Compositions and methods for treating hepatic diseases by inhibiting EFHD1
SiRNA molecules targeting EFHD1 gene sequences address the limitations of current MASH therapies by reducing liver injury and cardiovascular risk, effectively treating metabolic liver diseases and other conditions by inhibiting mitochondrial fission.
Patent Information
- Application Number
- PCT/US2025/055547
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-08-12
- Filing Date
- 2025-11-14
- Publication Date
- 2026-05-21
AI Technical Summary
Current therapies for metabolic dysfunction-associated steatotic liver disease (MASH) and nonalcoholic steatohepatitis are limited, and inhibiting hepatic lipid metabolism to treat these conditions increases cardiovascular risk.
Compositions comprising siRNA molecules that specifically target EFHD1 gene sequences, reducing EFHD1 expression and Ca2+-induced mitochondrial fission, thereby treating metabolic liver diseases, kidney diseases, Alzheimer's disease, dementia, breast cancer, and inflammation by administering therapeutically effective amounts of siRNA molecules with a 20- to 25-nucleotide blunt-ended double-stranded structure.
The siRNA molecules effectively reduce liver injury, inflammation, and fibrosis, increase mitochondrial size, and mitigate cardiovascular risks associated with MASH, while also treating kidney diseases and cancers by inhibiting EFHD1 expression and mitochondrial fission.
Smart Images

Figure IMGF000015_0001 
Figure IMGF000018_0001 
Figure IMGF000021_0001
Abstract
Description
[0001] ATTORNEY DOCKET NO 21101.0493P1
[0002] COMPOSITIONS AND METHODS FOR TREATING HEPATIC DISEASES BY INHIBITING EFHD1
[0003] CROSS REFERENCE TO RELATED APPLICATIONS
[0004] This application claims the benefit of the filing date of U. S. Provisional Application No. 63 / 720,527, filed on November 14, 2024; and U. S. Provisional Application 63 / 862,425, filed on August 12, 2025. The content of these earlier filed applications is hereby incorporated by reference in its entirety.
[0005] STATEMENT REGARDING FEDERALLY FUNDED RESEARCH
[0006] This invention was made with government support under RO1 K141142 aw arded by the National Institutes of Health. The government has certain rights in the invention.
[0007] REFERENCE TO A SEQUENCE LISTING
[0008] The present application contains a Sequence Listing that is submitted concurrent with the filing of this application in XML format, containing the file name “37759_0493Pl_SL.xml,” created on November 12, 2025, and having a size of 225,280 bytes. The Sequence Listing is hereby incorporated by reference pursuant into the present application in its entirety.
[0009] BACKGROUND
[0010] The growing prevalence of metabolic dysfunction-associated steatotic liver disease and steatohepatitis (referred to hereafter as MASH) is an area of unmet clinical need (Zhang. X., et al. (2025). JAMA Netw Open 8, e2516367). One approach for therapeutic and mechanistic insight has been to seek genes altering MASH risk, as liver injury has a strong genetic basis (Sookoian, S., et al. (2020). Hepatology 72, 330-346). Multiple genome-wide association studies (GW AS) have either assessed liver fat content by imaging or histology, or measured serum liver enzymes, which are correlated with the susceptibility to liver injury. Both types of analyses have repeatedly identified genes important for hepatic lipid metabolism, including PNPLA3, HSD17B13, and TM6SF2. However, inhibiting hepatic lipid metabolism has been hampered by difficulties, partly because the protection from MASH comes at the cost of increased cardiovascular risk as lipids redistribute into the circulation (Simons, N., et al. (2017). Gastroenterology 152, 912-913; and Sparse, T., et al. (2008). Diabetologia57, 70-75).
[0011] Diseases of the liver are responsible for 3.5% of deaths worldwide, and over 40,000 deaths within the United States (Asrani, S. K., et al, J Hepatol. 2019. 70(1): p. 151-171; and Murphy, S. L., et al, Natl Vital Stat Rep, 2021. 69(13): p. 1-83). The prevalence of liver ATTORNEY DOCKET NO 21101.0493P1
[0012] disease is also growing rapidly, driven predominantly by increasing obesity leading to nonalcoholic fatty liver disease and nonalcoholic steatohepatitis (referred to as metabolic-associated fatty liver disease (MAFLD)) (Younossi, Z. M., et al, Clin Gastroenterol Hepatol, 2011. 9(6): p. 524-530. el; quiz e60; and Eslam, M., et al., Gastroenterology, 2020. 158(7): p.
[0013] 1999-2014). Moreover, cardiovascular disease risk is worsened in the presence of MAFLD, contributing to the morbidity and mortality associated with this condition6. However, limited therapies exits for treating liver diseases, placing these as an area of unmet clinical need.
[0014] SUMMARY OF THE INVENTION
[0015] Disclosed herein are compositions comprising a nucleic acid sequence or molecule wherein the nucleic acid comprises or consists of a sequence having at least 90% identity to the sequence set forth in: UUCAGCUCCAUCAGGUCGAUG (SEQ ID NO: 2), UUCAGCUCCAUCAGGUCGAUGAA (SEQ ID NO: 4), UUCUCCAUCAUCAGCUUCAGC (SEQ ID NO: 6), UUCUCCAUCAUCAGCUUCAGCUC (SEQ ID NO: 8), UUCAGGCCCAGGUGGGUCUGG (SEQ ID NO: 10), UUCAGGCCCAGGUGGGUCUGGUG (SEQ ID NO: 12), ACCUUGGCUUCAAAGAAGUUC (SEQ ID NO: 14), ACCUUGGCUUCAAAGAAGUUCUU (SEQ ID NO: 16).
[0016] AAACUUACUGGCCGAUGACAA (SEQ ID NO: 18), AAACUUACUGGCCGAUGACAAGG (SEQ ID NO: 20), GAACAUGCUCUCCAGGUCCUU (SEQ ID NO: 22), GAACAUGCUCUCCAGGUCCUUGA (SEQ ID NO: 24).
[0017] ACAGUUUGAACAUGCUCUCCA (SEQ ID NO: 26), ACAGUUUGAACAUGCUCUCCAGG (SEQ ID NO: 28), UCUGCUUCAAACUUACUGGCC (SEQ ID NO: 30), UCUGCUUCAAACUUACUGGCCGA (SEQ ID NO: 32), GCUCAGCUUUCAACUCUGCUU (SEQ ID NO: 34), GCUCAGCUUUCAACUCUGCUCCA (SEQ ID NO: 36), or GUUGGCCUUGAGUUUCUGGAA (SEQ ID NO: 38).
[0018] Disclosed herein are siRNA molecules wherein the siRNA molecule specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242 and reduces expression of EF-hand domain-containing protein 1 (EFHD1) gene in a cell, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double- ATTORNEY DOCKET NO 21101.0493P1
[0019] stranded structure, wherein the siRNA molecule comprises at least one sequence having at least 90% sequence identity selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236.
[0020] Disclosed herein are methods of treating metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis, the methods comprising: administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a composition comprising the siRNA molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236, and wherein the therapeutically effective amount reduces Ca2+-induced mitochondrial fission.
[0021] Disclosed herein are methods of inhibiting expression of a EFHD1 polynucleotide in a subject, the methods comprising administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a composition comprising the siRNA molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 25- to 28-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236.
[0022] Disclosed herein are methods of reducing Ca2+-induced mitochondrial fission in a subject, the methods comprising administering to a subject with Alzheimer’s disease or dementia a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a composition comprising the siRNA molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. ATTORNEY DOCKET NO 21101.0493P1
[0023] Disclosed herein are methods of treating acute kidney disease, chronic kidney disease, diabetic kidney disease, or hypertensive kidney disease, the methods comprising: administering to a subject with acute kidney disease, chronic kidney disease, diabetic kidney disease, or hypertensive kidney disease a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a composition comprising the siRNA molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236, and wherein the therapeutically effective amount reduces Ca2+-induced mitochondrial fission.
[0024] Disclosed herein are methods of treating breast cancer, the methods comprising: administering to a subject with breast cancer a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a composition comprising the siRNA molecule, a pharmaceutical composition compnsing the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236, and wherein the therapeutically effective amount reduces Ca2+-induced mitochondrial fission.
[0025] Disclosed herein are methods of suppressing expression of a EFHD1 polynucleotide in a subject, the methods comprising administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended doublestranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236.
[0026] Disclosed herein are methods of reducing or decreasing inflammation in a subject, the methods comprising administering to a subject with Alzheimer's disease or dementia a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a composition comprising the siRNA molecule, a pharmaceutical composition comprising the ATTORNEY DOCKET NO 21101.0493P1
[0027] siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236.
[0028] Disclosed herein are methods of reducing fibrosis in a subject, the methods comprising administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a composition comprising the siRNA molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236.
[0029] Disclosed herein are methods of reducing hepatitis in a subject, the methods comprising administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a composition comprising the siRNA molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236.
[0030] Disclosed herein are methods of reducing hepatocyte injury in a subject, the methods comprising administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a composition comprising the siRNA molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA ATTORNEY DOCKET NO 21101.0493P1
[0031] molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236.
[0032] Disclosed herein are methods of increasing mitochondrial size within cells in a subject, the method comprising administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a composition comprising the siRNA molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236.
[0033] Disclosed herein are methods of inhibiting expression of a EFHD1 polynucleotide, the methods comprising contacting a cell with a small interfering RNA (siRNA) molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236, wherein the siRNA molecule reduces Ca2+-induced mitochondrial fission.
[0034] Disclosed herein are methods of suppressing expression of a EFHD1 polynucleotide, the methods comprising contacting a cell with a small interfering RNA (siRNA) molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236, wherein the siRNA molecule reduces Ca2+-induced mitochondrial fission.
[0035] Disclosed herein are methods of reducing Ca2+-induced mitochondrial fission, the methods comprising contacting a cell with a small interfering RNA (siRNA) molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236, wherein the siRNA molecule reduces Ca2+-induced mitochondrial fission. ATTORNEY DOCKET NO 21101.0493P1
[0036] Disclosed herein are methods of reducing or decreasing inflammation, the methods comprising contacting a cell with a small interfering RNA (siRNA) molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236, wherein the siRNA molecule reduces Ca2+-induced mitochondrial fission.
[0037] Disclosed herein are methods of reducing hepatitis, the methods comprising contacting a cell with a small interfering RNA (siRNA) molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended doublestranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236, wherein the siRNA molecule reduces Ca2+-induced mitochondrial fission.
[0038] Disclosed herein are methods of reducing fibrosis, the methods comprising contacting a cell with a small interfering RNA (siRNA) molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. wherein the siRNA molecule reduces Ca2+-induced mitochondrial fission.
[0039] Disclosed herein are methods of reducing hepatocyte injury, the methods comprising contacting a cell with a small interfering RNA (siRNA) molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended doublestranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236, wherein the siRNA molecule reduces Ca2+-induced mitochondrial fission.
[0040] Disclosed herein are methods of increasing mitochondrial size within cells, the methods comprising contacting a cell with a small interfering RNA (siRNA) molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one ATTORNEY DOCKET NO 21101.0493P1
[0041] sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236, wherein the siRNA molecule reduces Ca2+-induced mitochondrial fission.
[0042] DESCRIPTION OF THE DRAWINGS
[0043] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of the specification embodiments presented herein.
[0044] FIGS. 1A-W show loss of EFHD1 prevents hepatocyte injury7in MASH. FIG. 1A shows the summary of human liver single cell RNA-seq studies. FIG. IB show representative immunohistochemistry showing EFHD1 is present and enriched around portal tracts in healthy human liver (n=8). FIGS. 1C and ID show Western blot (FIG. 1C) and summary band quantification (FIG. ID) depicting elevated EFHD1 in human MASH livers (n=3). FIGS. IE and IF show Western blot and band analysis for MASH diet-fed mice (n=8). FIG.
[0045] 1G depict immunohistochemistry showing EFHD1 (green) co-expression with the hepatocyte marker, albumin (magenta) in livers from WT and EftidT' mice. In merge, nuclei are DAPI-stained. FIG. 1H show that EFHD1 is absent in Eftidl^' livers on Western blot (n=3). FIGS.
[0046] 1I-W show assays performed on mice follow ing 28 weeks of MASH diet. FIG. 1 shows serum triglyceride levels. WT: males n=6, females n=5; Eftidl'1'-. males n=8, females n=5. FIG. 1J shows MASH activity score. FIG. IK shows hepatocyte ballooning score. FIGS. IL and IM show the histological assessment of liver fat. FIG. IN and 10 shows the direct measurement of lipid droplet size (FIG. IN) and count (FIG. 10). FIGS. IP and IQ show serum AST (FIG. IP) and ALT (FIG. IQ) measurements. FIG. 1R shows representative liver micrographs following hematoxylin and eosin staining. Arrows indicate leukocyte clusters. FIG. IS shows the histological assessment of inflammation. FIG. IT shows the direct assessment of leukocyte clusters from liver micrographs. FIG. 1U shows the representative liver micrographs following Masson’s tri chrome staining, with more fibrosis (blue staining) noted in WT sections. FIG. IV shows the histological assessment of fibrosis. FIG. 1W shows the direct assessment of fibrotic area from liver micrographs. The clinical histological scoring in FIGS. 1J, IK, IL, IM, IS, and IV was assessed in blinded fashion by liver pathologist. For FIGS. 1J-Q, IS, and IV, WT: males n=7, females n=7; Eftidl'^-. males n=6, females n=7. For FIGS. IN and 10, WT: n=21; Eftidl^-. n=18. For FIGS. IT and 1W, WT: males n=21, females n=21; Eftidl''''. males n=21. females n=21. Bar: mean ± SEM. ATTORNEY DOCKET NO 21101.0493P1
[0047] FIGS. 2A-L show that EFHD1 is important for Ca2+-induced mitochondrial fission. FIG. 2A shows representative images of hepatocytes isolated from WT (top) and Efhdl'1' (bottom) mice stained with 200 nM MitoTracker Orange. Cells are imaged either before (Control) or 5 minutes after treatment with 1 mM ATP (+ATP). Boxed insets are shown at higher magnification to the right. FIG. 2B shows automated iLastik analysis of hepatocyte mitochondrial size before and after ATP treatment. Data is displayed as a bar chart (top) to show mean effects and as a violin plot (bottom) to show the full distribution. WT Ctrl n=10008 mitochondria from N=6 mice; WT ATP N=5, n=7740; Efhdl'1' Ctrl N=7, n=6577; Efhdl'1' ATP N=5, n=4160. FIG. 2C shows mitochondrial size as in (FIG. 2B) but for hepatocytes after 28 weeks of MASH diet. WT n=7071 mitochondria from N=3 mice, Efhdl’ ’ Ctrl: N=3, n=4642. FIG. 2D shows representative transmission electron micrographs of WT and Efhdl'1' mouse livers either fed a CHOW or MASH diet for 28 weeks. FIGS. 2E and 2F show hepatocyte mitochondrial length measured from EM images taken from the livers mice fed a normal chow (FIG. 2E) or MASH diet (FIG. 2F). Chow: WT n=347 mitochondria from N=3 mice; Efhdl''- N=3, n=273. MASH: WT N=3, n=274; Efhdl-'" =3, n=294. FIG. 2G as in FIG. 2A, but for WT or EFHD1'’ HepG2 cells. FIG. 2H as in FIG. 2B. but for HepG2 cells. WT Ctrl n=1226 mitochondria from N=36 cells; WT ATP N=27, n=1301; Efhdl-1' Ctrl N=25, n=972; Efhdl' ' ATP N=27, n=1068. FIG. 21 shows the comparison of mean mitochondrial size in WT, EFHD1 '', and EFHD1-HA (rescue) HepG2 cells. WT Ctrl: n=1226 mitochondria fromN=36 cells; Efhdl-'’ Ctrl: N=25. n=972; EFHD1-HA: N=41, n=530. FIGS. 2J and 2K show the direct measurement of fission events after addition of vehicle (PBS, Ctrl) or ImM ATP in hepatocytes (FIG. 2J) or HepG2 cells (FIG. 2K) with MitoTracker-labeled mitochondria. Hepatocytes: WT Ctrl n=15; WT ATP n=9; Efhdl'1’ Ctrl n=19; Efhdl-- ATP n=12. HepG2: WT Ctrl n=22; WT ATP n=29; EFHD1'1' Ctrl n=19; EFHD1' - ATP n=20. FIGS. 2L and 2M show representative images (FIG. 2L) and summary of mitochondrial length FIG. 2 (M) of MitoTracker-labeled hepatocytes. Cells were imaged for 6 minutes, and treated sequentially with digitonin and a Ca2+bolus. Boxed insets in (FIG.
[0048] 2L) are shown at higher magnification on top of each series. WT n=14; Efhdl’1’ n=9. Bar: mean ± SEM.
[0049] FIGS. 3A-J show' that EFHD1 triggers Ca2+-dependent actin rearrangements driving mitochondrial fission. FIG. 3 A show s a diagram depicting DRP1 recruitment and actin rearrangement during mitochondrial fission. FIG. 3B shows a Western blot of liver proteins important for mitochondrial fission and fusion. Band analysis is shown alongside (n=6 per genotype). Mice were fed normal chow. FIG. 3C shows co-immunoprecipitation of HepG2 ATTORNEY DOCKET NO 21101.0493P1
[0050] cells, either untransfected (WT) or transfected with EFHD1-HA and OMP25-GFP-HA (outer membrane protein). EFHD1-HA co-immunoprecipitates with FIS1 and P-actin.
[0051] Representative of 4 experiments. FIG. 3D shows three representative images showing coexpression of EFHD1 (green), INF2 (magenta) and mitochondria (cyan) in WT HepG2 cells. Areas of EFHD1 and INF2 overlap are white in the merged image. FIG. 3E shows that AlphaFold3 predicts EFHDE -actin interaction with high confidence (ipTM > 0.8). EFHD1 linear domain structure is shown above. ATP and Ca2+are shown within the EFHD1 EF hands and actin nucleotide binding pocket, respectively. FIG. 3F shows representative images of SiR- Actin stained hepatocytes. Arrows indicate stress fibers in Efhdl'!' cell. FIG. 3G depicts exemplar transmission electron micrographs showing ERMCS following either a normal chow or MASH diet for 28 weeks. Plain images are shown next to images where the OMM (yellow) and ER membrane (magenta) at ERMCS have been highlighted. FIG. 3H show s a comparison of ER-mitochondrial distance whether in zones of close apposition (ERMCS, <30 nm, left) or any close association (<150 nm) measured from electron micrographs as in (FIG. 31). N=3 male mice for each condition where n=135 micrographs (WT CHOW); n=150 micrographs (Eftidl'1' CHOW); n=90 micrographs (WT GAN); n=92 micrographs Eftidl'1' GAN). FIGS. 31 and 3J shows representative images (FIG. 31) and quantification (FIG. 3J) or actin rearrangements on ionomycin stimulation visualized in hepatocytes isolated from chow-fed mice. The cells were stained with MitoTracker (cyan) and SiR-actin (yellow). Cells were treated with 1 pM ionomycin at t=0 and imaged for 4 minutes. The SiR-actin signal at the nucleus representing INF2-driven actin localization was measured every 2 seconds. WT: N=3 mice and n=ll cells. Eftidl^': N=3 mice and n=8 cells. Bars are mean ± SEM.
[0052] FIGS. 4A-0 shows that the loss of EFHD1 protects hepatocyte mitochondria without a direct effect on mitochondrial Ca2+uptake. FIGS. 4A and 4B show Seahorse assay of oxygen consumption rates (OCR) with glycolytic (FIG. 4A) or fatty acid (FIG. 4B) substrates in isolated hepatocytes. WT: N=3 male mice; Eftidl'1’-. N=3 male mice with n=8 replicates for each mouse. Left, line graph showing the mean ± SEM for replicates. Right, bar graph comparing respiratory parameters as mean ± SEM for replicates. Oligo, oligomycin. FCCP, carbonyl cyanide-p-trifluoromethoxy-phenylhydrazone. AA, antimycin A. FIG. 4C shows mitochondrial ROS levels in isolated hepatocytes measured using MitoSOX. WT: N=8 male mice (n=785 cells); Eftidl'1'-. N=6 male mice (n=785 cells). FIG. 4D shows mitochondrial Ca2+levels in isolated hepatocytes measured using X-rhod-1. WT: N=8 male mice (n=500 cells); Eftidl'1' N=6 male mice (n=470 cells). FIG. 4E shows mitochondrial membrane ATTORNEY DOCKET NO 21101.0493P1
[0053] potential in isolated hepatocytes measured using TMRM. WT: N=8 male mice (n=188 cells); Eftidr'-. N=6 male mice (n=191 cells). FIGS. 4F and 4G show exemplar (FIG. 4F) and summary (FIG. 4G) of Ca2+retention capacity (CRC) assay performed on purified liver mitochondria. Permeability transition visible as a sudden increase in TMRM signal. 5 pM Ca2+per bolus. CSA, mitochondrial permeability transition inhibitor, cyclosporin A (IpM). WT: n=6; Eftidr''-. n=8. FIGS. 4H and 41 show the Western blot (FIG. 4H) and band quantification (FIG. 41) analysis of liver mitochondrial Ca2+homeostasis proteins MCU: mitochondrial Ca2+uniporter; MICU1: mitochondrial calcium uptake 1; TOMM20: translocase of outer mitochondrial membrane 20; PPIF: peptidylprolyl isomerase F; VDAC: voltage-dependent anion channel. TOMM20 is same as in FIG. 3A. MCU: N=7 WT and N=5 Eftidr'' mice; MICU1: N=9 WT and N=5 Eftidr'- mice; TOMM20: N=7 WT and N=5 EfhdE ■ mice; PPIF: N=5 WT and N=5 Eftidr'' mice; VDAC: N=7 WT and N=7 Eftdl'1- mice. FIG.
