Sugar-inducible promoters

Recombinant nucleic acids with sugar-inducible promoters allow precise control of gene expression in microorganisms for targeted delivery of biologies to the gastrointestinal tract, addressing the lack of such tools in existing technologies.

WO2026085522A1PCT designated stage Publication Date: 2026-04-23WISCONSIN ALUMNI RES FOUND
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/051634
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-07-18
Filing Date
2025-10-20
Publication Date
2026-04-23

AI Technical Summary

Technical Problem

Existing technologies lack tools for tailoring gene expression in microorganisms for in vivo delivery of therapeutics and biologies to the gastrointestinal tract, particularly through promoters regulated by dietary sugars.

Method used

Development of recombinant nucleic acids with sugar-inducible promoters operably linked to heterologous nucleic acid sequences, enabling precise control of gene expression in response to sugars like glucose, maltose, raffinose, sucrose, arabinose, galactose, lactose, melibiose, and ribose, and recombinant microorganisms such as Limosilactobacillus reuteri to deliver biologies.

Benefits of technology

Enables targeted and controlled expression of therapeutic biologies in response to specific sugars, enhancing the delivery and efficacy of biologies to the gastrointestinal tract.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000037_0001
    Figure IMGF000037_0001
  • Figure IMGF000027_0001
    Figure IMGF000027_0001
  • Figure IMGF000028_0001
    Figure IMGF000028_0001
Patent Text Reader

Abstract

Promoters inducible with sugars such as glucose, maltose, raffinose, sucrose, arabinose, galactose, lactose, melibiose, and ribose; recombinant nucleic acids comprising the sugar-inducible promoters, including sugar-excisable nucleic acid cassettes comprising the sugar-inducible promoters; recombinant microorganisms comprising the recombinant nucleic acids; and methods of using same.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] SUGAR-INDUCIBLE PROMOTERS

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] Priority is hereby claimed to US Provisional Application 63 / 708,974, filed October 18, 2024, and US Provisional Application 63 / 846,355, filed July 18, 2025, which are incorporated herein by reference in their entireties.

[0004] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0005] This invention was made with government support under GM 135483 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0006] SEQUENCE LISTING

[0007] The instant application contains a Sequence Listing which has been submitted in XML format and is hereby incorporated by reference in its entirety. The XML copy, created on September 17, 2025, is named USPTO-251020-09824638-P240255W001 -SEQ_LIST.xml and is 236,059 bytes in size.

[0008] FIELD OF THE INVENTION

[0009] The invention is directed to promoters inducible with sugars such as glucose, maltose, raffinose, sucrose, arabinose, galactose, lactose, melibiose, and ribose; recombinant nucleic acids comprising the sugar- inducible promoters, including sugar-excisable nucleic acid cassettes comprising the sugar-inducible promoters; recombinant microorganisms comprising the recombinant nucleic acids; and methods of using same.

[0010] BACKGROUND

[0011] Microorganisms have been used for in situ delivery of therapeutics and other biologies to the gastrointestinal tract and other various in vivo sites. However, tools that tailor gene expression during gastrointestinal transit are lacking. Promoters regulated by dietary sugars that would allow in vivo modulation of gene expression for the delivery of biologies are needed.

[0012] SUMMARY OF THE INVENTION

[0013] One aspect of the invention is directed to recombinant nucleic acids.

[0014] In some versions, the recombinant nucleic acids comprise a sugar-inducible promoter operably linked to a heterologous nucleic acid sequence. In some versions, the sugar-inducible promoter comprises a sugar- inducible promoter sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to at least 100 contiguous bases, at least 125 contiguous bases, at least 150 contiguous bases, at least 175 contiguous bases, at least 200 contiguous bases, at least 225 contiguous bases, at least 250 contiguous bases, at least 300 contiguous bases, at least 325 contiguous bases, at least 350 contiguous bases, at least 375 contiguous bases, or the entirety of a sequence selected from the group consisting of SEQ ID NOS: 1- 38. In some versions, the sugar-inducible promoter sequence has at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOS: 1-6. In some versions, the sugar-inducible promoter sequence has at least 95%, at least 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOS: 1-6.

[0015] In some versions, the heterologous nucleic acid sequence is within at least 1 base, at least 2 bases, at least 3 bases, at least 4 bases, at least 5 bases, at least 6 bases, at least 7 bases, at least 8 bases, at least 9 bases, at least 10 bases, at least 25 bases, at least 50 bases, at least 75 bases, at least 100 bases, at least 125 bases, at least 150 bases, at least 175 bases, at least 200 bases, at least 225 bases, at least 250 bases, at least 275 bases, at least 300 bases, at least 325 bases, at least 350 bases, at least 375 bases, at least 400 bases, at least 425 bases, at least 450 bases, at least 475 bases, or at least 500 bases of the sugar-inducible promoter sequence.

[0016] In some versions, the heterologous nucleic acid sequence comprises a transcription sequence operably linked to the sugar-inducible promoter. In some versions, the heterologous nucleic acid sequence comprises a template sequence for a biologic operably linked to the sugar-inducible promoter. In some versions, the heterologous nucleic acid sequence comprises a template sequence for a therapeutic biologic operably linked to the sugar-inducible promoter.

[0017] In some versions, the recombinant nucleic acid comprises a recombinant nucleic acid cassette comprising: recombinase recognition sites; and internal cassette elements disposed between the recombinase recognition sites, wherein the internal cassette elements comprise a recombinase promoter operably linked to a recombinase coding sequence, wherein the recombinase promoter is the sugar-inducible promoter and the recombinase coding sequence is comprised by the heterologous nucleic acid sequence.

[0018] In some versions, the recombinase coding sequence encodes a recombinase selected from the group consisting of a Cre recombinase, a FLP recombinase, a gamma-delta recombinase, a Tn3 resolvase, a cpC31 integrase, a Bxb1 integrase, and an R4 integrase. In some versions, the recombinase coding sequence encodes a Cre recombinase. In some versions, the Cre recombinase comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% to SEQ ID NQ:40.

[0019] In some versions, the internal cassette elements further comprise a selection marker comprising a selection-marker promoter operably linked to a selection-marker coding sequence. In some versions, the selection-marker coding sequence encodes a sucrose transporter, a sucrose phosphorylase, or a sucrose transporter and a sucrose phosphorylase. In some versions, the selection-marker promoter comprises a selectionmarker promoter sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO:5.

[0020] In some versions, the internal cassette elements further comprise a biologic gene configured to express a biologic. In some versions, the biologic comprises a therapeutic biologic.

[0021] In some versions, the internal cassette elements further comprise an adhesin gene configured to express an adhesin comprising an adhesin protein sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOS:48, 50, 52, 54, 56, 58, 60, 62, 64, 66, and 68. In some versions, the internal cassette elements further comprise an antirepressor gene comprising an antirepressor coding sequence encoding an antirepressor protein comprising an antirepressor protein sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO:70. In some versions, the antirepressor gene comprises an antirepressor promoter operably linked to the antirepressor coding sequence.

[0022] In some versions, the antirepressor promoter is the recombinase promoter.

[0023] In some versions, the antirepressor promoter is not the recombinase promoter. In some versions, the antirepressor promoter comprises a promoter sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to the recombinase promoter sequence. In some versions, the antirepressor promoter is a second sugar-inducible promoter inducible by at least one sugar that induces the recombinase promoter. In some versions, the second sugar-inducible promoter has a second sugar-inducible promoter sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to at least 100 contiguous bases, at least 125 contiguous bases, at least 150 contiguous bases, at least 175 contiguous bases, at least 200 contiguous bases, at least 225 contiguous bases, at least 250 contiguous bases, at least 300 contiguous bases, at least 325 contiguous bases, at least 350 contiguous bases, at least 375 contiguous bases, or the entirety of a sequence selected from the group consisting of SEQ ID NOS: 1-38.

[0024] In some versions, the internal cassette elements further comprise an essential gene.

[0025] In some versions, the heterologous nucleic acid sequence comprises an insertion sequence.

[0026] Another aspect of the invention is directed to recombinant microorganisms comprising a recombinant nucleic acid of the invention. In some versions, the recombinant microorganism is a bacterium. In some versions, the recombinant microorganism is a member of lactic acid bacteria. In some versions, the recombinant microorganism is a member of Limosilactobacillus. In some versions, the recombinant microorganism is Limosilactobacillus reuteri.

[0027] Another aspect of the invention is directed to methods of producing a biologic with a recombinant nucleic acid of the invention comprising a heterologous nucleic acid sequence comprising a template sequence for a biologic operably linked to the sugar-inducible promoter. In some versions, the methods comprise comprising contacting the sugar-inducible promoter with an amount of an inducing sugar effective to induce expression of the biologic. In some versions, the recombinant nucleic acid is comprised by a recombinant microorganism of the invention, and the method comprises contacting the recombinant microorganism with an amount of the inducing sugar effective to induce expression of the biologic.

[0028] Another aspect of the invention is directed to methods of excising the internal cassette elements from a recombinant nucleic acid comprising a recombinant nucleic acid cassette of the invention. In some versions, the methods comprise contacting the recombinase promoter with an amount of an inducing sugar effective to express the recombinase in an amount effective to excise the internal cassette elements from the recombinant nucleic acid. In some versions, the recombinant nucleic acid is incorporated in a genome of a recombinant microorganism of the invention, the method comprises contacting the recombinant microorganism with an amount of the inducing sugar effective to express the recombinase in an amount effective to excise the internal cassette elements from the recombinant nucleic acid, and the excising comprises excising the internal cassette elements from the genome of the microorganism.

[0029] In some versions, the inducing sugar in the aforementioned methods is selected from the group consisting of glucose, maltose, raffinose, sucrose, arabinose, galactose, lactose, melibiose, and ribose.

[0030] In some versions, the inducing sugar in the aforementioned methods comprises one or more of glucose, raffinose, arabinose, galactose, lactose, melibiose, and ribose; and the sugar-inducible promoter sequence has at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to at least 100 contiguous bases, at least 125 contiguous bases, at least 150 contiguous bases, at least 175 contiguous bases, at least 200 contiguous bases, at least 225 contiguous bases, at least 250 contiguous bases, at least 300 contiguous bases, at least 325 contiguous bases, at least 350 contiguous bases, at least 375 contiguous bases, or the entirety of any one of SEQ ID NOS: 1-4.

[0031] In some versions, the inducing sugar in the aforementioned methods comprises one or more of sucrose and raffinose, and the sugar-inducible promoter sequence has at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to at least 100 contiguous bases, at least 125 contiguous bases, at least 150 contiguous bases, at least 175 contiguous bases, at least 200 contiguous bases, or the entirety of SEQ ID NO:5.

[0032] In some versions, the inducing sugar in the aforementioned methods comprises maltose, and the sugar- inducible promoter sequence has at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to at least 100 contiguous bases, at least 125 contiguous bases, at least 150 contiguous bases, at least 175 contiguous bases, at least 200 contiguous bases, at least 225 contiguous bases, at least 250 contiguous bases, at least 300 contiguous bases, or the entirety of SEQ ID NO:6.

[0033] In some versions, the methods comprise contacting the recombinant microorganism with the inducing sugar at a site on or in a subject. In some versions, the methods comprise introducing the recombinant microorganism to the site of the subject. In some versions, the methods comprise introducing the inducing sugar or a precursor thereof to the site of the subject. In some versions, the site comprises a gastrointestinal tract of the subject. In some versions, the methods comprise orally administering the recombinant microorganism to the gastrointestinal tract of the subject. In some versions, the methods comprise orally administering the inducing sugar or a precursor thereof to the gastrointestinal tract of the subject.

[0034] The objects and advantages of the invention will appear more fully from the following detailed description of the preferred embodiment of the invention made in conjunction with the accompanying drawings.

[0035] BRIEF DESCRIPTION OF THE DRAWINGS

[0036] FIGS. 1A-1C. Characterization of Pglucose. FIG. 1A. Characterization of Pglucose in inducing and noninducing sugars. Pglucose produces significantly more recombinant Leptin-HIBIT upon growth within the inducing sugar (glucose, left bar at each timepoint) as compared to the noninducing sugar (sucrose, right bar at each timepoint). Data analyzed with 2-way ANOVA using multiple comparisons with Sidak's correction. FIG. 1 B. Expression profile with Pglucose across all sugars utilized by L reuteri. Expression under Pglucose is low only in sucrose. In all other sugars, Pglucose leads to production of recombinant Leptin-HIBIT. Data are significant (P<0.05) when compared to sucrose for all sets other than maltose and ribose when analyzed via 2-way ANOVA using multiple comparisons with Dunnett correction. FIG. 1C. Expression profile with Pglucose in response to fructose titration. Expression under Pglucose appears to be inhibited or otherwise decreased upon the addition of fructose (fructose supplemented samples are highlighted by black underline). N=1.

[0037] FIGS. 2A and 2B. Characterization of Psucrose. FIG. 2A. Characterization of Psucrose in inducing and noninducing sugars. Psucrose produces significantly more recombinant Leptin-HiBiT upon growth within the inducing sugar (sucrose, right bar at each timepoint) as compared to the noninducing sugar (glucose, left bar at each timepoint). Data analyzed with 2-way ANOVA using multiple comparisons with Sidak's correction. FIG. 2B. Expression profile with Psucrose across 4 sugars utilized by L reuteri. Psucrose appears to be induced by raffinose alongside sucrose. N=1 .

[0038] FIG. 3 Characterization of Pmaltose. Characterization of Pmaltose in inducing (maltose, right bar at each timepoint) and noninducing (sucrose, left bar at timepoint T1) sugars. Pmaltose appears to be induced by maltose and not induced by sucrose. N=1 .

[0039] FIGS. 4A-4C. Characterization of Pglucose ribosomal binding site and leptin start codon variants. FIG. 4A. Preliminary expression of Pglucose and all modifications in glucose. Two constructs (3 and 5) were prioritized for future study as their glucose expression was between 10,000 and 1000pg / mL. N=1 . FIG. 4B. Expression of Pglucose, Construct 3, and Construct 5 in glucose. The modifications made in both constructs yield a lower expression relative to the original Pglucose sequence. Data analyzed via 1-way ANOVA using multiple comparisons with Dunnett correction. N=3. FIG. 4G. Expression of Pglucose, Construct 3, and Construct 5 in sucrose. Similarly to B, the modifications made in both constructs yield a lower relative expression in sucrose. Data analyzed via 1 -way ANOVA using multiple comparisons with Dunnett correction. N=3.

[0040] FIG. 5. Recombinant ere Cassette. The DNA inserted encoded the following, from left to right: loxP66, Pglu, ere containing two in-frame stop codons, an inverted repeat (IR), murine interleukin-22 (IL-22), the promoter for the gene elongation factor thermo unstable (PEFTU), noncoding region isolated from L. plantarum ( / .. plan NC), and loxP71. Upon exposure to an inducing sugar and activation of Pglu, Cre excises the cassette and forms the inert scar loxP72. Cre cannot interact with loxP72. Insertions were done to flank the genes encoding sucT and sucP and their native promoter (Psuc). sucT and sucP were used as selection markers for the retention of the cassette on sucrose.

[0041] FIG. 6. Proof of concept of sugar-inducible Cre in VPL4366. Validation of sugar-inducible Cre activity over the course of 8hrs. Growth in 100 mM glucose, and therefore activation of Pglu, led to significantly more excision events and therefore a higher logCFU reduction than growth on 50 mM sucrose. Data are representative of three biological replicates and are analyzed using two-way Anova with Sidak's correction.

[0042] FIG. 7. Validation of cassette excision, expressed as percent excision. Results from plate counts displayed as percent excision. VPL4366 harboring the recombinant cre cassette was grown in in mMRS + sugar, and colonies were enumerated on both mMRS + 100mM glucose plates (total colonies) and mMRS + 50 mM sucrose plates (unexcised colonies). Percent excision was calculated as (total - unexcised colonies) / (total colonies). Growth in 50 mM sucrose led to 18% excision after five passages, showing maintenance of the cassette. Growth in both 100 mM glucose and 50 mM melibiose led to 99.4% and 99.98% excision, respectively, after five passages. Data are representative of one biological replicate.

[0043] FIG. 8. Validation of cassette excision, expressed as bacterial concentrations. Results from plate counts displayed as raw CFU / mL. VPL4366 harboring the recombinant ere cassette was grown in mMRS + sugar, and colonies were enumerated on both mMRS + 100mM glucose plates (total colonies; dashed lines) and mMRS + 50 mM sucrose plates (unexcised colonies; solid lines). Growth in 50 mM sucrose led to a total 0.09-log reduction in bacterial concentration recovered on sucrose after five passages, showing stable maintenance of the cassette. Conversely, growth in 100 mM glucose or 50 mM melibiose led to a total 3.26- or 3.70-log reduction (respectively) in bacteria recovered on sucrose after five passages. Data are representative of one biological replicate.

[0044] DETAILED DESCRIPTION OF THE INVENTION

[0045] One aspect of the invention is directed to recombinant nucleic acids. A recombinant nucleic acid is a nucleic acid comprising a sequence that is not naturally occurring. The recombinant nucleic acids of the invention are preferably comprised of DNA.

