application also provides an application of the active peptide as described above in the preparation of a health food with the functions of enhancing immunity or resisting oxidation.

[0017] The present application also provides a health food with the functions of enhancing immunity or resisting oxidation, which is characterized in that it is a product prepared from the active peptide as described above as an active ingredient, and a food acceptable excipient or auxiliary ingredient.

[0018] Compared with the prior art, the present application has the following beneficial effects:

[0019] The present application screens an active peptide with a sequence of FVAPFPE from a casein hydrolysate prepared by fermentation, through in vitro simulation of the human body process after food intake, molecular docking prediction and cell experiment verification. The active peptide can stably enter the brain after oral intake, and has the effects of anti-inflammation, anti-oxidation and protection of telomere wear. The active peptide can delay aging, and is expected to be used for preventing and / or treating diseases related to aging, and has a good clinical application prospect.

[0020] The present application provides an active peptide from casein, which can directly act on the brain, improve telomere wear, oxidative stress and neuroinflammation of the nervous system, and can be used for preparing a drug for improving aging, oxidative stress and inflammation of the nervous system, and can also be used for compounding with other health products or food additives. The active peptide developed in the present application has a clear structure and can be chemically synthesized, and has low synthesis cost. Moreover, the active peptide is from natural casein from cow milk, has good biological compatibility and high safety.

[0021] Obviously, according to the above content of the present application, according to the ordinary technical knowledge and common means in the art, other various forms of modifications, replacements or changes can be made without departing from the above basic technical idea of the present application.

[0022] The above content of the present application will be further described in detail through the following embodiment mode. However, it should not be understood that the above subject matter of the present application is limited to the following examples. Any technology realized based on the above content of the present application belongs to the scope of the present application. BRIEF DESCRIPTION OF DRAWINGS

[0023] Fig. 1 is a result graph of the toxic effects of 7 polypeptides on BV2 cells.

[0024] Figure 2 is a graph showing the effect of seven polypeptides on the amount of NO production of BV2 cells induced by lipopolysaccharide.

[0025] Figure 3 is a graph showing the effect of polypeptides FVAPFPE (FE7) and FGKEKVNE (FE8) on the level of IL-1β.

[0026] Figure 4 is a graph showing the effect of polypeptides FVAPFPE (FE7) and FGKEKVNE (FE8) on the level of ROS.

[0027] Figure 5 is a graph showing the effect of polypeptides FVAPFPE (FE7) and FGKEKVNE (FE8) on the level of MDA.

[0028] Figure 6 is a graph showing the identification results of primary neural stem cells from rats. A. Characteristic 1: capable of asymmetric division; B. Characteristic 2: has the ability of division and proliferation; C. Characteristic 3: stem cell characteristic protein Nestin is positive; D. Characteristic 4: differentiation marker protein GFAP is positive.

[0029] Figure 7 is a graph showing the cytotoxicity results of different concentrations of tert-butyl hydroperoxide intervention for 48 h on neural stem cells.

[0030] Figure 8 is a graph showing the cytotoxicity results of different concentrations of polypeptide FVAPFPE intervention for 48 h on neural stem cells.

[0031] Figure 9 is a graph showing the effect of polypeptide FVAPFPE intervention on telomere length under oxidative stress. DETAILED DESCRIPTION

[0032] In the specific embodiments of the present application, the experimental methods without specific conditions are carried out according to the conventional conditions or the conditions recommended by the manufacturer, and the various common chemical reagents used are commercially available products.

[0033] Example 1, screening of brain-accessible active peptides from casein

[0034] The present application uses a simple and efficient method to screen brain-accessible active peptides from casein hydrolysate fermented by Lactobacillus bulgaricus. After preparing the fermented casein hydrolysate, the following three steps of in vitro simulation of digestion, absorption and transport are carried out in turn: (1) the standard method of INFOGEST simulates the human digestive process; (2) based on the formation of barrier by culturing human colon cancer cells (Caco-2) on transwell chamber to simulate the absorption process in human intestinal tract; (3) based on the formation of barrier by culturing immortalized human brain microvascular endothelial cells (hCMEC / D3) cells on transwell chamber to simulate the penetration process of blood-brain barrier in human body.