[0054] 4J shows isolated hepatocytes stained with cytoplasmic Ca2+sensor Cal-520 (yellow, top) and mitochondrial Ca2+sensor X-rhod-1 (magenta, bottom). FIG. 4K shows exemplar cytoplasmic (top, Cal-520) and mitochondrial (bottom, X-rhod-1) Ca2+transients from isolated hepatocytes following treatment with 1 mM ATP. FIG. 4L shows Ca2+uptake rate summaiy calculated from traces as in (FIG. 4K) (WT n=7; Eftidr'- n=8). FIGS. 4M and 4N show exemplar (FIG. 4M) and summary' (FIG. 4N) of Ca2+uptake in isolated liver mitochondria measured via a decline in extramitochondrial Ca2+(1 pM Oregon Green BAPTA-6F) following a 10 pM Ca2+bolus (WT n=6. Eftidr'- n=8). FIGS. 40 and 4P show exemplar (FIG. 40) and summary (FIG. 4P) of whole-mitoplast analysis of mitochondrial Ca2+currents. FIG. 40, top, shows the voltage ramp protocol, and bottom, shows exemplar Ca2+currents from isolated liver mitoplasts. The assays in this figure were performed on normal chow-fed mice. Bars are mean ± SEM.
[0055] FIGS. 5A-L show transcriptomic and proteomic analysis of EFHD1 ablation. FIGS.
[0056] 5A and 5B show that selected hallmark pathw ays differentially regulated in whole liver RNA-seq of Eftidl'7' versus WT mice fed either (FIG. 5A) normal chow or (FIG. 5B) MASH diet. FDR, false discovery rate. FIGS. 5C-5E show that selected REACTOME pathways are differentially regulated in whole liver proteomics of (FIG. 5C) Eftidr'' versus WT mice fed normal chow, (FIG. 5D) WT mice fed normal chow or MASH diet, or (FIG. 5E) Eftidr'' versus WT mice fed MASH diet. FIGS. 5F-5H show heat maps of selected proteins from each indicated REACTOME pathway for (FIG. 5F) Eftidr7versus WT mice fed normal chow, (FIG. 5G) WT mice fed normal chow or MASH diet, or (FIG. 5H) Eftidl '- versus WT mice fed MASH diet. FIGS. 5I-5L show fold change for WT MASH versus WT normal chow ATTORNEY DOCKET NO 21101.0493P1
[0057] (x axis) graphed against the fold change for Efhdl'^ MASH versus WT MASH (y axis) for parental REACTOME pathways (FIG. 51), fat metabolism pathways (FIG. 5J), immune system pathways (FIG. 5K) and translation pathways (FIG. 5L) extracted from proteomic data. The general trend is for changes in MASH (relative to normal chow) to be reversed in Efl'id / ', visible as a negative slope. For (FIG. 5K), increases in immune pathway during MASH are decreased in Efhdl'^. whereas for (FIG. 5L) decreases in translation during MASH are increased inE' / h / '. RNA-seq, chow: WT n=5. EJhd 'n=5. MASH: WT n=4. Efhdf' n=5. Proteomics, chow: WT n=5, Efhdl'f' n=5. MASH: WT n=5, Ejhd / 'n=5.
[0058] FIGS. 6A-Q show that pathological mt-dsRNA release triggers a PKR-dependent integrated stress response in MASH. FIGS. 6A and 6B show Western blot (FIG. 6A) and band quantification (FIG. 6B) showing expression of ISR-associated proteins in the livers of WT mice fed normal chow or a 28-week MASH diet. EIF2a: Eukaryotic translation initiation factor 2A; p-EIF2a: Phosphorylated EIF2a; PKR: Protein kinase R; p-PKR: Phosphorylated PKR; PERK: protein kinase R (PKR)-like endoplasmic reticulum kinase / Eukary otic translation initiation factor 2-alpha kinase 3 (EIF2AK3); p-PERK: Phosphory lated PERK. Chow n=6, MASH n=5. FIGS. 6C and 6D depict Western blot (FIG. 6C) and band quantification (FIG. 6D) showing expression of ISR-associated proteins in the livers of WT or Efhdl / _mice fed a MASH diet. WT n=7, Efhdl'^ n=7. FIGS. 6E and 6F show representative images (FIG. 6E) and quantification summary (FIG. 6F) of dsRNA staining in human liver sections (Stage 0, 1. 2-3 n=6, Stage 4 n=5). FIG. 6G show representative images showing dsRNA and mitochondrial staining in isolated mouse hepatocytes. FIG. 6H show representative high-contrast images stained for PKR and dsRNA in sections of human livers. Arrowheads show PKR staining in dense non-hepatocyte nuclei, while arrows show dsRNA-and PKR-stained cytoplasmic signal. FIG. 61 show representative images stained for dsRNA and PKR in isolated mouse hepatocytes. FIGS. 6J-6M show quantitative RT-PCR following immunoprecipitation of dsRNA (FIG. 6J, FIG. 6K) or PKR (FIG. 6L, FIG. 6M) from isolated mouse hepatocytes. dsRNA: WT chow n=8; WT MASH n 6; Eftidl^ MASH n=8. PKR WT chow n=5; WT MASH n=5; Ejhdl'' MASH n=7. FIG. 6N shows representative images of isolated hepatocytes from MASH diet-fed mice (FIG. 6N) showing that mt-dsRNA, DRP1, and mitochondria are in close proximity. Because less dsRNA was evident in EfhdT'' hepatocytes, WT and Eftid ' images were obtained with different acquisition settings to maximize dsRNA signal. FIG. 60 shows quantification of average dsRNA-DRPl distance per hepatocyte (WT n=49, Efhdl n=19. N=3 mice per condition). FIG. 6P and FIG. 6Q ATTORNEY DOCKET NO 21101.0493P1
[0059] shows GW AS association with circulating aspartate aminotransferase (AST) (FIG. 6P) and liver eQTL (FIG. 6Q) in UK Biobank. Lead variant is shown as purple diamond.
[0060] FIGS. 7A-T show liver-specific EFHD1 inhibition reduces hepatocyte injury. FIG. 7A shows a schematic of Efhdl targeting strategy. Eflidlox,loxmice were crossed with Alb-Cre to generate hepatocyte-specific deletion due to frameshifit and early termination. FIG. 7B shows a Western blot confirming liver EFHD1 deletion but preservation in hearts ofE / 7iJ7hKOmice. FIG. 7C shows representative images of isolated hepatocytes stained with 200 nM MitoTracker Orange. Boxed insets are shown at higher magnification to the right. FIG. 7D shows automated iLastik analysis of hepatocyte mitochondrial size before and after ATP treatment. Data is displayed as a bar chart (top) to show mean effects and as a violin plot (bottom) to show the full distribution. WT Ctrl n=12055 mitochondria from N=6 mice: WT ATP N=4, n=19498; EflidlhKOCtrl N=3, n=24890; EftidlhKOATP N=3, n=21088. FIGS. 6E-6J show assays performed on mice following 4 weeks CCL injection. FIG. 7E and FIG. 7F show serum AST (FIG. 7E) and ALT (FIG. 7F) measurements. FIG. 6G show s representative liver micrographs following Masson’s tri chrome staining, with fibrosis evident as blue stain. FIG. 7H shows MASH activity score. FIG. 71 shows histological assessment of fibrosis. FIG.
[0061] 7J shows direct assessment of fibrotic area from liver micrographs. FIGS. 7K-7T show- assays performed on mice on MASH diet and treated with AAV8 as described in FIG. 15G. FIG. 7K shows representative images of isolated hepatocytes from AAV8-treated mice. Cells are treated with MitoTracker Orange and display GFP fluorescence, confirming infection. FIG.
[0062] 7L shows automated iLastik analysis of hepatocyte mitochondrial size as in (FIG. 7D). shCtrl n=2129 mitochondria fromN=5 mice; shEFHDl l N=5, n=2253; shEFHDl#2 N=5, n=2859. FIG. 7M and FIG. 7N show' serum AST (FIG. 7M) and ALT (FIG. 7N) measurements. FIG. 70 shows representative liver micrographs following Masson's trichrome staining, with fibrosis evident as blue stain. FIG. 7P shows MASH activity score. FIG. 7Q shows the histological assessment of inflammation. FIG. 7R show s direct assessment of leukocyte clusters from liver micrographs. FIG. 7S shows histological assessment of fibrosis. FIG. 7T show s direct assessment of fibrotic area from liver micrographs. The assays were performed on male mice. The clinical histological scoring in FIGS. 7H, 71, 7P, 7Q, and 7S was assessed in blinded fashion by liver pathologist. For FIGS.
[0063] 7E-J, WT n=13; Eflidl^0n=3. For FIG. 7M, shCtrl n=6; shEfhdl#! n=5; s\EJhdl#2 n=6. For FIG. 7N, shCtrl n=6; s Eftidl#! n=10; s Eftidl#2 n=8. For FIG. 7P, FIG. 7Q, and FIG.
[0064] 7S, shCtrl n=5; s EJhdl l n=5; s Efhdl#2 n=5. For FIG. 7R and FIG. 7T, shCtrl n=15; s Efhdl l n=15; shE / 7?<77#2n=15. Bar: mean ± SEM. ATTORNEY DOCKET NO 21101.0493P1
[0065] FIGS. 8A-R show that organismal energy' balance is preserved in Eftidl''' mice, related to FIG. 1. FIG. 8A shows that human single-cell RNA-seq data reveals EFHD1 is preferentially expressed in hepatocytes (GSE115469). FIG. 8B shows the timeline of dietary interventions. Created with BioRender. FIGS. 8C and 8D show the Western blot and band analysis for HFD-fed mice (FIG. 8D, n=7). FIG. 8E and FIG. 8F show grow th curves for normal chow and HFD over 20 weeks, showing no difference between WT and Eftidl' ~ mice. Shaded grey and pink areas here and throughout represent SEM. (FIG. 8E) Normal Chow. WT: male n=7, female n=5; Efthdl''". male n=5, female n=7. (FIG. 8F) MASH. WT: male n=12, female n=7; Eftidl'1". male n=5, female n=ll. FIGS. 8G, 8H, and 81 show'NMR scan for body composition obtained for mice on 12 w eeks HFD. (FIG. 8G) % body fat, (FIG. 8H) % body lean, and (FIG. 81) and % body fluid. WT: male n=20, female n=l 1; Efhdl'ft male n=7, female n=15. FIG. 8 J and FIG. 8K show' food intake over 5 days for normal chow and 20-w'eek HFD-fed mice. WT, n=5; Efhdl'1', n=5. FIG. 8L shows stool lipid content in 20-week HFD-fed mice. WT, n=10; Eftidl'1', n=5. FIG. 8M and FIG. 8N show metabolic cage assessment of respiratory’ exchange ratio (top) and locomotor activity (bottom) over 52 hours for mice fed normal chow (FIG. 8M; WT, n=5; Eftidl'1', n=5.) or 12 weeks HFD (FIG. 8N; WT, n=5; Eftidl'1', n=5.). FIG. 80 and FIG. 8P shows glucose (FIG. 80) and insulin (FIG. 8P) tolerance tests for 12 w eeks HFD-fed mice. WT: males n=8, females n=10; Eftidl''': males n=8, females n=5. FIG. 8Q and FIG. 8R shows liver to body weight ratios for mice fed normal chow (FIG. 8Q, WT: males n=25, females n=7; Eftidl''". males n=14, females n=14.) or HFD (FIG. 8R, WT: males n=10, females n=8; Eftidl''". males n=14, females n=l 1). Bar: mean ± SEM.
[0066] FIGS. 9A-W show that loss of EFHD1 prevents hepatocyte injury, related to FIG. 1. FIG. 9A and FIG. 9B show serum triglyceride levels in mice fed normal chow (FIG. 9A, WT: males n=10, females n=7; Eftidl'1''. males n=6, females n=8) or 28 weeks of HFD (FIG. 9B, WT: males n=6, females n=4; Eftidl'1''. males n=4, females n=4). FIG. 9C and FIG. 9D show' MASH activity7score in normal chow' (FIG. 9C) or 28 week HFD animals (FIG. 9D). FIG. 9E and FIG. 9J show hepatocyte ballooning score in normal chow (FIG. 9E) or 28 week HFD animals (FIG. 9J). FIGS. 9F. 9G, 9K, and 9L show histological assessment of liver fat in normal chow (FIGS. 9F,9G) or 28 week HFD animals (FIGS. 9K,9L). FIG. 9H, FIG. 91, FIG.
[0067] 9M, and FIG. 9N show' direct measurement of lipid droplet size (FIGS. 9H, 9M) and count (FIG. 91, 9N). For normal chow, WT: n=19; Eftidl'1". n=23. For HFD, WT: n=28; Eftidl"". n=16. FIGS. 9O-9R show serum AST (FIGS. 90, 9Q) and ALT (FIGS. 9P. 9R) measurements. For normal chow; WT: males n=ll, females n=8; Eftidl'". males n=10. ATTORNEY DOCKET NO 21101.0493P1
[0068] females n=14. For HFD, WT: males n=l 1, females n=9; EftidT''. males n=21, females n=15. FIG. 9S shows representative liver micrographs following hematoxylin and eosin staining. Arrows indicate leukocyte clusters. FIG. 9T shows representative liver micrographs following Masson’s trichrome staining. FIG. 9U and FIG. 9V show histological assessment of inflammation for normal chow (FIG. 9U) or HFD (FIG. 9V). FIG. 9W shows direct assessment of leukocyte clusters from liver micrographs of normal chow (WT n=19, Efhdl'^ n=23) or HFD (WT n=19, Eftidl^ n=23). The clinical histological scoring in FIGS. 9C-9G, 9J-9L, and 9U-9V was assessed in blinded fashion by liver pathologist. For normal chow in FIGS. 9C, 9E-9G, and 9U, WT: males n=8, females n=l 1; Eftidl^-. males n=10, females n=13. For HFD in FIGS. 9D, 9J-L, and 9 V, WT: males n=19, females n=9; Ejhdl ~'. males n=9, females n=7. Bar: mean ± SEM.
[0069] FIGS. 10A-N show additional data for EFHD1 contribution to Ca2+-induced mitochondrial fission, related to FIG 2. FIG. 10A shows a summary of proximity ligation and proteinase protection studies (listed by Pubmed ID), indicating that EFHD1 is primarily present in cytoplasm and IMS. EFHD1 is also present, though not necessarily enriched, at ERMCS. FIG. 10B shows a Western blot analysis showing that EFHD1 is present in both mitochondrial and ERMCS fractions. CalR: Calreticulin (ER marker); NDUFS3:
[0070] NADH:ubi quinone oxidoreductase core subunit S3 (mitochondrial matrix / IMM marker); VDAC: Voltage-dependent anion channel (OMM / ERMCS marker); TOMM20: translocase of outer mitochondrial membrane 20 (OMM / ERMCS marker). FIG. 10C show Representative bright field images of WT hepatocytes immediately after (day 0) and 24 hours (day 1) after isolation. Arrowheads indicate lipid droplets which differentiate hepatocytes from other liver cells. FIG. 10D and FIG. 10E show representative images (FIG. 10D) and summary (FIG. 10E) showing albumin staining in hepatocytes at day 0. day 1, day 3 and day 6 post isolation. Albumin levels decrease as hepatocytes de-differentiate. Day 0: n=22 hepatocytes fromN=2 mice; Day 1: N=2, n=23; Day 2: N=2, n=21; Day 3: N=2, n=21; Day 6: N=2, n=24. FIG. 10F show same image as FIG. 2D with mitochondria outlined to highlight morphological changes in EftidE ' hepatocytes. FIG. 10G and FIG. 10H show absent EFHD1 on Western blot in EFHD1'1’ HepG2 (FIG. 10G) or Hapl (FIG. 10H) cells compared with EFHD1 overexpressed cells (EFHD1-HA). Overexpressed (EFHD1-HA) was compared to knockout (EFHDl ^
[0071]
[0072] ) cells because of low endogenous EFHD1 expression in HepG2 cells. FIG. 101 and FIG. 10J show representative images (FIG. 101) and mitochondrial length quantification (FIG. 10J) of HAP 1 cells stained with 200 nM MitoTracker Orange. Rescue is / TfflV IAPI expressing EFHD1-HA. WT n=4821 mitochondria from N=99 cells; ATTORNEY DOCKET NO 21101.0493P1
[0073] EFHDl^ N=111, n=4368; EFHD1-HA N=104, n=4811. FIG. 10K shows comparison of mitochondrial length in WT or EFHD1 HAP1 cells either treated with 1 pM ionomycin (iono) or DMSO vehicle (Ctrl). WT Ctrl n=50 mitochondria from N=11 cells; WT ionomycin N=9, n=78 EFHD1 '- Ctrl N=10, n=105; EFHDl ^ ionomycin N=10, n=74. FIG. 10L shows comparison of mitochondrial size in WT or EfhdH' ' hepatocytes incubated for 24 hours in either low-glucose (1 g / L, starved) or high-glucose, high-fat media (4.5 g / L D-glucose. 0.4 mM palmitate, fed). WT fed n=3770 mitochondria from N=2 mice; WT starvation N=2 n=2530; Efhdl^ fed N=2, n=6883; EftidF'- starvation N=2, n=4382. FIG. 10M shows MCU levels are diminished in shA / CU-expressing HepG2 cells relative to control (shGFP) on Western blot. FIG. ION shows direct measurement of fission events after addition of vehicle (PBS, Ctrl) or ImM ATP in HepG2 cells as in FIG. 2J. Inhibiting MCU had no effect on the rate of ATP-induced fission events. shGFP: EFHD1-HA Ctrl: n=10; Eftidl'1' Ctrl: n=12; EFHD1-HA ATP: n=13; Eftidl'1- ATP: n=15. shMCU: EFHD1-HA Ctrl: n=34; Eftidl'1- Ctrl: n=25; EFHD1-HA ATP: n=20; EfhdE'- ATP: n=20. Data in FIGs. 10J-10L is displayed as a bar chart (top) to show mean effects and as a violin plot (bottom) to show the full distribution. Bars are mean ± SEM.
[0074] FIGS. 11A-F showEFHDl promotes actin rearrangements, related to FIG. 3. FIG. 11A shows representative hepatocytes from normal chow-fed mice stained for mitochondria (magenta) and DRP1 (green). Arrowheads show mitochondria-localized DRP1 puncta. FIG.
[0075] 11B shows representative images showing changes in mitochondrial morphology when FIS1 is overexpressed in HAP1 cells. Mitochondria are stained green. Arrowheads indicate mitochondrial localization to the nucleus in the presence of FIS 1. FIG. 11C shows native organelle immunoprecipitation data from PMID 39742809 annotates EFHD1 primarily as an actin-binding protein. FIG. 11D, top, shows a ribbon diagram depiction of AlphaFold3 confidence (predicted local distance difference test) for EFHDEP-actin structure; and, bottom, in the overlay of the top 5 AlphaFold3 predicted structures, shows the greatest uncertainty7is in the localization of the N-terminal helix and IDR, with some structures showing it occupying the target-binding cleft in the actin + end where polymerization occurs. FIG. 1 IE shows the comparison of the AlphaFold3 predicted EFHDEP-actin structure with other actin-bundling proteins shows they bind at a similar location at actin domain 1-2. PDB structure IDs are shown for fimbrin and fascin. FIG. 1 IF show s representative images showing actin (green) morphology via phalloidin staining in HAP1 cells. Arrowheads indicate prominent cytoplasmic actin stress fibers observed in EFHDE ~ cells. Bars are mean ± SEM. ATTORNEY DOCKET NO 21101.0493P1
[0076] FIGS. 12A-B show a working model for EFHDl-driven Ca2+-dependent mitochondrial fission. FIG. 12A shows the current model for actin crosslinking at ERMCS requires a direct interaction between the OMM-bound actin -nucleating factor Spire 1C, and the ER-bound actin polymerization factor INF2. Interactions between these two factors are possibly less efficient as they are localized on opposite membranes and may have limited contact. FIG. 12B shows that EFHDl-driven fission does not require direct interaction between ER- and OMM-bound factors. Instead, actin filaments may be more diffuse and motile at ERMCS. Upon Ca2+release from the ER, EFHD1 is poised to crosslink actin filaments originating from opposite membranes, leading to more robust actin-driven constriction at ERMCS.
[0077] FIGS. 13A-F show mitochondrial Ca2+phenotypes after EFHD1 ablation, related to FIG 4. FIG. 13A and FIG. 14B show Western blot (FIG. 14A) and band quantification (FIG.
[0078] 14B) of pyruvate dehydrogenase (PDH) and phosphorylated PDH (p-PDH). Chow: WT n=5, Eftidl’1’ n=5; MASH: WT n=7, Eftidl’’ n=7. FIG. 14C and FIG. 14D shows exemplar (FIG.
[0079] 14C) and summary (FIG. 14D) of Ca2+retention capacity as in FIGS. 4F, 4G except performed on digitonin-permeabilized HepG2 cells. EFHD1-HA n=20; Eftidr1’ n=15;
[0080] EFHD1-HA+CSA n=8; Efhd ’+CS n=4. FIG. 14E and FIG. 14F show' Ca2+retention capacity as in (FIG. 14C and FIG. 14D) except with HAP1 cells. EFHD1-HA n=3, Eftidr1' n=9, EFHD1-HA+CSA n=4, Efhdft’+C n=4. Bars are mean ± SEM.
[0081] FIGS. 14A-G show further transcriptomic and proteomic analysis of EFHD1 ablation, related to FIG. 5. FIG. 14A and FIG. 14B show from whole liver RNA-seq of Eftidr ' versus WT mice fed normal chow (FIG. 14A) principal components analysis using the top 500 most variable genes, and (FIG. 14B) volcano plot of differential gene expression. FIG. 14C and FIG. 14D show from whole liver RNA-seq oi Eftidr'' versus WT mice fed a MASH diet, (FIG. 14A) principal components analysis using the top 500 most variable genes, and (FIG.
[0082] 14B) volcano plot of differential gene expression. FIGS. 14E-14G show from whole liver proteomics of Efhdl'^ versus WT mice fed a normal chow' or MASH diet, (FIG. 14E) principal components analysis using proteins expressed in the samples, and volcano plot of differential gene expression comparing Eftidr'’ versus WT mice fed a (FIG. 14F) normal chow or (FIG. 14G) MASH diet. RNA-seq, chow: WT n=5, Eftidl ’ / ’n=5. MASH: WT n=4, Eftidl_ / n=5. Proteomics, chow: WT n=5, Eftidl'^ n=5. MASH: WT n=5, Eftidl / _n=5.