[0046] In some versions, the recombinant nucleic acids of the invention comprise a sugar-inducible promoter and a heterologous nucleic acid sequence. The sugar-inducible promoter is preferably operably linked to the heterologous nucleic acid sequence.

[0047] In various versions of the invention, the sugar-inducible promoter comprises a sugar-inducible promoter sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to at least 50 contiguous bases, at least 75 contiguous bases, at least 100 contiguous bases, at least 125 contiguous bases, at least 150 contiguous bases, at least 175 contiguous bases, at least 200 contiguous bases, at least 225 contiguous bases, at least 250 contiguous bases, at least 300 contiguous bases, at least 325 contiguous bases, at least 350 contiguous bases, at least 375 contiguous bases, or the entirety of a sequence selected from the group consisting of SEQ ID NOS: 1-38.

[0048] In various versions of the invention, the sugar-inducible promoter comprises a sugar-inducible promoter sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to at least 50 contiguous bases, at least 75 contiguous bases, at least 100 contiguous bases, at least 125 contiguous bases, at least 150 contiguous bases, at least 175 contiguous bases, at least 200 contiguous bases, at least 225 contiguous bases, at least 250 contiguous bases, at least 300 contiguous bases, at least 325 contiguous bases, at least 350 contiguous bases, at least 375 contiguous bases, or the entirety of a sequence selected from the group consisting of SEQ ID NOS:1-6.

[0049] In some versions, the sugar-inducible promoter sequence has at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to at least 50 contiguous bases, at least 75 contiguous bases, at least 100 contiguous bases, at least 125 contiguous bases, at least 150 contiguous bases, at least 175 contiguous bases, at least 200 contiguous bases, at least 225 contiguous bases, at least 250 contiguous bases, at least 300 contiguous bases, at least 325 contiguous bases, at least 350 contiguous bases, at least 375 contiguous bases, or the entirety of a sequence selected from the group consisting of SEQ ID NOS:1-4, such as SEQ ID NO: 1 , SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4.

[0050] In some versions, the sugar-inducible promoter sequence has at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to at least 50 contiguous bases, at least 75 contiguous bases, at least 100 contiguous bases, at least 125 contiguous bases, at least 150 contiguous bases, at least 175 contiguous bases, at least 200 contiguous bases, or the entirety of SEQ ID NO:5.

[0051] In some versions, the sugar-inducible promoter sequence has at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to at least 50 contiguous bases, at least 75 contiguous bases, at least 100 contiguous bases, at least 125 contiguous bases, at least 150 contiguous bases, at least 175 contiguous bases, at least 200 contiguous bases, at least 225 contiguous bases, at least 250 contiguous bases, at least 300 contiguous bases, or the entirety of SEQ ID NO:6.

[0052] The heterologous sequence preferably comprises a transcription sequence and / or an insertion sequence.

[0053] A transcription sequence is a sequence in the recombinant nucleic acid that is transcribed by virtue of the activity of a promoter, such as a sugar-inducible promoter of the invention. A transcription sequence is accordingly operably linked to the promoter (e.g., the sugar-inducible promoter) such that the promoter drives transcription of the transcription sequence. In some versions, the transcription sequence comprises template sequence for a biologic, such as a therapeutic biologic, as described in further detail below. Examples of template sequences include protein coding sequences and RNA template sequences for any of a variety of RNAs, such as mRNAs, tRNAs, miRNAs, siRNAs, etc.

[0054] An insertion sequence is a first nucleic acid sequence structured for insertion of a second nucleic acid sequence therein. Exemplary insertion sequences include restriction enzyme sequences, recombineering sequences, CRISPR target sequences, Gibson assembly sequences, Type IIS assembly (e.g., Golden Gate & MoClo) sequences, ligation independent cloning sequences, etc. The insertion sequences preferably comprise an insertion site positioned with respect to the sugar-inducible promoter such that a transcription sequence can be inserted within the insertion site in an operably linked manner with respect to the sugar-inducible promoter.

[0055] In some versions, the heterologous nucleic acid sequence operably linked to the sugar-inducible promoter comprises a template sequence for a biologic, such as a therapeutic biologic.

[0056] As used herein, "biologic” refers to any biologically active product capable of being expressed from a gene. The biologic can be biologically active in vivo in any prokaryote or eukaryote or in vitro in any in vitro biochemical system. The biologic can have any activity, whether enzymatic, binding, structural, etc. Biologies that have a therapeutic effect activity are referred to herein as "therapeutic biologies.” Therapeutic biologies can target and promote growth of beneficial cells in the subject, target and inhibit growth of deleterious cells in the subject, target certain cells for destruction, or can have any other activity that provides a therapeutic effect to a subject to which they are introduced. Examples of biologies include nucleic acids and polypeptides.

[0057] Exemplary nucleic acid biologies include DNA and RNA. Preferred nucleic acid biologies include therapeutic nucleic acids. Nucleic acid biologies can generally be classified as nucleotides and nucleosides, oligonucleotides, or polynucleotides. Various types of nucleic acid biologies include oligonucleotides for antisense and antigene applications, DNA aptamers, antisense oligodeoxynucleotides, DNAzymes, DNA vaccines, RNA- based therapeutics, RNA aptamers, RNA Decoys, antisense RNA, ribozymes, small interfering RNAs, and microRNAs, among others.

[0058] Suitable polypeptide biologies can include any polypeptide of interest. The polypeptide can have any of a number of amino acid chain lengths. In some versions, the polypeptide can have an amino acid chain length of from about 2 to about 2,000 amino acids, from about 2 to about 1 ,000 amino acids, from about 2 to about 500 amino acids, from about 3 to about 250 amino acids, or from about 3 to about 225 amino acids. The polypeptide can have a net positive charge at neutral pH, a net negative charge at neutral pH, or a net neutral charge at neutral pH. The polypeptide is preferably soluble in water. The polypeptide can form a globular or fibrous structure or can have an intrinsically disordered structure.

[0059] The polypeptide can have any of a number of functionalities. The polypeptide, for example, can be enzymatic or non-enzymatic. The polypeptide can be fluorescent or non-fluorescent. The polypeptide can be a cytokine, a hormone, an antibody, an antimicrobial peptide, and an antigenic peptide, among others.

[0060] Exemplary classes of cytokines include interleukins, lymphokines, monokines, interferons (IFNs), colony stimulating factors (CSFs), among others. Specific exemplary cytokines include IL-1 alpha (IL1 a), IL-1 beta (IL1 b), IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11 , IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21 , IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31 , IL-32, IL-33, IL-34, IL-35, IL-36, IFN-alpha, IFN-beta IFN-gamma, TNF-alpha, TNF-beta, CNTF (C-NTF), LIF, OSM (oncostatin-M), EPO (erythropoietin), G- CSF (GCSF), GM-CSF (GMCSF), M-CSF (MCSF), SCF, GH (growth hormone), PRL (prolactin), aFGF (FGF- acidic), bFGF (FGF-basic), I NT-2, KGF (FGF7). EGF, TGF-alpha, TGF-beta, PDGF, betacellulin (BTC), SCDGF, amphiregulin, and HB-EG, among others.

[0061] Exemplary hormones include epinephrine, melatonin, triiodothyronine, thyroxine, amylin (or islet amyloid polypeptide), adiponectin, adrenocorticotropic hormone (or corticotropin), angiotensinogen, angiotensin, antidiuretic hormone (or vasopressin, arginine vasopressin), atrial-natriuretic peptide (or atriopeptin), brain natriuretic peptide, calcitonin, cholecystokinin, corticotropin-releasing hormone, cortistatin, encephalin, endothelin, erythropoietin, follicle-stimulating hormone, galanin, gastric inhibitory polypeptide, gastrin, ghrelin, glucagon, glucagon-like peptide-1, gonadotropin-releasing hormone, growth hormone-releasing hormone, hepcidin, human chorionic gonadotropin, human placental lactogen, growth hormone, inhibin, insulin, insulin-like growth factor (or somatomedin), leptin, lipotropin, luteinizing hormone, melanocyte stimulating hormone, motilin, orexin, oxytocin, pancreatic polypeptide, parathyroid hormone, pituitary adenylate cyclase-activating peptide, prolactin, prolactin releasing hormone, relaxin, renin, secretin, somatostatin, thrombopoietin, thyroid-stimulating hormone (or thyrotropin), thyrotropin-releasing hormone, and vasoactive intestinal peptide, among others.

[0062] Other physiologically active peptides include tachykinin peptides, such as substance P, kassinin, neurokinin A, eledoisin, and neurokinin B; peptide PHI 27 (peptide histidine isoleucine 27); pancreatic poly peptide- related peptides, such as NPY (neuropeptide Y), PYY (peptide YY), and APP (avian pancreatic polypeptide); opioid peptides, such as proopiomelanocortin (POMC) peptides and prodynorphin peptides; AGG01 ; B-type natriuretic peptide (BNP); lactotripeptides; and peptides that inhibit PCSK9 (Zhang et al. 2014).

[0063] Other physiological peptides include the peptides, derivatives, and homologs as described in Wang et al. 2023.

[0064] Exemplary antibodies include single-chain antibodies, single-domain antibodies (sdAbs), and singlechain variable fragments (scFvs).

[0065] Exemplary antimicrobial peptides include cathelicidins, defensins, protegrins, mastoparan, poneratoxin, cecropin, moricin, melittin, magainin, dermaseptin, nisin, and others. Other antimicrobial peptides include reglll-p and reg-lll-y, which are eukaryotic antimicrobial peptides produced in the intestine. Lactic acid bacteria are well known for their extensive heterogenic repertoire of antimicrobial compounds, including bacteriocins (Alvarez- Sieiro et al. 2016).

[0066] Other exemplary biologies include any of a number of antimicrobials. Lactic acid bacteria, for example, are well-known for their extensive heterogenic repertoire of antimicrobial compounds, including bacteriocins (Alvarez-Sieiro et al. 2016). Bacteriocins are small ribosomally synthesized peptides that can inhibit or kill bacteria. The functional diversity of this family of antimicrobials is large, which is illustrated by the fact that bacteriocins can collectively target a wide-array of Gram-negative and Gram-positive bacteria (Cotter et al. 2013). Although narrowspectrum bacteriocins may be preferential, the application of broad-spectrum bacteriocins may be useful to alleviate bacterial infections of unknown sources. Bacteriocin-mediated impact on the gut microbiota composition can be substantial. This was demonstrated for Abp118, a broad-spectrum bacteriocin produced by L. salivarius UCC118 (Riboulet-Bisson et al. 2012). See also Corr et al. 2007 (Corr SC, Li Y, Riedel CU, O'Toole PW, Hill C, Gahan CG. Bacteriocin production as a mechanism for the anti-infective activity of Lactobacillus salivarius UCC118. Proc Natl Acad Sci U S A. 2007 May 1 ;104(18):7617-21). By comparing the microbiota in mice and pigs between groups that were administrated with L. salivarius wild-type or L. salivariusAabp118, it was confirmed that the presence of the bacteriocin-producing lactobacilli alters the gut microbiota composition without significance changes in microbial diversity. See also Kommineni et al. 2015. One example of a useful bacteriocin is nisin, which is produced by select Lactococcus lactis strains and streptococci. The 372-base pair gene encoding nisin (n / sA) is one of the six natural nisin variants, and certain mutants NisA display enhanced activity against Grampositive and Gram-negative pathogens (Field et al. 2008, Field et al. 2012).

[0067] Other exemplary biologies comprise lytic biologies. As used herein, "lytic biologic” refers to any biologic that causes or aids, either directly or indirectly, the lysis of a cell in which it is produced. Expression of a lytic biologic in a cell, for example, can induce lysis of the cell and any contents thereof, including any other biologies made by the cell.

[0068] Lytic biologies comprise lytic proteins. Lytic proteins are well known in the art. A number of lytic proteins, for example, are found in bacteriophages and serve to lyse cells during the lytic stages of the bacteriophage's life cycle. These include holins and lysins (Sheehan et al. 1999). During bacteriophage replication, biologically active lysins are present in the cytosol but require expression of a membrane protein, holin, to release the virions from the cell. When holin levels are optimal, the lysin can access the peptidoglycan layer for cleavage which leads to bacterial cell lysis (Wang et al. 2000). So far, five main groups of lysins have been identified that can be distinguished from one and another based on the cleavage specificity of the different bonds within the peptidoglycan (Fischetti 2009). Structurally, lysins can comprise a single catalytic domain, which generally is typical for lysins derived from bacteriophages targeting Gram-negative bacteria (Cheng et al. 1994). Bacteriophages targeting Gram-positive bacteria typically encode lysins that contain multiple domains: a N- terminal catalytic domain and a C-terminal cell-wall binding domain (Nelson et al. 2006, Navarre et al. 1999). A few lysins have been identified that have three domains (Becker et al. 2009).

[0069] A number of other lytic proteins are native to the cells themselves (Feliza et al. 2012, Jacobs et al. 1994, Jacobs et al. 1995, Lopez et al. 1997). These lytic proteins can affect cell wall metabolism or introduce nicks in the cell wall. Five protein classes are differentiated by the wall component they attack (Loessner et al. 2005, Loessner et al. 2002).

[0070] In some versions, the biologic comprises a chimeric protein. A chimeric protein is a recombinant protein comprising sequences from two different native polypeptides. Any of the protein biologies described herein (or fragments thereof) can be fused with another polypeptide to generate a chimeric protein biologic.

[0071] In some versions, the biologic comprises a protein comprising an affinity tag. The affinity tags can be used for purification, detection with antibodies, or other uses. A number of affinity tags are known in the art. Exemplary affinity tags include the His tag, the Strep II tag, the T7 tag, the FLAG tag, the S tag, the HA tag, the c-Myc tag, the dihydrofolate reductase (DHFR) tag, the chitin binding domain tag, the calmodulin binding domain tag, the cellulose binding domain tag, and the Hi BiT tag. The sequences of each of these tags are well-known in the art.

[0072] In some versions, the biologic is a fusion protein comprising a label. A label is a polypeptide sequence that is capable of being detected by any of a number methods. The label can be a fluorescent label (e.g., GFP, RFP, etc.), an enzymatic label (horseradish peroxidase (HRP), alkaline phosphatase (AP), glucose oxidase and p-galactosidase), an antibody, an antigen, or other types of polypeptide labels that can be fused to another polypeptide for detection.

[0073] In various versions of the invention, heterologous nucleic acid sequence is within at least 1 base, at least 2 bases, at least 3 bases, at least 4 bases, at least 5 bases, at least 6 bases, at least 7 bases, at least 8 bases, at least 9 bases, at least 10 bases, at least 25 bases, at least 50 bases, at least 75 bases, at least 100 bases, at least 125 bases, at least 150 bases, at least 175 bases, at least 200 bases, at least 225 bases, at least 250 bases, at least 275 bases, at least 300 bases, at least 325 bases, at least 350 bases, at least 375 bases, at least 400 bases, at least 425 bases, at least 450 bases, at least 475 bases, or at least 500 bases of the sugar-inducible promoter sequence. The number of bases outlined above are counted from the last base of the sugar-inducible promoter sequence to the first base of the heterologous sequence. The last base of the sugar-inducible promoter sequence is the furthest 3' base of the heterologous nucleic acid sequence aligning with an exact match to any one or more of SEQ ID NOS: 1-38. The first base of the heterologous sequence is the first mismatching base downstream (3') from the sugar-inducible promoter sequence in the heterologic nucleic acid sequence when the heterologous nucleic acid sequence is aligned to a natural sequence comprising any one or more of SEQ ID NOS: 1-38. In various versions of the invention, heterologous nucleic acid sequence is within at least 1 base, at least 2 bases, at least 3 bases, at least 4 bases, at least 5 bases, at least 6 bases, at least 7 bases, at least 8 bases, at least 9 bases, at least 10 bases, at least 25 bases, at least 50 bases, at least 75 bases, at least 100 bases, at least 125 bases, at least 150 bases, at least 175 bases, at least 200 bases, at least 225 bases, at least 250 bases, at least 275 bases, at least 300 bases, at least 325 bases, at least 350 bases, at least 375 bases, at least 400 bases, at least 425 bases, at least 450 bases, at least 475 bases, or at least 500 bases of the transcription sequence. The number of bases outlined above are counted from the last base of the sugar-inducible promoter sequence to the first base of the transcription sequence. The last base of the sugar-inducible promoter sequence is the furthest 3' base of the heterologous nucleic acid sequence aligning with an exact match to any one or more of SEQ ID NOS: 1-38. The first base of the transcription sequence is the first base in the heterologous nucleic acid sequence that is transcribed from the heterologous nucleic acid into a transcript.