[0035] The standard strain of Lactobacillus bulgaricus (Genbank sequence number: CP032451.1) was mixed to ferment casein hydrolysate. After the Lactobacillus bulgaricus was activated by recovering and subculturing twice, it was added to the sterilized MRS liquid medium at a ratio of 1%-2% and mixed uniformly, and then cultured in a 37°C anaerobic incubator for 36h for strain amplification. After the culture was completed, the bacterial solution was concentrated by centrifugation, and plate counting was performed according to the national standard method. The concentrated bacterial solution was added to a sterile 50mL centrifuge tube, centrifuged at 3000rpm / min for 10min at 4°C, and the supernatant was discarded. Then 3 times the volume of PBS was added, and centrifuged at 3000rpm / min for 10min at 4°C. The PBS was discarded and the bacteria were prepared for use. Casein was weighed in a beaker at a ratio of 2.5g / 100mL ultrapure water, 4%(v / v) 0.5M NaOH solution was added, and then 96%(v / v) ultrapure water was added. The beaker was sealed with sealing film and stirred magnetically at room temperature. After the lumpy casein was completely dissolved, the pH was measured to be between 7.2-7.3, and it was sterilized by heating at 90°C for 15min. After cooling to room temperature, 5mL of casein solution was taken to resuspend the prepared bacteria, and a certain amount of casein solution was added to mix uniformly, so that the concentration of the bacterial solution reached 5×10 8 CFU / mL. Then the centrifuge tube cap was screwed on, sealed with sealing film, and placed in a 37°C anaerobic incubator for fermentation for 72h. The fermentation system was centrifuged at 4°C, 3900rpm / min for 10min, filtered with a 0.22um membrane to remove bacteria, and then "fermented casein hydrolysate" was prepared. After freeze-drying, it was used for the next experiment.

[0036] (1) INGEST standard method simulates human digestive process

[0037] This part is completely based on the standard operating procedure required by INFOGEST version 2.0. Briefly, first prepare the stock solution, then prepare the digestion solution according to the amount of stock solution used in each digestion solution, and prepare it for use at 37°C. During the heating process, seal the opening with sealing film to prevent solvent evaporation. Then weigh 120 mg of freeze-dried casein hydrolysate and dissolve it in 3 mL of prepared oral digestion solution, shake at 37°C for 2 min at 60 rpm / min to simulate the oral digestion stage. Next, add 3 mL of gastric digestion solution containing 2000 U / mL pepsin to the system, start timing from the addition of enzyme, and shake at 60 rpm / min in a 37°C incubator. Next, add 6 mL of intestinal digestion solution containing 100 U / mL trypsin and 200 mg / mL bile to the system, start timing from the addition of enzyme, and shake at 60 rpm / min in a 37°C incubator. After digestion, inactivate at 100°C for 5 min, then add all the liquid to a 10 kDa ultrafiltration tube, centrifuge at 3000 rpm / min for 15 min at 4°C to remove the interference of digestive enzymes, and collect the <10 kDa fraction as "simulated digestion products".

[0038] (2) Human colon cancer cells (Caco-2) form a barrier to simulate the human intestinal absorption process

[0039] Caco-2 cells were cultured in DMEM high glucose medium supplemented with 10% fetal bovine serum, 1% penicillin-streptomycin, and passaged every 2-3 days. The well-grown cell suspension was added to the transwell chamber (corning, 3470, membrane diameter 6.5 mm, membrane pore size 0.4 um) at a density of 2 x 10 5 2 The above holes are effective holes, and the products transported by the effective holes are collected as "simulated intestinal absorption fractions".

[0040] ​(3) hCMEC / D3 cells are cultured in hCMEC / D3 specific medium (PriMed-iCell-002, formula: 93% endothelial cell culture basal medium, 5% premium fetal bovine serum, 1% endothelial cell culture supplement, 1% penicillin / streptomycin) and subcultured when the cell density reaches 80-90%. The well-grown cell suspension is added to the top side of the transwell chamber (corning, 3470, membrane diameter 6.5 mm, membrane hole diameter 0.4 um) at a density of 2x10 5 6 mL of medium on the bottom side, and the medium is changed every 2 days. The transwell chamber is cultured for 7 days to form a complete monolayer, during which the transmembrane resistance on both sides of the membrane is monitored every 2 days using a Millicell-ERS2 cell resistance meter. The standard for the TEER value of this part is ≥ 20 Ω·cm 2 At the same time, the toxic effect of the "simulated intestinal absorption into blood" intervention on the hCMEC / D3 cells is detected, and the concentration with the maximum non-toxic effect is selected for the transport experiment. The "simulated intestinal absorption into blood" is diluted in HBSS solution at this concentration, then added to the top side of the transwell chamber, and received from the bottom side for 2 h. After collecting the liquid on the bottom side, the transmembrane resistance is detected again, and the hCEMC / D3 cell barrier transmembrane resistance is maintained at 20 Ω·cm 2 The above holes are effective holes, and the products after the transport of the effective holes are used as "simulated blood into brain".