[0083] FIGS. 15A-J show the pathways to the integrated stress response in MASH, related to FIG. 6. FIG. 15A and FIG. 15B show heat maps of protein expression of ATF4 target genes from livers of (FIG. 15 A) WT mice fed normal chow or MASH diet, or (FIG. 15B) Efhdr'’ ATTORNEY DOCKET NO 21101.0493P1
[0084] versus WT mice fed MASH diet. FIG. 15C show Western blot (top) and band quantification (bottom) of FGF21 expression (WT n=5, EflidlLn=5). FIG. 15D shows heat map of ATF4 target gene expression from RNA-seq data of
[0085]
[0086] versus WT mice fed MASH diet. Most targets are down regulated (negative) in EftidT'' relative to WT (WT n=4, Eftidl^' n=5). FIG.
[0087] 15E show s Western blot (top) and band quantification (bottom) of RIG-I and MDA5 liver expression. RIG-I: Retinoic acid-inducible gene I; MDA5: Melanoma Differentiation-Associated gene 5 (WT n=5. EftidE'' n=5). FIG. 15F shows additional representative images, as in FIG. 6G, of dsRNA and mitochondrial staining in isolated mouse hepatocytes. FIG. 15G shows quantification of dsRNA fluorescence (WT chow n=23 from 4 mice, WT MASH n=13 from 5 mice, Eftidl^' MASH n=18 from 5 mice). FIG. 15H shows additional exemplars as in FIG. 6H. Arrowheads show PKR staining in dense non-hepatocyte nuclei, while arrows show dsRNA- and PKR-stained cytoplasmic signal. FIG. 151 shows additional representative images as in FIG. 61. FIG. 15 J show s the panel was downloaded and modified from hugeamp.org / gene.html?gene=EIF2AK2 on Feb 8, 2025, and represents the calculated Human Genetic Evidence (HuGE) score, which quantifies genetic support for involvement in the diseases and traits available in the Common Metabolic Diseases Knowledge Portal. Shown are different thresholds (dotted lines) for the quality of evidence.
[0088] FIGS. 16A-P show liver-specific EFHD1 inhibition, related to FIG. 7. FIG. 16A and FIG. 16B show representative images (FIG. 16A) and summary of mitochondrial length (FIG. 16B) in MitoTracker-labeled isolated mouse hepatocytes. Cells were imaged for 6 minutes, and treated sequentially with digitonin and a Ca2+bolus. FIGS. 16C-16E show assays performed on mice following 4 weeks CCh injection. FIG. 16C shows hepatocyte ballooning score. FIG. 16D show s histological assessment of liver fat. FIG. 16E shows histological assessment of inflammation. FIG. 16F shows schematic of AAV plasmid used for acute EFHD1 inhibition. FIG. 16G shows timeline of AAV8-mediated Eflidl inhibition experiments. Image created using BioRender. FIG. 16H show s quantitative RT-PCR of liver Efhdl mRNA level after AAV8 treatments. FIG. 161 shows confirmation of AAV8-mediated EFHD1 inhibition via Western blot of livers. Middle two unlabeled lanes are from other s Eftidl constructs screened but not used further. FIG. 16J shows GFP fluorescence measured via flow cytometry from hepatocytes isolated from uninjected or AAV8-treated mice. FIG. 16K shows representative images comparing GFP fluorescence from liver sections of uninjected mice and mice injected with AAV8. FIG. 16L shows serum triglyceride levels. FIG. 16M shows hepatocyte ballooning score. FIG. 16N shows histological assessment of liver fat. FIG. 160 shows direct measurement of lipid droplet size. ATTORNEY DOCKET NO 21101.0493P1
[0089] FIG. 16P shows additional representative liver micrographs following Masson's trichrome staining, with fibrosis evident as blue stain. Each panel is from a different injected mouse. For FIGS. 16C-16E, WT n=13; Eftid 7hK0n=3. For FIG. 16H, shCtrl n=3; s Efhdl l n=6; s}Efhdl#2 n=8. For FIG. 16L, shCtrl n=7; s Efhdl#! n=8; s\Efhdl#2 n=7. For FIG. 16M and FIG. 16N, shCtrl n=5; s\\Efhdl#l n=5; s\Ejhdl#2 n=5. For FIG. 160, shCtrl n=15; s\\EfhdlUl n=15; sh£ / 7i / #2n=15. Bar: mean ± SEM.
[0090] FIGS. 17A-F show the effect of whole body EFHD1- / - on mouse livers. FIG. 17A depicts a Western blot showing that EFHD1 is absent in Efhdl- / - mouse liver. FIG. depicts immunohistochemistry showing that EFHD1 is present in hepatocytes. Samples are slices from WT and Efhdl-'- mouse livers. Staining is for EFHD1 (cyan), Albumin (hepatocyte marker, magenta). FIG. 17C shows the size comparison of whole body Efhdl- / - mouse and WT mouse. FIG. 17D shows ALT and AST levels in WT (black) and Efhdl- - (red) mouse serum. Lower levels indicate healthier livers. FIG. 17E shows exemplar histology images of WT and Efhdl- / - mouse liver. H& E stain (top) and Trichrome stain (bottom). FIG. 17F shows the comparison of liver fat scoring (left) and hepatocyte ballooning (steatohepatitis, right) scoring from histology slides of WT and Efhdl- / - mouse liver.
[0091] FIGS. 18A-I show EFHD1 ablation reduces liver damage in mice fed high-fat diets. FIG. 18 shows a diagram depicting the protocol for mouse diet treatments. FIG. 18B shows that EFHD 1 is increased in mouse livers following a high-fat diet (HFD) which indicates MAFLD in mice. FIG. 18C shows that EFHD1 is increased in mouse livers following a Gubra-Amylin NASH (GAN) diet which induces MASLD and MASH in mice. FIG. 18D shows representative histological images of livers from WT and Efhdl- / - mice following 28 weeks of HFD (H& E stain). FIG. 18E shows ALT and AST levels in WT (black) and Efhdl- / - (red) mouse serum following an HFD. Lower levels indicate healthier livers. FIG. 18F shows representative histological images of livers from WT and Efhdl- / - mice following 28 weeks of GAN diet (H& E stain). FIG. 18G shows ALT and AST levels in WT (black) and Efhdl-,'- (red) mouse serum following a GAN diet. Lower levels indicate healthier livers. FIG. 18H show s representative histological images of livers from WT and Efhdl- / - mice following 28 weeks of GAN diet where mice had been treated with a liver-targeting AAV8 virus containing an shRNA molecule to knock-down EFHD1 (shEFHDl). Two shRNA molecules were tested, shEFHDl #1 (GTAAGTTCGAAGCTGAGTTAActcgagTTAACTCAGCTTCGAACTTAC (SEQ ID NO: 243)), and shEFHDl #2 (GCTGGAAGGGACGGCTTTATTctcgagAATAAAGCCGTCCCTTCCAGC (SEQ ID NO: ATTORNEY DOCKET NO 21101.0493P1
[0092] 244)). Fibrosis (blue staining) was seen to be markedly lower in the treated animals. FIG. 181 shows ALT and AST levels in control (grey) and shEFHDl -treated (magenta and pink) mouse serum following a GAN diet.
[0093] FIGS. 19A-H show that EFHD1 ablation alters mitochondrial morphology by increasing the MAM-ER distance in hepatocytes. FIG. 19A shows representative images of hepatocytes isolated from WT and Efhdl- / - mice. Mitochondria were stained with Mito tracker orange and the cells imaged live using a confocal microscope. 100 y. M ATP was added to the cells to promote fission. FIG. 19B shows the comparison of mitochondrial size in hepatocytes isolated from WT and Efhdl- / - mice in the presence and absence of ATP. FIG.
[0094] 19C show s the comparison of mitochondrial size in hepatocytes isolated from WT and Efhdl- / - mice fed a GAN diet for 28 weeks. FIG. 19D shows the comparison of mitochondrial size in hepatocytes isolated from control (grey) and shEFHDl -treated (pink) mice following 28 w eeks of a GAN diet. FIG. E. Comparison of expression levels of mitochondrial fission and fusion proteins in WT and Efhdl- / - mouse livers. INF2 is notable because it is the only protein which follows the expected expression pattern if mitochondrial fission is inhibited. FIG. 19F depicts a Western blot following differential centrifugation of liver samples showing that EFHD1 is present in the mitochondrial-associated membranes (MAMS) where the mitochondria is in close association with the endoplasmic reticulum (ER). This region is important for mitochondrial fission. FIG. 19G shows electron micrographs showing the MAM regions in WT and Efhdl- / - livers. FIG. 19H shows the comparison of the distance between the MAM and ER in WT (black) and Efhdl- / - (red) livers. INF2 is an important protein in maintaining the close proximity between MAMs and the ER, so the larger distances observed in Efhdl- / - livers are indicative of impaired INF2 function.
[0095] FIGS. 20A-I shows hepatic and cellular EftidE''' phenotypes. FIG. 20A shows reduced serum liver enzymes (AST, ALT) and no increase in triglycerides (TG) in EftidE" (n=3 WT / KO). FIG. 20B show s mitochondria are elongated (arrowheads; left) in EftidE'' primary hepatocytes; and summary of mitochondrial length. (n=5IWT, 101KO; right). FIG. 20C shows mitochondrial fission (reduced length) after Ca2+treatment (1 pM ionomycin. lono) is blunted in EftidE'' hepatocytes (n=79WT, 75KO). FIG. 20D show's, as in (FIG. 20B) but using EftidE^ HAP-1 cells (n=35WT, 51KO). FIG. 20E show s loss of perinuclear localization in EftidE'' mitochondria (arrow s). FIG. 20F shows an alteration in fission and fusion proteins in EftidE'' livers. FIG. 20G depicts the quantification of (FIG. 20F) showing increased fission protein DRP1 and less MFN2 in EjhdE / ~ livers (n=6WT / KO). FIG. 20H shows co- ATTORNEY DOCKET NO 21101.0493P1
[0096] immunoprecipitation of VDAC2 with EFHD1 in HAP-1 cells. FIG. 201 shows Efhdl'^ hepatic mitochondria are more resistant to Ca2+overload. Calcium retention capacity: repetitive Ca2+pulses are applied (orange arrowheads above, 10 pM) while measuring A. A sudden rise in fluorescence (arrows) indicated mitochondrial disruption due to the permeability transition, and requires more Ca2+in Efhdl'^ liver mitochondria (representative of n=3).
[0097] FIGS. 21 A-L show EFHD1 phenotypes associated with HFD. FIG. 21A shows elevated EFHD1 protein levels in wild-type mice fed an HFD. FIG. 21B shows a summary of (FIG. 21 A) (n=6WT / KO). FIG. 21 C shows
[0098]
[0099] mice gain less weight on an HFD, and have less body fat (FIG. 21D) (normal n=27WT, 17KO, HFD n=13WT, 8KO). FIGS. 21E, F show no difference in food eaten or activity measured using Comprehensive Laboratory Animal Monitoring System chambers (n=4WT / KO). FIGS. 21 G, H show no difference in glucose or insulin tolerance tests at 12 weeks (n=23WT, 25KO). FIGS. 211 show reduced hepatic steatosis in histology ivomEfhdl_ / ' animals at 12 weeks. FIG. 21 J shows a summary of measured via pixel intensity on histology images (left) or steatosis score (right) (n=18WT / KO). FIG. 21K shows examples of mild fibrosis evident in wild-type (blue arrowheads) but not Eflidl'^ liver sections (tri chrome stain). FIG. 21L shows reduced IL-10 expression via qPCR of total hepatic mRNA in Eflidl'^ mice (n=6WT, 5KO).
[0100] FIG. 22 shows a floxed cassette around exon 2 in Efhdl (top) and genotyping PCR (bottom).
[0101] FIG. 23 shows exemplar Ca2+uptake trace. Purified hepatic mitochondria are incubated with a fluorescent Ca2+sensor (Oregon Green BAPTA-6F, OGB6F). Ca2+uptake is visible as a decline to baseline after a Ca2+pulse (arrow, 25 pM).
[0102] FIGS. 24A-B show EFHD1 in mitochondrial fission. FIG. 24A shows that FIS1 co-immunoprecipitates with EFHD1 (arrowhead) in HAP-1 cells. FIG.24B shows live cell imaging of mitochondrial fission (arrowheads, mitochondria are red) at actin (green) contact site.
[0103] FIG. 25 shows that for high fat diet (HFD), no change in average food per mouse measured over a week in standard cages for EflidE'' compared to wild-type animals (n=8WT, 4KO).
[0104] FIG. 26 shows that a high fat diet (HFD) fed Eflidl'^ livers (right) are smaller than wild-type controls fed the same diet (left). Overt nodularity or cirrhosis is not evident. ATTORNEY DOCKET NO 21101.0493P1
[0105] FIG. 27 shows quantification of knockdown of EFHD1 after expression of short hairpin RNAs in two different cell lines. The shRNA sequences and location on the EFHD1 transcript is shown below.
[0106] DETAILED DESCRIPTION
[0107] The disclosed method and compositions may be understood more readily by reference to the following detailed description of particular embodiments and the Example included therein and to the Figures and their previous and following description.
[0108] It is to be understood that the disclosed method and compositions are not limited to specific synthetic methods, specific analytical techniques, or to particular reagents unless otherwise specified, and, as such, may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.
[0109] All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present disclosure is not entitled to antedate such publication by virtue of prior disclosures. Further, the dates of publication provided herein can be different from the actual publication dates, which can require independent confirmation.
[0110] DEFINITIONS
[0111] It is understood that the disclosed method and compositions are not limited to the particular methodology, protocols, and reagents described as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims.
[0112] It must be noted that as used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural reference unless the context clearly dictates otherwise.
[0113] The use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims and / or the specification may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.”
[0114] “Optional” or “optionally” means that the subsequently described event, circumstance, or material may or may not occur or be present, and that the description includes instances where the event, circumstance, or material occurs or is present and instances where it does not occur or is not present. ATTORNEY DOCKET NO 21101.0493P1
[0115] The word “or” as used herein means any one member of a particular list and also includes any combination of members of that list. The use of the term “or” in the claims is used to mean “and / or” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and “and / or.”
[0116] Throughout this application, the term “about” is used to indicate that a value includes the standard deviation of error for the device or method being employed to determine the value.
[0117] Ranges may be expressed herein as from “about” one particular value, and / or to “about” another particular value. When such a range is expressed, also specifically contemplated and considered disclosed is the range from the one particular value and / or to the other particular value unless the context specifically indicates otherwise. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another, specifically contemplated embodiment that should be considered disclosed unless the context specifically indicates otherwise. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint unless the context specifically indicates otherwise. Finally, it should be understood that all of the individual values and subranges of values contained within an explicitly disclosed range are also specifically contemplated and should be considered disclosed unless the context specifically indicates otherwise. The foregoing applies regardless of whether in particular cases some or all of these embodiments are explicitly disclosed.
[0118] Throughout the description and claims of this specification, the word “comprise” and variations of the word, such as “comprising” and “comprises,” means “including but not limited to,” and is not intended to exclude, for example, other additives, components, integers or steps. In particular, in methods stated as comprising one or more steps or operations it is specifically contemplated that each step comprises what is listed (unless that step includes a limiting term such as “consisting of’), meaning that each step is not intended to exclude, for example, other additives, components, integers or steps that are not listed in the step.
[0119] As used in this specification and claim(s), the words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. ATTORNEY DOCKET NO 21101.0493P1
[0120] Ranges can be expressed herein as from “about’' or “approximately'’ one particular value, and / or to “about” or “approximately” another particular value. When such a range is expressed, a further aspect includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” or “approximately,” it will be understood that the particular value forms a further aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint and independently of the other endpoint. It is also understood that there are a number of values disclosed herein and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that each unit between two particular units is also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.
[0121] “Inhibit,” “inhibiting” and “inhibition” mean to diminish or decrease an activity, level, response, condition, disease, or other biological parameter. This can include, but is not limited to, the complete ablation of the activity’, response, condition, or disease. This may also include, for example, a 10% inhibition or reduction in the activity, response, condition, or disease as compared to the native or control level. Thus, in some aspects, the inhibition or reduction can be a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount of reduction in between as compared to native or control levels. In some aspects, the inhibition or reduction is 10-20, 20-30, 30-40. 40-50, 50-60, 60-70. 70-80, 80-90, or 90-100% as compared to native or control levels. In some aspects, the inhibition or reduction is 0-25, 25-50, 50-75, or 75-100% as compared to native or control levels.
[0122] “Modulate”, “modulating” and “modulation” as used herein mean a change in activity’ or function or number. The change may be an increase or a decrease, an enhancement or an inhibition of the activity, function or number.
[0123] “Treatment” and “treating” refer to administration or application of a therapeutic agent (e.g., siRNA) to a subject or performance of a procedure or modality’ on a subject for the purpose of obtaining a therapeutic benefit of a disease or health-related condition. For example, a treatment may include administration of a pharmaceutically effective amount of a siRNA disclosed herein.
[0124] As used herein, the term “treating” refers to partially or completely alleviating, ameliorating, relieving, delaying onset of, inhibiting or slowing progression of, reducing severity’ of. and / or reducing incidence of one or more symptoms or features of a particular disease, disorder, and / or condition (e.g., metabolic liver disease, metabolic dysfunction- ATTORNEY DOCKET NO 21101.0493P1
[0125] associated steatotic liver disease, and steatohepatitis). Treatment can be administered to a subject who does not exhibit signs of a disease, disorder, and / or condition and / or to a subject who exhibits only early signs of a disease, disorder, and / or condition for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and / or condition. For example, the disease, disorder, and / or condition can be metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis.
[0126] As used herein, the term “subject” refers to the target of administration, e.g., a human. Thus, the subject of the disclosed methods can be a vertebrate, such as a mammal, a fish, a bird, a reptile, or an amphibian. The term “subject” also includes domesticated animals (e.g., cats, dogs, etc.), livestock (e.g., cattle, horses, pigs, sheep, goats, etc.), and laboratory animals (e.g., mouse, rabbit, rat, guinea pig, fruit fly, etc.). In some aspects, a subject is a mammal. In another aspect, a subject is a human. In some aspects, a subject is a non-human primate. The term does not denote a particular age or sex. Thus, adult, child, adolescent and newborn subjects, as well as fetuses, whether male or female, are intended to be covered.
[0127] As used herein, the term “patient” refers to a subject afflicted with a condition, disease or disorder (e.g., metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis). The term “patient” includes human and veterinary subjects. In some aspects of the disclosed methods, the “patient” has been diagnosed with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis. In some aspects of the disclosed methods, the “patient” has been diagnosed with a need for treatment (e.g., treatment for metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis), such as, for example, prior to the administering step.
[0128] As used herein, the term “sample” is meant a tissue or organ from a subject; a cell (either within a subject, taken directly from a subject, or a cell maintained in culture or from a cultured cell line); a cell lysate (or lysate fraction) or cell extract; or a solution containing one or more molecules derived from a cell or cellular material (e.g. a polypeptide or nucleic acid), which is assayed as described herein. A sample may also be any body fluid or excretion (for example, but not limited to, blood, urine, stool, saliva, tears, bile) that contains cells or cell components.
[0129] The phrase “nucleic acid” as used herein refers to a naturally occurring or synthetic oligonucleotide or polynucleotide, whether DNA or RNA or a DNA-RNA hybrid, singlestranded or double-stranded, sense or antisense, which is capable of hybridization to a complementary nucleic acid by Watson-Crick base-pairing. Nucleic acids as disclosed herein ATTORNEY DOCKET NO 21101.0493P1
[0130] can also include nucleotide analogs (e.g., BrdU), and non-phosphodiester intemucleoside linkages (e.g., peptide nucleic acid or thiodiester linkages). In particular, nucleic acids can include, without limitation, DNA, RNA, cDNA, gDNA, ssDNA, dsDNA or any combination thereof.
[0131] Nucleic acid sequences recited herein are written in a 5' to 3' direction unless otherwise indicated. The term mucleic acid” refers to either DNA or RNA or a modified form thereof comprising the purine or pyrimidine bases present in DNA (adenine “A”. cytosine “C”, guanine “G”, thymine “T”) or in RNA (adenine ‘’A”, cytosine “C”, guanine “G”, uracil “U”). Interfering RNAs provided herein may comprise “T” bases, for example at 3' ends, even though “T” bases do not naturally occur in RNA. In some cases, these bases may appear as ”dT” to differentiate deoxyribonucleotides present in a chain of ribonucleotides.
[0132] As used herein, the term '‘complementary’’ refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick or other non-traditional ty pes. A percent complementary indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary).
[0133] As used herein, the term “vector” or “construct” refers to a nucleic acid sequence capable of transporting into a cell another nucleic acid to which the vector sequence has been linked. The term “expression vector” includes any vector, (e.g., a plasmid, cosmid or phage chromosome) containing a gene construct in a form suitable for expression by a cell (e.g., linked to a transcriptional control element or regulatory element). The terms "plasmid" and “vector” can be used interchangeably, as a plasmid is a commonly used form of vector. Moreover, this disclosure is intended to include other vectors which serve equivalent functions.
[0134] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of skill in the art to which the disclosed method and compositions belong. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present method and compositions, the particularly useful methods, devices, and materials are as described.
[0135] Publications cited herein and the material for which they are cited are hereby specifically incorporated by reference. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such disclosure by virtue of prior invention. No admission is made that any reference constitutes prior art. The discussion of references states ATTORNEY DOCKET NO 21101.0493P1
[0136] what their authors assert, and applicants reserve the right to challenge the accuracy and pertinency of the cited documents. It will be clearly understood that, although a number of publications are referred to herein, such reference does not constitute an admission that any of these documents forms part of the common general knowledge in the art.
[0137] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, certain changes and modifications may be practiced within the scope of the appended claims.
[0138] Twin studies have revealed that nearly half of the variation in liver injury is attributable to genetic factors (Loomba, R., et al., Gastroenterology, 2015. 149(7): p. 1784-93). Therefore, one approach to identify targets for therapeutic development has been to seek genes altering the risk of injury, such as has been performed for low-density lipoprotein metabolism in the identification of PCSK9 inhibitors. Application of such genetic analyses to hepatic biology has been driven by the ease of measuring liver enzymes in serum, and the correlation of these levels (even within the normal range) with susceptibility to liver injury (Trepo. E., and L. Valenti, J Hepatol, 2020. 72(6): p. 1196-1209;. Jonas, W., and A.