[0074] In various versions of the invention, heterologous nucleic acid sequence is within at least 1 base, at least 2 bases, at least 3 bases, at least 4 bases, at least 5 bases, at least 6 bases, at least 7 bases, at least 8 bases, at least 9 bases, at least 10 bases, at least 25 bases, at least 50 bases, at least 75 bases, at least 100 bases, at least 125 bases, at least 150 bases, at least 175 bases, at least 200 bases, at least 225 bases, at least 250 bases, at least 275 bases, at least 300 bases, at least 325 bases, at least 350 bases, at least 375 bases, at least 400 bases, at least 425 bases, at least 450 bases, at least 475 bases, or at least 500 bases of a protein coding sequence. The number of bases outlined above are counted from the last base of the sugar-inducible promoter sequence to the first base of the protein coding sequence. The last base of the sugar-inducible promoter sequence is the furthest 3' base of the heterologous nucleic acid sequence aligning with an exact match to any one or more of SEQ ID NOS: 1-38. The first base of the transcription sequence is the first base in the heterologous nucleic acid sequence that is present in a codon encoding a protein reside in a protein expressed from the heterologous nucleic acid.

[0075] In various versions of the invention, heterologous nucleic acid sequence is within at least 1 base, at least 2 bases, at least 3 bases, at least 4 bases, at least 5 bases, at least 6 bases, at least 7 bases, at least 8 bases, at least 9 bases, at least 10 bases, at least 25 bases, at least 50 bases, at least 75 bases, at least 100 bases, at least 125 bases, at least 150 bases, at least 175 bases, at least 200 bases, at least 225 bases, at least 250 bases, at least 275 bases, at least 300 bases, at least 325 bases, at least 350 bases, at least 375 bases, at least 400 bases, at least 425 bases, at least 450 bases, at least 475 bases, or at least 500 bases of an RNA template sequence. The number of bases outlined above are counted from the last base of the sugar-inducible promoter sequence to the first base of the RNA template sequence. The last base of the sugar-inducible promoter sequence is the furthest 3' base of the heterologous nucleic acid sequence aligning with an exact match to any one or more of SEQ ID NOS: 1-38. The first base of the RNA template sequence is the first base heterologous nucleic acid sequence that is transcribed from the heterologous nucleic acid into an RNA.

[0076] In various versions of the invention, heterologous nucleic acid sequence is within at least 1 base, at least 2 bases, at least 3 bases, at least 4 bases, at least 5 bases, at least 6 bases, at least 7 bases, at least 8 bases, at least 9 bases, at least 10 bases, at least 25 bases, at least 50 bases, at least 75 bases, at least 100 bases, at least 125 bases, at least 150 bases, at least 175 bases, at least 200 bases, at least 225 bases, at least 250 bases, at least 275 bases, at least 300 bases, at least 325 bases, at least 350 bases, at least 375 bases, at least 400 bases, at least 425 bases, at least 450 bases, at least 475 bases, or at least 500 bases of an insertion site of an insertion sequence. The number of bases outlined above are counted from the last base of the sugar-inducible promoter sequence to the last base upstream of the insertion site. The last base of the sugar-inducible promoter sequence is the furthest 3' base of the heterologous nucleic acid sequence aligning with an exact match to any one or more of SEQ ID NOS: 1-38. The last base upstream of the insertion site is the furthest 3' base in the heterologous nucleic acid sequence downstream of the sugar-inducible promoter sequence that would have an exact match with the heterologous nucleic acid sequence after insertion of the insertion sequence.

[0077] In various versions of the invention, the sugar-inducible promoter of the invention is disposed within 50 bases, 45 bases, 40 bases, 35 bases, 30 bases, 25 bases, 20 bases, 15 bases, 10 bases, or 5 bases upstream, or immediately upstream of (contiguous with), a start codon of a coding sequence. In some versions, the start codon is modified from its native sequence. In some versions the start codon is ATG. In some versions, the start codon is GTG.

[0078] In some versions, the heterologous nucleic acid sequence operably linked with the sugar-inducible promoter comprises a recombinase coding sequence.

[0079] In some versions, the recombinant nucleic acids of the invention comprise a recombinant nucleic acid cassette. A recombinant nucleic acid cassette is a nucleic acid cassette comprising a sequence that is not naturally occurring. The recombinant nucleic acid cassettes can comprise recombinase recognition sites and internal cassette elements disposed between the recombinase recognition sites. The recombinant nucleic acid cassettes of the invention are preferably comprised of DNA.

[0080] The internal cassette elements preferably comprise a recombinase gene. The recombinase gene can comprise a recombinase promoter operably linked to a recombinase coding sequence. The recombinase promoter is preferably a sugar-inducible promoter of the invention. The recombinase coding sequence can encode a recombinase that recognizes the recombinase recognition sites. "Recognize” in this context refers to the ability of the recombinase to bind to the recombinase recognition sites and cleave the DNA at the sites, and rejoin the DNA strands, thereby excising sequences intervening between the recognition sites.

[0081] A large number of recombinases and their cognate recognition sites are known in the art. These include Ore (from the P1 phage and variants thereof), FLP (from the yeast Saccharomyces cerevisiae and variants thereof), gamma-delta resolvase (from the Tn1000 transposon and variants thereof), Tn3 resolvase (from the Tn3 transposon and variants thereof), cpC31 integrase (from the cpC31 phage and variants thereof), Bxb1 integerase (and variants thereof), and R4 integrase (and variants thereof) (Stark, W.M.; Boocock, M.R. (1995). Topological selectivity in site-specific recombination. Mobile Genetic Elements. Oxford University Press, pp. 101-129) (Stark, W.M.; Boocock, M.R.; Sherratt, DJ (1992). Catalysis by site-specific recombinases. Trends in Genetics. 8 (12): 432-9). As used herein, the terms "Cre recombinase,” "FLP recombinase,” "gamma-delta recombinase,” "Tn3 resolvase, ” "(pC31 integrase,” "Bxb1 integrase,” and "R4 integrase” refer to enzymes having the amino acid sequences of the native forms of these enzymes and functional modified versions thereof. The functional modified versions can comprise a sequence having at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the native forms. The sequences of the native forms of these recombinases are known in the art, as are many variants thereof.

[0082] Exemplary recombinase and recombination recognition sites provided in the following examples include the Cre recombinase (SEQ ID NO:39 (coding Sequence), SEQ ID NO:40 (protein sequence)) and recognition sites loxP66 (SEQ ID NO:41) and loxP71 (SEQ ID NO:42). Variants of the Cre recombinase comprising a sequence having at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NQ:40 can be used as an alternative to the Cre recombinase of SEQ ID NQ:40.

[0083] In some versions, the internal cassette elements further comprise a biologic gene configured to express a biologic. The biologic can comprise any biologic described herein, such as a therapeutic biologic.

[0084] In some versions, the internal cassette elements further comprise a selection marker (also referred to herein as a "selection gene”). The selection marker may be independent of a biologic gene that may be present as an internal cassette element. A selection marker is a gene that confers positive selection (growth or survival) of a cell comprising the selection marker in either the presence or absence of a specific selection agent. In some versions, the internal cassette elements further comprise a counter-selection marker (also referred to herein as a "counter-selection gene”). The counter-selection marker may be independent of a biologic gene that may be present as an internal cassette element. A counter-selection marker is a gene that confers negative selection (elimination or inhibition of growth) of a cell comprising the counter-selection marker in either the presence or absence of a specific selection agent. A large number of selection and counter-selection markers are known in the art. Non-limiting examples of selection markers include antibiotic resistance genes, auxotrophic complementation genes, herbicide tolerance genes, metal tolerance genes, and drug resistance genes, among others. Exemplary antibiotic resistance genes include markers that confer resistance to ampicillin (e.g., beta-lactamase [bla, TEM-1]), hygromycin (e.g., hygromycin phosphotransferase [aphIV, hpt]), kanamycin, neomycin (e.g., neomycin phosphotransferase II [nptll, APH(3')-II]), chloramphenicol (e.g., chloramphenicol acetyltransferase [cmR, cat]), tetracycline (tetR), and the like. Suitable auxotrophic complementation genes include those involved in DNA-precursor, amino-acid, or cell-wall biosynthetic pathways. Examples of suitable auxotrophic complementation genes include sucT (encoding sucrose transporter) sucP (encoding sucrose phosphorylase), asd (encoding aspartate beta-semialdehyde dehydrogenase), thyA (encoding thymidylate synthetase), glnA (encoding glutamine synthase), leuD (encoding isopropylmalate isomerase small subunit), pyrF (encoding orotidi ne-5'-phosphate decarboxylase), proC (encoding pyrroline-5-carboxylate reductase), glyA (encoding serine hydroxymethyl transferase), and nadC (encoding quinolinic acid phosphoribosyltransferase), These genes can complement hosts that are auxotrophic for particular nutrients or factors as a result of a disruption of a corresponding chromosomal gene in the host.

[0085] In some versions, the selection marker comprises a selection-marker coding sequence that encodes a sucrose transporter, a sucrose phosphorylase, or a sucrose transporter and a sucrose phosphorylase. "A selection-marker coding sequence” in this context can encompass multiple separate coding sequences, such as the case in which the "selection-marker coding sequence” encodes a sucrose transporter and a sucrose phosphorylase. An exemplary sucrose transporter is SucT from L. reuteri (SEQ ID NO:44 (protein), SEQ ID NO:43 (coding sequence)) and variants thereof comprising a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO:44. An exemplary sucrose phosphorylase is SucP from L. reuteri (SEQ ID NO:46 (protein), SEQ ID NO:45 (coding sequence)) and variants thereof comprising a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO:46. SucP has also been referred to as "scrP” (Teixeira JS, Abdi R, Su MS, Schwab C, Ganzle MG. Functional characterization of sucrose phosphorylase and scrR, a regulator of sucrose metabolism in Lactobacillus reuteri. Food Microbiol. 2013 Dec;36(2):432-9) and “gtfA.” The genes encoding these proteins can serve as selection markers in microorganisms in which the corresponding native genes, for example, have been disrupted or inactivated.

[0086] The selection marker can comprise a selection-marker promoter operably linked to the selection-marker coding sequence. The selection-marker promoter can comprise an inducible promoter or a constitutive promoter. In some versions, selection-marker promoter can comprise a sugar-inducible promoter as described herein. The sugar-inducible promoter serving as the selection-marker promoter is preferably inducible by at least one sugar that does not induce the recombinase promoter. In some versions, the selection-marker promoter comprises a selection-marker promoter sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to at least 125 contiguous bases, at least 150 contiguous bases, at least 175 contiguous bases, at least 200 contiguous bases, at least 225 contiguous bases, at least 250 contiguous bases, at least 300 contiguous bases, at least 325 contiguous bases, at least 350 contiguous bases, at least 375 contiguous bases, or the entirety of SEQ ID NO:5.

[0087] In some versions, the internal cassette elements further comprise an adhesin gene configured to express an adhesin. The adhesin gene may be independent of a biologic gene that may be present as an internal cassette element. Adhesins are proteins that facilitate the association of a cell within the gut of a subject. See, e.g., US 2023 / 0381253 A1. The adhesin gene may be configured to express any one or more adhesins described in US 2023 / 0381253 A1.

[0088] Exemplary adhesins include sortases, sortase-dependent proteins, fibronectin-binding proteins, autolysins, surface-layer proteins, aggregation-promoting factors, and collagen-binding proteins. Exemplary sortases include proteins comprising a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO:48, an exemplary coding sequence for which is SEQ ID NO:47. Exemplary sortase- dependent proteins include proteins comprising a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NQS:50, 52, 54, 56, and 58, exemplary coding sequences for which are SEQ ID NOS:49, 51 , 53, 55, and 57, respectively. Exemplary fibronectin-binding proteins include proteins comprising a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO:60, an exemplary coding sequence for which is SEQ ID NO:59. Exemplary autolysins include proteins comprising a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO:62, an exemplary coding sequence for which is SEQ ID NO:61. Exemplary surface-layer proteins include proteins comprising a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO:64, an exemplary coding sequence for which is SEQ ID NO:63. Exemplary aggregation-promoting factors include proteins comprising a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO:66, an exemplary coding sequence for which is SEQ ID NO:65. Exemplary collagen-binding proteins include proteins comprising a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO:68, an exemplary coding sequence of which is SEQ ID NO:67.

[0089] In some versions, the internal cassette elements further comprise an antirepressor gene. The antirepressor gene preferably encodes an antirepressor protein comprising an antirepressor protein sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NQ:70 (an exemplary coding sequence of which is SEQ ID NO:69). The antirepressor protein of SEQ ID NQ:70 is a protein in L. reuteri that promotes the expression of one or more phages in L reuteri and thereby promotes lysis of the cell. In some versions, the antirepressor gene comprises a sugar-inducible promoter that is inducible by at least one sugar that induces the recombinase promoter. In some versions, the sugar-inducible promoter of the antirepressor gene comprises a sugar-inducible promoter sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to the recombinase promoter sequence. In some versions, the antirepressor gene comprises an antirepressor coding sequence that is operably linked to the recombinase promoter, such that the recombinase promoter drives expression of both the recombinase coding sequence and the antirepressor coding sequence.

[0090] In some versions, the internal cassette elements further comprise an essential gene. An "essential gene” is a gene that is required for an organism's survival, such that its disruption or loss results in cell death or development failure. Essential genes include genes crucial for fundamental processes such as DNA replication, transcription, and cell division. Exemplary essential genes include DNA polymerase genes, RNA polymerase genes, ribosomal genes, etc.

[0091] Another aspect of the invention is directed to recombinant microorganisms. A recombinant microorganism is a microorganism that comprises a recombinant nucleic acid, a recombinant gene, or a recombinant polypeptide. Recombinant nucleic acids are described above. A recombinant gene is a gene that comprises a recombinant nucleic acid sequence, is present within a microorganism in which it does not naturally occur, and / or is present at a locus (e.g., genetic locus or on an extrachromosomal plasmid) in which it does not naturally occur. A recombinant polypeptide is one comprising a sequence that is not naturally occurring. In some versions, the recombinant microorganisms of the invention comprise a recombinant nucleic acid of the invention. In some versions, the recombinant nucleic acid can comprise a recombinant nucleic acid cassette of the invention. The recombinant nucleic acid can be incorporated within the genome of the microorganism or be included in an extrachromosomal nucleic acid, such as a plasmid. Incorporation within the genome of the microorganism is preferred in certain embodiments. The microorganism can be engineered using any methods known in the art. General methods are provided in Green et al. 2012. Methods for engineering lactic acid bacteria such as L lactis are provided by van Pijkeren and Britton et al. 2012, van Pijkeren and Neoh et al. 2012, Oh et al. 2014, and Barrangou et al. 2016.

[0092] In some versions, the recombinant microorganism is a bacterium. The bacteria of the invention can include certain commensal or probiotic bacteria, non-commensal bacteria, and other types of bacteria. The bacteria can include non-pathogenic, Gram-positive bacteria capable of anaerobic growth. The bacteria in some cases are viable in the gastrointestinal tract of mammals. The bacteria can be food grade. Other exemplary bacteria of the invention include E. coll.

[0093] Exemplary bacteria of the invention include species of lactic acid bacteria ( / .e., species of the order Lactobacillales), such as those from the genera Lactobacillus, Limosilactobacillus, Leuconostoc, Pediococcus, Lactococcus, Streptococcus, Aerococcus, Carnobacterium, Enterococcus, Oenococcus, Fructobacillus, Sporolactobacillus, Tetragenococcus, Vagococcus, and Weissella.

[0094] Exemplary bacteria of the invention include species of the Lactobacillus genus. Exemplary species from the Lactobacillus genus include L. acetototerans, L. acidifarinae, L. acidipiscis, L. acidophilus, L. agilis, L. algidus, L. atimentarius, L. amytolyticus, L. amylophilus, L amylotrophicus, L. amylovorus, L animatis, L. antri, L. apodemi, L. aviarius, L bifermentans, L. brevis, L. buchneri, L camelliae, L casei, L. catenaformis, L. ceti, L. coleohominis, L. collinoides, L composti, L concavus, L coryniformis, L. crispatus, L crustorum, L. curvatus, L. delbrueckii subsp. delbrueckii, L. delbrueckii subsp. butgaricus, L. delbrueckii subsp. lactis, L. dextrinicus, L diolivorans, L. egui, L. eguigenerosi, L farraginis, L farciminis, L fermentum, L. fornicalis, L fructivorans, L. frumenti, L fuchuensis, L gallinarum, L. gassed, L. gastricus, L ghanensis, L. graminis, L. hammesii, L. hamster), L. harbinensis, L. hayakitensis, L helveticus, L. hitgardii, L homohiochii, L iners, L. ingluviei, L. intestinalis, L. jensenii, Ljohnsonii, L katixensis, L. kefiranofaciens, L. kefiri, L. kimchii, L. kitasatonis, L. kunkeei, L. leichmannii, L. lindneri, L malefermentans, L. mati, L manihotivorans, L. mindensis, L mucosae, L. murinus, L. nagelii, L. namurensis, L. nantensis, L oligofermentans, L. oris, L. panis, L. pantheris, L. parabrevis, L. parabuchneri, L. paracollinoides, L. parafarraginis, L parakefiri, L paratimentarius, L. paraplantarum, L. pentosus, L perolens, L. plantarum, L pontis, L. psittaci, L rennini, L. reuteri, L. rhamnosus, L. rimae, L. rogosae, L. rossiae, L ruminis, L. saerimneri, L sake!, L salivarius, L. sanfranciscensis, L. satsumensis, L. secaliphilus, L. sharpeae, L. siliginis, L. spicheri, L. suebicus, L. thailandensis, L ultunensis, L vaccinostercus, L. vaginalis, L. versmoldensis, L. vini, L. vitulinus, L. zeae, and L zymae.