[0041] The "fermented casein hydrolysate", "simulated digestion product", "simulated intestinal absorption into blood portion", and "simulated blood-brain barrier penetration portion" were subjected to polypeptidomic detection, and after polypeptide identification, the intersection of the four stages was determined to represent the subset of polypeptides derived from the casein hydrolysate fermented by Lactobacillus bulgaricus that can resist the destruction of the digestion process, can withstand the hydrolysis of the enzymes secreted by the intestinal epithelial cells to the lumen side, can pass through the intestinal epithelial barrier intact, and can pass through the blood-brain barrier intact. The above results contain 63 peptides, and next, Autodock vina was used to perform molecular docking of the above 63 peptides with the active site Ketch domain of the Keap1 protein (https: / / www.rcsb.org / structure / 2FLU). In theory, the active peptides can promote the release of Nrf2 by competing with the target, thereby starting the downstream anti-oxidation and cross-talk process with the inflammatory response. We ranked the above 63 polypeptides according to the docking score, and with the docking score of the original ligand Nrf2 of the Keap1 protein as the cutoff point -7.8 kcal / mol, we determined 7 polypeptides with docking scores lower than -7.8 kcal / mol and molecular weights less than 1 kDa (the sequence information of the 7 polypeptides is shown in Table 1). Searching the two active peptide databases BIOPEP-UWM (https: / / www.uwm.edu.pl / biochemia) and the Milk Bioactive Peptide Database (https: / / mbpdb.nws.oregonstate.edu / ) found that the 7 polypeptides were not recorded, so it can be considered that the 7 polypeptides are newly discovered sequences. These 7 polypeptides were predicted by ToxiBTL (http: / / server.wei-group.net / ToxIBTL) to be non-toxic. Prediction with the peptide ranker tool (http: / / distilldeep.ucd.ie / PeptideRanker / ) found that FVAPFPE and PVVVPPF may have biological activity.

[0042] Table 1. Information of 7 polypeptides with potential biological activity screened

[0043] Example 2, verification of the predicted results in a mouse microglial cell line BV2 cell model

[0044] Shanghai Generay Biotech Co., Ltd. used solid-phase synthesis to artificially synthesize and desalt the above 7 polypeptides. Reverse-phase high-performance liquid chromatography showed that the purity of the synthesized polypeptides was >99%.

[0045] 2.1 Toxic effects of polypeptides screened in vitro on BV2 cells and effects on NO production

[0046] BV2 cells were cultured in DME medium containing 10% fetal bovine serum, 1% penicillin-streptomycin at 37°C in a 5% CO2 incubator, and subcultured every 1-2 days. BV2 cells were plated at a density of 1 x 10 5 The cells were grown for 24 h, and then intervened with polypeptides at concentrations of 0.01 pg / mL, 0.1 pg / mL, 1.00 pg / mL, and 10.00 pg / mL for 24 h. The cell survival rate was detected by CCK-8 method, and the experiment was repeated 3 times.

[0047] The results are shown in Figure 1. None of the 7 polypeptides showed cytotoxicity to BV2 cells.

[0048] The Griess method was used to detect the amount of NO generated to evaluate the effect of the 7 polypeptides screened in vitro on the neuroinflammation of BV2 cells induced by lipopolysaccharide. BV2 cells were plated at a density of 1 x 10 5 The cells were grown for 24 h, and then intervened with polypeptides at concentrations of 0.01 pg / mL, 0.1 pg / mL, 1.00 pg / mL, and 10.00 pg / mL for 24 h. The cell survival rate was detected by CCK-8 method, and the experiment was repeated 3 times.