[0139] Schiirmann, Mol Metab, 2021. 50: p. 101111; and Targher, G., Clin Chem Lab Med, 2010.
[0140] 48(2): p. 147-57). Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) are released during hepatocyte injury, with ALT more specific for liver injury; alkaline phosphatase is a marker of biliary obstruction; while gamma-glutamyl transferase (GGT) is elevated in many forms of hepatic damage, especially alcoholic injury (Pratt. D. S., and M. M. Kaplan, N Engl J Med, 2000. 342(17): p. 1266-71).
[0141] Multiple genome-wide association studies (GWAS) of either liver enzymes or MAFLD have repeatedly identified components of hepatic lipid metabolism including PNP A3. HSD17B13, and TM6SF2 (Chambers, J. C., et al., Nat Genet, 2011. 43(11): p. 1131-8; Hakim, A., Met al., Hepatology, 2021. 74(6): p. 3394-3408; Pazoki, R., et al., Nat Commun, 2021. 12(1): p. 2579; Ward, L. D., et al., Nat Commun, 2021. 12(1): p. 4571; and Roh, Y. S., et al., Gastroenterology, 2015. 148(1): p. 252-4). Unfortunately, further study of these targets has been hampered by several difficulties. First, mechanistic investigation has been complicated by lipid phenotypes that are different in human cellular or animal model systems compared to those seen in humans. For example, there have been conflicting reports about the variant with strongest inherited effect on MAFLD, the rs738409 C> G allele producing the H48M mutation in patatin-like phospholipase domain-containing 3 (PNPLA3) (Valenti, L. V. C., and A. Cherubini, Hepatology, 2021. 74(6): p. 2942-2944). In addition, whereas reduced PNPLA3 expression is associated with protection from liver injury in ATTORNEY DOCKET NO 21101.0493P1
[0142] genetic studies, loss of this protein in mouse models or hepatocytes derived from human induced pluripotent stem cells failed to prevent liver injury or even worsened it (Basantani, M. K., et al., J Lipid Res, 2011. 52(2): p. 318-29; Tilson, S. G., et al., Hepatology, 2021. 74(6): p. 2998-3017; Tardelli, M„ et al., Int J Mol Sci, 2021. 22(4); and Mitsche, M. A., et al., J Biol Chem, 2018. 293(18): p. 6958-6968). Second, therapeutic strategies inhibiting a target are much easier to develop, yet for some of these proteins’ loss-of-function mutations often lead to increased hepatic steatosis. For example, the human loss-of-function variant rs72613567: TA in the hepatic lipid droplet protein hydroxysteroid 17-beta dehydrogenase 13 (HSD17B13) alters splicing to produce an unstable, truncated protein that confers protection against MAFLD (Abul-Husn, N. S., et al., N Engl J Med, 2018. 378(12): p. 1096-1106). However, HSD17B13 knockout in mouse models is not protective, and actually worsens steatohepatitis (Ma, Y., et al.. Hepatology, 2021. 73(5): p. 1701-1716; and Adam, M., H. et al., Faseb J, 2018. 32(6): p. 3434-3447). Such markedly different responses in model systems compared to humans hampers mechanistic insight into how to target pathways to prevent liver injury. Third, these difficulties are particularly concerning because in several cases genetic variants protective for MAFLD can increase the risk for cardiovascular disease, presumably since decreasing hepatic lipid accumulation leaves increased levels in the vasculature. For example, variants in TM6SF2 and PNPLA3 that decreased hepatic fat accumulation were associated with greater cardiovascular disease, and vice versa (Roh, Y. S., et al.. Gastroenterology’, 2015. 148(1): p. 252-4; Liu, D. J., et al., Nat Genet, 2017. 49(12): p.
[0143] 1758-1766; and Grandone, A., et al., Pediatr Obes, 2016. 11(2): p. 115-9).
[0144] As with PNPLA3 and HSD17B13, variation in the EFHD1 locus has been consistently associated with serum levels of liver enzymes, including in studies of American, British, European, and Japanese populations (Hakim, A., et al., Hepatology, 2021. 74(6): p. 3394-3408; Pazoki, R., et al., Nat Commun, 2021. 12(1): p. 2579; Ward, L. D., et al., Nat Commun, 2021. 12(1): p. 4571; Chambers, J. C., et al., Nat Genet, 2011. 43(11): p. 1131-8; Kanai, M., et al., Nat Genet, 2018. 50(3): p. 390-400; Sakaue, S., et al., Nat Genet, 2021. 53(10): p. 1415-1424; Nielsen, J. B., et al., Nat Commun, 2020. 11(1): p. 6417; Chen, V. L., et al., Nat Commun, 2021. 12(1): p. 816; and Currin, K. W., et al., Am J Hum Genet, 2021. 108(7): p.
[0145] 1169-1189). Despite expression across several organs, human data suggests EFHD1 activity is most relevant for liver physiology. Within the liver, EFHD1 is preferentially expressed in hepatocytes (Chen, V. L., et al., Nat Commun, 2021. 12(1): p. 816; and Currin, K. W., et al., Am J Hum Genet, 2021. 108(7): p. 1169-1189). The most intriguing EFHD1 variant, rs 13395911, is associated with higher levels of serum ALT in most studies, and AST and ATTORNEY DOCKET NO 21101.0493P1
[0146] GGT in some (Pazoki, R., et al., Nat Commun, 2021. 12(1): p. 2579; Kanai, M., et al., Nat Genet, 2018. 50(3): p. 390-400; Sakaue, S., et al., Nat Genet, 2021. 53(10): p. 1415-1424; Nielsen, J. B., et al., Nat Commun, 2020. 11(1): p. 6417). This variant was recently shown to alter liver-specific expression of EFHD1 and downstream phenotypes (Currin, K. W., et al.. Am J Hum Genet, 2021. 108(7): p. 1169-1189). The major T variant at this locus (frequency ~0.6) increases both expression and chromatin accessibility (eQTL, caQTL) for EFHD1 by encoding a better consensus sequence for binding of several transcription factors, including FOXA2 and HNF4A, known regulators of EFHD1 gene expression (Currin, K. W., et al, Am J Hum Genet, 2021. 108(7): p. 1169-1189; Gngo, K., et al., Biol Chem, 2008. 389(2): p. 179-87; and Lucas, B., et al., Oncogene, 2005. 24(42): p. 6418-31). Moreover, this region physically interacts with the EFHD1 promoter on Hi-C assays, and is preferentially accessible in liver but not blood cells, suggesting liver-specific effects of this variant. Finally, in phenome-wide analyses the strongest associations of this variant are with serum triglyceride levels and hepatic steatosis, metabolic traits downstream of the ALT association (Chen, V. L., et al., Nat Commun, 2021. 12(1): p. 816; and Vujkovic, M., et al., medRxiv, 2021: p. 2020.12.26.20248491).
[0147] Therefore, there is a need to identify liver disease targets that (1) produce phenotypes that are conserved between humans and model systems, (2) possess loss-of-function profiles that are protective, and (3) are not associated with malignant cardiovascular outcomes.
[0148] Notably, for many of the genes identified in GWAS studies, protective human variants were in targets involved directly in fat metabolism, transport, and / or located at lipid droplets. Perhaps by focusing on human genes involved in a different axis important for hepatocyte metabolism, mitochondrial function (Moore, M. P., et al, Hepatology, 2022), it may be possible to identify targetable pathways to prevent liver injury- without worsening cardiac outcomes. Described herein is data that shows that the loss of EF-hand domain family member DI (EFHD1) is such a target.
[0149] Human GWAS of metabolic-associated steatohepatitis (MASH), the most common liver disease worldwide, have examined either liver injury biomarkers or liver fat content, with lipid metabolism enzymes ranked highly in both analyses. As described herein, pathophysiological pathways independent of lipid metabolism were defined, focused on a gene of unknown function found in liver biomarker but not liver fat GWAS, EFHD1. Further disclosed herein, is EFHD1 identified as the factor transducing endoplasmic reticulum calcium (Ca2+) release into a mitochondrial fission signal. Mechanistically, EFHD1 ablation prevented Ca2+-dependent actin rearrangements that support fission. Moreover, EFHD1 was ATTORNEY DOCKET NO 21101.0493P1
[0150] important for increased hepatocyte mitochondrial fission noted during MASH, and promoted cytoplasmic release of mitochondrial double-stranded RNA, a damage-associated molecular pattern driving an integrated stress response and injury via the protein kinase PKR. Finally, acutely inhibiting EFHD1 in mice developing MASH did not substantially alter steatosis but blunted hepatocyte injury, inflammation, and fibrosis.
[0151] EFHD1 is a 27-kDa protein expressed in multiple tissues. It contains two Cambinding EF-hand domains, and disordered and coiled-coiled domains (Mun, S. A., et al., Front Cell Dev Biol, 2020. 8: p. 628222; and Tominaga, M., et al. (2006). JNeurochem 96, 292-304). These last two domains may be important for varied protein-protein interactions. In its initial characterization, it was found to be a nuclear-encoded protein that localized predominantly to mitochondria. Though expression in the liver is lower than in heart or kidney (Eberhardt, D. R., et al. (2022) J Mol Cell Cardiol. 10), human genetic data suggests EFHD1 has strong effects on liver physiol ogy.
[0152] EFHD1 is a marker of differentiated state lost in certain cancers (Lucas, B., et al., Oncogene, 2005. 24(42): p. 6418-31; and Mandruzzato. S., et al., J Transl Med, 2006. 4: p.
[0153] 50), with high expression associated with favorable outcomes in renal cancer, worse outcomes in breast cancer, and no effect on hepatocellular cancer (TCGA evidence in Human Protein Atlas). Mitochondrial function was also altered in pro-B immune cells after EFHD1 inhibition, with a shift towards glycolysis (Stein, M., et al., Cell Death Differ, 2017. 24(7): p.
[0154] 1239-1252), and its expression in pancreatic cell lines increases when an important component of the mitochondrial anti-oxidant system, superoxide dismutase 2, is downregulated (Hurt, E. M., et al., Br J Cancer, 2007. 97(8): p. 1116-23). Studies of wholebody Efhdl- / - mice found lowered basal respiration and ATP production in dorsal root ganglion, without significant neurological deficiencies (Ulisse, V., et al., Life Sci Alliance.
[0155] 2020. 3(7), PMC723298543). Despite these limited descriptions of phenotypes associated with EFHD1 inhibition, and despite its clear importance to hepatic biology, the mechanism of EFHD1 activity is unknown and there have been no studies of EFHD1 function in liver.
[0156] Variation in the EFHD1 locus has been consistently associated with serum levels of liver enzymes, including in studies of American, British, European, and Japanese populations (Chambers, J. C., et al. (2011). Nat Genet 43, 1131-1138; Kanai, M., et al. (2018). Nat Genet 50, 390-400; Pazoki, R., et al. (2021). Nat Commun 12, 2579; and Ward, L. D., et al. (2021). Nat Commun 12, 4571). The variant with strongest effect, rs13395911, was recently shown to alter liver-specific expression of EFHD1 (Currin, K. W., et al. (2021). Am J Hum Genet 108, 1169-1189; and Pandey, G. K., et al. (2024). HGG Adv 5, 100275). The T variant at this ATTORNEY DOCKET NO 21101.0493P1
[0157] locus (frequency ~0.6) is associated with higher serum liver enzymes, and increases both hepatocyte expression and chromatin accessibility for EFHD1 by encoding abetter consensus sequence for potential binding of several hepatic transcription factors, including FOXA2, FOXO1, or HNF4A (Currin, K. W., et al. (2021). Am J Hum Genet 108, 1169-1189; Pandey, G. K., et al. (2024). HGG Adv 5, 100275; and Hong, S. E., et al. (2025). Nat Genet 57, 1638-1648). The protective A variant, on the other hand, is associated with both reduced EFHD1 and serum liver enzymes. However, though alterations in EFHD1 are associated with changes in metabolism in different cell types, no consistent pattern emerges, with variable effects on glycolysis and fatty acid metabolism (Pandey, G. K., et al. (2024). HGG Adv 5, 100275; Hong, S. E., et al. (2025). Nat Genet 57, 1638-1648; Stem, M., et al. (2017). Cell Death Differ 24, 1239-1252; and Ulisse, V.. et al. (2020). Life Sci Alliance 3). Thus, whether EFHD1 truly contributes to MASH progression, and by what mechanism it acts, remain unanswered questions.
[0158] As disclosed herein, it was established that loss of hepatocyte EFHD1 in a mouse model of diet-induced MASH is protective, reducing levels of inflammation and fibrosis. Notably, these effects occur independently of changes in organismal energy balance or liver steatosis, consistent with EFHD1 being identified in liver enzyme but not liver fat GW AS. Within cells, loss of EFHD1 leads to an increase in mitochondrial size. Ca2+was established to trigger mitochondrial fission (Breckenridge, D. G., et al. (2003). J Cell Biol 160, 1115-1127), yet the Ca2+sensor for this signal remained elusive. The data described herein shows that EFHD1 is this long-sought transducer for this fundamental aspect of cellular physiology, Ca2+-induced mitochondrial fission (Fung, T. S., et al. (2023). Nat Rev Mol Cell Biol 24, 651-667). As MASH progresses, EFHD1 activity' leads to increased mitochondrial fission. In this period, it was also identified that an injury pathway involving the release of mitochondrial double-stranded RNA (mt-dsRNA), a damage-associated molecular pattern that activates the integrated stress response (ISR) via the protein kinase PKR. This PKR-dependent ISR appears to be overactive, as inhibition of EFHD1 reduces its levels and leads to less hepatocyte injury, inflammation and fibrosis. Finally, the results show that acute EFHD1 knockdown with viral transduction of short-hairpin RNAs also leads to reduced liver injury and fibrosis, demonstrating that EFHD1 can be a target for treating metabolic liver disease.
[0159] Multiple human genetic studies across a variety of populations (American, European, Japanese) have shown that reduction in the expression of EFHD1 is associated with protection from liver injury’. Using mouse models, deletion of EFHD1 is associated with less weight gain, reduced fatty liver, and reduced serum markers of liver injury when fed a high- ATTORNEY DOCKET NO 21101.0493P1
[0160] fat diet. Disclosed herein are methods, based on RNA interference, to inhibit the expression ofEFHDl.
[0161] Being based on human genetic studies, the compositions and methods disclosed herein are likely to be better tolerated than anti-diabetic medications, which have several known, serious side-effects. In addition, the knockout mice used in the Examples described herein have no adverse phenotypes at baseline and are healthy, demonstrating a positive safety profile of inhibiting EFHD1. Moreover, the compositions and methods disclosed herein can meet the unmet need for therapies for NASH and obesity including pediatric obesity.
[0162] There are no currently-approved, effective therapies for NASH. Recent drug trials for NASH have failed. Pharmacological therapies are available for treating patients with obesity and diabetes (e.g., DPP-4 inhibitors, GLP-1 agonists). Weight reduction surgery is also an option for advanced morbid obesity. Therapies for obesity' and pediatric obesity in the absence of diabetes, or very' advanced morbid obesity, are lacking.
[0163] The compositions and methods disclosed herein can be used to slow the progress of metabolic-associated liver disease (previously known as NASH), as well be a useful therapy for obesity including pediatric obesity.
[0164] COMPOSITIONS
[0165] Disclosed herein are target sequences and nucleic acids useful in the methods described herein. In some aspects, the target sequence(s) can be selected from one or more of the sequences listed in Table 1. In some aspects, the target sequence can be EFHD1 gene (also known as Swiprosin-2). In some aspects, the target sequence can be a gene or gene fragment of a sequence of gene ID 98363 (mouse), gene ID 80303 (human), gene ID 486164 (canine), gene ID 501181 (rat), gene ID 717627 (macaque), or a sequence having 80. 85. 90, 95, 96, 97, 98, or 99% identity to any one of these genes. In some aspects, the target sequence is the mRNA transcribed from gene ID 98363 (mouse), gene ID 80303 (human), gene ID 486164 (canine), gene ID 501181 (rat), gene ID 717627 (macaque), or a sequence having 80, 85, 90, 95, 96, 97, 98, or 99% identity to any one of these genes. In some aspects, the target sequence can encompass a fragment of the mRNA transcribed from gene ID 98363 (mouse), gene ID 80303 (human), gene ID 486164 (canine), gene ID 501181(rat), gene ID 717627 (macaque), or a sequence having 80, 85, 90, 95, 96, 97, 98, or 99% identity to any one of these genes. In some aspects, the target sequence can encompass or can be SEQ ID NO: 237, SEQ ID NO: 238 or SEQ ID NO: 239 or a fragment thereof. In some aspects, the target sequence can be SEQ ID NO: 240 or a fragment thereof. In some aspects, the target sequence ATTORNEY DOCKET NO 21101.0493P1
[0166] can be SEQ ID NO: 241 or a fragment thereof. In some aspects, the target sequence can be SEQ ID NO: 242 or a fragment thereof. As used herein, the term “target sequence" as described herein is a target DNA sequence as used for definition of transcript variants in databases used for the purposes of designing siRNAs, whereas the specific compounds to be used will be RNA sequences defined as such.
[0167] A gene is “targeted” by a siRNA as described herein when, for example, the siRNA molecule selectively decreases or inhibits the expression of the gene. The phrase “selectively decrease or inhibit” as used herein encompasses siRNAs that affect expression of one gene, in this case EFHD1. Alternatively, a siRNA targets a gene when (one strand of) the siRNA hybridizes under stringent conditions to the gene transcript, i.e., its mRNA. Hybridizing “under stringent conditions” means annealing to the target sequence under standard conditions, e.g., high temperature and / or low salt content which tend to disfavor hybridization. A suitable protocol (involving 0.1. times. SSC, 68. degree. C. for 2 hours) is described in Maniatis, T., et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, 1982, on pages 387-389.
[0168] In some aspects, the target sequence can encompass the EFHD1 central EF-hand domains or a part or a portion of the EFHD1 EF-hand domains. EFHD1 has several main domains: an N-terminal intrinsically -disordered region and proline-rich region, a central pair of EF-hand domains that bind calcium, and a C-terminal coiled-coil domain which may include a ligand-mimic helix. Together, these domains allow it to bind actin, sense calcium, and localize to the mitochondria, influencing mitochondrial function and cellular processes like differentiation and metabolism. The central EF-hand domains are the functional part of the EFHD1 protein that binds calcium. In some aspects, to achieve a strong loss of function, the siRNA sequence can target the EFHD1 N-terminal EF-hand domain.
[0169] In some aspects, a target sequence described herein can comprise or consist of at least one sequence selected from SEQ ID NO: 240 to SEQ ID NO: 242.
[0170] Table 1: Examples of Target Sequences
[0171] Target Gene Sequence SEQ
[0172] ID NO.
[0173] EFHD1 GCCAGTTTCTAACATCTGTTT 240
[0174] EFHD1 CCAGAAACTCAAGGCCAACTT 241
[0175]
[0176] ATTORNEY DOCKET NO 21101.0493P1
[0177] EFHD1 GCAGAGTTGAAAGCTGAGCAA 242
[0178]
[0179] The human coding mRNA for EFHD1, transcript variant 1 is:
[0180] GGAGTGTTGTAGAGCCTCGAGCCTGCGAGGAGCGCGCCGCCCGCCAGCTCCCTG CGTCCCGTCCCGCGTCCCCGCGTTCCCGCGTCCTGCGATCCGCCGCCATGGCCAG TGAGGAGCTGGCGTGCAAGCTGGAGCGCCGGCTGCGGCGCGAGGAGGCCGAGG AGAGTGGCCCCCAGCTGGCTCCCCTCGGCGCCCCAGCCCCGGAGCCCAAGCCCG AGCCCGAGCCTCCCGCCCGTGCGCCCACGGCCAGCGCCGACGCGGAGCTGAGCG CCCAGCTGAGCCGGCGGCTGGACATCAACGAGGGCGCTGCGCGGCCCCGGCGCT GCAGGGTCTTCAACCCCTACACGGAGTTCCCGGAGTTCAGCCGCCGCCTCATCAA GGACCTGGAGAGCATGTTCAAACTGTATGACGCTGGGCGGGATGGCTTCATCGA CCTGATGGAGCTGAAGCTGATGATGGAGAAGCTGGGGGCCCCCCAGACCCACCT GGGCCTGAAGAGCATGATCAAGGAGGTGGATGAGGACTTCGATGGCAAGCTCAG CTTCCGGGAGTTCCTGCTCATTTTCCACAAGGCCGCGGCAGGGGAGCTGCAGGA GGACAGTGGGCTGATGGCGCTGGCAAAGCTTTCTGAGATCGATGTGGCCCTGGA GGGTGTCAAAGGTGCCAAGAACTTCTTTGAAGCCAAGGTCCAAGCCTTGTCATCG GCCAGTAAGTTTGAAGCAGAGTTGAAAGCTGAGCAAGATGAGCGGAAGCGGGA GGAGGAGGAGAGGCGGCTCCGCCAGGCAGCCTTCCAGAAACTCAAGGCCAACTT CAATACATAGTCCTGCTGACCTTGCCCTCTGCCCACAGCTGTGCCTCACAGATGC CCCGAGAAGAGATGACTAGGCATCTTCATCACTGCTGTCGGTCCCCTCCCTGAGC CAGCATCTCCATCCACCACCCCGTGCCAGCTCCCGTGCCAGCCTTCATTCCTCCC AGTGTCCAAGCCCCTCCAGGAGGGTCCTGGGGTGGGCCAGATGCCTGCCCACCT CTGTCTCCTGCCTCTGCTCCTCTGCCCTTCTTATAGCCAGAACTTGTATCTTCTCA GCAACCTTCACTTTGTCCTTGTCCCTTTACCATTCCCCATCAAAGAGTAGTCTGCT ATATCAATTTGTGTAGATATGTCTGTCTTTTTGGGTCCTCAGAGAAAATGCCCATT TTCTCGGAGAATTCTCTGCACTCCTCTCTGCTTCACATTCAACTTCCCTGTTCTCA TCTTTGGTAGGATTCTGCCAGTTGCTTTTGCATCTTCTGTTCCTGGGTAATGGTGG GTCTTAATGGAGGCTGGGTGGACCACTGCCCGTCCACTCTTCAACAGGAGGAAC AGCATGCCACCATAGTAACACACATTAGAGAAAGGACAGAGGTCTGCTCCTTCC TGCCACCTTTCTCCTGGCCCCTTAGCATTCCCCCAGTCCCTCCCTCTTCACCTTGC TCCGTCTATGTCTTCCCAGCTCAGCCTTTTCCCCACTCTTAAATACTGTACTACTT CACTGTAAGAACGAAAGAATAGTTAGGATACCAATGAGTAAAAGGGTTCCTGTT CACTCTGACTCTGTGCAAATTGTATTACAGTAGACCGCTGACGTTCCCAAGTGAC ATTORNEY DOCKET NO 21101.0493P1
[0181] AGATCCAGGGCCTTTCAAACATCCCCAAAGTCATGGCCATACTCACCATTAGCCA GTTTCTAACATCTGTTTCAGGGTATCCAGCTGTAGATGTTCTTATCCCCCATACTT GTGAGTTCTTGGGGTTGCTCACAAATACTAGGGGTTTTTGTTGTATTTTTAACAAA TATATCCTAATGTCATATTTATTCTCTTTTGTAACTGCTGTCTTTACAATAAAGAA ATCATCTGCCTTTCTA (SEQ ID NO: 237; NM 025202.4).