[0095] Exemplary bacteria of the invention include species of the Limosilactobacillus genus. Exemplary species from the Limosilactobacillus genus include L. agrestis, L. albertensis, L. alvi, L. antri, L. balticus, L. caviae, L. coleohominis, L. eguigenerosi, L fastidiosus, L. fermentum, L. frumenti, L. gastricus, L. gorilla, L. ingluviei, L. mucosae, L. oris, L. panis, L. pontis, L. portuensis, L. reuteri, L. rudii, L. secaliphilus, L. urinaemulieris, and L. vaginalis.

[0096] Exemplary bacteria of the invention include species of Bifidobacterium. Exemplary species from the Bifidobacterium genus include B. actinocoloniiforme, B. adolescentis, B. aemilianum, B. aerophilum, B. aesculapii, B. amazonense, B. angulatum, B. animalis, B. anseris, B. apousia, B. apri, B. aguikefiri, B. asteroides, B. avesanii, B. biavatii, B. bifidum, B. bohemicum, B. bombi, B. bourn, B. breve, B. callimiconis, B. callitrichidarum, B. callitrichos, B. canis, B. castoris, B. catenulatum, B. catulorum, B. cebidarum, B. choerinum, B.choladohabitans, B. choloepi, B. colobi, B. commune, B. criceti, B. crudilactis, B.cuniculi, B. dentium, B. dolichotidis, B. eriksonii, B. erythrocebi, B. eulemuris, B. faecale, B. felsineum, B. gallicum, B. gallinarum, B. globosum, B. goeldii, B. hapali, B. indicum, B. italicum, B. jacchi, B. lemurum, B. leontopitheci, B. longum, B. magnum, B.margollesii, B. merycicum, B. miconis, B. miconisargentati, B. minimum, B. mongoliense, B. moraviense, B. moukalabense, B. myosotis, B. oedipodis, B. olomucense, B. panos, B. parmae, B. platy rrhinorum, B. pluvialisilvae, B. polysaccharolyticum, B. pongonis, B. porcinum, B. primatium, B. pseudocatenulatum, B. pseudoIongum, B. psychraerophilum, B. pullorum, B. ramosum, B. reuteri, B. rousetti, B. ruminale, B. ruminantium, B. saguini, B. saguinibicoloris, B. saimiriisciurei, B. samirii, B. santillanense, B. scaligerum, B. scardovii, B. simiarum, B. simiiventris, B. stellenboschense, B. subtile, B. thermacidophilum, B. thermophilum corrig., B. tibiigranuli, B. tissieri corrig., B. tsurumiense, B. urinalis, B. vansinderenii, B. vespertilionis, and B. xylocopae.

[0097] Other exemplary bacteria of the invention include bacteria of the genera Lactiplantibacillius, such as Lactiplantibacillius plantarum.

[0098] A bacterium used in the following examples is L. reuteri (Limosilactobacillus reuteri formerly referred to as Lactobacillus reuteri). In addition to L. reuteri, other particularly preferred bacteria include L. plantarum (e.g., L. plantarum BAA-793), L rhamnosus (e.g., L. rhamnosus GG (L rhamnosus ATCC 53103)), L. lactis (e.g., L. lactis MG1363), and L casei.

[0099] In some embodiments, the recombinant microorganism comprises or is configured to comprise a recombinant nucleic acid cassette comprising a gene encoding a sucrose transporter, a sucrose phosphorylase, or a sucrose transporter and a sucrose phosphorylase. In such embodiments, the recombinant microorganism may have a native sucrose transporter gene, a native sucrose phosphorylase gene, or a native sucrose transporter gene and a native sucrose phosphorylase gene mutated, modified, disrupted, or deleted. The native sucrose transporter gene can encode a sucrose transporter comprising a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO:44. An exemplary native sucrose transporter is SucT from L. reuteri (SEQ ID NO:44 (protein), SEQ ID NO:43 (coding sequence)) and variants thereof comprising a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO:44. The native sucrose phosphorylase gene can encode a sucrose phosphorylase comprising a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO:46. An exemplary native sucrose phosphorylase is SucP from L. reuteri (SEQ ID NO:46 (protein), SEQ ID NO:45 (coding sequence)) and variants thereof comprising a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO:46.

[0100] In some embodiments, the recombinant microorganism comprises or is configured to comprise a recombinant nucleic acid cassette comprising one or more adhesion genes. In such embodiments, the recombinant microorganism may have one or more native adhesin gene(s) mutated, modified, disrupted, or deleted. The native adhesin genes may include sortase genes, sortase-dependent protein genes, fibronectin- binding protein genes, autolysin genes, surface-layer protein genes, aggregation-promoting factor genes, and collagen-binding protein genes. Exemplary sortase genes encode proteins comprising a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 48, an exemplary coding sequence for which is SEQ ID NO:47. Exemplary sortase-dependent protein genes encode proteins comprising a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NQS:50, 52, 54, 56, and 58, exemplary coding sequences for which are SEQ ID NOS:49, 51 , 53, 55, and 57, respectively. Exemplary fibronectin-binding protein genes encode proteins comprising a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 60, an exemplary coding sequence for which is SEQ ID NO:59. Exemplary autolysin genes encode proteins comprising a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 62, an exemplary coding sequence for which is SEQ ID NO:61. Exemplary surface-layer protein genes encode proteins comprising a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 64, an exemplary coding sequence for which is SEQ ID NO:63. Exemplary aggregation-promoting factor genes encode proteins comprising a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 66, an exemplary coding sequence for which is SEQ ID NO:65. Exemplary collagen-binding protein genes encode protein comprising a sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO: 68, an exemplary coding sequence of which is SEQ ID NO:67.

[0101] In some embodiments, the recombinant microorganism comprises or is configured to comprise a recombinant nucleic acid cassette comprising an antirepressor gene. In such embodiments, the recombinant microorganism may have a native antirepressor gene mutated, modified, disrupted, or deleted. The native antirepressor gene can encode an antirepressor protein having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NQ:70 (an exemplary coding sequence of which is SEQ ID NO:69). Another aspect of the invention is directed to methods of producing a biologic. In some versions, the recombinant nucleic acid comprises a transcription sequence operably linked to a sugar-inducible promoter of the invention and the transcription sequence comprises a template sequence for the biologic. The methods can comprise contacting the sugar-inducible promoter with an amount of an inducing sugar effective to express the biologic. In some versions, the recombinant nucleic acid is comprised by a recombinant microorganism. The methods in such versions can comprise contacting the recombinant microorganism with an amount of an inducing sugar sufficient to induce expression of the biologic.

[0102] Another aspect of the invention is directed to methods of excising the internal cassette elements from a recombinant nucleic acid comprising a recombinant nucleic acid cassette of the invention. The methods of this aspect can comprise contacting the recombinase promoter with an amount of an inducing sugar effective to express the recombinase in an amount effective to excise the internal cassette elements from the recombinant nucleic acid. In some versions, the recombinant nucleic acid is comprised within the genome of a recombinant microorganism of the invention. The methods can comprise contacting the recombinant microorganism with an amount of an inducing sugar effective to express the recombinase in an amount effective to excise the internal cassette elements from the recombinant nucleic acid. The excising the internal cassette elements in such versions can comprise excising the internal cassette elements from the genome of the microorganism.

[0103] In the methods herein, the inducing sugar in some versions is selected from the group consisting of glucose, maltose, raffinose, sucrose, arabinose, galactose, lactose, melibiose, ribose, and combinations thereof.

[0104] In the methods herein, the inducing sugar in some versions comprises one or more of glucose, raffinose, arabinose, galactose, lactose, melibiose, and ribose, and the sugar-inducible promoter sequence has at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to at least 50 contiguous bases, at least 75 contiguous bases, at least 100 contiguous bases, at least 125 contiguous bases, at least 150 contiguous bases, at least 175 contiguous bases, at least 200 contiguous bases, at least 225 contiguous bases, at least 250 contiguous bases, at least 300 contiguous bases, at least 325 contiguous bases, at least 350 contiguous bases, at least 375 contiguous bases, or the entirety of any one of SEQ ID NOS: 1 -4.

[0105] In the methods herein, the inducing sugar in some versions comprises one or more of sucrose and raffinose and the sugar-inducible promoter sequence has at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to at least 50 contiguous bases, at least 75 contiguous bases, at least 100 contiguous bases, at least 125 contiguous bases, at least 150 contiguous bases, at least 175 contiguous bases, at least 200 contiguous bases, or the entirety of SEQ ID NO:5.

[0106] In the methods herein, the inducing sugar in some versions comprises maltose and the sugar-inducible promoter sequence has at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to at least 50 contiguous bases, at least 75 contiguous bases, at least 100 contiguous bases, at least 125 contiguous bases, at least 150 contiguous bases, at least 175 contiguous bases, at least 200 contiguous bases, at least 225 contiguous bases, at least 250 contiguous bases, at least 300 contiguous bases, or the entirety of SEQ ID NO:6. In the methods herein, the sugar-inducible promoter sequence has at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to at least 50 contiguous bases, at least 75 contiguous bases, at least 100 contiguous bases, at least 125 contiguous bases, at least 150 contiguous bases, at least 175 contiguous bases, at least 200 contiguous bases, at least 225 contiguous bases, at least 250 contiguous bases, at least 300 contiguous bases, or the entirety of any one of SEQ ID NOS:7-38, and the inducing sugar comprises one or more sugars identified in Table 1 as an "inducing sugar” for the one of SEQ ID NOS:7-38.

[0107] Some versions can comprise producing the biologic and / or excising the internal cassette elements at a site. Such methods can include introducing a recombinant microorganism of the invention to the site. The introducing can be performed before, after, or during contacting the recombinant microorganism with the inducing sugar. Some versions also include introducing the inducing sugar or a precursor thereof to the site. The precursor can then be converted to the inducing sugar which then contacts the sugar-inducible promoter at the site. Exemplary precursors of the inducing sugar include disaccharides or polysaccharides comprising the inducing sugars as subunits thereof. The site can be a site in a subject. The subject can comprise an animal, such as a mammal or a human.

[0108] In some versions, the site comprises a gastrointestinal tract of a subject. Some methods comprise administering the recombinant microorganism to the gastrointestinal tract of the subject. Some methods comprise orally administering the recombinant microorganism to the gastrointestinal tract of the subject. Some methods comprise administering the inducing sugar or a precursor thereof to the gastrointestinal tract of the subject. Some methods comprise orally administering the inducing sugar or a precursor thereof to the gastrointestinal tract of the subject. The inducing sugar or a precursor thereof can be orally administered to the subject such that the contacting the recombinant microorganism with the inducing sugar occurs in the gastrointestinal tract. Suitable precursors of the inducing sugar can comprise compounds that are either broken down or converted within the gastrointestinal tract into the inducing sugar. Digestion of the disaccharides or polysaccharides can release the inducing sugars for contacting the recombinant microorganism in the gastrointestinal tract. See, e.g., US Patent 10,898,552, which is incorporated herein by reference in its entirety.

[0109] Some versions can comprise contacting the sugar-inducible promoter (and / or the recombinant microorganism as the case may be) with the inducing sugar prior to orally administering the recombinant microorganism to the subject. Induction of the sugar-inducible promoter in such cases can commence prior to orally administering the recombinant microorganism in the gastrointestinal tract, such that production of the biologic occurs and / or excision of the internal cassette elements occurs once the recombinant microorganism reaches the gastrointestinal tract. See, e.g, US Patent 10,898,552, which is incorporated herein by reference in its entirety.

[0110] The recombinant microorganism, inducing sugars, or precursors can be introduced to the gastrointestinal tract by any method known in the art. The recombinant microorganism, inducing sugars, or precursors can be administered orally, rectally, or directly into the gastrointestinal tract via a stoma. The recombinant microorganism is preferably administered directly into or upstream of the small intestines, so that the recombinant microorganism ultimately passes through or into the small intestines. The recombinant microorganism can be swallowed or introduced via a tube. The recombinant microorganism can be combined in a composition with a pharmaceutically acceptable excipient, carrier, buffer, stabilizer or other material well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the recombinant microorganism. The precise nature of the carrier or other material may depend on the route of administration. The composition can be liquid, solid, or semi-solid. The composition can comprise a foodstuff or can take the form of a pharmaceutical composition. Those of relevant skill in the art are well able to prepare suitable compositions.

[0111] In some versions, the methods of producing a biologic at a site and excising the internal cassette elements are combined, such that the recombinant microorganism is permitted to produce the biological at the site before the internal cassette elements are excised. In some embodiments, the site is the gastrointestinal tract of a subject. In some embodiments, the recombinant microorganism is contacted with the inducing sugar after the microorganism has been introduced to the site, wherein the microorganism produces the biologic at the site prior to the internal cassette elements being excised.

[0112] Any of the genes described herein can comprise a coding sequence operably linked to a heterologous promoter.

[0113] "Heterologous” as used herein refers to a structural arrangement of two elements with respect to each other that does not occur in nature. A sequence is heterologous to a promoter, for example, if the sequence is not structurally linked to the promoter in nature or is linked to the promoter via different structural linkage (e.g., a different nucleic acid sequence) than that which occurs in nature.

[0114] Proteins and / or protein sequences are "homologous” when they are derived, naturally or artificially, from a common ancestral protein or protein sequence. Similarly, nucleic acids and / or nucleic acid sequences are homologous when they are derived, naturally or artificially, from a common ancestral nucleic acid or nucleic acid sequence. Nucleic acid or gene product (amino acid) sequences of any known gene, including the genes or gene products described herein, can be determined by searching any sequence databases known the art using the gene name or accession number as a search term. Common sequence databases include GenBank (www.ncbi.nlm.nih.gov / genbank / ), ExPASy (expasy.org), KEGG (www.genome.jp / kegg / ), among others. Homology is generally inferred from sequence similarity between two or more nucleic acids or proteins (or sequences thereof). The precise percentage of similarity between sequences that is useful in establishing homology varies with the nucleic acid and protein at issue, but as little as 25% sequence similarity (e.g., identity) over 50, 100, 150 or more residues (nucleotides or amino acids) is routinely used to establish homology (e.g., over the full length of the two sequences to be compared). Higher levels of sequence similarity (e.g., identity), e.g., 30%, 35% 40%, 45% 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% or more, can also be used to establish homology. Accordingly, homologs of the genes or gene products described herein include genes or gene products having at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity to the genes or gene products described herein. Methods for determining sequence similarity percentages (e.g., BLASTP and BLASTN using default parameters) are described herein and are generally available. The homologous proteins should demonstrate comparable activities and, if an enzyme, participate in the same or analogous pathways. "Orthologs” are genes in different species that evolved from a common ancestral gene by speciation. Normally, orthologs retain the same or similar function in the course of evolution. As used herein "orthologs” are included in the term "homologs”.

[0115] For sequence comparison and homology determination, one sequence typically acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence based on the designated program parameters. A typical reference sequence of the invention is a nucleic acid or amino acid sequence corresponding to acsA or other genes or products described herein.

[0116] Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection (see Current Protocols in Molecular Biology, F. M. Ausubel et al., eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc., (supplemented through 2008)).

[0117] One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity for purposes of defining homologs is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always>0) and N (penalty score for mismatching residues; always<0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11 , an expectation (E) of 10, a cutoff of 100, M=5, N=-4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915).

[0118] In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Natl. Acad. Sci. USA 90:5873- 5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.1 , more preferably less than about 0.01 , and most preferably less than about 0.001 . The above-described techniques are useful in identifying homologous sequences for use in the methods described herein.

[0119] The terms "identical” or "percent identity”, in the context of two or more nucleic acid or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described above (or other algorithms available to persons of skill) or by visual inspection.

[0120] The phrase "substantially identical” in the context of two nucleic acids or polypeptides refers to two or more sequences or subsequences that have at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90, about 95%, about 98%, or about 99% or more nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using a sequence comparison algorithm or by visual inspection. Such "substantially identical” sequences are typically considered to be "homologous”, without reference to actual ancestry. Preferably, the "substantial identity” exists over a region of the sequences that is at least about 50 residues in length, more preferably over a region of at least about 100 residues, and most preferably, the sequences are substantially identical over at least about 150 residues, at least about 250 residues, or over the full length of the two sequences to be compared.

[0121] Deletion: The removal of one or more nucleotides from a nucleic acid molecule or one or more amino acids from a protein, the regions on either side being joined together.

[0122] Endogenous: An endogenous nucleic acid, gene, gene element (e.g., promoter, enhancer, coding sequence), polypeptide, sequence or any other element in a given cell is one that is naturally occurring in the given cell.

[0123] Encode: Unless explicitly stated otherwise, the term "encode” is used in an open-ended sense such that the recitation of a nucleic acid encoding a particular product requires that at least the particular product is encoded and that additional elements may additionally be encoded.

[0124] Exogenous: An exogenous nucleic acid, gene, gene element (e.g., promoter, enhancer, coding sequence), polypeptide, sequence or any other element in a given cell is one that is not naturally occurring in the given cell.