[0049] The results of NO detection are shown in Figure 2. Compared with the control group without intervention, the amount of NO generated in the model group increased significantly, and the amount of NO generated in the positive control group decreased significantly (curcumin is a recognized natural medicine with antioxidant and anti-inflammatory activity, and also helps to delay aging, but cannot cross the blood-brain barrier). Among the polypeptide intervention groups, FVAPFPE (FE7) and FGKEKVNE (FE8) significantly reduced the amount of nitric oxide (NO) generated, and the other 5 polypeptides did not show inhibitory effect on NO. Therefore, in subsequent experiments, only the effects of these two polypeptides were evaluated.

[0050] 2.2 Evaluation of Anti-inflammatory and Antioxidant Effects of Polypeptides that Reduce NO Production

[0051] BV2 cells were plated at a density of 1 x 10 5The BV2 cells were plated in a 96-well plate at a density of 1×10 After the cells were grown for 24 h, the treatment measures of each group were as follows: the control group was not added with the polypeptide or lipopolysaccharide, and was supplemented with an equal amount of medium; the model group was not added with the polypeptide, and was added with lipopolysaccharide at a final concentration of 1 μg / mL; the positive control group was added with lipopolysaccharide at a final concentration of 1 μg / mL and curcumin at a final concentration of 5 μM; and the intervention group was added with lipopolysaccharide at a final concentration of 1 μg / mL and the polypeptide at different concentrations (0.01 μg / mL, 0.1 μg / mL and 1.00 μg / mL). Each group was intervened for 24 h. The cell supernatant was collected, and the content of IL-1β was detected by using an ELISA kit.

[0052] The IL-1β detection results are shown in FIG. 3. The IL-1β production amount of the model group indicated that more IL-1β was released from the BV2 cells induced by LPS, and after the intervention of the polypeptide at different concentrations, the IL-1β production amount showed a decreasing trend with the increase of the polypeptide concentration. The IL-1β production amount after the intervention of the polypeptide decreased most obviously in the 1.00 μg / mL dose group, and the difference was statistically significant. However, the intervention of FGKEKVNE did not reduce the IL-1β level.

[0053] The BV2 cells were plated in a 24-well plate at a density of 1×10 5 After the cells were cultured for 24 h, the treatment measures of each group were as follows: the control group was not added with the polypeptide or lipopolysaccharide, and was supplemented with an equal amount of medium; the model group was not added with the polypeptide, and was added with lipopolysaccharide at a final concentration of 1 μg / mL; the positive control group was added with lipopolysaccharide at a final concentration of 1 μg / mL and curcumin at a final concentration of 5 μM; and the intervention group was added with lipopolysaccharide at a final concentration of 1 μg / mL and the polypeptide at different concentrations (0.01 μg / mL, 0.1 μg / mL and 1.00 μg / mL). Each group was intervened for 24 h. The ROS level was detected by using a ROS detection kit (Biyun Tian) by an enzyme-labeled method. Specifically, the DCFH-DA was diluted by using serum-free DMEM at a ratio of 1:1000, so that the final concentration was 10 μmol / L. After the cell culture solution in the 24-well plate was removed, the diluted DCFH-DA was added, and the cells were incubated in a 37°C incubator for 20 min. After the cells were scraped, the cells were washed with serum-free cell culture solution for 3 times, and the cells were mixed and divided into two parts. One part was used to detect the fluorescence intensity under the condition of 488 nm excitation wavelength and 525 nm emission wavelength by using a fluorescence enzyme-labeled instrument. The other part was used to detect the absorbance at 450 nm by using a CCK-8 method. The ratio of the fluorescence intensity to the absorbance at 450 nm was calculated, and the value of the control group was corrected, so that the relative ROS value was obtained.

[0054] The ROS detection results are shown in Figure 4. The decrease in ROS in the positive control group was statistically significant compared to the model group. FVAPFPE (1 μg / mL) intervention also significantly reduced ROS, with a statistically significant difference compared to the model group. Furthermore, the intervention effect of 1 μg / mL FVAPFPE was comparable to that of the positive control, suggesting that 1 μg / mL FVAPFPE possesses nearly the same ROS scavenging capacity as 5 μM curcumin. However, there was no statistically significant difference in relative ROS after FGKEKVNE intervention compared to the model group.