[0182] The human coding mRNA for EFHD1, transcript variant 2 is:
[0183] GCTAAGTGCAGGCGGATACCCCGGCCTTGGCGGCTGCTTGCCTTTCTCCGTACTG TCCCTGTGAAGGCCAAGATCTGTAACGCTGACAGTCCCCAGACATACGATGGGA GAGTTGCAGTATGACGCTGGGCGGGATGGCTTCATCGACCTGATGGAGCTGAAG CTGATGATGGAGAAGCTGGGGGCCCCCCAGACCCACCTGGGCCTGAAGAGCATG ATCAAGGAGGTGGATGAGGACTTCGATGGCAAGCTCAGCTTCCGGGAGTTCCTG CTCATTTTCCACAAGGCCGCGGCAGGGGAGCTGCAGGAGGACAGTGGGCTGATG GCGCTGGCAAAGCTTTCTGAGATCGATGTGGCCCTGGAGGGTGTCAAAGGTGCC AAGAACTTCTTTGAAGCCAAGGTCCAAGCCTTGTCATCGGCCAGTAAGTTTGAAG CAGAGTTGAAAGCTGAGCAAGATGAGCGGAAGCGGGAGGAGGAGGAGAGGCGG CTCCGCCAGGCAGCCTTCCAGAAACTCAAGGCCAACTTCAATACATAGTCCTGCT GACCTTGCCCTCTGCCCACAGCTGTGCCTCACAGATGCCCCGAGAAGAGATGACT AGGCATCTTCATCACTGCTGTCGGTCCCCTCCCTGAGCCAGCATCTCCATCCACC ACCCCGTGCCAGCTCCCGTGCCAGCCTTCATTCCTCCCAGTGTCCAAGCCCCTCC AGGAGGGTCCTGGGGTGGGCCAGATGCCTGCCCACCTCTGTCTCCTGCCTCTGCT CCTCTGCCCTTCTTATAGCCAGAACTTGTATCTTCTCAGCAACCTTCACTTTGTCC TTGTCCCTTTACCATTCCCCATCAAAGAGTAGTCTGCTATATCAATTTGTGTAGAT ATGTCTGTCTTTTTGGGTCCTCAGAGAAAATGCCCATTTTCTCGGAGAATTCTCTG CACTCCTCTCTGCTTCACATTCAACTTCCCTGTTCTCATCTTTGGTAGGATTCTGC CAGTTGCTTTTGCATCTTCTGTTCCTGGGTAATGGTGGGTCTTAATGGAGGCTGGG TGGACCACTGCCCGTCCACTCTTCAACAGGAGGAACAGCATGCCACCATAGTAA CACACATTAGAGAAAGGACAGAGGTCTGCTCCTTCCTGCCACCTTTCTCCTGGCC CCTTAGCATTCCCCCAGTCCCTCCCTCTTCACCTTGCTCCGTCTATGTCTTCCCAG CTCAGCCTTTTCCCCACTCTTAAATACTGTACTACTTCACTGTAAGAACGAAAGA ATAGTTAGGATACCAATGAGTAAAAGGGTTCCTGTTCACTCTGACTCTGTGCAAA TTGTATTACAGTAGACCGCTGACGTTCCCAAGTGACAGATCCAGGGCCTTTCAAA CATCCCCAAAGTCATGGCCATACTCACCATTAGCCAGTTTCTAACATCTGTTTCA GGGTATCCAGCTGTAGATGTTCTTATCCCCCATACTTGTGAGTTCTTGGGGTTGCT CACAAATACTAGGGGTTTTTGTTGTATTTTTAACAAATATATCCTAATGTCATATT ATTORNEY DOCKET NO 21101.0493P1
[0184] TATTCTCTTTTGTAACTGCTGTCTTTACAATAAAGAAATCATCTGCCTTTCTA (SEQ ID NO: 238; NM 001243252.2).
[0185] The human coding mRNA for EFHD1, transcript variant 3 is:
[0186] GGAGTGTTGTAGAGCCTCGAGCCTGCGAGGAGCGCGCCGCCCGCCAGCTCCCTG CGTCCCGTCCCGCGTCCCCGCGTTCCCGCGTCCTGCGATCCGCCGCCATGGCCAG TGAGGAGCTGGCGTGCAAGCTGGAGCGCCGGCTGCGGCGCGAGGAGGCCGAGG AGAGTGGCCCCCAGCTGGCTCCCCTCGGCGCCCCAGCCCCGGAGCCCAAGCCCG AGCCCGAGCCTCCCGCCCGTGCGCCCACGGCCAGCGCCGACGCGGAGCTGAGCG CCCAGCTGAGCCGGCGGCTGGACATCAACGAGGGCGCTGCGCGGCCCCGGCGCT GCAGGGTCTTCAACCCCTACACGGAGTTCCCGGAGTTCAGCCGCCGCCTCATCAA GGACCTGGAGAGCATGTTCAAACTAATCTGAAACGGTGATGTCATGGATGTCCT GCCAGTGCCAGAGTCCCGCGTTACCAAGACACCAGTGAAACCCAAAAAGGTATG ACGCTGGGCGGGATGGCTTCATCGACCTGATGGAGCTGAAGCTGATGATGGAGA AGCTGGGGGCCCCCCAGACCCACCTGGGCCTGAAGAGCATGATCAAGGAGGTGG ATGAGGACTTCGATGGCAAGCTCAGCTTCCGGGAGTTCCTGCTCATTTTCCACAA GGCCGCGGCAGGGGAGCTGCAGGAGGACAGTGGGCTGATGGCGCTGGCAAAGC TTTCTGAGATCGATGTGGCCCTGGAGGGTGTCAAAGGTGCCAAGAACTTCTTTGA AGCCAAGGTCCAAGCCTTGTCATCGGCCAGTAAGTTTGAAGCAGAGTTGAAAGC TGAGCAAGATGAGCGGAAGCGGGAGGAGGAGGAGAGGCGGCTCCGCCAGGCAG CCTTCCAGAAACTCAAGGCCAACTTCAATACATAGTCCTGCTGACCTTGCCCTCT GCCCACAGCTGTGCCTCACAGATGCCCCGAGAAGAGATGACTAGGCATCTTCAT CACTGCTGTCGGTCCCCTCCCTGAGCCAGCATCTCCATCCACCACCCCGTGCCAG CTCCCGTGCCAGCCTTCATTCCTCCCAGTGTCCAAGCCCCTCCAGGAGGGTCCTG GGGTGGGCCAGATGCCTGCCCACCTCTGTCTCCTGCCTCTGCTCCTCTGCCCTTCT TATAGCCAGAACTTGTATCTTCTCAGCAACCTTCACTTTGTCCTTGTCCCTTTACC ATTCCCCATCAAAGAGTAGTCTGCTATATCAATTTGTGTAGATATGTCTGTCTTTT TGGGTCCTCAGAGAAAATGCCCATTTTCTCGGAGAATTCTCTGCACTCCTCTCTG CTTCACATTCAACTTCCCTGTTCTCATCTTTGGTAGGATTCTGCCAGTTGCTTTTG CATCTTCTGTTCCTGGGTAATGGTGGGTCTTAATGGAGGCTGGGTGGACCACTGC CCGTCCACTCTTCAACAGGAGGAACAGCATGCCACCATAGTAACACACATTAGA GAAAGGACAGAGGTCTGCTCCTTCCTGCCACCTTTCTCCTGGCCCCTTAGCATTC CCCCAGTCCCTCCCTCTTCACCTTGCTCCGTCTATGTCTTCCCAGCTCAGCCTTTTC CCCACTCTTAAATACTGTACTACTTCACTGTAAGAACGAAAGAATAGTTAGGATA CCAATGAGTAAAAGGGTTCCTGTTCACTCTGACTCTGTGCAAATTGTATTACAGT ATTORNEY DOCKET NO 21101.0493P1
[0187] AGACCGCTGACGTTCCCAAGTGACAGATCCAGGGCCTTTCAAACATCCCCAAAG TCATGGCCATACTCACCATTAGCCAGTTTCTAACATCTGTTTCAGGGTATCCAGCT GTAGATGTTCTTATCCCCCATACTTGTGAGTTCTTGGGGTTGCTCACAAATACTAG GGGTTTTTGTTGTATTTTTAACAAATATATCCTAATGTCATATTTATTCTCTTTTGT AACTGCTGTCTTTACAATAAAGAAATCATCTGCCTTTCTA (SEQ ID NO: 239; NM 001308395.2).
[0188] Disclosed herein compositions comprising a double stranded RNAi agent that inhibits the expression of EF-Hand Domain Family Member DI (EFHD1) in a cell. Also disclosed herein are compositions comprising a double stranded RNAi agent that inhibits the expression of EF-Hand Domain Family Member DI (EFHD1) in a cell comprising an antisense strand comprising or consisting of a sequence having at least 90% identity to SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138. 140, 142, 144, 146, 148, 150, 152. 154, 156, 158, 160, 162. 164, 166, 168, 170, 172, 174. 176, 178, 180. 182, 184. 186, 188. 190. 192, 194. 196, 198. 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, or 236 and a sense strand comprising or consisting of the nucleotide sequence of SEQ ID NOs: 1, 3, 5, 7, 8, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33. 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83. 85. 87. 89. 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217. 219, 221, 223, 225, 227, 229, 231. 233, or 235.
[0189] Disclosed herein are siRNA molecules. Disclosed herein are siRNA molecules comprising a sense strand and an antisense strand. Also, disclosed herein are compositions comprising any of the siRNA molecules described herein or recited in Table 2. In some aspects, the siRNA molecule can be a sense strand. In some aspects, the siRNA molecule can be an antisense strand.
[0190] Disclosed herein are compositions comprising a nucleic acid sequence or molecule wherein the nucleic acid comprises or consists of a sequence having the sequence set forth in: UUCAGCUCCAUCAGGUCGAUG (SEQ ID NO: 2), UUCAGCUCCAUCAGGUCGAUGAA (SEQ ID NO: 4), UUCUCCAUCAUCAGCUUCAGC (SEQ ID NO: 6), ATTORNEY DOCKET NO 21101.0493P1
[0191] UUCUCCAUCAUCAGCUUCAGCUC (SEQ ID NO: 8), UUCAGGCCCAGGUGGGUCUGG (SEQ ID NO: 10), UUCAGGCCCAGGUGGGUCUGGUG (SEQ ID NO: 12), ACCUUGGCUUCAAAGAAGUUC (SEQ ID NO: 14), ACCUUGGCUUCAAAGAAGUUCUU (SEQ ID NO: 16), AAACUUACUGGCCGAUGACAA (SEQ ID NO: 18), AAACUUACUGGCCGAUGACAAGG (SEQ ID NO: 20).
[0192] GAACAUGCUCUCCAGGUCCUU (SEQ ID NO: 22), GAACAUGCUCUCCAGGUCCUUGA (SEQ ID NO: 24), ACAGUUUGAACAUGCUCUCCA (SEQ ID NO: 26), ACAGUUUGAACAUGCUCUCCAGG (SEQ ID NO: 28).
[0193] UCUGCUUCAAACUUACUGGCC (SEQ ID NO: 30), UCUGCUUCAAACUUACUGGCCGA (SEQ ID NO: 32), GCUCAGCUUUCAACUCUGCUU (SEQ ID NO: 34), GCUCAGCUUUCAACUCUGCUCCA (SEQ ID NO: 36), or GUUGGCCUUGAGUUUCUGGAA (SEQ ID NO: 38).
[0194] Disclosed herein are compositions comprising a nucleic acid sequence or molecule wherein the nucleic acid comprises or consists of a sequence having at least 90% identity to the sequence set forth in: UUCAGCUCCAUCAGGUCGAUG (SEQ ID NO: 2), UUCAGCUCCAUCAGGUCGAUGAA (SEQ ID NO: 4), UUCUCCAUCAUCAGCUUCAGC (SEQ ID NO: 6), UUCUCCAUCAUCAGCUUCAGCUC (SEQ ID NO: 8), UUCAGGCCCAGGUGGGUCUGG (SEQ ID NO: 10), UUCAGGCCCAGGUGGGUCUGGUG (SEQ ID NO: 12).
[0195] ACCUUGGCUUCAAAGAAGUUC (SEQ ID NO: 14), ACCUUGGCUUCAAAGAAGUUCUU (SEQ ID NO: 16), AAACUUACUGGCCGAUGACAA (SEQ ID NO: 18), AAACUUACUGGCCGAUGACAAGG (SEQ ID NO: 20).
[0196] GAACAUGCUCUCCAGGUCCUU (SEQ ID NO: 22).
[0197] GAACAUGCUCUCCAGGUCCUUGA (SEQ ID NO: 24), ACAGUUUGAACAUGCUCUCCA (SEQ ID NO: 26), ACAGUUUGAACAUGCUCUCCAGG (SEQ ID NO: 28), UCUGCUUCAAACUUACUGGCC (SEQ ID NO: 30).
[0198] UCUGCUUCAAACUUACUGGCCGA (SEQ ID NO: 32), ATTORNEY DOCKET NO 21101.0493P1
[0199] GCUCAGCUUUCAACUCUGCUU (SEQ ID NO: 34), GCUCAGCUUUCAACUCUGCUCCA (SEQ ID NO: 36), or GUUGGCCUUGAGUUUCUGGAA (SEQ ID NO: 38).
[0200] Table 2: Examples of siRNA Sequences
[0201] Name Sense Antisense
[0202] UC GACCUGAUGGAGCUGAAGC UUCAGCUCCAUCAGGUCGAUG la (SEQ ID NO: 1) (SEQ ID NO: 2)
[0203] CAUCGACCUGAUGGAGCUGAA UUCAGCUCCAUCAGGUCGAUGAA
[0204] lb (SEQ ID NO: 3) (SEQ ID NO: 4)
[0205] UGAAGCUGAUGAUGGAGAAGC UUCUCCAUCAUCAGCUUCAGC
[0206] 2a (SEQ ID NO: 5) (SEQ ID NO: 6)
[0207] GCUGAAGCUGAUGAUGGAGAA UUCUCCAUCAUCAGCUUCAGCUC
[0208] 2b (SEQ ID NO: 7) (SEQ ID NO: 8)
[0209] AGACCCACCUGGGCCUGAAGA UUCAGGCCCAGGUGGGUCUGG
[0210] 3a (SEQ ID NO: 9) (SEQ ID NO: 10)
[0211] CCAGACCCACCUGGGCCUGAA UUCAGGCCCAGGUGGGUCUGGUG
[0212] 3b (SEQ ID NO: 11) (SEQ ID NO: 12)
[0213] ACUUCUUUGAAGCCAAGGUCC ACCUUGGCUUCAAAGAAGUUC
[0214] 4a (SEQ ID NO: 13) (SEQ ID NO: 14)
[0215] GAACUUCUUUGAAGCCAAGGU ACCUUGGCUUCAAAGAAGUUCUU
[0216] 4b (SEQ ID NO: 15) (SEQ ID NO: 16)
[0217] GUCAUCGGCCAGUAAGUUUGA AAACUUACUGGCCGAUGACAA
[0218] 5a (SEQ ID NO: 17) (SEQ ID NO: 18)
[0219] UUGUC AUC GGC C AGUAAGUUU AAACUUACUGGCCGAUGACAAGG
[0220] 5b (SEQ ID NO: 19) (SEQ ID NO: 20)
[0221] GGACCUGGAGAGCAUGUUCAA GAACAUGCUCUCCAGGUCCUU
[0222] 6a (SEQ ID NO: 21) (SEQ ID NO: 22)
[0223] AAGGACCUGGAGAGCAUGUUC GAACAUGCUCUCCAGGUCCUUGA
[0224] 6b (SEQ ID NO: 23) (SEQ ID NO: 24)
[0225] GAGAGCAUGUUCAAACUGUAU ACAGUUUGAACAUGCUCUCCA
[0226] 7a (SEQ ID NO: 25) (SEQ ID NO: 26)
[0227] UGGAGAGCAUGUUCAAACUGU ACAGUUUGAACAUGCUCUCCAGG
[0228] 7b (SEQ ID NO: 27) (SEQ ID NO: 28)
[0229] CCAGUAAGUUUGAAGCAGAGU UCUGCUUCAAACUUACUGGCC
[0230] 8a (SEQ ID NO: 29) (SEQ ID NO: 30)
[0231] GGC C AGUAAGUUUGAAGC AGA UCUGCUUCAAACUUACUGGCCGA
[0232] 8b (SEQ ID NO: 31) (SEQ ID NO: 32)
[0233] GCAGAGUUGAAAGCUGAGCAA GCUCAGCUUUCAACUCUGCUU
[0234] 9a (SEQ ID NO: 33) (SEQ ID NO: 34)
[0235] GAGCAGAGUUGAAAGCUGAGC GCUCAGCUUUCAACUCUGCUCCA
[0236] 9b (SEQ ID NO: 35) (SEQ ID NO: 36)
[0237] CCAGAAACUCAAGGCCAACUU GUUGGCCUUGAGUUUCUGGAA
[0238] 10a (SEQ ID NO: 37) (SEQ ID NO: 38)
[0239] UUCCAGAAACUCAAGGCCAAC GUUGGCCUUGAGUUUCUGGAAGG
[0240] 10b (SEQ ID NO: 39) (SEQ ID NO: 40)
[0241] CGAAAGAAUAGUUAGGAUACC UAUCCUAACUAUUCUUUCGUU
[0242]
[0243] Ila (SEQ ID NO: 41) (SEQ ID NO: 42) ATTORNEY DOCKET NO 21101.0493P1
[0244] AACGAAAGAAUAGUUAGGAUA UAUCCUAACUAUUCUUUCGUUCU
[0245] lib (SEQ ID NO: 43) (SEQ ID NO: 44)
[0246] GUAACACACAUUAGAGAAAGG UUUCUCUAAUGUGUGUUACUA
[0247] 12a (SEQ ID NO: 45) (SEQ ID NO: 46)
[0248] UAGUAACACACAUUAGAGAAA UUUCUCUAAUGUGUGUUACUAUG
[0249] 12b (SEQ ID NO: 47) (SEQ ID NO: 48)
[0250] CUGUAAGAACGAAAGAAUAGU UAUUCUUUCGUUCUUACAGUG
[0251] 13a (SEQ ID NO: 49) (SEQ ID NO: 50)
[0252] CACUGUAAGAACGAAAGAAUA UAUUCUUUCGUUCUUACAGUGAA
[0253] 13b (SEQ ID NO: 51) (SEQ ID NO: 52)
[0254] AGUUGAAAGCUGAGCAAGAUG UCUUGCUCAGCUUUCAACUCU
[0255] 14a (SEQ ID NO: 53) (SEQ ID NO: 54)
[0256] AGAGUUGAAAGCUGAGCAAGA UCUUGCUCAGCUUUCAACUCUGC
[0257] 14b (SEQ ID NO: 55) (SEQ ID NO: 56)
[0258] CAGCAUGCCACCAUAGUAACA UUACUAUGGUGGCAUGCUGUU
[0259] 15a (SEQ ID NO: 57) (SEQ ID NO: 58)
[0260] AACAGCAUGCCACCAUAGUAA UUACUAUGGUGGCAUGCUGUUCC
[0261] 15b (SEQ ID NO: 59) (SEQ ID NO: 60)
[0262] AGGCCAACUUCAAUACAUAGU UAUGUAUUGAAGUUGGCCUUG
[0263] 16a (SEQ ID NO: 61) (SEQ ID NO: 62)
[0264] C AAGGCC AAC UUC AAUAC AUA UAUGUAUUGAAGUUGGCCUUGAG
[0265] 16b (SEQ ID NO: 63) (SEQ ID NO: 64)
[0266] ACGAAAGAAUAGUUAGGAUAC AUCCUAACUAUUCUUUCGUUC
[0267] 17a (SEQ ID NO: 65) (SEQ ID NO: 66)
[0268] GAACGAAAGAAUAGUUAGGAU AUCCUAACUAUUCUUUCGUUCUU
[0269] 17b (SEQ ID NO: 67) (SEQ ID NO: 68)
[0270] UGGCAAAGCUUUCUGAGAUCG AUCUCAGAAAGCUUUGCCAGC
[0271] 18a (SEQ ID NO: 69) (SEQ ID NO: 70)
[0272] GCUGGC AAAGC UUUCUGAGAU AUCUCAGAAAGCUUUGCCAGCGC
[0273] 18b (SEQ ID NO: 71) (SEQ ID NO: 72)
[0274] AAGCAGAGUUGAAAGCUGAGC UCAGCUUUCAACUCUGCUUCA
[0275] 19a (SEQ ID NO: 73) (SEQ ID NO: 74)
[0276] UGAAGCAGAGUUGAAAGCUGA UCAGCUUUCAACUCUGCUUCAAA
[0277] 19b (SEQ ID NO: 75) (SEQ ID NO: 76)
[0278] UCCAGAAACUCAAGGCCAACU UUGGCCUUGAGUUUCUGGAAG
[0279] 20a (SEQ ID NO: 77) (SEQ ID NO: 78)
[0280] CUUCCAGAAACUCAAGGCCAA UUGGCCUUGAGUUUCUGGAAGGC
[0281] 20b (SEQ ID NO: 79) (SEQ ID NO: 80)
[0282] ACACAUUAGAGAAAGGACAGA UGUCCUUUCUCUAAUGUGUGU
[0283] 21a (SEQ ID NO: 81) (SEQ ID NO: 82)
[0284] ACACACAUUAGAGAAAGGACA UGUCCUUUCUCUAAUGUGUGUUA
[0285] 21b (SEQ ID NO: 83) (SEQ ID NO: 84)
[0286] ACUGUAAGAACGAAAGAAUAG AUUCUUUCGUUCUUACAGUGA
[0287] 22a (SEQ ID NO: 85) (SEQ ID NO: 86)
[0288] UCACUGUAAGAACGAAAGAAU AUUCUUUCGUUCUUACAGUGAAG
[0289] 22b (SEQ ID NO: 87) (SEQ ID NO: 88)
[0290] AUGAGGACUUCGAUGGCAAGC UUGCCAUCGAAGUCCUCAUCC
[0291] 23a (SEQ ID NO: 89) (SEQ ID NO: 90)
[0292]
[0293] 23b GGAUGAGGACUUCGAUGGCAA UUGCCAUCGAAGUCCUCAUCCAC ATTORNEY DOCKET NO 21101.0493P1
[0294] (SEQ ID NO: 91) (SEQ ID NO: 92) AGUUUGAAGCAGAGUUGAAAG UUCAACUCUGCUUCAAACUUA a (SEQ ID NO: 93) (SEQ ID NO: 94) UAAGUUUGAAGCAGAGUUGAA UUCAACUCUGCUUCAAACUUACU
[0295] b (SEQ ID NO: 95) (SEQ ID NO: 96) GAGAAGAGAUGACUAGGCAUC UGCCUAGUCAUCUCUUCUCGG a (SEQ ID NO: 97) (SEQ ID NO: 98)
[0296] CC GAGAAGAGAUGACUAGGC A UGCCUAGUCAUCUCUUCUCGGGG
[0297] b (SEQ ID NO: 99) (SEQ ID NO: 100) UUAGGAUACCAAUGAGUAAAA UUACUCAUUGGUAUCCUAACU a (SEQ ID NO: 101) (SEQ ID NO: 102) AGUUAGGAUACCAAUGAGUAA UUACUCAUUGGUAUCCUAACUAU
[0298] b (SEQ ID NO: 103) (SEQ ID NO: 104) UGUCAAAGGUGCCAAGAACUU GUUCUUGGCACCUUUGACACC a (SEQ ID NO: 105) (SEQ ID NO: 106) GGUGUCAAAGGUGCCAAGAAC GUUCUUGGC AC CUUUGAC ACC CU
[0299] b (SEQ ID NO: 107) (SEQ ID NO: 108) UCAAAGGUGCCAAGAACUUCU AAGUUCUUGGCACCUUUGACA a (SEQ ID NO: 109) (SEQ ID NO: 110) UGUCAAAGGUGCCAAGAACUU AAGUUCUUGGCACCUUUGACACC
[0300] b (SEQ ID NO: 111) (SEQ ID NO: 112) ACUUGUAUCUUCUCAGCAACC UUGCUGAGAAGAUACAAGUUC a (SEQ ID NO: 113) (SEQ ID NO: 114) GAACUUGUAUCUUCUCAGCAA UUGCUGAGAAGAUACAAGUUCUG
[0301] b (SEQ ID NO: 115) (SEQ ID NO: 116) CUGUACUACUUCACUGUAAGA UUACAGUGAAGUAGUACAGUA a (SEQ ID NO: 117) (SEQ ID NO: 118) UACUGUACUACUUCACUGUAA UUACAGUGAAGUAGUACAGUAUU
[0302] b (SEQ ID NO: 119) (SEQ ID NO: 120) CUUCACUGUAAGAACGAAAGA UUUCGUUCUUACAGUGAAGUA a (SEQ ID NO: 121) (SEQ ID NO: 122) UACUUCACUGUAAGAACGAAA UUUCGUUCUUACAGUGAAGUAGU
[0303] b (SEQ ID NO: 123) (SEQ ID NO: 124) UGUAAGAACGAAAGAAUAGUU CUAUUCUUUCGUUCUUACAGU a (SEQ ID NO: 125) (SEQ ID NO: 126) ACUGUAAGAAC GAA AG AAUAG CUAUUCUUUCGUUCUUACAGUGA
[0304] b (SEQ ID NO: 127) (SEQ ID NO: 128) GAAAGAAUAGUUAGGAUACCA GUAUCCUAACUAUUCUUUCGU a (SEQ ID NO: 129) (SEQ ID NO: 130) ACGAAAGAAUAGUUAGGAUAC GUAUCCUAACUAUUCUUUCGUUC
[0305] b (SEQ ID NO: 131) (SEQ ID NO: 132) GGCAAAGCUUUCUGAGAUCGA GAUCUCAGAAAGCUUUGCCAG a (SEQ ID NO: 133) (SEQ ID NO: 134) CUGGCAAAGCUUUCUGAGAUC GAUCUCAGAAAGCUUUGCCAGCG