[0125] Expression: The process by which a gene's coded information is converted into the structures and functions of a cell, such as a protein or RNA (e.g., transfer RNA, ribosomal RNA, etc.).

[0126] Gene: "Gene” refers minimally to a coding sequence and a promoter operably linked to the coding sequence. A gene may additionally include other elements, such as enhancers and silencers.

[0127] Isolated: An "isolated" biological component (such as a nucleic acid molecule, polypeptide, or cell) has been substantially separated or purified away from other biological components in its original form, such as its native form or the form in which it was originally produced. Nucleic acid: Encompasses both RNA and DNA molecules including, without limitation, cDNA, genomic DNA, and mRNA. Nucleic acids also include synthetic nucleic acid molecules, such as those that are chemically synthesized or recombinantly produced. The nucleic acid can be double-stranded or single-stranded. Where single-stranded, the nucleic acid molecule can be the sense strand, the antisense strand, or both. In addition, the nucleic acid can be circular or linear.

[0128] Operably linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. An origin of replication is operably linked to a coding sequence if the origin of replication controls the replication or copy number of the nucleic acid in the cell. A promoter is operably linked to an insertion sequence as described herein if it is positioned with respect to the insertion sequence such that the promoter affects the transcription or expression of a transcription sequence or coding sequence inserted in the insertion sequence. Operably linked nucleic acids may or may not be contiguous. The terms "operably linked” and "operationally connected” are used interchangeably herein.

[0129] Overexpress: When a gene is caused to be transcribed at an elevated rate compared to the endogenous or basal transcription rate for that gene. In some examples, overexpression additionally includes an elevated rate of translation of the gene compared to the endogenous translation rate for that gene. Methods of testing for overexpression are well known in the art, for example transcribed RNA levels can be assessed using rtPCR and protein levels can be assessed using SDS page gel analysis.

[0130] Vector or expression vector: An entity comprising a nucleic acid molecule that is capable of introducing the nucleic acid, or being introduced with the nucleic acid, into a cell for expression of the nucleic acid. A vector can include nucleic acid sequences that permit it to replicate in the cell, such as an origin of replication. A vector can also include one or more selectable marker genes and other genetic elements known in the art.

[0131] Unless explained otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below.

[0132] Nucleic acids encoding biologies desired to be expressed in a cell may be codon-optimized for that particular type of cell. Codon optimization can be performed for any nucleic acid by "OPTIMUMGENE”-brand gene design system by GenScript (Piscataway, NJ).

[0133] US 2023 / 0381253 A1 is incorporated herein by reference in its entirety.

[0134] The elements and method steps described herein can be used in any combination whether explicitly described or not.

[0135] All combinations of method steps as used herein can be performed in any order, unless otherwise specified or clearly implied to the contrary by the context in which the referenced combination is made.

[0136] As used herein, the singular forms "a,” "an,” and "the” include plural referents unless the content clearly dictates otherwise. Numerical ranges as used herein are intended to include every number and subset of numbers contained within that range, whether specifically disclosed or not. Further, these numerical ranges should be construed as providing support for a claim directed to any number or subset of numbers in that range. For example, a disclosure of from 1 to 10 should be construed as supporting a range of from 2 to 8, from 3 to 7, from 5 to 6, from 1 to 9, from 3.6 to 4.6, from 3.5 to 9.9, and so forth.

[0137] All patents, patent publications, and peer-reviewed publications ( / .e., "references”) cited herein are expressly incorporated by reference to the same extent as if each individual reference were specifically and individually indicated as being incorporated by reference. In case of conflict between the present disclosure and the incorporated references, the present disclosure controls.

[0138] It is understood that the invention is not confined to the particular construction and arrangement of parts herein illustrated and described, but embraces such modified forms thereof as come within the scope of the claims.

[0139] EXAMPLES

[0140] EXAMPLE 1. IDENTIFICATION AND CHARACTERIZATION OF SUGAR-INDUCIBLE PROMOTERS

[0141] Introduction

[0142] Sugar-regulated promoters have been identified from the chromosome of Limosilactobacillus reuteri ( / .. reuteri). Three such promoters have been characterized and shown to produce nanogram levels of recombinant protein in vivo. These promoters, induced by simple dietary sugars, create possibilities to control gene expression via diet.

[0143] Identification of Sugar-Regulated Promoters

[0144] L. reuteri was grown in modified deMan, Rogosa and Sharpe broth (mMRS) supplemented with 100 mM carbon source (Glucose, Maltose, Raffinose, or Sucrose). Samples were harvested at OD600= 1 , 2.5, and 4, constituting early, middle, and late log phase respectively. RNA was isolated using the standard TRIzol method. Isolated RNA samples were then sequenced by the University of Wisconsin Biotechnology Center- Gene Expression Center.

[0145] Raw counts generated by RSEM (version 1.2.31) were then processed using R (version 4.3.1). All R code was visualized using RStudio (version 2023.09.1 +494), and code was written using both native R functionality alongside the following packages: data.table (version 1.14.8), dplyr (version 1.1.3), EdgeR (version 3.42.4), genbankr (version 1.27.0), installr (version 0.23.4), openxlsx (version 4.2.5.2), readxl (version 1.4.3), Tidyverse (version 2.0.0), and writexl (version 1 .4.2). EdgeR was used to normalize transcript levels. Inter-sample normalization was conducted with trimmed mean of M-values (TMM; (Robinson and Oshiack, 2010)), and intrasample normalization was conducted with count-per-million reads (CPM). EdgeR was then used to generate a list of differentially expressed genes (DEGs), which was subjected to the following filters: log base 2 fold change (log2FC) >3 or <-3, meaning at least 8-fold expression difference, and log base 2 CPM (log2CPM) >3, meaning at least 8 counts per million reads. A genbank file of the closed reference genome, JCM1112 (Morita et al. 2008), was read in by genbankr and locus tags of DEGs were matched back to their location on the chromosome. Any gene with less than 250 bp of noncoding region upstream on its respective coding strand was filtered out. This length was chosen as a comprehensive estimate of putative promoter size, given the findings of Walter et al. on the size of promoter-active fragments in L reuteri 100-23 (Walter et al. 2003). Resulting genes, along with their log2FC and GPM were then exported to an excel sheet. Sequences of each promoter region were manually compiled into a promoter database. These sequences were taken from the -1 position relative to the DEG to either the end of the upstream noncoding region or 400 bp, whichever came first. Inducing and noninducing sugars were found for each promoter by comparing the GPM per sample to the total GPM. The GPM per sugar sample was calculated by summing all GPM over time in a given sugar condition. Total GPM for each promoter was calculated by adding all GPM values from each time point and each sugar sample. The GPM per sample was divided by the total GPM and was rounded to the nearest percent. The average quotient was 25%. If a sample had a quotient above average (>25%), the corresponding sugar was labelled an "inducing sugar.” If a sample had a quotient below average (<25%), the corresponding sugar was labelled as a "noninducing sugar.”

[0146] The sequences of the identified regions containing the sugar-regulated promoters, the locus tags of the genes directly downstream, and the inducing and noninducing sugars are provided in Table 1.

[0147] Table 1. Sequences of identified regions containing sugar-regulated promoters and locus tags of the genes directly downstream.

[0148] Characterization of Sugar-Regulated Promoters

[0149] Genes that were constitutively differentially expressed over all growth conditions were prioritized for characterization first. If no genes were constitutively expressed, then genes with higher fold change were prioritized. To characterize the promoters, a given promoter sequence (Table 2) was placed upstream of a reporter gene (Leptin) tagged at the C terminus with HIBIT- an 11 amino acid long bioluminescent peptide tag (VSGWRLFKKIS (SEQ ID NO:71); Promega). By high fidelity PGR, the backbone of pSI P_Leptin_Hi BiT (SEQ ID NO:72) was amplified using OVPL2238 and OVPL4710 (Table 3). This backbone (SEQ ID NO:72) did not include sppK, sppR, and Porfx, ensuring that Leptin-HIBIT production was not due to readthrough from the inducible pSIP411 promoter. Elements in pSIP_Leptin_HiBIT include a leptin coding sequence (414 bp) at positions 1 -441 of SEQ ID NO:72 (promoters were ligated directly upstream of position 1), an HIBIT tag (33 bp) at positions 442- 474 of SEQ ID NO:72, a pSH71 origin of replication (1743 bp) at positions 774-2516 of SEQ ID NO:72, and an erythromycin resistance coding sequence (735 bp) at positions 2849-3583 of SEQ ID NO:72. Each promoter sequence (Table 2) was amplified via high-fidelity PGR using primers identified in Table 3. Due to AT density, primer sets could not encompass the entirety of the noncoding region upstream of the DEG at times. In such cases, the minimum length allowed for the promoter sequence was 200 bp. Promoter sequences were ligated into pSIP_Leptin_HiBIT directly upstream of leptin via Ligase Cycling Reaction (LCR; (de Kok et al. 2014)). EC1000 was used as a cloning host, and sequenced plasmid DNA was then transformed into L. reuteri. Table 2. Exemplary promoter sequences, inducing sugars, and noninducing sugars.

[0150] Table 3. Oligonucleotide information.

[0151] To test recombinant protein production, cultures were grown overnight in mMRS with the noninducing sugar. Carbohydrate concentration was as described above. Cultures were washed with equal volume of plain mMRS and resuspended in equal volume plain of mMRS. Cultures were then inoculated at CD600=0.1 to 40mL mMRS containing inducing or noninducing sugars individually. HiBiT assays were conducted using the extracellular protocol as described in (Choi In, Oh, Wang and van Pijkeren, 2023). All data were normalized to CD600=1 mathematically and pg / mL Leptin-HIBIT data were obtained by fitting Relative Luminescence Units (RLU) to a standard curve generated using the HIBIT Control Protein (Promega). For preliminary testing, cultures were grown until CD600=1 and tested for bioluminescence. Any candidate promoters that passed preliminary testing were then subject to sampling every hour from T 1 to T8, with the addition of T24, to generate a full profile of recombinant protein production. For further characterization of the promoters upon additional sugars, samples were tested via HIBIT at T2, T4, and T6. All data were collected for N=3.

[0152] Results for the characterization of the Pglucose promoter (Table 2, SEQ ID NOH) are shown in FIGS. 1 A-1C. FIG. 1 A. shows the characterization of Pglucose in inducing and noninducing sugars. Pglucose produced significantly more recombinant Leptin-HIBIT upon growth within the inducing sugar (glucose) as compared to the noninducing sugar (sucrose). FIG. 1 B shows an expression profile with Pglucose across all sugars utilized by L. reuteri. Expression under Pglucose was low only in sucrose. In all other sugars, Pglucose led to production of recombinant Leptin-HIBIT. FIG. 10 shows an expression profile with Pglucose in response to fructose titration. Expression under Pglucose appeared to be inhibited or otherwise decreased upon the addition of fructose (fructose supplemented samples are highlighted by black underline).

[0153] Results for the characterization of the Psucrose promoter (Table 2, SEQ ID NO:5) are shown in FIGS. 2A and 2B. FIG. 2A shows the characterization of Psucrose in inducing and noninducing sugars. Psucrose produced significantly more recombinant Leptin-HIBIT upon growth within the inducing sugar (sucrose) as compared to the noninducing sugar (glucose). FIG. 2B shows an expression profile with Psucrose across four sugars utilized by L reuteri. Psucrose appeared to be induced by raffinose alongside sucrose.

[0154] Results for the characterization of the Pmaltose promoter (Table 2, SEQ ID NO:6) in inducing (maltose) and noninducing (sucrose) sugars are shown in FIG. 3. Pmaltose appeared to be induced by maltose and not induced by sucrose.

[0155] Modifications to Pglucose and Leptin to Yield Lower Expression: Modifications to Pglucose ribosomal binding site and leptin start codon

[0156] Modifications to the ribosomal binding site (RBS) of Pglucose were performed. The canonical RBS comprises an AGGAGG motif (also sometimes annotated as AAAGGAGG). Across gram positive and negative bacteria, weaker RBSs tended to have one or several transversions. In particular, AGGAGG can change to either AGGAGG (construct 1) or TCCAGG (construct 2). In addition to the makeup of the RBS sequence itself, the spacer between the RBS and the start codon can play a role in the level of gene expression. Within B. subtilis, a well-studied gram-positive bacterium, the RBS appears between 5-11 bases upstream of the start codon The RBS of Pglucose appears 9 bases upstream. To test if extending this spacer region would affect the strength of Pglucose, two constructs were made: one with an 11 bp spacer (construct 3), and one with a 13bp spacer (construct 4). Finally, manipulating the first base of a gene's start codon can also have impacts on expression. Therefore, one construct was created that changed the canonical ATG to a GTG on leptin (construct 5). All constructs were derived from pSIP_Pglucose_Leptin_HiBIT (SEQ ID NO:73). Key elements in pSI P_Pglucose_Leptin_Hi BiT (SEQ ID NO:73) include Pglucose (394bp) at positions 1-394 of SEQ ID NO:73, a leptin coding sequence (414 bp) at positions 395-835 of SEQ ID NO:73, an Hi BiT tag (33bp) at positions 836-868 of SEQ ID NO:73, an pSH71 origin of replication: (1743 bp) at positions 1168-2910 of SEQ ID NO:73, and an erythromycin resistance gene (735 bp) at positions 3243-3977 of SEQ ID NO:73. Constructs were synthesized by high fidelity PCR using oligos containing strategic mismatches, yielding a modified plasmid backbone. See Table 4 for sequence information. Constructs 1-4 amplified pSIP_Pglucose_Leptin_HiBIT via OVPL2238 and the corresponding reverse oligo for the construct (see Table 5). Construct 5 amplified the plasmid backbone via oVPL5223 and OVPL5820. DNA was self-circularized via T4 ligase and transformed to the cloning host EC1000. Isolated and sequenced plasmid DNA was then transformed into L reuteri.

[0157] Table 4. Sequences of Pglucose, leptin start codon, and modifications thereof.*

[0158] * Pglucose (regular text)

[0159] RBS of Pglucose (underline)

[0160] Changed base(s) (bold)

[0161] All sequences were placed immediate upstream of the start codon.

[0162] Table 5. Oligonucleotide information.

[0163] To test recombinant protein production, cultures were grown overnight in mMRS with the noninducing sugar supplemented with 100 mM carbon source. Cultures were washed with equal volume of plain mMRS and resuspended in equal volume plain of mMRS. Cultures were then inoculated at OD600=0.1 to 40mL mMRS containing glucose or sucrose individually. HiBiT assays were conducted using the extracellular protocol as described in (Choi et al. 2023). All data were normalized to CD600=1 mathematically and pg / mL Leptin-HiBIT data were obtained by fitting Relative Luminescence Units (RLU) to a standard curve generated using the HIBIT Control Protein (Promega).

[0164] For preliminary testing, cultures were grown in only mMRS+glucose until CD600=1 and were tested for bioluminescence. Any construct with expression between 10,000 and 1000pg / mL leptin-HIBIT was subject to further testing. Samples for subsequent testing were collected at 4 hours post-inoculation (T4) from both glucose and sucrose samples. Preliminary data were collected for N=1 ; subsequent data were collected for N=3.

[0165] Results are shown in FIGS. 4A-4C. FIG. 4A shows preliminary expression of Pglucose and all modifications in glucose. Two constructs (3 and 5) were prioritized for future study as their glucose expression was between 10,000 and 1000pg / mL. FIG. 4B shows expression of Pglucose, Construct 3, and Construct 5 in glucose. The modifications made in both constructs yield a lower expression relative to the original Pglucose sequence. FIG. 4C shows expression of Pglucose, Construct 3, and Construct 5 in sucrose. Similarly to FIG. 4B, the modifications made in both constructs yield a lower relative expression in sucrose.

[0166] It is predicted that the modifications made to Pglucose can be made to the other promoters disclosed herein (e.g., the promoters disclosed in Tables 1 and 2).

[0167] EXAMPLE 2. SUGAR-INDUCED EXCISION OF RECOMBINANT DNA FROM AN ENGINEERED PROBIOTIC

[0168] Background

[0169] Our present examples show that a recombinant nucleic acid cassette can be stably maintained in the chromosome of a genetically modified bacterium but can be precisely excised upon exposure to a sugar that drives the expression of a recombinase enzyme. The cassette can include a gene for a biologic, such as a therapeutic biologic, for delivery thereof to a subject. The cassette can then be excised to remove the cassette and its contents, such as the biologic gene, and either convert the microbe back to a non-GMO for regulatory purposes or kill the microbe.