[0055] BV2 cells were fed at a rate of 1×10 5 Cells were seeded at a density of 3 mL / well in 6-well plates and cultured for 24 h before intervention. The treatments for each group were as follows: Control group: no peptides or lipopolysaccharide added, with an equal volume of culture medium added; Model group: no peptides added, only lipopolysaccharide added at a final concentration of 1 μg / mL; Positive control group: lipopolysaccharide and curcumin at a final concentration of 5 μM were added; Intervention group: lipopolysaccharide at a final concentration of 1 μg / mL and peptides at different concentrations (0.01 μg / mL, 0.1 μg / mL, 1.00 μg / mL) were added. All groups were intervened for 24 h. After intervention, cells were scraped off with a cell scraper, lysed, and protein quantification was performed using a BCA kit (Beyotime). MDA levels were detected using an MDA detection kit (Beyotime). All experimental procedures were performed strictly according to the manufacturer's instructions.

[0056] The MDA detection results are shown in Figure 5. In the model group, LPS-induced BV2 cell MDA levels significantly increased. After intervention with different concentrations of FVAPFPE, MDA levels tended to decrease with increasing peptide concentration, with the most significant decrease observed in the 1.00 μg / mL FVAPFPE intervention group, a statistically significant difference compared to the model group. However, there was no statistically significant difference in MDA levels between the model group and the FGKEKVNE intervention group.

[0057] In summary, this section validated the functions of the seven small peptides screened through molecular docking. The results showed that FVAPFPE exhibited the best efficacy, possessing both anti-inflammatory and antioxidant capabilities. 1 μg / mL of FVAPFPE was comparable to 5 μM curcumin in improving IL-1β, ROS, and MDA levels.

[0058] Example 3: Effect of FVAPFPE on relative telomere length of neural stem cells derived from SD rats

[0059] Natural aging is accompanied by telomere shortening, while oxidative stress can accelerate telomere wear and aging. Therefore, based on the close relationship between oxidative stress and telomeres in neurodegenerative diseases, this invention focuses on the protective effect of FVAPFPE, which has been screened for antioxidant and anti-inflammatory activities, against telomere wear accelerated by oxidative stress.

[0060] 3.1 Isolation, culture and identification of neural stem cells

[0061] The hippocampus of SD newborn rats within 24 hours after birth was isolated under sterile conditions and mechanically digested, and then cultured in DMEM / F12 medium (added with 2% B27, 1% penicillin-streptomycin, 20 ng / mL epidermal growth factor, and 20 ng / mL basic fibroblast growth factor), and the medium was replaced every 2 days. After 7 days of culture, the neural stem cells were counted after being digested with Accutase. The morphological characteristics, division ability, and proliferation ability of the neural stem cells were observed under a microscope, and the surface marker proteins were identified by immunofluorescence. In the immunofluorescence experiment, the cells were incubated with Nestin and GFAP antibodies, and then green-labeled secondary antibodies and DAPI staining solution were added to label the cell nucleus. Then, the cells were observed under a fluorescence microscope.

[0062] As shown in FIG. 6, the single neural cells had a round shape, had the typical asymmetric division ability of neural stem cells, had the symmetric division and proliferation ability, the Nestin staining result was positive, indicating that the cells had the characteristics of stem cells, and the surface GFAP staining result was positive, indicating that the cells had the differentiation ability. The above characteristics indicated that the cells obtained by the above method had the characteristics of neural stem cells.

[0063] 3.2 Selection of hydrogen peroxide tert-butyl alcohol modeling dose

[0064] The neural stem cells were plated in a 96-well plate at a density of 2 x 10 5 After the cells were grown for 24 hours, they were intervened with hydrogen peroxide tert-butyl alcohol at different concentrations (0 μM, 10 μM, 20 μM, 40 μM, 50 μM, and 60 μM final concentration) for 48 hours, and then the cell survival rate was detected by CCK-8 method. The experiment was repeated 3 times.

[0065] As shown in FIG. 7, when the concentration of hydrogen peroxide tert-butyl alcohol was 20 μM, the survival rate of the primary neural stem cells was about 80%, and in combination with the modeling concentration reported in the literature, 20 μM was used as the modeling dose in the present application.