[0306] b (SEQ ID NO: 135) (SEQ ID NO: 136) AGAGUUGAAAGCUGAGCAAGA UUGCUCAGCUUUCAACUCUGC a (SEQ ID NO: 137) (SEQ ID NO: 138) GCAGAGUUGAAAGCUGAGCAA UUGCUCAGCUUUCAACUCUGCUU
[0307]
[0308] b (SEQ ID NO: 139) (SEQ ID NO: 140) ATTORNEY DOCKET NO 21101.0493P1
[0309] GGUAAUGGUGGGUCUUAAUGG AUUAAGACCCACCAUUACCCA
[0310] a (SEQ IDNO: 141) (SEQ ID NO: 142) UGGGUAAUGGUGGGUCUUAAU AUUAAGACCCACCAUUACCCAGG
[0311] b (SEQ IDNO: 143) (SEQ ID NO: 144) ACUCUGACUCUGUGCAAAUUG AUUUGCACAGAGUCAGAGUGA a (SEQ IDNO: 145) (SEQ ID NO: 146 UCACUCUGACUCUGUGCAAAU AUUUGCACAGAGUCAGAGUGAAC
[0312] b (SEQ IDNO: 147) (SEQ ID NO: 148) GUAUCCAGCUGUAGAUGUUCU AACAUCUACAGCUGGAUACCC a (SEQ IDNO: 149) (SEQ ID NO: 150)
[0313] GGGUAUCC AGC UGU AGAUGUU AACAUCUACAGCUGGAUACCCUG
[0314] b (SEQ IDNO: 151) (SEQ ID NO: 152) GCCUGAAGAGCAUGAUCAAGG UUGAUCAUGCUCUUCAGGCCC a (SEQ IDNO: 153) (SEQ ID NO: 154) GGGCCUGAAGAGCAUGAUCAA UUGAUCAUGCUCUUCAGGCCCAG
[0315] b (SEQ IDNO: 155) (SEQ ID NO: 156) AUCAAAGAGUAGUCUGCUAUA UAGCAGACUACUCUUUGAUGG a (SEQ IDNO: 157) (SEQ ID NO: 158) CCAUCAAAGAGUAGUCUGCUA UAGCAGACUACUCUUUGAUGGGG
[0316] b (SEQ IDNO: 159) (SEQ ID NO: 160) CAAAGAGUAGUCUGCUAUAUC UAUAGCAGACUACUCUUUGAU a (SEQ IDNO: 161) (SEQ ID NO: 162) AUCAAAGAGUAGUCUGCUAUA UAUAGCAGACUACUCUUUGAUGG
[0317] b (SEQ IDNO: 163) (SEQ ID NO: 164) AGUAACACACAUUAGAGAAAG UUCUCUAAUGUGUGUUACUAU a (SEQ IDNO: 165) (SEQ ID NO: 166) AUAGUAACACACAUUAGAGAA UUCUCUAAUGUGUGUUACUAUGG
[0318] b (SEQ IDNO: 167) (SEQ ID NO: 168) GUGUCAAAGGUGCCAAGAACU UUCUUGGCACCUUUGACACCC a (SEQ IDNO: 169) (SEQ ID NO: 170) GGGUGUCAAAGGUGCCAAGAA UUCUUGGCACCUUUGACACCCUC
[0319] b (SEQ IDNO: 171) (SEQ ID NO: 172) ACAUAGUCCUGCUGACCUUGC AAGGUCAGCAGGACUAUGUAU a (SEQ IDNO: 173) (SEQ ID NO: 174) AUACAUAGUCCUGCUGACCUU AAGGUCAGCAGGACUAUGUAUUG
[0320] b (SEQ IDNO: 175) (SEQ ID NO: 176) UCUCAUCUUUGGUAGGAUUCU AAUCCUACCAAAGAUGAGAAC a (SEQ IDNO: 177) (SEQ ID NO: 178) GUUCUCAUCUUUGGUAGGAUU AAUCCUACCAAAGAUGAGAACAG
[0321] b (SEQ IDNO: 179) (SEQ ID NO: 180) GUUAGGAUACCAAUGAGUAAA UACUCAUUGGUAUCCUAACUA a (SEQ IDNO: 181) (SEQ ID NO: 182) UAGUUAGGAUACCAAUGAGUA UACUCAUUGGUAUCCUAACUAUU
[0322] b (SEQ IDNO: 183) (SEQ ID NO: 184) ACUGCUGUCUUUACAAUAAAG UUAUUGUAAAGACAGCAGUUA a (SEQ IDNO: 185) (SEQ ID NO: 186) UAACUGCUGUCUUUACAAUAA UUAUUGUAAAGACAGCAGUUACA
[0323] b (SEQ IDNO: 187) (SEQ ID NO: 188)
[0324]
[0325] a UCAAAGAGUAGUCUGCUAUAU AUAGCAGACUACUCUUUGAUG ATTORNEY DOCKET NO 21101.0493P1
[0326] (SEQ IDNO: 189) (SEQ ID NO: 190) CAUCAAAGAGUAGUCUGCUAU AUAGCAGACUACUCUUUGAUGGG
[0327] b (SEQ IDNO: 191) (SEQ ID NO: 192) CACCAUAGUAACACACAUUAG AAUGUGUGUUACUAUGGUGGC a (SEQ IDNO: 193) (SEQ ID NO: 194) GCCACCAUAGUAACACACAUU AAUGUGUGUUACUAUGGUGGCAU
[0328] b (SEQ IDNO: 195) (SEQ ID NO: 196) AGAAUAGUUAGGAUACCAAUG UUGGUAUCCUAACUAUUCUUU a (SEQ IDNO: 197) (SEQ ID NO: 198) AAAGAAUAGUUAGGAUAC C AA UUGGUAUCCUAACUAUUCUUUCG
[0329] b (SEQ IDNO: 199) (SEQ ID NO: 200) CUGAAGCUGAUGAUGGAGAAG UCUCCAUCAUCAGCUUCAGCU
[0330] a (SEQ ID NO: 201) (SEQ ID NO: 202) AGCUGAAGCUGAUGAUGGAGA UCUCCAUCAUCAGCUUCAGCUCC
[0331] b (SEQ ID NO: 203) (SEQ ID NO: 204) GUUGAAAGCUGAGCAAGAUGA AUCUUGCUCAGCUUUCAACUC a (SEQ ID NO: 205) (SEQ ID NO: 206) GAGUUGAAAGCUGAGCAAGAU AUCUUGCUCAGCUUUCAACUCUG
[0332] b (SEQ ID NO: 207) (SEQ ID NO: 208) GAGUAGUCUGCUAUAUCAAUU UUGAUAUAGCAGACUACUCUU a (SEQ ID NO: 209) (SEQ ID NO: 210) AAGAGUAGUCUGCUAUAUCAA UUGAUAUAGCAGACUACUCUUUG
[0333] b (SEQ ID NO: 211) (SEQ ID NO: 212) GUUUGAAGCAGAGUUGAAAGC UUUCAACUCUGCUUCAAACUU a (SEQ ID NO: 213) (SEQ ID NO: 214) AAGUUUGAAGCAGAGUUGAAA UUUCAACUCUGCUUCAAACUUAC
[0334] b (SEQ ID NO: 215) (SEQ ID NO: 216) GAAGCAGAGUUGAAAGCUGAG CAGCUUUCAACUCUGCUUCAA a (SEQ ID NO: 217) (SEQ ID NO: 218) UUGAAGCAGAGUUGAAAGCUG CAGCUUUCAACUCUGCUUCAAAC
[0335] b (SEQ ID NO: 219) (SEQ ID NO: 220) UCUUAUAGCCAGAACUUGUAU ACAAGUUCUGGCUAUAAGAAG a (SEQ ID NO: 221) (SEQ ID NO: 222) CUUCUUAUAGCCAGAACUUGU ACAAGUUCUGGCUAUAAGAAGGG
[0336] b (SEQ ID NO: 223) (SEQ ID NO: 224) UAGUAACACACAUUAGAGAAA UCUCUAAUGUGUGUUACUAUG a (SEQ ID NO: 225) (SEQ ID NO: 226) CAUAGUAACACACAUUAGAGA UCUCUAAUGUGUGUUACUAUGGU
[0337] b (SEQ ID NO: 227) (SEQ ID NO: 228) GCCAGUUUCUAACAUCUGUUU ACAGAUGUUAGAAACUGGCUA a (SEQ ID NO: 229) (SEQ ID NO: 230) UAGCCAGUUUCUAACAUCUGU ACAGAUGUUAGAAACUGGCUAAU
[0338] b (SEQ ID NO: 231) (SEQ ID NO: 232) AAGCAGAGUUGAAAGCUGAGC GCUCAGCUUUCAACUCUGCUUCA
[0339] (SEQ ID NO: 233) (SEQ ID NO: 234) CCAGACCCACCUGGGCCUGAA UUCAGGCCCAGGUGGGUCUGGGG
[0340]
[0341] (SEQ ID NO: 235) (SEQ ID NO: 236) ATTORNEY DOCKET NO 21101.0493P1
[0342] In some aspects, a siRNA molecule can comprise a double-stranded RNA molecule. In some aspects, the siRNA molecule can comprise a double-stranded RNA molecule whose antisense strand will compnse an RNA sequence substantially complementary to at least one sequence consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28. SEQ ID NO: 30. SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68. SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114. SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124. SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, SEQ ID NO: 146, SEQ ID NO: 148, SEQ ID NO: 150, SEQ ID NO: 152, SEQ ID NO: 154, SEQ ID NO: 156, SEQ ID NO: 158, SEQ ID NO: 160, SEQ ID NO: 162, SEQ ID NO: 164. SEQ ID NO: 166, SEQ ID NO: 168, SEQ ID NO: 170, SEQ ID NO: 172, SEQ ID NO: 174, SEQ ID NO: 176, SEQ ID NO: 178, SEQ ID NO: 180, SEQ ID NO: 182, SEQ ID NO: 184, SEQ ID NO: 186, SEQ ID NO: 188, SEQ ID NO: 190, SEQ ID NO: 192, SEQ ID NO: 194, SEQ ID NO: 196, SEQ ID NO: 198, SEQ ID NO: 200, SEQ ID NO: 202, SEQ ID NO: 204. SEQ ID NO: 206, SEQ ID NO: 208, SEQ ID NO: 210, SEQ ID NO: 212, SEQ ID NO: 214, SEQ ID NO: 216, SEQ ID NO: 218, SEQ ID NO: 220, SEQ ID NO: 222, SEQ ID NO: 224, SEQ ID NO: 226, SEQ ID NO: 228, SEQ ID NO: 230, SEQ ID NO: 232, SEQ ID NO: 234, and SEQ ID NO: 236 and whose sense strand will comprise an RNA sequence complementary to the antisense strand, wherein both strands are hybridised by standard base pairing between nucleotides. In some aspects, a siRNA molecule can comprise a double stranded RNA molecule, whose antisense strand will comprise an RNA sequence substantially complementary’ to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20. SEQ ID NO: 22. SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: ATTORNEY DOCKET NO 21101.0493P1
[0343] 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108. SEQ ID NO: 110, SEQ ID NO: 112. SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, SEQ ID NO: 146, SEQ ID NO: 148, SEQ ID NO: 150, SEQ ID NO: 152. SEQ ID NO: 154, SEQ ID NO: 156, SEQ ID NO: 158, SEQ ID NO: 160, SEQ ID NO: 162, SEQ ID NO: 164, SEQ ID NO: 166, SEQ ID NO: 168, SEQ ID NO: 170, SEQ ID NO: 172, SEQ ID NO: 174, SEQ ID NO: 176, SEQ ID NO: 178, SEQ ID NO: 180, SEQ ID NO: 182, SEQ ID NO: 184, SEQ ID NO: 186, SEQ ID NO: 188, SEQ ID NO: 190, SEQ ID NO: 192, SEQ ID NO: 194, SEQ ID NO: 196, SEQ ID NO: 198. SEQ ID NO: 200, SEQ ID NO: 202. SEQ ID NO: 204, SEQ ID NO: 206, SEQ ID NO: 208, SEQ ID NO: 210, SEQ ID NO: 212, SEQ ID NO: 214, SEQ ID NO: 216, SEQ ID NO: 218, SEQ ID NO: 220, SEQ ID NO: 222, SEQ ID NO: 224, SEQ ID NO: 226, SEQ ID NO: 228, SEQ ID NO: 230, SEQ ID NO: 232, SEQ ID NO: 234, and SEQ ID NO: 236.
[0344] As used herein, “substantially complementary” to a target mRNA sequence, can also be understood as “substantially identical” to said target sequence. “Identity” is the degree of sequence relatedness between nucleotide sequences as determined by matching the order and identity of nucleotides between sequences. In some apects, the antisense strand of an siRNA having 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% complementarity to the target mRNA sequence are considered substantially complementary and may be used in the present invention. The percentage of complementarity describes the percentage of contiguous nucleotides in a first nucleic acid molecule that can base pair in the Watson-Crick sense with a set of contiguous nucleotides in a second nucleic acid molecule. In some aspects, the antisense siRNA strand is 100% complementary to the target mRNA sequence, and the sense strand is 100% complementary to the antisense strand over the double stranded portion of the siRNA. The siRNA may also include unpaired overhangs, for example, 3’ dinucleotide overhangs, and, in some aspects, dTdT. ATTORNEY DOCKET NO 21101.0493P1
[0345] Generally, double stranded molecules can be from about 19 to about 25 nucleotides in length, and include blunt-ended structures as well as those with overhangs. Overhangs have been described to be advantageous and may be present on the 5’ ends or on the 3’ ends of either strand as they reduce recognition by RNAses and imitate Dicer’s natural substrate. In some aspects, overhangs can be present on both 3’ ends of the molecules. In some aspects one overhang is present on one end of the molecule. Others have described the use of blunt-ended structures with specific modification patterns (EP1527176. W02005062937, W02008104978, EP2322617, EP2348133, US20130130377, and many others).
[0346] Overhangs can comprise between 1 and 5 nucleotides; typically overhangs are made up of dinucleotides. Classical molecules used in the field, comprise a 19 nucleotide double stranded molecule which further comprises 3’ dinucleotide overhangs preferably comprising deoxynucleotides as taught in initial studies by Tuschl (WO0244321). These overhangs are said to further enhance resistance to nuclease (RNase) degradation. Later, Kim et al. 2005 (Kim et al., Nat. Biotechnol. 2005, Feb; 23(2): 222-6) describe that 21-mer products (containing dinucleotide overhangs) are important for loading onto RNA-induced silencing complex (RISC). Further, Bramsen et al. 2009 (Bramsen et al. Nucleic Acids Res. 2009, May; 37(9): 2867-81) describe the introduction of possible destabilizing modifications to the overhangs to further increase silencing efficiency.
[0347] In some aspects, the siRNA molecules described herein can target at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236 which comprises at least one overhang, preferably a 3’ overhang in the sense and / or the antisense strand. In some aspects, wherien the siRNA molecule targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, the siRNA can include an antisense strand of equivalent length and complementary to the target, and a sense strand of equivalent length and complementary to the antisense strand. The antisense and sense strands can further include additional bases which are not complementary to the other strand or the target, and / or which are not paired in the double stranded portion of the siRNA.
[0348] In some aspects, the siRNA molecules described herein that target at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein each strand of the double-stranded siRNA molecules is about 18 to about 28 or more (e.g., about 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 or more) nucleotides long.
[0349] Disclosed herein are siRNA molecules wherein the siRNA molecule specifically targets a sequence comprising or consisting of a sequence having the sequence of SEQ ID NOs: 240, 241, or 242 and reduces expression of EF-hand domain family member DI ATTORNEY DOCKET NO 21101.0493P1
[0350] (EFHD1) gene in a cell, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence having at least 90% sequence identity to a sequence comprising the sequence of SEQ ID NO: 1 to SEQ ID NO: 236.
[0351] In some aspects, the siRNA molecules described herein comprising 20-25 nucleotides long or more and comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecules described herein comprising 20-25 nucleotides long or more and comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the doublestranded siRNA molecules can be at least 21 nucleotides long and selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236.
[0352] Also described herein are blunt-ended molecules. Disclosed herein are siRNA molecules wherein the siRNA molecules specifically target at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242. In some aspects, the siRNA molecules can reduce expression of EF-hand domain family member DI (EFHD1) gene in a cell. In some aspects, the siRNA molecules comprise a 20- to 25-nucleotide blunt-ended double-stranded structure. In some aspects, the siRNA molecule comprises at least one sequence having at least 90% a sequence identity selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule comprises at least one sequence having at least 90% a sequence identity selected from the group consisting of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, and 38.
[0353] In some aspects, the siRNA molecules comprise a 20- to 25-nucleotide doublestranded blunt-ended siRNA targeted against at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242. In some aspects, the siRNA molecule comprises or consists of at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the antisense strand of this siRNA is at least 80%, at least 90%, complementary to at least one sequence selected from the group consisting of SEQ ID NOs: 2, 4. 6, 8, 10, 12, 14, 16, 18, 20. 22. 24. 26. 28. 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168. 170, 172, 174, 176, 178, 180, 182. 184, 186, 188, 190, 192. 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, or 236. ATTORNEY DOCKET NO 21101.0493P1
[0354] In some aspects, the siRNA molecules disclosed herein can comprise or consist of at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecules disclosed herein can comprise or consist of at least one sequence selected from the group consisting of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, and 38.