[0170] Proof of Concept

[0171] To assess if a glucose-inducible promoter (Pglu) can express Ore at levels to induce excision in Limosilactobacillus reuteri VPL4366, we inserted a fusion of Pglu and ere into the chromosome using established protocols (Zhang et al. 2018) (Suicide Vector 0 (SEQ ID NO:88)). Elements in Suicide Vector 0 include an upstream homologous region at positions 636-1638 of SEQ ID NO:88, Pglucose at positions 1639-2032 of SEQ ID NO:88, ere coding sequence (codon optimized for L reuteri) at positions 2033-3064 of SEQ ID NO:88, downstream homologous region at positions 3065-4064 of SEQ ID NO:88, Ddl counterselection gene coding sequence at positions 4139-5594 of SEQ ID NO:88, and erythromycin resistance marker at positions 6081-6812 of SEQ ID NO:88. To monitor Cre-mediated excision, we transformed pVPL8048-lox (SEQ ID NO:89). pVPL8048- lox encodes a gene conferring chloramphenicol resistance (CmR) flanked by loxP sites. If Cre is expressed at sufficient levels, the gene encoding CmRwill be excised. A second antibiotic marker encoding erythromycin resistance (EmR) allowed plasmid maintenance regardless of cm excision. Elements in pVPL8048-lox (SEQ ID NO:89) include a partial Biobrick spacer 1 generic at positions 207-258 of SEQ ID NO:89, A loxPWT (left to right) at positions 259-292 of SEQ ID NO:89, Phelp promoter at positions 293-503 of SEQ ID NO:89, Hibit tag (Promega) at positions 504-539 of SEQ ID NO:89, Chloramphenicol resistance marker at positions 540-1190 of SEQ ID NO:89, loxPWT (left to right) at positions 1218-1251 of SEQ ID NO:89, (Partial) Biobrick spacer 0 at positions 1252-1283 of SEQ ID NO:89, Origin of replication at positions 1690-3314 of SEQ ID NO:89, and Erythromycin resistance marker at positions 3658-4392 of SEQ ID NO:89.

[0172] The strain transformed with pVPL8048-lox was then exposed to modified Man, Rogosa, and Sharpe broth (mMRS) containing either 100 mM glucose + EM or 50 mM sucrose + CM. The first condition, 100 mM glucose + EM, had no selection for the cassette and had active expression of ere. The second condition, 50 mM sucrose + CM, was used to monitor the low expression of Pglu and ere when active selection for the retention of the cassette was present. Total colony forming units per milliliter (CFU / mL) were found by counting the number of colonies surviving on EM. CFU / mL surviving on CM were taken as colonies that did not undergo an excision event in all plasmid copies present in the cell. LogCFU reduction was then calculated as per the equation below:

[0173] LogCFU reduction = log10(CFU on EM — CFU on CM)

[0174] VPL4366 cells were inoculated to the media at an ODeoo=0.1. Bacteria were grown for a total of 8 hours, and at T2, 4, 6, and 8 hours CFU counts were determined. A total of three biological replicates were obtained, and data are shown in FIG. 6 The results of this study were analyzed using 2-way Anova corrected using Sidak's multiple comparisons test.

[0175] Excisable Biotherapeutic Cassette

[0176] Creation of Pglu Cassette

[0177] Once we determined ore could be controlled by Pglu, the cassette shown in FIG. 5 (SEQ ID NQ:90) was created.

[0178] The cassette was inserted into the chromosome of VPL4366 using the same vancomycin counterselection tool as above (Zhang et al. 2018). This was done using 2 distinct suicide vectors (Suicide Vector 1 (SEQ ID NO:91 ) for loxP71 insertion and Suicide Vector 2 (SEQ ID NO:92) for insertion of loxP66 + biotherapeutic insertion + ere** under Pglu loxP). Elements of Suicide Vector 1 (SEQ ID NO:91) include an upstream homologous region at positions 636-1804 of SEQ ID NO:91 , an L. plantarum noncoding region at positions 1805-2175 of SEQ ID NO:91 , loxP71 (left to right orientation) at positions 2176-2209 of SEQ ID NO:91 , a downstream homologous region at positions 2210-3279 of SEQ ID NO:91 , a De / / counterselection gene coding sequence at positions 3354-4809 of SEQ ID NO:91 , and an erythromycin resistance marker at positions 5296- 6027 of SEQ ID NO:91. Elements of Suicide Vector 2 (SEQ ID NO:92) include an upstream homologous region Positions 636-1866 of SEQ ID NO:92, loxP66 (left to right orientation) at positions 1867-1900 of SEQ ID NO:92, Pglucose at positions 1901-2294 of SEQ ID NO:92, a ore coding sequence codon optimized for L. reuteri at positions 2295-3326 of SEQ ID NO:92, an inverted repeat at positions 3327-3748 of SEQ ID NO:92, murine IL- 22 (biotherapeutic) coding sequence at positions 3479-3922 of SEQ ID NO:92, an EFTU promoter at positions 3923-4122 of SEQ ID NO:92, a downstream homologous region at positions 4123-5176 of SEQ ID NO:92, a Ddl counterselection gene coding sequence at positions 5251 -6706 of SEQ ID NO:92, and an erythromycin resistance marker at positions 7193-7924 of SEQ ID NO:92. LoxP66 (SEQ ID NO:41) and loxP71 (SEQ ID NO:42) were described previously (Albert et al. 1995) and were chosen as their product upon excision is an inert lox site (loxP72). Both loxP sites were oriented in the same direction so that upon expression of Cre, the entire cassette would be excised. The gene encoding murine IL-22, a biotherapeutic, was included in the cassette under the control of a strong constitutive promoter (EFTU). Between cre and IL-22, an inverted repeat was added to ensure no transcriptional collision between the two genes. The loxP sites flanked sucT and sucP, two genes essential for VPL4366 growth on sucrose. These genes served as a positive selection marker to ensure the maintenance of the cassette when the cells were grown on sucrose. A noncoding region from Lactiplantibacillus plantarum (LP) was included in the second suicide vector to lengthen the nonhomologous region to be inserted into the chromosome. This was done as the length of loxP71 alone (34bp) was deemed too short for efficient recombination. Cre was inserted into the chromosome containing two tandem in-frame stop codons. These two stop codons were included upstream of the sequence encoding the catalytic domains of the Cre recombinase, which abolished the chance of any random excision events during the construction of the recombinant strain. By single-stranded DNA recombineering, the stop codons were restored to the wild-type codons, a protocol described in van Pijkeren et al. 2012.

[0179] The exemplary cassette (SEQ ID NO:90) was as follows:

[0180] Positions 1-34: LoxP66

[0181] Positions 35-428: Pglu

[0182] Positions 429-1460: Cre (for LR)

[0183] Positions 1461-1612: Inverted repeat

[0184] Positions 1613-2056: Murine IL-22

[0185] Positions 2057-2256: EF-TU

[0186] Positions 2301-3758: SucP (native) Positions 3785-5002: SucT (native) Positions 5003-5227: Psuc (native) Positions 5299-5669: L. plantarum noncoding region Positions 5670-5703: LoxP71 taccgttcgtataatgtatgctatacgaagttatgatatgcgtaactgaaaaacgaagctgagagatggttgatatgtctcagcttcgttttttagtataaatttaaata tttatccgtacaaataattaataaaaacttaattgattattaaagactaattccagtttatgtgcattaaacgagaattagtcttttttggtagtaaaaaaataaaaata tttttcacatgcataactgcttctaaatacaagatagacatgaaattgttaaatgtataaaatgctttttcacaattggttatgattatttttaaataattcgcttgatttatc cgtacaaatattttatagtaataattgttcaatgaaagcgcgttcatgttcatgaaaaactactactttttaatttttaaggaggatgaatgtaATGAGTAATTT GCTCACTGTTCATCAAAATCTTCCGGCATTACCTGTAGACGCTACATCAGATGAGGTTCGGAAAAACTTAAT GGATATGTTTCGAtgataaCAAGCTTTCTCTGAGCATACTTGGAAAATGCTTTTGAGTGTCTGCCGAAGTTGGG CTGCTTGGTGTAAGCTAAATAATCGGAAGTGGTTTCCAGCAGAACCAGAGGATGTCCGTGACTACTTACTTT ATCTACAAGCGCGCGGTCTCGCAGTTAAAACTATTCAACAGCATTTAGGACAGTTAAATATGCTACACCGCC GCTCAGGATTACCTCGGCCGTCAGATTCTAATGCTGTTAGCCTCGTTATGCGTCGTATCAGAAAAGAAAAC GTTGATGCTGGAGAACGGGCTAAGCAAGCACTAGCTTTTGAACGAACTGACTTCGATCAGGTAAGATCTTT AATGGAAAATAGCGATCGTTGTCAGGATATCCGGAACTTGGCGTTTCTTGGAATTGCGTATAATACCTTACT ACGTATTGCAGAAATTGCACGTATTCGTGTTAAAGACATTTCTCGGACGGACGGCGGACGTATGTTAATACA TATTGGGCGCACCAAAACATTGGTATCTGCTGCGGGAGTTGAAAAGGCTCTTTCATTAGGTGTTACAAAATT AGTTGAACGATGGATCTCAGTCTCAGGCGTGGCAGATGATCCCAACAATTATCTTTTTTGTAGGGTTCGGAA GAATGGGGTCGCGGCACCATCCGCAACCAGTCAATTATCAACACGGGCACTTGAAGGAATTTTCGAAGCG ACTCATCGTCTGATTTATGGAGCGAAGGATGATAGCGGTCAACGTTACCTTGCATGGTCTGGTCACAGTGC ACGCGTTGGAGCAGCTCGTGATATGGCACGGGCTGGGGTTTCTATCCCGGAAATTATGCAGGCAGGGGG GTGGACGAACGTTAACATCGTTATGAATTATATTCGGAATCTTGATTCGGAAACTGGGGCTATGGTTCGTTT ACTCGAAGATGGAGATTAGgctttgattgatagccaaaaagcagcagttgataaagcaattactgatattgctgaaaaattgtaatttataaataaa aatcaccttttagaggtggtttttttatttataaattattcgtttgatttcgctttcgatagaacaatcaaagctcaAACACAAGCATTACGTAAACTCAT AAATAATAAATCTAATTCACCAATAGCTTTAATTTCACCACTTTCACCTAATTTTTTAACAGTTTCTTTTAAACG ACGAACATTTTTTTGAATATTTTGATCATCACCACTAATATGACAACTACTTAATTGATTACTTAATTTAGTTAA AAATGGAACAACTTCTTGCATATATGGTTGAAAACGATCACTTTGTGGTAATAAAACATCTTCTAAAGTAAAA TTTAAAACTTGTTTCATTAAATAACATTGATCTTTAGCACTAACACCACGAAATAATTTTTCACCAATTAAACG AACATCAGTATTATTATCAGCTAAACTAGCTTCTTTAGCTAACATAAAAGTACGATTAACAATATATGGTTGTT GAAAATT ACT AACTT CT AATTT ACAACGAGTATT AACT GGTAACATtaatgaaaacctcctgataatttacaagtataatgccaga tcatctg attcgg tg actg acatacccttatacatattg tacaacttcttttcgccaattg aaagctttaatcttag actctg aag aag aattcttaaatataatatcaa ctatctgttcatttgtaaatgtatttgactaatgtttttctattaattcgagaaaaccgactgtaaaaagtacagtcggcattatctcatattactatttttgttccatcactttt tcaccattagctgtaatagtgaaagtcttgttagcagcatcagcatcaagaacagccacattcttgccatccttatctttccgcgtaaccttgatagttgtttcagttg gtgtttccacttcaattgaaccatcaagatcaaaggctgcaaatttattccgccatgcaagtaagtctaagagattcttaactactggacgttgaacttcttgtgcaa cttcttctttagtgtagtagtgacggttgatgttccgaccttccttagtcttttcaagtaattcaaggtcatttgaaccagcaagtaaaccaacatagtaaaccattgg aataccaggtgcaaatacttggaatgcccgagaaagcaagtaagctttgtcatcgtcacctaatgcagagtagtaagtagagttaatttggtaaatatccaagt tgttgtattcagcacttgagtatttccgcttaacgttagcaccaaccttgtataattcattggatgcatattcgatttcatcatcagttaagatatccttagcatcaacaa ccccaataccatcatgagtatcaagagtagtaaattgcttcatcggtgacatctttaaccacttagcaaggcggttagtcttaccagagtaaagggtataaaga gtagtcattggtaaggtaaagtcatagatgaagaagtcatgttgtgaaatcttttgtggaatggtgtagtgttcgtgaatttcaggaaggatgatggccttgtaagg agccaaaatatcttgaacttcatttaaaagatcccagatttcaggttcaacgaagaaatcattagtaccaaccttcttaatagcgtaagcaaaggcatcaagac gaatcatatctgcaccgtgcttaaccatgtcaattaatgtttccttgaagaattcgttagctaccttactcttaacattaatatcaatttgttcttcaccgaaagtgttcca taagttttcagtagtaccatcatcaaaggtaatttcttgcttaggagccttatcctttcgcttgtaaattaaatcaacatcttcttgagttggacggttcttaccagctttttc ccagaacttttcccaacgaataaagaagtcgttgtacttagaatcatcgtgcttcttcttgaagtcttggtacatttcagacttcttggaaatatggttaatcatgaagt caaacattaagtagtagtcttcacctaatgcttcaacatcatcccagttaccaaaagcagaatcaacaacatcgtaacggtatggtgcaaaaccacggtcacc agttgatgggaagaatggaagtaagtgaacaccgccgattgcatcaccgatatagttctttaatacttcatgagtttctttaatatttttacccattgagtcagagta agtaattaacattgcttcatttttgattggcataatgatatcctccaataattttaaatttagttagcttgtttagaatgacgagttgcaaagaaaataattaaggcaat aactattagcattaccccgtagattgggaatggtgcggcaagatcaaggccactcattgggcgaccgactaatcgattcatccattcagcaattgttggtgaga agaaagctccaaagttaaaaccaatcagtaccattgaagttactaatggttgacgcttagcaggagctaaatccggcaacaagttaaaaatcaacggagaa actaattgtagtgggaagccgattaaaagcaaaccaattactaacattgcaaagttgccgtttgcgaaggcaaataagaagtttgaaatggccattaacccga gaccaaggtaaacagtgttaaaacctaacgctttattaattgatccgtagaataaaccaccaagcgttgccccaattaacattaaggaaaggaacattgatga accagtatagctacttcccttaattgcaacggttaagccagggaaacgattttccattccaacataatctacaaccaagaggaaggcaaagagaacaagga ggtaaactactggactaatctttttaattggttcttccacttcagttaattcttcagcaagatcatcttcggcaacgttattatcctgtgctttgctatcgtcaggaacacg aacggcaaagaagaagagaacaacaaaggcaagaaggtagacggcaaatgatgcatgccaacctgcatagctaagaattaacccagcaattgccag ggtacaagcttgaccgatttgttcagccgcagcacgccaaccaagcatttgagctcgagttgtaccttcataccaaactgaaatcatcgaaattgcttgagaatt gtataaaccaaaccctgctcctaaaactaaccgcgaaatcaaaatcgcagtgtagtcattcgcaaacatgggaacaattccggcaaggccaacaattgtaa ccccggccataataatcttcttatcagaaatattgaaccattgttgaagtaatggtgaaaggacaacaaaaatcattacagcaaatgatggagtcgtaactaaa tattctgactgtgtctgtgagattccgagtgccgcctttaattgcggtaaagaaccttgaatggcataagcactcgtaaccatgaatgaaactgacaggaacgcc aatttggtaacaagagaatttttgttattcataattagtaggtactctttctataggtatttgataaacgtttatcattactgtacatcaataatatacaatgaagtttttaa aatgtcaaacgtttaacaaagatttcctacaaaaaattgtaatccattacattgttattataacgcgccttaaatgaaaatagatgaaaacggatgataacgctat tttaggtctctttcgggattgcttgtgaattttcacgcattattttttataaaaaaagagtaaagcaatgaccgattcatcgttttactcttttcaacttagtatttactcggg acagtgttcgaatggcagacggagatgtacccaacttttattggactcatcattgttcttcataaacagtaattttgtcgagcaactgtcaggcagaaaatgacatt gtgatagcttactatttcggaatcaccatagtagtaatcgaacgtttcaacaaagtggttagggtaaccctaacgtctcgtttaaagttcctgtatcaaaatagtca acgaccaattgtgccgagttaagtggtcgttcatcagccattcgagcggcttcccgaaacgtgttcggtgccactaaagcctgtgcttgctacgccaacggact aatgccaaaaccgcattaatccgttggctaggcaatgctcggcttcaaataacttcgtataatgtatgctatacgaacggta (SEQ ID NO:90)

[0187] Validation of Excision from the Chromosome

[0188] Percent excision was monitored over the course of five days. VPL4366 harboring the recombinant ere cassette was grown in 10mL of mMRS broth containing either 100 mM glucose, 50 mM melibiose, or 50 mM sucrose. Melibiose was included alongside glucose and sucrose as previous data has shown that Pglu leads to more expression when a reporter culture was grown on melibiose than when grown on glucose. Following 24h incubation, colonies were enumerated on mMRS agar plates containing either 100 mM glucose or 50 mM sucrose. To grow on sucrose, VPL4366 needs sucT and sucP. As excision leads to the removal of these genes, CFU growing on mMRS + 50 mM sucrose plates were taken as cells that had not undergone an excision event. CFU growing on mMRS + 100 mM glucose plates were taken as the entire population of surviving cells, as excision of sucT and sucP does not affect growth on glucose. Percent excision was therefore calculated by the equation below: Percent excision = 100

[0189] Once per day, 100uL was passaged to fresh mMRS containing the appropriate sugar. This constituted one passage. This experiment was completed once and the percent excision results are shown in FIG. 7. These results are also shown in FIG. 8 as unprocessed CFU / mL data of CFU recovered from glucose plates and CFU recovered from sucrose plates. Excision was greatest in 50 mM melibiose, with passage five reaching 99.98% excision.