[0066] 3.3 Cytotoxicity test of polypeptide FVAPFPE on neural stem cells

[0067] The neural stem cells were obtained in the same way as in 3.1. The primary neural stem cells were plated in a 96-well plate at a density of 2 x 10 5Cells were seeded at a density of 100 μL / mL in 96-well plates. After 24 h of cell growth, the cells were treated with FVAPFPE at concentrations of 0.01 μg / mL, 1.00 μg / mL, and 100.00 μg / mL for 48 h. Cell viability was then assessed using the CCK-8 assay. The experiment was repeated three times.

[0068] The results are shown in Figure 8. FVAPFPE showed no cytotoxicity within the dose range of 0.01-100.00 μg / mL. Therefore, this experiment will proceed with further testing within this dose range.

[0069] 3.4 Peptide FVAPFPE intervention followed by cytoplasmic length detection

[0070] The source and method of obtaining neural stem cells are the same as in 3.1. Neural stem cells derived from SD rats were processed at a rate of 2 × 10⁻⁶. 5 FVAPFPE was cultured at a density of 0.01 μg / mL in T25 culture flasks, 5 mL per flask. FVAPFPE was added to serum-free DMEM / F12 medium at final concentrations of 0.01 μg / mL, 0.1 μg / mL, and 1 μg / mL, with 5 μM curcumin as a positive control. The medium was completely changed every 2 days for 10 days. After this intervention, the medium was replaced with DMEM / F12 medium supplemented with a final concentration of 20 μM hydrogen peroxide tert-butanol. Genomic DNA was extracted 48 h after modeling and diluted to 50 ng / μL. Relative telomere length was detected by qt-PCR. A 10 μL reaction mixture was prepared using 0.4 μL of 10 μM forward primer, 0.4 μL of 10 μM negative primer, 3.2 μL of ddH2O, 5 μL of TaqII, and 1 μL of genomic DNA (reverse transcription reagents and PCR reaction reagents were purchased from Takara). Detection was performed using a Light Cycler 96 real-time quantitative PCR instrument. The qt-PCR reaction conditions were as follows: 95℃ pre-denaturation for 3 min, followed by 95℃ denaturation for 10 s, 60℃ annealing for 30 s, and 72℃ extension for 40 s, for a total of 40 cycles, with AT1 as an internal control. The experiment was repeated 3 times, and each sample was tested 3 times.

[0071] The primer sequences are as follows:

[0072] Telo-F: GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT (SEQ ID NO.8)

[0073] Telo-R:TCCCGACTATCCCTATCCCTATCCCTATCCCTATCCCTA(SEQ ID NO.9)

[0074] AT1-F: ACGTGTTCCAGCATCGACCCTACC (SEQ ID NO. 10)

[0075] AT1-R: AGAATGATAAGGAAAGGGAAGAAGCCC (SEQ ID NO. 11)

[0076] The results are shown in Figure 9: compared with the control group, the model group (t-BHP intervention group) of neural stem cells was accelerated and shortened after hydrogen t-butyl alcohol treatment, among the three intervention groups pretreated with active peptides for 10 days, the relative telomere length was longer than that of the model group, and the relative telomere length after polypeptide FVAPFPE intervention of 0.10 μg / mL had statistical significance compared with the model group. It is proved that polypeptide FVAPFPE can delay telomere wear.

[0077] In summary, the application screens an active peptide FVAPFPE from casein hydrolysate prepared by fermentation method, and through in vitro simulation, molecular docking prediction and cell experiment verification, it is confirmed that the active peptide can be stably taken into the brain after oral intake, and has the effects of anti-inflammatory, anti-oxidation and protection of telomere wear. The active peptide can delay aging, and prevent and / or treat diseases related to aging, and has good clinical application prospect.

Claims

1. Use of an active peptide for the preparation of a medicament for delaying telomere attrition, characterized in that: The amino acid sequence of the active peptide is FVAPFPE.

2. Use according to claim 1, characterized in that: The drug is a drug for improving telomere attrition in the nervous system.

3. Use according to claim 1, characterized in that: The drug is an anti-inflammatory and / or antioxidant drug.

4. Use according to claim 3, characterized in that: The drug is a drug for improving oxidative stress and neuroinflammation.

5. The use according to claim 1, characterized in that: The drug is a drug for improving cognitive decline.

6. Use according to claim 1, characterized in that: The drug is a drug for delaying aging.

7. Use according to claim 1, characterized in that: The drug is a drug for preventing and / or treating diseases associated with aging.

Images