[0355] In some aspects, the siRNA molecules disclosed herein can comprise or consist a sense strand which comprises or consists of at least one sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 8, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101. 103, 105, 107, 109, 111. 113, 115. 117, 119, 121, 123, 125.
[0356] 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217, 219, 221, 223, 225 227, 229, 231, 233, or 235 and an antisense strand which is complementary’ to the sense strand.
[0357] siRNA molecules can be unstable in biological fluids due to the ubiquitous nature of RNAses. Thus, the use of many different chemical modifications to nucleotides has been described with the purpose of enhancing compound stability. Disclosed herein are siRNA molecules that are stability in biological fluids.
[0358] siRNA molecules can be immunogenetic, and in some instance, have been found to induce unspecific activation of the innate immune system, including up-regulation of certain cytokines.
[0359] Both of these effects, recognition by RNases and immunogenicity, have also been described to be sequence-dependent.
[0360] Described herein are chemical modifications that can enhance or are capable of enhancing siRNA molecule stability. In some aspects, the chemical modification can increase or enhance siRNA molecule stability by decreasing its susceptibility to RNAses as well as reduce induction of immune recognition and thus reduce the subsequent immune response.
[0361] In some aspects, the siRNA molecules described herein can further comprise at least one nucleotide with a chemical modification. In some aspects, at least one nucleotide of the siRNA molecule can comprise a chemical modification.
[0362] In some aspects, the chemical modification(s) that enhances stability and reduces immunogenic effects can include but is not limited to 2'-O-methyl nucleotides, 2’-fluoro nucleotides, 2’-amino nucleotides, 2’-deoxy nucleotides, or nucleotides containing 2’-0 or ATTORNEY DOCKET NO 21101.0493P1
[0363] 4’-C methylene bridges. Examples of chemical modifications for exonuclease protection include but are not limited to the ExoEndoLight pattern of modification (EEL): modification of the pyrimidines in the sense strand to 2’-O-methyl residues, and modification of the pyrimidines in a 5’-UA-3’ or 5’-CA-3’ motif in the antisense strand to 2’-O-methyl residues. In some aspects, position 1 of the sense strand can also be changed to 2’-O-methyl to prevent 5 ’-phosphory lation of the sense strand and thus increasing strand-specificity of the siRNA. In addition, the sense strand can also include a 2’-O-methyl modification in position 14, because 2’-O-Me residues at this position inactivate the sense strand and therefore increase strandspecificity of the siRNA molecules. Additional examples of chemical modifications for nuclease protection include but are not limited to Methyl-Fluoro modification pattern (MEF): alternating 2’-fluoro and 2'-O-methyl modifications starting (5’-end) with a 2’-F on the sense strand and starting with 2’-O-Me on the antisense strand. In some aspects, position 1 of the sense strand can also be changed to 2’-O-Me and position 1 of the antisense strand to 2’-F (as 2’F residues are compatible with 5 ’-phosphorylation whereas 2’0— Me residues are bulky' and generally impair phosphorylation). This modification pattern can stabilize the molecule as well as disable the ability of the RISC to use the sense strand thus promoting strandspecificity. Also, modification of the ribonucleotide backbone can be performed by binding the nucleotides by using phosphorothioate bonds instead of phosphodiester links. In some aspects, the chemical modification can be a4'Thioribose, 5-Propynyluracile 3',5’-methyluridine or the substitution of uracyl ribonucleotides with deoxythymidine
[0364] (deoxy ribonucleotides).
[0365] In some aspects, the chemical modification can include one or more amino acids, with amino acid, carbohydrates, or lipid moieties.
[0366] In some aspects, the at least one chemically modified nucleotide and / or the at least one chemical modification in the ribonucleotide backbone is on the sense strand, on the antisense strand or on both strands of the siRNA molecule. In some aspects, the chemical modification is on the sense strand, on the antisense strand or on both strands of the siRNA molecule.
[0367] Also disclosed herein are siRNA conjugates. In some aspects, the siRNA conjugate can comprise any of the siRNA molecule disclosed herein and a targeting group. In some aspects, the siRNA molecule can comprise or consist of at least one sequence with a sense strand and / or an antisense strand selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise or consist of at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some ATTORNEY DOCKET NO 21101.0493P1
[0368] aspects, the targeting group can be a ligand with affinity for an asialoglycoprotein receptor. In some aspects, the targeting group can include a group derived from a lipophile. In some aspects, the lipophil can be selected from cholesterol, cholic acid, amantanoacetic acid, 1-pyrenebutanoic acid, dihydrotestosterone, l,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl, hexadecyl glycerol, borneol, menthol, 1,3 -propanediol, heptadecyl, palmitic acid, myristic acid, O-3-(oleoyl) lithocholic acid, O-3-(oleoyl) cholic acid, dimethoxytribenzyl, and phenoxazine. In some aspects, the targeting group can include a group derived from a carbohydrate. In some aspects, the carbohydrate can be selected from allose, altrose, arabinose, cladinose, erythrose, erythrulose, fructose, D-fucitol, L-fucitol, fucosamine, fucose, fuculose, galactosamine, D-galactosaminol, N-acetyl-galactosamine (GalNAc), galactose, glucosamine, N-acetyl-glucosamine, glucosaminitol, glucose, glucose-6-phosphate, gulonoglyceraldehyde, L-glycero-D-mannose-heptose, glycerol, glycerone, gulose, idose, lyxose, mannosamine, mannose, mannose-6-phosphate, psicose, quinovose, quinovosamine, rhamnitol, rhamnosamine, rhamnose, ribose, ribulose, sedoheptulose, sorbose, tagatose, talose, tartaric acid, threose. xylose, and xylulose.
[0369] In some aspects, the siRNA conjugate can further comprise a linker. In some aspects, the siRNA molecule, the linker, and the targeting group can be sequentially covalently or non-covalently linked. In some aspects, the linker can include: reactive groups, alkyl groups, abasic nucleotides, ribitol (abasic ribose), and / or PEG groups. In some aspects, one end of the linker can be a carbonyl group, through which the linker can be covalently linked to the targeting group, and the other end is an — O — group for covalent linkage to
[0370] the siRNA through a phosphoester bond ( — O — P(O)OH — ).
[0371] In some aspects, the siRNA molecule can comprise or consist of at least one sequence with a sense strand and / or an antisense strand selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise or consist of at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236.
[0372] In some aspects, the siRNA molecule can comprise or consists of a sense strand which comprises or consists of at least one sequence selected from the group of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID ATTORNEY DOCKET NO 21101.0493P1
[0373] NO: 55, SEQ ID NO: 57, SEQ ID NO: 59 SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109. SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119. SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 129, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, SEQ ID NO: 141, SEQ ID NO: 143, SEQ ID NO: 145, SEQ ID NO: 147, SEQ ID NO: 149, SEQ ID NO: 151, SEQ ID NO: 153, SEQ ID NO: 155, SEQ ID NO: 157, SEQ ID NO: 159. SEQ ID NO: 161, SEQ ID NO: 163, SEQ ID NO: 165, SEQ ID NO: 167, SEQ ID NO: 169, SEQ ID NO: 171, SEQ ID NO: 173, SEQ ID NO: 175, SEQ ID NO: 177, SEQ ID NO: 179, SEQ ID NO: 181, SEQ ID NO: 183, SEQ ID NO: 185, SEQ ID NO: 187, SEQ ID NO: 189, SEQ ID NO: 191, SEQ ID NO: 193, SEQ ID NO: 195, SEQ ID NO: 197, SEQ ID NO: 199. SEQ ID NO: 201, SEQ ID NO: 203, SEQ ID NO: 205, SEQ ID NO: 207, SEQ ID NO: 209. SEQ ID NO: 211, SEQ ID NO: 213, SEQ ID NO: 215, SEQ ID NO: 217, SEQ ID NO: 219, SEQ ID NO: 221, SEQ ID NO: 223, SEQ ID NO: 225, SEQ ID NO: 227, SEQ ID NO: 229, SEQ ID NO: 231, SEQ ID NO: 233, and SEQ ID NO: 235.
[0374] In some aspects, the siRNA molecule can comprise or consists of an antisense strand which is complementary to the sense strand which is selected from the group of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88. SEQ ID NO: 90. SEQ ID NO: 92. SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128. SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, SEQ ID NO: 146, SEQ ID ATTORNEY DOCKET NO 21101.0493P1
[0375] NO: 148, SEQ ID NO: 150, SEQ ID NO: 152. SEQ ID NO: 154, SEQ ID NO: 156, SEQ ID NO: 158. SEQ ID NO: 160, SEQ ID NO: 162, SEQ ID NO: 164, SEQ ID NO: 166, SEQ ID NO: 168, SEQ ID NO: 170, SEQ ID NO: 172, SEQ ID NO: 174, SEQ ID NO: 176, SEQ ID NO: 178, SEQ ID NO: 180, SEQ ID NO: 182, SEQ ID NO: 184, SEQ ID NO: 186, SEQ ID NO: 188, SEQ ID NO: 190, SEQ ID NO: 192, SEQ ID NO: 194, SEQ ID NO: 196, SEQ ID NO: 198, SEQ ID NO: 200, SEQ ID NO: 202, SEQ ID NO: 204, SEQ ID NO: 206, SEQ ID NO: 208. SEQ ID NO: 210, SEQ ID NO: 212, SEQ ID NO: 214, SEQ ID NO: 216, SEQ ID NO: 218, SEQ ID NO: 220, SEQ ID NO: 222, SEQ ID NO: 224, SEQ ID NO: 226, SEQ ID NO: 228, SEQ ID NO: 230, SEQ ID NO: 232, SEQ ID NO: 234, and SEQ ID NO: 236.
[0376] In some aspects, the siRNA molecule can comprise or consist of a sense strand which comprises or consists of at least one sequence selected from the group of SEQ ID NO: 1. SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45. SEQ ID NO: 47. SEQ ID NO: 49. SEQ ID NO: 51. SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59 SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 95. SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 129. SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, SEQ ID NO: 141, SEQ ID NO: 143, SEQ ID NO: 145, SEQ ID NO: 147, SEQ ID NO: 149, SEQ ID NO: 151, SEQ ID NO: 153, SEQ ID NO: 155, SEQ ID NO: 157, SEQ ID NO: 159, SEQ ID NO: 161, SEQ ID NO: 163, SEQ ID NO: 165, SEQ ID NO: 167, SEQ ID NO: 169. SEQ ID NO: 171, SEQ ID NO: 173, SEQ ID NO: 175, SEQ ID NO: 177, SEQ ID NO: 179. SEQ ID NO: 181, SEQ ID NO: 183, SEQ ID NO: 185, SEQ ID NO: 187, SEQ ID NO: 189, SEQ ID NO: 191, SEQ ID NO: 193, SEQ ID NO: 195, SEQ ID NO: 197, SEQ ID NO: 199, SEQ ID NO: 201, SEQ ID NO: 203, SEQ ID NO: 205, SEQ ID NO: 207, SEQ ID NO: 209, SEQ ID NO: 211, SEQ ID NO: 213, SEQ ID NO: 215, SEQ ID NO: 217, SEQ ID NO: 219. SEQ ID NO: 221, SEQ ID NO: 223, SEQ ID NO: 225, SEQ ID NO: 227, SEQ ID NO: 229, SEQ ID NO: 231, SEQ ID NO: 233, and SEQ ID NO: 235; and an ATTORNEY DOCKET NO 21101.0493P1
[0377] antisense strand which is complementary to the sense strand which is selected from the group of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6. SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44. SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62. SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104. SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136. SEQ ID NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, SEQ ID NO: 146. SEQ ID NO: 148, SEQ ID NO: 150, SEQ ID NO: 152, SEQ ID NO: 154, SEQ ID NO: 156, SEQ ID NO: 158, SEQ ID NO: 160, SEQ ID NO: 162, SEQ ID NO: 164, SEQ ID NO: 166, SEQ ID NO: 168, SEQ ID NO: 170, SEQ ID NO: 172, SEQ ID NO: 174, SEQ ID NO: 176, SEQ ID NO: 178, SEQ ID NO: 180, SEQ ID NO: 182, SEQ ID NO: 184, SEQ ID NO: 186. SEQ ID NO: 188, SEQ ID NO: 190, SEQ ID NO: 192, SEQ ID NO: 194, SEQ ID NO: 196, SEQ ID NO: 198, SEQ ID NO: 200, SEQ ID NO: 202, SEQ ID NO: 204, SEQ ID NO: 206, SEQ ID NO: 208, SEQ ID NO: 210, SEQ ID NO: 212, SEQ ID NO: 214, SEQ ID NO: 216, SEQ ID NO: 218, SEQ ID NO: 220, SEQ ID NO: 222, SEQ ID NO: 224, SEQ ID NO: 226. SEQ ID NO: 228, SEQ ID NO: 230, SEQ ID NO: 232, SEQ ID NO: 234, and SEQ ID NO: 236.
[0378] Any of the compositions disclosed herein can further comprise a pharmaceutically acceptable carrier. In some aspects, the pharmaceutically acceptable carrier for the siRNA molecule can be buffered saline. In some aspects, the pharmaceutically acceptable carrier can comprise a lipid-based or polymer-based colloid. In some aspects, the colloid can be a liposome, a hydrogel, a microparticle, a nanoparticle, or a block copolymer micelle. In some aspects, the compositions described herein can be formulated for intravenous, subcutaneous, intrathecal, intramuscular, oral, intrathecal, intratumoral, or intraperitoneal administration. In some aspects, the therapeutically effective amount of any of the siRNA molecules disclosed herein reduces accumulation of phosphorylated and aggregated human tau. ATTORNEY DOCKET NO 21101.0493P1
[0379] siRNA molecules described herein can be delivered to the cell interior in their native structure using methods known in the art. In some aspects, when the siRNA molecules can be administered using standard transfection reagents. To achieve effects in vivo these siRNA molecules can also be administered naked or using delivery enhancing agents such as for example liposomes, conjugation with a specific moiety, etc. although many different alternatives are known in the art. and are used differently depending on the desired target site within the body.
[0380] In some aspects, the siRNA molecules described herein can be expressed within cells from eukaryotic promoters. Recombinant vectors capable of expressing the siRNA molecules can be delivered and persist in target cells. Alternatively, vectors can be used that provide for transient expression of nucleic acid molecules. Such vectors can be repeatedly administered as necessary. Once expressed, the siRNA molecule interacts with the target mRNA and generates an RNA interfering response. The siRNA molecules produced in this manner are often termed shRNA (short hairpin RNA), as their sense and antisense strands are joined by a small loop of nucleotides. Delivery’ of siRNA molecules expressing vectors can be systemic, such as by intravenous, intrathecal, or intra-muscular administration, by administration to target cells ex-planted from a subject followed by reintroduction into the subject, or by any other means that would allow’ for introduction into the desired target cell.
[0381] Also disclosed is the use of siRNA targeting at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236 in the preparation of a medicament for use in a method of treatment metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis characterized by increased expression and / or activity of EFHD1. In some aspects, the use comprises inhibiting expression of EFHD1 polynucleotide in a subject. The term inhibition is used to indicate a decrease or downregulation of expression or activity. In some aspects, the metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis can be associated with or related to an increase in blood calcium levels.
[0382] In some aspects, any of the siRNA molecules disclosed herein, any of the compositions disclosed herein, any’ of the pharmaceutical compositions disclosed herein, or any of the siRNA conjugates disclosed herein, are capable of inhibiting the expression of EFHD1 in a cell.
[0383] METHODS OF TREATMENT
[0384] The methods disclosed herein can be useful for the treatment of a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, metabolic ATTORNEY DOCKET NO 21101.0493P1
[0385] dysfunction-associated steatohepatitis, or steatohepatitis. The methods disclosed herein can also be useful for the treatment of a subject with kidney disease, acute kidney disease, chronic kidney disease, diabetic kidney disease, or hypertensive kidney disease. The methods disclosed herein can further be useful for the treatment of a subject with breast cancer.
[0386] In some aspects, the siRNA molecule can reduce endoplasmic reticulum calcium (Ca2+) release into a mitochondrial fission signal or reduces Ca2+-induced mitochondrial fission. In some aspects, the siRNA molecule can reduce or decrease inflammation. In some aspects, the siRNA molecule can reduce fibrosis. In some aspects, the siRNA molecule can inhibit expression of a EFHD1 polynucleotide. In some aspects, the siRNA molecule can reduce hepatocyte injury. In some aspects, the siRNA molecule can increase in mitochondrial size within cells. In some aspects, the siRNA molecule effects can occur independently of changes in organismal energy balance or liver steatosis.
[0387] In some aspects, the methods can comprise administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a pharmaceutical composition compnsing the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242. In some aspects, the siRNA molecule comprises a 25- to 28-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0388] In some aspects, the methods can comprise administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising a siRNA molecule wherein the siRNA molecule comprises a 25- to 28-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission. ATTORNEY DOCKET NO 21101.0493P1
[0389] The methods disclosed herein can be useful for inhibiting expression of a EFHD1 polynucleotide. In some aspects, the method can inhibit expression of a EFHD1 polynucleotide in a subject. The method can comprise administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242. In some aspects, the siRNA molecule comprises a 25- to 28-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0390] The methods disclosed herein can be useful for inhibiting expression of a EFHD1 polynucleotide. In some aspects, the method can inhibit expression of a EFHD1 polynucleotide in a subject. The method can comprise administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising a siRNA molecule wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0391] The methods disclosed herein can be useful for reducing Ca2+-induced mitochondrial fission in a subject. The methods can comprise administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242. In some aspects, the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein ATTORNEY DOCKET NO 21101.0493P1
[0392] the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0393] The methods disclosed herein can be useful for Ca2+-induced mitochondrial fission in a subject. The methods can comprise administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising a siRNA molecule wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended doublestranded structure, wherein the siRNA molecule comprises at least one sequence of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0394] In some aspects, the methods can comprise administering to a subject with acute kidney disease, chronic kidney disease, diabetic kidney disease, or hypertensive kidney disease a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242. In some aspects, the siRNA molecule comprises a 25- to 28-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0395] In some aspects, the methods can comprise administering to a subject with acute kidney disease, chronic kidney disease, diabetic kidney disease, or hypertensive kidney disease a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising a siRNA molecule wherein the siRNA molecule comprises a 25- to 28-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one ATTORNEY DOCKET NO 21101.0493P1
[0396] sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0397] In some aspects, the methods can comprise administering to a subject with breast cancer a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242. In some aspects, the siRNA molecule comprises a 25- to 28-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0398] In some aspects, the methods can comprise administering to a subject with breast cancer disease a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising a siRNA molecule wherein the siRNA molecule comprises a 25- to 28-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0399] The methods disclosed herein can be useful for suppressing expression of a EFHD1 polynucleotide. In some aspects, the method can suppress expression of a EFHD1 polynucleotide in a subject. The method can comprise administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242. In some aspects, the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group ATTORNEY DOCKET NO 21101.0493P1
[0400] consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0401] The methods disclosed herein can be useful for suppressing expression of a EFHD1 polynucleotide. In some aspects, the method can suppress expression of a EFHD1 polynucleotide in a subject. The method can comprise administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising a siRNA molecule wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0402] The methods disclosed herein can be useful for reducing or decreasing inflammation. In some aspects, the method can reduce or decrease inflammatory in a subject. The method can comprise administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242. In some aspects, the siRNA molecule comprises a 25- to 28-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the reduction or decrease in inflammation can be in the liver. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0403] The methods disclosed herein can be useful for reducing or decreasing inflammation. In some aspects, the method can reduce or decrease inflammatory in a subject. The method can comprise administering to a subject with metabolic liver disease, metabolic dysfunction- ATTORNEY DOCKET NO 21101.0493P1
[0404] associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising a siRNA molecule wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the reduction or decrease in inflammation can be in the liver. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0405] The methods disclosed herein can be useful for reducing fibrosis. In some aspects, the method can reduce fibrosis in a subject. The method can comprise administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242. In some aspects, the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the reduction in fibrosis can be in the liver. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0406] The methods disclosed herein can be useful for reducing fibrosis. In some aspects, the method can reduce fibrosis in a subject. The method can comprise administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising a siRNA molecule wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the reduction ATTORNEY DOCKET NO 21101.0493P1
[0407] in fibrosis can be in the liver. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0408] The methods disclosed herein can be useful for reducing hepatocyte injury. In some aspects, the method can reduce hepatocyte injury in a subject. The method can comprise administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242. In some aspects, the siRNA molecule comprises a 25- to 28-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0409] The methods disclosed herein can be useful for reducing hepatocyte injury. In some aspects, the method can reduce hepatocyte injury in a subject. The method can comprise administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising a siRNA molecule wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can compnse at least one sequence having at least 90% sequence identity to a sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0410] The methods disclosed herein can be useful for increasing mitochondrial size within cells. In some aspects, the method can increase mitochondrial size within cells in a subject. The method can comprise administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that ATTORNEY DOCKET NO 21101.0493P1
[0411] specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242. In some aspects, the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+ -induced mitochondrial fission.
[0412] The methods disclosed herein can be useful for increasing mitochondrial size within cells. In some aspects, the method can increase mitochondrial size within cells in a subject. The method can comprise administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising a siRNA molecule wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0413] In some aspects, the subject has metabolic liver disease. In some aspects, the subject has metabolic dysfunction-associated steatotic liver disease. In some aspects, the subject has steatohepatitis. In some aspects, the subject has metabolic dysfunction-associated steatohepatitis (MASH). In some aspects, the subject has kidney disease. In some aspects, the subject has acute kidney disease. In some aspects, the subject has chronic kidney disease. In some aspects, the subject has diabetic kidney disease. In some aspects, the subject has hypertensive kidney disease. In some aspects, the subject has breast cancer. In some aspects, the subject has hepatitis. In some aspects, the subject has an hepatocyte injury'. In some aspects, the subject has Alzheimer's disease or dementia.
[0414] The methods disclosed herein can be effective for targeting one or more genes, including EF-hand domain-containing protein 1 (EFHD1).