[0190] Discussion

[0191] Our foregoing examples show that a genetically modified cassette can be stably maintained in the chromosome of a genetically modified bacterium but is precisely excised upon exposure to a sugar that drives the expression of the recombinase enzyme.

[0192] In vitro, the cassette can be stably retained when sucrose is the major carbohydrate present in the diet. Sucrose serves as a positive selection to maintain the cassette. The genes sucTP are essential for LR to grow on sucrose and excision of the cassette would remove sucTP. In sucrose, the Pglu-promoter, which drives expression of Cre, is switched off. When sucrose is removed from the diet, and the microbe is exposed to a sugar that induces the expression of Pglu (e.g., glucose or melibiose), the Cre enzyme is produced and facilitates recombination between LoxP-66 and LoxP-71. This leads to excision of the cassette and leaves a 'scar' that is LoxP-72. Cre recombinase cannot interact with LoxP-72. In our experimental setup described herein, after ~50-generations cultured in the presence of glucose or melibiose, we observed that >99.94% of microbes lost the recombinant cassette.

[0193] The cassette described herein can serve as a safety switch. A dietary sugar can be fed for the gradual removal of the recombinant cassette, which is expected to reduce the recombinant microbial load to nondetrimental levels.

[0194] The exemplary cassette can be modified to include key adhesins (US 2023 / 0381253 A1) in the cassette. The adhesins can promote maintenance of the microbe within the gastrointestinal tract but, upon excision will accelerate the removal of the recombinant microbe from the gastrointestinal tract.

[0195] An important feature of the exemplary cassette is that it can stably maintained within the microbe when cultured in sucrose. This presents the opportunity to include genes essential for microbial survival ("essential genes”) in the cassette, which— upon excision— will result in a microbe that cannot replicate anymore.

[0196] When included with a microbe such as L. reuteri, an antirepressor gene placed in the cassette under the control of a glucose-inducible promoter, either as a transcriptional fusion with Cre or separately. Switching from sucrose to glucose will excise the cassette. Delayed excision is expected to induce the antirepressor gene that will subsequently induce prophages leading to cell lysis.

[0197] The cassettes can be used as a switch to transition from an engineered probiotic to a minimally engineered probiotic. A microbe comprising a cassette containing a recombinant gene can be ingested, which, upon transit, can lead to the release of microbes in feces of which >99% have lost the recombinant gene.

[0198] Table 6: Oligonucleotides used in Example 2.

[0199]

[0200] REFERENCES

[0201] Albert, H., Dale, E.C., Lee, E., and Ow, D.W. (1995). Site-specific integration of DNA into wild-type and mutant lox sites placed in the plant genome. Plant J. 7, 649-659. Alvarez-Sieiro P, Montalban-Lopez M, Mu D, Kuipers OP. Bacteriocins of lactic acid bacteria: extending the family. Appl Microbiol Biotechnol. 2016. 100(7):2939-51 .

[0202] Bahey-EI-Din M, Gahan CGM, Griffin BT. 2010. Lactococcus lactis as a cell factory for delivery of therapeutic proteins. Curr Gene Ther 10:34-45.

[0203] Barrangou R, van Pijkeren JP. Exploiting CRISPR-Cas immune systems for genome editing in bacteria. Curr Opin Biotechnol. 2016 Feb;37:61 -8.

[0204] Becker SC, Dong S, Baker JR, Foster-Frey J, Pritchard DG, Donovan DM. 2009. LysK CHAP endopeptidase domain is required for lysis of live staphylococcal cells. FEMS Microbiol Lett 294:52-60.

[0205] Beisel CL, Gomaa AA, Barrangou R. 2014. A CRISPR design for next-generation antimicrobials. Genome Biol 15:516.

[0206] Bikard D, Euler CW, Jiang W, Nussenzweig PM, Goldberg GW, Duportet X, Fischetti VA, Marraffini LA. 2014. Exploiting CRISPR-Cas nucleases to produce sequence-specific antimicrobials. Nat Biotech 32:1146- 1150.

[0207] Borysowski J, Weber-Dabrowska B, Gorski A. Bacteriophage endolysins as a novel class of antibacterial agents. Exp Biol Med (Maywood). 2006 Apr; 231 (4):366-77.

[0208] Britton, R. A.; Irwin, R.; Cuach, D.; Schaefer, L; Zhang, J.; Lee, T.; Parameswaran, N.; McCabe, L. R. Probiotic L. reuteri Treatment Prevents Bone Loss in a Menopausal Ovariectomized Mouse Model. J Cell Physiol 2014, 229 (11), n / a-n / a DOI: 10.1002 / jcp.24636.

[0209] Chatel J-M, Pothelune L, Ah-Leung S, Corthier G, Wai J-M, Langella P. 2008. In vivo transfer of plasmid from food-grade transiting lactococci to murine epithelial cells. Gene Ther 15: 1184-1190.

[0210] Cheng X, Zhang X, Pflugrath JW, Studier FW. 1994. The structure of bacteriophage T7 lysozyme, a zinc amidase and an inhibitor of T7 RNA polymerase. Proc Natl Acad Sci USA 91 :4034-4038.

[0211] Choi IY, Oh J-H, Wang Z, van Pijkeren J-P. Bioluminescent monitoring of recombinant lactic acid bacteria and their products. mBio. 2023 Oct 31 ; 14(5):e0119723.

[0212] Citorik RJ, Mimee M, Lu TK. 2014. Sequence-specific antimicrobials using efficiently delivered RNA-guided nucleases. Nat Biotech 32:1141-1145.

[0213] Cotter PD, Ross RP, Hill C. Bacteriocins - a viable alternative to antibiotics? Nat Rev Microbiol. 2013 Feb; 11 (2) :95- 105.

[0214] Cronin, M.; Akin, A. R.; Collins, S. A.; Meganck, J.; Kim, J.-B.; Baban, C. K.; Joyce, S. A.; van Dam, G. M.; Zhang, N.; van Sinderen, D.; et al. High resolution in vivo bioluminescent imaging for the study of bacterial tumour targeting. PLoS ONE 2012, 7 (1), e30940 DOI: 10.1371 / journal.pone.0030940. de Azevedo M, Karczewski J, Lefevre F, Azevedo V, Miyoshi A, Wells JM, Langella P, Chatel J-M. 2012. In vitro and in vivo characterization of DNA delivery using recombinant Lactococcus lactis expressing a mutated form of L. monocytogenes Internalin A. BMC Microbiol 12:299. de Kok S, Stanton LH, Slaby T, Durot M, Holmes VF, Patel KG, Platt D, Shapland EB, Serber Z, Dean J, Newman JD, Chandran SS. Rapid and reliable DNA assembly via ligase cycling reaction. ACS Synth Biol. 2014 Feb 21 ;3(2):97-106. de Ruyter, P. G.; Kuipers, 0. P.; Meijer, W. C.; de Vos, W. M. Food-grade controlled lysis of Lactococcus lactis for accelerated cheese ripening. Nat Biotech 1997, 15 (10), 976-979 DOI: 10.1038 / nbt1097-976

[0215] De Weirdt R, Crabbe A, Roos S, Vollenweider S, Lacroix C, van Pijkeren J-P, Britton RA, Barker S, Van de Wiele T, Nickerson CA. 2012. Glycerol Supplementation Enhances L. reuteri's Protective Effect against S. Typhimurium Colonization in a 3-D Model of Colonic Epithelium. PLoS ONE 7:e37116.

[0216] Dishisha T, Pereyra LP, Pyo S-H, Britton RA, Hatti-Kaul R. 2014. Flux analysis of the Lactobacillus reuteri propanediol-utilization pathway for production of 3-hydroxypropionaldehyde, 3-hydroxypropionic acid and 1 ,3-propanediol from glycerol. Microb Cell Fact 13:76.

[0217] Doleyres Y, Beck P, Vollenweider S, Lacroix C. 2005. Production of 3-hydroxypropionaldehyde using a two-step process with Lactobacillus reuteri. Appl Microbiol Biotechnol 68:467-474.

[0218] Duan, Y., Zhang, X., Zhai, W. et al. Characterization and implications of prokaryotic ribosome-binding sites across species. Syst Microbiol and Biomanuf 2, 676-684 (2022).

[0219] Eaton, K. A.; Honkala, A.; Auchtung, T. A.; Britton, R. A. Probiotic Lactobacillus reuteri Ameliorates Disease Due to Enterohemorrhagic Escherichia coli in Germfree Mice. Infect Immun 2011 , 79 (1), 185-191 DOI: 10.1128 / 1 Al.00880-10.

[0220] Elzagheid, A.; Algars, A.; Bendardaf, R.; Lamlum, H.; Ristamaki, R.; CoIlan, Y.; Syrjanen, K.; Pyrhonen, S. E- cadherin expression pattern in primary colorectal carcinomas and their metastases reflects disease outcome. World J Gastroenterol 2006, 12 (27), 4304-4309.

[0221] Feliza A. Bourguet, Brian E. Souza, Angela K. Hinz, Matthew A. Coleman, and Paul J. Jackson. Characterization of a Novel Lytic Protein Encoded by the Bacillus cereus E33L Gene ampD as a Bacillus anthracis Antimicrobial Protein. Appl Environ Microbiol. 2012 Apr; 78(8): 3025-3027.

[0222] Field D, Connor PMC, Cotter PD, Hill C, Ross RP. 2008. The generation of nisin variants with enhanced activity against specific gram-positive pathogens. - PubMed - NCBI. Mol Microbiol 69:218-230.

[0223] Field D, Begley M, O'Connor PM, Daly KM, Hugenholtz F, Cotter PD, Hill C, Ross RP. 2012. Bioengineered Nisin A Derivatives with Enhanced Activity against Both Gram Positive and Gram Negative Pathogens. PLoS ONE 7:e46884

[0224] Fischetti VA. 2004. The use of phage lytic enzymes to control bacterial infections, p 321-334 In Kutter E, Sulakvelidze A, editors, (ed), Bacteriophages: biology and applications. CRC Press, Boca Raton, FL.

[0225] Fischetti VA. 2009. Bacteriophage Lysins: the Ultimate EnzybioticEnzybiotics. John Wiley & Sons, Inc., Hoboken, NJ, USA

[0226] Fogel, M. R.; Gray, G. M. Starch hydrolysis in man: an intraluminal process not requiring membrane digestion. J Appl Physiol 1973, 35 (2), 263-267.

[0227] Frese, S. A.; Hutkins, R. W.; Walter, J. Comparison of the Colonization Ability of Autochthonous and Allochthonous Strains of Lactobacilli in the Human Gastrointestinal Tract. Advances in Microbiology 2012, 02 (03), 399-409 DOI: 10.4236 / aim.2012.23051.

[0228] Gibson DG, Young L, Chuang R-Y, Venter JC, Hutchison CA, Smith HO. 2009. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Meth 6:343-345. Good L, Stach JE. Synthetic RNA silencing in bacteria - antimicrobial discovery and resistance breaking. Front Microbiol. 2011 Sep 12;2: 185.

[0229] Gomaa AA, Klumpe HE, Luo ML, Selle K, Barrangou R, Beisel CL. 2014. Programmable Removal of Bacterial Strains by Use of Genome-Targeting CRISPR-Cas Systems. mBio 5:e00928-13.

[0230] Green et al., Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press, 2012.

[0231] Guimaraes, V. D.; Gabriel, J. E.; Lefevre, F.; Cabanes, D.; Gruss, A.; Cossart, P.; Azevedo, V.; Langella, P. Internalin-expressing Lactococcus lactis is able to invade small intestine of guinea pigs and deliver DNA into mammalian epithelial cells. Microbes Infect 2005, 7 (5-6), 836-844 DOI: 10.1016 / j.micinf.2005.02.012.

[0232] Guimaraes V, Innocentin S, Chatel J-M, Lefevre F, Langella P, Azevedo V, 582 Miyoshi A. 2009. A new plasmid vector for DNA delivery using lactococci. Genet Vaccines Ther 7:4.

[0233] Jacobs C, Huang LJ, Bartowsky E, Normark S, Park JT. Bacterial cell wall recycling provides cytosolic muropeptides as effectors for beta-lactamase induction. EMBO J. 1994 Oct 3; 13(19):4684-94.

[0234] Jacobs C, Joris B, Jamin M, Klarsov K, Van Beeumen J, Mengin-Lecreulx D, van Heijenoort J, Park JT, Normark S, Frere JM. AmpD, essential for both beta-lactamase regulation and cell wall recycling, is a novel cytosolic N-acetylmuramyl-L-alanine amidase. Mol Microbiol. 1995 Feb; 15(3):553-9.

[0235] Kommineni S, Bretl D J, Lam V, Chakraborty R, Hayward M, Simpson P, Cao Y, Bousounis P, Kristich CJ, Salzman NH. 2015. Bacteriocin production augments niche competition by enterococci in the mammalian Gl tract. Nature 526:719-722.

[0236] Lecuit, M.; Ohayon, H.; Braun, L; Mengaud, J.; Cossart, P. Internalin of Listeria monocytogenes with an intact leucine-rich repeat region is sufficient to promote internalization. Infect Immun 1997, 65 (12), 5309-5319.

[0237] Liu, Y.; Fatheree, N. Y.; Mangalat, N.; Rhoads, J. M. Human-derived probiotic Lactobacillus reuteri strains differentially reduce intestinal inflammation. Am J Physiol Gastrointest Liver Physiol 2010, 299 (5), G1087— G1096 DOI: 10.1152 / ajpgi.00124.2010.

[0238] Lopez R, Garcia E, Garcia P, Garcia JL. The pneumococcal cell wall degrading enzymes: a modular design to create new lysins? Microb Drug Resist. 1997; 3(2): 199-211 .

[0239] Loessner MJ. Bacteriophage endolysins-current state of research and applications. Curr Opin Microbiol. 2005 Aug; 8(4):480-7.

[0240] Loessner MJ, Kramer K, Ebel F, Scherer S. C-terminal domains of Listeria monocytogenes bacteriophage murein hydrolases determine specific recognition and high-affinity binding to bacterial cell wall carbohydrates. Mol Microbiol. 2002 Apr; 44(2):335-49.

[0241] Morita H, Toh H, Fukuda S, Horikawa H, Oshima K, Suzuki T, Murakami M, Hisamatsu S, Kato Y, Takizawa T, Fukuoka H, Yoshimura T, Itoh K, O'Sullivan DJ, McKay LL, Ohno H, Kikuchi J, Masaoka T, Hattori M. Comparative genome analysis of Lactobacillus reuteri and Lactobacillus fermentum reveal a genomic island for reuterin and cobalamin production. DNA Res. 2008 Jun 30; 15(3): 151 -61.

[0242] Navarre WW, Ton-That H, Faull KF, Schneewind O. 1999. Multiple Enzymatic Activities of the Murein Hydrolase from Staphylococcal Phage cp11 . Journal of Biological Chemistry 274:15847-15856. Nelson D, Schuch R, Chahales P, Zhu S, Fischetti VA. 2006. PlyC: A multimeric bacteriophage lysin. Proc Natl Acad Sci USA 103: 10765-10770.

[0243] Nicoletti M, Bertani G. 1983. DNA fusion product of phage P2 with plasmid pBR322: A new phasmid. Mol Gen Genet 189:343-347.

[0244] Oh, P. L; Benson, A. K.; Peterson, D. A.; Patil, P. B.; Moriyama, E. N.; Roos, S.; Walter, J. Diversification of the gut symbiont Lactobacillus reuteri as a result of host-driven evolution. ISME J 2010, 4 (3), 377-387 DOI: 10.1038 / ismej.2009.123.

[0245] Oh JH, van Pijkeren JP. CRISPR-Cas9-assisted recombineering in Lactobacillus reuteri. Nucleic Acids Res. 2014;42(17):e131.

[0246] Paez-Espino D, Morovic W, Sun CL, Thomas BO, Ueda K-l, Stahl B, Barrangou R, Banfield JF. 2013. Strong bias in the bacterial CRISPR elements that confer immunity to phage. Nat Comms 4:1430-1430.

[0247] Palffy, R.; Gardlik, R.; Hodosy, J.; Behuliak, M.; Resko, P.; Radvansky, J.; Celec, P. Bacteria in gene therapy: bactofection versus alternative gene therapy. Gene Ther 2006, 13 (2), 101-105 DCI: 10.1038 / sj.gt.3302635.

[0248] Riboulet-Bisson E, Sturme MH J, Jeffery IB, O'Donnell MM, Neville BA, Forde BM, Claesson MJ, Harris H, Gardiner GE, Casey PG, Lawlor PG, O'Toole PW, Ross RP. 2012. Effect of Lactobacillus salivarius Bacteriocin Abp118 on the Mouse and Pig Intestinal Microbiota. PLoS ONE 7:e31113.

[0249] Riedel, C. U.; Monk, I. R.; Casey, P. G.; Morrissey, D.; O'Sullivan, G. C.; Tangney, M.; Hill, C.; Gahan, C. G. M. Improved luciferase tagging system for Listeria monocytogenes allows real-time monitoring in vivo and in vitro. Appl Environ Microbiol 2007, 73 (9), 3091-3094 DOM0.1128 / AEM.02940-06.

[0250] Robert S, Steidler L. 2014. Recombinant Lactococcus lactis can make the difference in antigen-specific immune tolerance induction, the Type 1 Diabetes case. Microb Cell Fact 13:S11.

[0251] Rocha EP, Danchin A, Viari A. Translation in Bacillus subtilis: roles and trends of initiation and termination, insights from a genome analysis. Nucleic Acids Res. 1999 Sep 1 ;27(17):3567-76.

[0252] Robinson MD, Oshiack A. A scaling normalization method for differential expression analysis of RNA-seq data. Genome Biol. 2010;11 (3):R25.

[0253] Schaefer L, Auchtung TA, Hermans KE, Whitehead D, Borhan B, Britton RA. 2010. The antimicrobial compound reuterin (3-hydroxypropionaldehyde) induces oxidative stress via interaction with thiol groups. Microbiology 156: 1589-1599.

[0254] Sheehan MM, Stanley E, Fitzgerald GF, van Sinderen D. 1999. Identification and characterization of a lysis module present in a large proportion of bacteriophages infecting Streptococcus thermophilus. Appl Environ Microbiol 65:569-577.

[0255] Shi, Y.; Yan, Y.; Ji, W.; Bin Du; Meng, X.; Wang, H.; Sun, J. Characterization and determination of holin protein of Streptococcus suis bacteriophage SMP in heterologous host. Virol J 2012, 9 (1), 70-70 DOI: 10.1186 / 1743-422X-9-70.

[0256] Steidler L, Hans W, Schotte L, Neirynck S, Obermeier F, Falk W, Fiers W, 574 Remaut E. 2000. Treatment of Murine Colitis by Lactococcus lactis Secreting Interleukin-10. Science 289:1352-1355. Spinier JK, Taweechotipatr M, Rognerud CL, Ou ON, Tumwasorn S, Versalovic J. 2008. Human-derived probiotic Lactobacillus reuteri demonstrate antimicrobial activities targeting diverse enteric bacterial pathogens. Anaerobe 14:166-171.

[0257] Sulakvelidze, Alexander; Alavidze, Zemphira; and J. Glenn Morris, Jr. Bacteriophage Therapy. Antimicrob Agents Chemother. 2001 , 45(3): 649-659).

[0258] Summers WC. Bacteriophage therapy. Annu Rev Microbiol. 2001 ; 55:437-51.

[0259] Sznol, M.; Lin, S. L; Bermudes, D.; Zheng, L.-M.; King, I. Use of preferentially replicating bacteria for the treatment of cancer. Journal of Clinical Investigation 2000, 105 (8), 1027-1030 DOI: 10.1172 / JCI9818.

[0260] Talarico TL, Casas IA, Chung TC, Dobrogosz WJ. 1988. Production and isolation of reuterin, a growth inhibitor produced by Lactobacillus reuteri. Antimicrob Agents Chemother 32:1854-1858.

[0261] Tannock, G. W.; Wilson, C. M.; Loach, D.; Cook, G. M.; Eason, J.; O'Toole, P. W.; Holtrop, G.; Lawley, B. Resource partitioning in relation to cohabitation of Lactobacillus species in the mouse forestomach. ISME J 2011 , 6 (5), 927-938 DOI: 10.1038 / ismej.2011 .161 .

[0262] Thomas, C. M.; Hong, T.; van Pijkeren, J.P.; Hemarajata, P.; Trinh, D. V.; Hu, W.; Britton, R. A.; Kalkum, M.; Versalovic, J. Histamine Derived from Probiotic Lactobacillus reuteri Suppresses TNF via Modulation of PKA and ERK Signaling. PLoS ONE 2012, 7 (2), e31951 DOI : 10.1371 / journal.pone.0037116.g006. van Pijkeren, J.P.; Morrissey, D.; Monk, I. R.; Cronin, M.; Rajendran, S.; O'Sullivan, G. C.; Gahan, C. G. M.; Tangney, M. A novel Listeria monocytogenes-based DNA delivery system for cancer gene therapy. Hum. Gene Ther. 2010, 21 (4), 405-416 DOI: 10.1089 / hum.2009.022. van Pijkeren JP, Britton RA. High efficiency recombineering in lactic acid bacteria. Nucleic Acids Res. 2012 May;40(10):e76. van Pijkeren J-P, Neoh KM, Sirias D, Findley AS, Britton RA. 2012. Exploring optimization parameters to increase ssDNA recombineering in Lactococcus lactis and Lactobacillus reuteri. Bioengineered 3:209-217. van Pijkeren, J.P.; Britton, R. A. Precision genome engineering in lactic acid bacteria. Microb Cell Fact 2014, 13 Suppl 1 , S10-S10 DOI: 10.1186 / 1475-2859-13-S1-S10

[0263] Walter J, Heng NO, Hammes WP, Loach DM, Tannock GW, Hertel C. Identification of Lactobacillus reuteri genes specifically induced in the mouse gastrointestinal tract. Appl Environ Microbiol. 2003 Apr;69(4):2044-51.

[0264] Wang IN, Smith DL, Young R. 2000. Holins: the protein clocks of bacteriophage infections. Annual Reviews in Microbiology

[0265] Wang Y, Zhu D, Ortiz-Velez LC, Perry JL, Pennington MW, Hyser JM, Britton RA, Beeton C. A bioengineered probiotic for the oral delivery of a peptide Kv1 .3 channel blocker to treat rheumatoid arthritis. Proc Natl Acad Sci U S A. 2023 Jan 10;120(2):e2211977120.

[0266] Wells M. et al. Lactococcus lactis: high-level expression of tetanus toxin fragment C and protection against lethal challenge. Mol. Microbiol., 8 (1993), pp. 1155-1162.

[0267] Zhang, S., Oh, J.-H., Alexander, L.M., Ozgam, M., and van Pijkeren, J.-P. (2018). d-Alanyl-d-Alanine Ligase as a Broad-Host-Range Counterselection Marker in Vancomycin-Resistant Lactic Acid Bacteria. J. Bacteriol. 200, e00607-17. Zhang Y, Eigenbrot C, Zhou L, Shia S, Li W, Quan C, Tom J, Moran P, Di Lello P, Skelton NJ, Kong-Beltran M, Peterson A, Kirchhofer D. Identification of a small peptide that inhibits PCSK9 protein binding to the low density lipoprotein receptor. J Biol Chem. 2014 Jan 10;289(2):942-55.

[0268] Zhou, Y.; Liang, Y.; Lynch, K. H.; Dennis, J. J.; Wishart, D. S. PHAST: A Fast Phage Search Tool. 2011, 39 (suppl), W347-W352 DOI: 10.1093 / nar / gkr485.

Claims

CLAIMSWhat is claimed is:1 . A recombinant nucleic acid comprising a sugar-inducible promoter operably linked to a heterologous nucleic acid sequence, wherein the sugar-inducible promoter comprises a sugar-inducible promoter sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to at least 100 contiguous bases, at least 125 contiguous bases, at least 150 contiguous bases, at least 175 contiguous bases, at least 200 contiguous bases, at least 225 contiguous bases, at least 250 contiguous bases, at least 300 contiguous bases, at least 325 contiguous bases, at least 350 contiguous bases, at least 375 contiguous bases, or the entirety of a sequence selected from the group consisting of SEQ ID NOS: 1-38.

2. The recombinant nucleic acid of claim 1 , wherein the sugar-inducible promoter sequence has at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOS:1-6.

3. The recombinant nucleic acid of claim 1 , wherein the sugar-inducible promoter sequence has at least 95%, at least 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOS: 1-6.

4. The recombinant nucleic acid of any prior claim, wherein the heterologous nucleic acid sequence is within at least 1 base, at least 2 bases, at least 3 bases, at least 4 bases, at least 5 bases, at least 6 bases, at least 7 bases, at least 8 bases, at least 9 bases, at least 10 bases, at least 25 bases, at least 50 bases, at least 75 bases, at least 100 bases, at least 125 bases, at least 150 bases, at least 175 bases, at least 200 bases, at least 225 bases, at least 250 bases, at least 275 bases, at least 300 bases, at least 325 bases, at least 350 bases, at least 375 bases, at least 400 bases, at least 425 bases, at least 450 bases, at least 475 bases, or at least 500 bases of the sugar-inducible promoter sequence.

5. The recombinant nucleic acid of any prior claim, wherein the heterologous nucleic acid sequence comprises a transcription sequence operably linked to the sugar-inducible promoter.

6. The recombinant nucleic acid of any prior claim, wherein the heterologous nucleic acid sequence comprises a template sequence for a biologic operably linked to the sugar-inducible promoter.

7. The recombinant nucleic acid of any prior claim, wherein the heterologous nucleic acid sequence comprises a template sequence for a therapeutic biologic operably linked to the sugar-inducible promoter.

8. The recombinant nucleic acid of any one of claims 1-5, wherein the recombinant nucleic acid comprises a recombinant nucleic acid cassette comprising: recombinase recognition sites; andinternal cassette elements disposed between the recombinase recognition sites, wherein the internal cassette elements comprise a recombinase promoter operably linked to a recombinase coding sequence, wherein the recombinase promoter is the sugar-inducible promoter and the recombinase coding sequence is comprised by the heterologous nucleic acid sequence.

9. The recombinant nucleic acid of claim 8, wherein the recombinase coding sequence encodes a recombinase selected from the group consisting of a Cre recombinase, a FLP recombinase, a gamma-delta recombinase, a Tn3 resolvase, a cpC31 integrase, a Bxb1 integrase, and an R4 integrase.

10. The recombinant nucleic acid of any one of claims 8-9, wherein the recombinase coding sequence encodes a Cre recombinase.11 . The recombinant nucleic acid of any one of claims 9-10, wherein the Cre recombinase comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% to SEQ ID NC:40.

12. The recombinant nucleic acid of any one of claims 8-11 , wherein the internal cassette elements further comprise a selection marker comprising a selection-marker promoter operably linked to a selection-marker coding sequence.

13. The recombinant nucleic acid of claim 12, wherein the selection-marker coding sequence encodes a sucrose transporter, a sucrose phosphorylase, or a sucrose transporter and a sucrose phosphorylase.

14. The recombinant nucleic acid of any one of claims 12-13, wherein the selection-marker promoter comprises a selection-marker promoter sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO:5.

15. The recombinant nucleic acid of any one of claims 8-14, wherein the internal cassette elements further comprise a biologic gene configured to express a biologic.

16. The recombinant nucleic acid of claim 15, wherein the biologic comprises a therapeutic biologic.

17. The recombinant nucleic acid of any one of claims 8-16, wherein the internal cassette elements further comprise an adhesin gene configured to express an adhesin comprising an adhesin protein sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOS:48, 50, 52, 54, 56, 58, 60, 62, 64, 66, and 68.

18. The recombinant nucleic acid of any one of claims 8-17, wherein the internal cassette elements further comprise an antirepressor gene comprising an antirepressor coding sequence encoding an antirepressor proteincomprising an antirepressor protein sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NO:70.

19. The recombinant nucleic acid of claim 18, wherein the antirepressor gene comprises an antirepressor promoter operably linked to the antirepressor coding sequence.

20. The recombinant nucleic acid of claim 19, wherein the antirepressor promoter is the recombinase promoter.

21. The recombinant nucleic acid of claim 19, wherein the antirepressor promoter is not the recombinase promoter.

22. The recombinant nucleic acid of claim 21, wherein the antirepressor promoter comprises a promoter sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to the recombinase promoter sequence.

23. The recombinant nucleic acid of any one of claims 21-22, wherein the antirepressor promoter is a second sugar-inducible promoter inducible by at least one sugar that induces the recombinase promoter.

24. The recombinant nucleic acid of claim 23, wherein the second sugar-inducible promoter has a second sugar- inducible promoter sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to at least 100 contiguous bases, at least 125 contiguous bases, at least 150 contiguous bases, at least 175 contiguous bases, at least 200 contiguous bases, at least 225 contiguous bases, at least 250 contiguous bases, at least 300 contiguous bases, at least 325 contiguous bases, at least 350 contiguous bases, at least 375 contiguous bases, or the entirety of a sequence selected from the group consisting of SEQ ID NOS:1-38.

25. The recombinant nucleic acid of any one of claims 8-24, wherein the internal cassette elements further comprise an essential gene.

26. The recombinant nucleic acid of any one of claims 1-4, wherein the heterologous nucleic acid sequence comprises an insertion sequence.

27. A recombinant microorganism comprising the recombinant nucleic acid of any prior claim.

28. The recombinant microorganism of claim 27, wherein the recombinant microorganism is a bacterium.

29. The recombinant microorganism of any one of claims 27-28, wherein the recombinant microorganism is a member of lactic acid bacteria.

30. The recombinant microorganism of any one of claims 27-29, wherein the recombinant microorganism is a member of Limosilactobacillus.

31. The recombinant microorganism of any one of claims 27-30, wherein the recombinant microorganism is Limosilactobacillus reuteri.

32. A method of producing a biologic with the recombinant nucleic acid of any one of claims 6-7, the method comprising contacting the sugar-inducible promoter with an amount of an inducing sugar effective to induce expression of the biologic.

33. The method of claim 32, wherein the recombinant nucleic acid is comprised by the recombinant microorganism of any one of claims 27-31 , wherein the method comprises contacting the recombinant microorganism with an amount of the inducing sugar effective to induce expression of the biologic.

34. A method of excising the internal cassette elements from the recombinant nucleic acid comprising the recombinant nucleic acid cassette of any one of claims 8-25, the method comprising contacting the recombinase promoter with an amount of an inducing sugar effective to express the recombinase in an amount effective to excise the internal cassette elements from the recombinant nucleic acid.

35. The method of claim 34, wherein the recombinant nucleic acid is incorporated in a genome of the recombinant microorganism of any one of claims 27-31 , wherein the method comprises contacting the recombinant microorganism with an amount of the inducing sugar effective to express the recombinase in an amount effective to excise the internal cassette elements from the recombinant nucleic acid, wherein the excising comprises excising the internal cassette elements from the genome of the microorganism.

36. The method of any one of claims 32-35, wherein the inducing sugar is selected from the group consisting of glucose, maltose, raffinose, sucrose, arabinose, galactose, lactose, melibiose, and ribose.

37. The method of any one of claims 32-36, wherein: the inducing sugar comprises one or more of glucose, raffinose, arabinose, galactose, lactose, melibiose, and ribose; and the sugar-inducible promoter sequence has at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to at least 100 contiguous bases, at least 125 contiguous bases, at least 150 contiguous bases, at least 175 contiguous bases, at least 200 contiguous bases, at least 225 contiguous bases, at least 250 contiguous bases, at least 300 contiguous bases, at least 325 contiguous bases, at least 350 contiguous bases, at least 375 contiguous bases, or the entirety of any one of SEQ ID NOS: 1-4.

38. The method of any one of claims 32-36, wherein:the inducing sugar comprises one or more of sucrose and raffinose; and the sugar-inducible promoter sequence has at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to at least 100 contiguous bases, at least 125 contiguous bases, at least 150 contiguous bases, at least 175 contiguous bases, at least 200 contiguous bases, or the entirety of SEQ ID NO:5.

39. The method of any one of claims 32-36, wherein: the inducing sugar comprises maltose; and the sugar-inducible promoter sequence has at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to at least 100 contiguous bases, at least 125 contiguous bases, at least 150 contiguous bases, at least 175 contiguous bases, at least 200 contiguous bases, at least 225 contiguous bases, at least 250 contiguous bases, at least 300 contiguous bases, or the entirety of SEQ ID NO:6.

40. The method of any one of claims 33 and 35-39, comprising contacting the recombinant microorganism with the inducing sugar at a site on or in a subject.

41. The method of claim 40, wherein the method comprises introducing the recombinant microorganism to the site of the subject.

42. The method of any one of claims 40-41, wherein the method comprises introducing the inducing sugar or a precursor thereof to the site of the subject.

43. The method of any one of claims 40-42, wherein the site comprises a gastrointestinal tract of the subject.

44. The method of claim 43, wherein the method comprises orally administering the recombinant microorganism to the gastrointestinal tract of the subject.

45. The method of any one of claims 43-44, wherein the method comprises orally administering the inducing sugar or a precursor thereof to the gastrointestinal tract of the subject.

Citation Information

Patent Citations

  • Microorganisms and methods for producing biologics and introducing biologics to sites

    US10898552B2

  • Microbes with reduced adhesion characteristics

    US20230381253A1

  • Methods for systemically delivering polypeptides and microorganisms therefor

    US10376563B1

  • Microorganisms and methods for producing biologics and introducing biologics to sites

    US10463719B1

  • Recombination system

    US20150037892A1