[0415] In some aspects, the methods also include the step of administering a therapeutic effective amount of any of the siRNA molecules disclosed herein. In some aspects, siRNA molecule comprises or consists of a sense strand which comprises or consists of at least one ATTORNEY DOCKET NO 21101.0493P1
[0416] sequence selected from the group of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9. SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59 SEQ ID NO: 61. SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105. SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 129, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, SEQ ID NO: 141, SEQ ID NO: 143, SEQ ID NO: 145. SEQ ID NO: 147, SEQ ID NO: 149, SEQ ID NO: 151, SEQ ID NO: 153, SEQ ID NO: 155. SEQ ID NO: 157, SEQ ID NO: 159, SEQ ID NO: 161, SEQ ID NO: 163, SEQ ID NO: 165, SEQ ID NO: 167, SEQ ID NO: 169, SEQ ID NO: 171, SEQ ID NO: 173, SEQ ID NO: 175, SEQ ID NO: 177, SEQ ID NO: 179, SEQ ID NO: 181, SEQ ID NO: 183, SEQ ID NO: 185, SEQ ID NO: 187, SEQ ID NO: 189, SEQ ID NO: 191, SEQ ID NO: 193, SEQ ID NO: 195. SEQ ID NO: 197, SEQ ID NO: 199, SEQ ID NO: 201, SEQ ID NO: 203, SEQ ID NO: 205, SEQ ID NO: 207, SEQ ID NO: 209, SEQ ID NO: 211, SEQ ID NO: 213, SEQ ID NO: 215, SEQ ID NO: 217, SEQ ID NO: 219, SEQ ID NO: 221, SEQ ID NO: 223, SEQ ID NO: 225, SEQ ID NO: 227, SEQ ID NO: 229, SEQ ID NO: 231, SEQ ID NO: 233, and SEQ ID NO: 235
[0417] In some aspects, siRNA molecule comprises or consists of an anti-sense strand which comprises or consists of at least one sequence selected from the group of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22. SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ATTORNEY DOCKET NO 21101.0493P1
[0418] ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104. SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, SEQ ID NO: 146, SEQ ID NO: 148. SEQ ID NO: 150, SEQ ID NO: 152, SEQ ID NO: 154, SEQ ID NO: 156, SEQ ID NO: 158, SEQ ID NO: 160, SEQ ID NO: 162, SEQ ID NO: 164, SEQ ID NO: 166, SEQ ID NO: 168, SEQ ID NO: 170, SEQ ID NO: 172, SEQ ID NO: 174, SEQ ID NO: 176, SEQ ID NO: 178, SEQ ID NO: 180, SEQ ID NO: 182. SEQ ID NO: 184, SEQ ID NO: 186, SEQ ID NO: 188. SEQ ID NO: 190, SEQ ID NO: 192, SEQ ID NO: 194, SEQ ID NO: 196, SEQ ID NO: 198, SEQ ID NO: 200, SEQ ID NO: 202, SEQ ID NO: 204, SEQ ID NO: 206, SEQ ID NO: 208, SEQ ID NO: 210, SEQ ID NO: 212, SEQ ID NO: 214, SEQ ID NO: 216, SEQ ID NO: 218, SEQ ID NO: 220, SEQ ID NO: 222, SEQ ID NO: 224, SEQ ID NO: 226, SEQ ID NO: 228. SEQ ID NO: 230, SEQ ID NO: 232, SEQ ID NO: 234, and SEQ ID NO: 236.
[0419] In some aspects, the siRNA molecule comprises or consists of a sense strand which comprises or consists of at least one sequence selected from the group of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59 SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109. SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119. SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 129, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, SEQ ID NO: 141, SEQ ID NO: 143, SEQ ID NO: 145, SEQ ID NO: 147, SEQ ID NO: 149, SEQ ID NO: 151, SEQ ID NO: 153, SEQ ID NO: 155, SEQ ID NO: 157, SEQ ID NO: 159. SEQ ID NO: 161, SEQ ID NO: 163, SEQ ID NO: 165, SEQ ID NO: 167, SEQ ID NO: 169, SEQ ID NO: 171, SEQ ID NO: 173, SEQ ID NO: 175, SEQ ID NO: ATTORNEY DOCKET NO 21101.0493P1
[0420] 177, SEQ ID NO: 179, SEQ ID NO: 181, SEQ ID NO: 183, SEQ ID NO: 185, SEQ ID NO: 187, SEQ ID NO: 189. SEQ ID NO: 191, SEQ ID NO: 193, SEQ ID NO: 195, SEQ ID NO: 197, SEQ ID NO: 199, SEQ ID NO: 201, SEQ ID NO: 203, SEQ ID NO: 205, SEQ ID NO: 207, SEQ ID NO: 209, SEQ ID NO: 211, SEQ ID NO: 213, SEQ ID NO: 215, SEQ ID NO: 217, SEQ ID NO: 219, SEQ ID NO: 221, SEQ ID NO: 223, SEQ ID NO: 225, SEQ ID NO: 227, SEQ ID NO: 229. SEQ ID NO: 231, SEQ ID NO: 233, and SEQ ID NO: 235; and an antisense strand which is complementary to the sense strand which is selected from the group of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86. SEQ ID NO: 88. SEQ ID NO: 90. SEQ ID NO: 92. SEQ ID NO: 94. SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126. SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, SEQ ID NO: 146, SEQ ID NO: 148, SEQ ID NO: 150, SEQ ID NO: 152, SEQ ID NO: 154, SEQ ID NO: 156, SEQ ID NO: 158, SEQ ID NO: 160, SEQ ID NO: 162, SEQ ID NO: 164, SEQ ID NO: 166. SEQ ID NO: 168, SEQ ID NO: 170, SEQ ID NO: 172, SEQ ID NO: 174, SEQ ID NO: 176, SEQ ID NO: 178, SEQ ID NO: 180, SEQ ID NO: 182, SEQ ID NO: 184, SEQ ID NO: 186, SEQ ID NO: 188, SEQ ID NO: 190, SEQ ID NO: 192, SEQ ID NO: 194, SEQ ID NO: 196, SEQ ID NO: 198, SEQ ID NO: 200, SEQ ID NO: 202, SEQ ID NO: 204, SEQ ID NO: 206, SEQ ID NO: 208, SEQ ID NO: 210, SEQ ID NO: 212, SEQ ID NO: 214, SEQ ID NO: 216. SEQ ID NO: 218, SEQ ID NO: 220, SEQ ID NO: 222, SEQ ID NO: 224, SEQ ID NO: 226, SEQ ID NO: 228, SEQ ID NO: 230, SEQ ID NO: 232, SEQ ID NO: 234, and SEQ ID NO: 236.
[0421] In some aspects, the methods of treating a subject can comprise contacting a cell or a subject with an effective amount of a small interfering RNA (siRNA) molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: ATTORNEY DOCKET NO 21101.0493P1
[0422] 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 25- to 28-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0423] In some aspects, the methods of treating a subject can comprise contacting a cell or a subject with an effective amount of a small interfering RNA (siRNA) molecule wherein the siRNA molecule comprises a 25- to 28-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0424] Disclosed herein are methods of inhibiting expression of a EFHD1 polynucleotide. In some aspects, the methods can comprise contacting a cell with a small interfering RNA (siRNA) molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242. In some aspects, the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0425] In some aspects, the methods can comprise contacting a cell with a small interfering RNA (siRNA) molecule wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0426] Disclosed herein are methods of suppressing expression of a EFHD1 polynucleotide. In some aspects, the methods can comprise contacting a cell with a small interfering RNA ATTORNEY DOCKET NO 21101.0493P1
[0427] (siRNA) molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242. In some aspects, the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0428] In some aspects, the methods can comprise contacting a cell with a small interfering RNA (siRNA) molecule wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0429] Disclosed herein are methods of reducing or decreasing inflammation. In some aspects, the methods can comprise contacting a cell with a small interfering RNA (siRNA) molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242. In some aspects, the siRNA molecule comprises a 20-to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0430] In some aspects, the methods can comprise contacting a cell with a small interfering RNA (siRNA) molecule wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0431] Disclosed herein are methods reducing fibrosis. In some aspects, the methods can comprise contacting a cell with a small interfering RNA (siRNA) molecule that specifically ATTORNEY DOCKET NO 21101.0493P1
[0432] targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242. In some aspects, the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+ -induced mitochondrial fission.
[0433] In some aspects, the methods can comprise contacting a cell with a small interfering RNA (siRNA) molecule wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0434] Disclosed herein are methods reducing hepatocyte injury. In some aspects, the methods can comprise contacting a cell with a small interfering RNA (siRNA) molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242. In some aspects, the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0435] In some aspects, the methods can comprise contacting a cell with a small interfering RNA (siRNA) molecule wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0436] Disclosed herein are methods increasing mitochondrial size within cells. In some aspects, the methods can comprise contacting a cell with a small interfering RNA (siRNA) ATTORNEY DOCKET NO 21101.0493P1
[0437] molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242. In some aspects, the siRNA molecule comprises a 20-to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0438] In some aspects, the methods can comprise contacting a cell with a small interfering RNA (siRNA) molecule wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the therapeutically effective amount can reduce Ca2+-induced mitochondrial fission.
[0439] In some aspects, the cell can be a vertebrate, a mammalian or a human cell. In some aspects, the cell can be a hepatocyte cell. In some aspects, the cell can be a mammalian cell. In some aspects, the mammalian cell can be a hepatocyte cell.
[0440] In some aspects, at least one nucleotide of any of the siRNA molecules can comprise a chemical modification. In some aspects, the chemical modification can be on the sense strand, the antisense strand or on both. In some aspects, the siRNA molecule can comprise at least one sequence is selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236.
[0441] In some aspects, the methods can further include the step of identifying a subject (e.g., a human patient) who has metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis and then providing to the subject any of the siRNA molecules disclosed herein or a composition comprising any of the siRNA molecules disclosed herein. In some aspects, the small interfering RNA (siRNA) molecule or the composition comprising the siRNA molecule specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ATTORNEY DOCKET NO 21101.0493P1
[0442] ID NO: 236. In some aspects, the siRNA molecule can comprise at least one sequence having at least 90% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236.
[0443] In some aspects, the subject has an metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis. In some aspects, the subject can be identified using standard clinical tests known to those skilled in the art. Diagnosis of any one of metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis can involve a clinical tests, laboratory tests, imaging tests, or a combination thereof. Examples of clinical tests or evaluations can include a medical history (e.g., obesity, type 2 diabetes, high blood pressure, high cholesterol, and insulin resistance) and a phy sical exam (e.g.. liver enlargement, tenderness). Examples of laboratory tests include but are not limited to liver function tests (ALT, AST, alkaline phosphatase, bilirubin), blood glucose levels, lipid profile (e.g., triglycerides, cholesterol) insulin levels, and fibrosis scores (e.g., FIB-4, ELF). Examples of imaging tests include but are not limited to ultrasound or MRI to assess fat accumulation in the liver; and liver biopsy.
[0444] The therapeutically effective amount can be the amount of the composition administered to a subject that leads to a full resolution of the symptoms of the condition or disease, a reduction in the severity of the symptoms of the condition or disease, or a slowing of the progression of symptoms of the condition or disease. The methods described herein can also include a monitoring step to optimize dosing. The compositions described herein can be administered as a preventive treatment or to delay or slow the progression of untoward or degenerative changes. In some aspects, the therapeutically effective amount of any of the siRNA molecules disclosed herein can reduce Ca2+-induced mitochondrial fission.
[0445] The compositions disclosed herein can be used in a variety of ways. For instance, the compositions disclosed herein can be used for direct delivery of modified therapeutic cells, or adeno-associated virus. The compositions disclosed herein can be used or delivered or administered at any time during the treatment process. The compositions described herein including cells or a virus can be delivered to the one or more liver regions, one or more liver cells, or to regions of the liver or liver cells to stop or prevent one or more signs of symptoms of the disease or condition in an adj cent region or the liver or liver cell.
[0446] The dosage to be administered depends on many factors including, for example, the route of administration, the formulation, the severity of the patient's condition / disease, previous treatments, the patient's size, weight, surface area, age, and gender, other drugs being administered, and the overall general health of the patient including the presence or ATTORNEY DOCKET NO 21101.0493P1
[0447] absence of other diseases, disorders or illnesses. Dosage levels can be adjusted using standard empirical methods for optimization known by one skilled in the art. Administrations of the compositions described herein can be single or multiple (e.g., 2- or 3-, 4-, 6-, 8-, 10-, 20-, 50-, 100-, 150-, or more fold). Further, encapsulation of the compositions in a suitable del i \ er\ vehicle (e.g., polymeric microparticles or implantable devices) can improve the efficiency of delivery.
[0448] The therapeutically effective amount of the compositions described herein can include a single treatment or a series of treatments (i.e., multiple treatments or administered multiple times). Treatment duration using any of compositions disclosed herein can be any length of time, such as, for example, one day to as long as the life span of the subject (e.g., many¬ years). For instance, the composition can be administered daily, weekly, monthly, yearly for a period of 5 years, ten years, or longer. The frequency of treatment can vary. For example, the compositions described herein can be administered once (or twice, three times, etc.) daily, weekly, monthly, or yearly for a period of 5 years, ten years, or longer.
[0449] In some aspects, the compositions disclosed herein can also be co-administered with another therapeutic agent. In some aspects, the methods disclosed herein can further comprise administering glucagon -like peptide (GLP-1), GLP-l / glucose-dependent insulinotropic polypeptide (GIP), or GLPl / GIP / glucagon(GCG) agonists; thyroid hormone receptor agonists; FGF21 analogs; PPAR agonists; fatty acid synthase inhibitors; metformin; thiazolidinediones. Vitamin E to the subject. In some aspects, the GLP-1 agonist can be semaglutide (Ozempic, Wegovy, Rybelsus), liraglutide (Victoza, Saxenda) or tirzepatide (Mounjaro, Zepbound), exenatide (Byetta), lixisenatide (Adlyxin) or dulaglutide (Trul icily). In some aspects, the GLP-l / GIP agonist can be tirzepatide (Mounjaro, Zepbound). In some aspects, the GLP1 / GIP / GCG agonist can be retatrutide. In some aspects, the thyroid hormone receptor agonist can be resmetirom (Rezdiffra), sobetirome (GC-1), eprotirome (KB2115) or VK2809. In some aspects, the FGF21 analog can be efruxifermin, pegozafermin, or LY2405319. In some aspects, the PPAR agonist can be fenofibrate, gemfibrozil, bezafibrate, rosiglitazone, pioglitazone, elafibranor, or seladelpar. In some aspects, the fatty acid synthase inhibitor can be orlistat, cerulenin. C75, epigallocatechin-3 -gallate (EGCG), quercetin, denifanstat (TVB-2640), C93, GSK8377149A, platensimycin, luteolin, ortriclosan. In some aspects, the thiazolidinedione can be pioglitazone (Actos) or rosiglitazone (Avandia). In some aspects, the methods disclosed herein can further comprise administering an antiinflammatory- therapy to the subject. ATTORNEY DOCKET NO 21101.0493P1
[0450] The compositions disclosed herein can be administered before, during, after, or in various combinations relative to a second therapeutic agent or therapy. The administrations may be in intervals ranging from concurrently to minutes to days to weeks. In aspects where the compositions disclosed herein are provided to a patient separately from a second therapeutic agent or therapy, one would generally ensure that a significant period of time did not expire between the time of each delivery, such that the two compounds would still be able to exert an advantageously combined effect on the patient. In such instances, it is contemplated that one may provide a patient with the compositions disclosed herein and the second therapeutic agent or therapy within about 12 to 24 or 72 h of each other and, more particularly, within about 6-12 h of each other. In some situations, it may be desirable to extend the time period for treatment significantly where several days (2, 3, 4, 5. 6, or 7) to several weeks (1, 2, 3, 4, 5, 6, 7, or 8) lapse between respective administrations.
[0451] In some aspects, a course of treatment can last between 1-90 days or more (this such range includes intervening days). It is contemplated that one agent may be given on any day of day 1 to day 90 (this such range includes intervening days) or any combination thereof, and another agent is given on any day of day 1 to day 90 (this such range includes intervening days) or any combination thereof. Within a single day (24-hour period), the patient may be given one or multiple administrations of the agent(s). Moreover, after a course of treatment, it is contemplated that there can be a period of time at which no anti-cancer treatment is administered. This time period may last 1-7 days, and / or 1-5 weeks, and / or 1-12 months or more (this such range includes intervening days), depending on the condition of the patient, such as their prognosis, strength, health, etc. It is expected that the treatment cycles would be repeated as necessary.
[0452] Various combinations may be employed. For the example below a composition disclosed herein is " A” and a second therapeutic agent is “B”:
[0453] A / B / A B / A / B B / B / A A / A / B A / B / B B / A / A A / B / B / B B / A / B / B B / B / B / A B / B / A / B A / A / B / B A / B / A / B A / B / B / A B / B / A / A B / A / B / A B / A / A / B A / A / A / B B / A / A / A A / B / A / A A / A / B / A.
[0454] Administration of any composition or therapy disclosed herein to a patient will follow general protocols for the administration of such compounds, taking into account the toxicity, if any, of the agents. Therefore, in some aspects there can be a step of monitoring toxicity that can be attributable to combination therapy.
[0455] In some aspects, the second therapeutic agent can be glucagon-like peptide (GLP-1), GLP-1 / glucose-dependent insulinotropic polypeptide (GIP), or GLP1 / GIP / GCG agonists; ATTORNEY DOCKET NO 21101.0493P1
[0456] thyroid hormone receptor agonists; FGF21 analogs; PPAR agonists; fatty acid synthase inhibitors; metformin; thiazolidinediones, Vitamin E to the subject. In some aspects, the GLP-1 agonist can be semaglutide (Ozempic, Wegovy, Rybelsus), liraglutide (Victoza, Saxenda) or tirzepatide (Mounjaro, Zepbound), exenatide (Byetta), lixisenatide (Adlyxin) or dulaglutide (Trulicity). In some aspects, the GLP-l / GIP agonist can be tirzepatide (Mounjaro, Zepbound). In some aspects, the GLP1 / GIP / GCG agonist can be retatrutide. In some aspects, the thyroid hormone receptor agonist can be resmetirom (Rezdiffra), sobetirome (GC-1). eprotirome (KB2115) or VK2809. In some aspects, the FGF21 analog can be efruxifermin, pegozafermin, or LY2405319. In some aspects, the PPAR agonist can be fenofibrate, gemfibrozil, bezafibrate, rosiglitazone, pioglitazone, elafibranor, or seladelpar. In some aspects, the fatty acid synthase inhibitor can be orlistat, cerulenin, C75. epigallocatechin-3-gallate (EGCG), quercetin, denifanstat (TVB-2640), C93, GSK8377149A, platensimycin, luteolin, or triclosan. In some aspects, the thiazolidinedione can be pioglitazone (Actos) or rosiglitazone (Avandia). In some aspects, the methods disclosed herein can further comprise administering an anti-inflammatory therapy to the subject.
[0457] The total effective amount of any of the siRNA molecules disclosed herein can be administered to a subject as a single dose, either as a bolus or by infusion over a relatively short period of time, or can be administered using a fractionated treatment protocol in which multiple doses are administered over a more prolonged period of time. Alternatively, continuous intravenous infusions sufficient to maintain therapeutically effective concentrations in the blood are also within the scope of the present disclosure.
[0458] PHARMACEUTICAL COMPOSITIONS
[0459] As disclosed herein, are pharmaceutical compositions, comprising the compositions disclosed herein. In some aspects, the pharmaceutical composition can comprise any of siRNA molecules disclosed herein. In some aspects, the compositions can comprise at least one siRNA molecule disclosed herein. In some aspects, the pharmaceutical compositions can further comprise a pharmaceutically acceptable carrier.
[0460] Disclosed herein, are pharmaceutical compositions, comprising a nucleic acid sequence or molecule wherein the nucleic acid comprises or consists of a sequence having the sequence set forth in:
[0461] UUCAGCUCCAUCAGGUCGAUG (SEQ ID NO: 2), UUCAGCUCCAUCAGGUCGAUGAA (SEQ ID NO: 4), UUCUCCAUCAUCAGCUUCAGC (SEQ ID NO: 6), UUCUCCAUCAUCAGCUUCAGCUC (SEQ ID NO: 8), ATTORNEY DOCKET NO 21101.0493P1
[0462] UUCAGGCCCAGGUGGGUCUGG (SEQ ID NO: 10), UUCAGGCCCAGGUGGGUCUGGUG (SEQ ID NO: 12), ACCUUGGCUUCAAAGAAGUUC (SEQ ID NO: 14), ACCUUGGCUUCAAAGAAGUUCUU (SEQ ID NO: 16), AAACUUACUGGCCGAUGACAA (SEQ ID NO: 18), AAACUUACUGGCCGAUGACAAGG (SEQ ID NO: 20), GAACAUGCUCUCCAGGUCCUU (SEQ ID NO: 22).
[0463] GAACAUGCUCUCCAGGUCCUUGA (SEQ ID NO: 24), ACAGUUUGAACAUGCUCUCCA (SEQ ID NO: 26), ACAGUUUGAACAUGCUCUCCAGG (SEQ ID NO: 28), UCUGCUUCAAACUUACUGGCC (SEQ ID NO: 30).
[0464] UCUGCUUCAAACUUACUGGCCGA (SEQ ID NO: 32), GCUCAGCUUUCAACUCUGCUU (SEQ ID NO: 34), GCUCAGCUUUCAACUCUGCUCCA (SEQ ID NO: 36), or GUUGGCCUUGAGUUUCUGGAA (SEQ ID NO: 38).
[0465] Disclosed herein, are pharmaceutical compositions, comprising a nucleic acid sequence or molecule wherein the nucleic acid comprises or consists of a sequence having at least 90% identity to the sequence set forth in:
[0466] UUCAGCUCCAUCAGGUCGAUG (SEQ ID NO: 2), UUCAGCUCCAUCAGGUCGAUGAA (SEQ ID NO: 4), UUCUCCAUCAUCAGCUUCAGC (SEQ ID NO: 6), UUCUCCAUCAUCAGCUUCAGCUC (SEQ ID NO: 8), UUCAGGCCCAGGUGGGUCUGG (SEQ ID NO: 10), UUCAGGCCCAGGUGGGUCUGGUG (SEQ ID NO: 12), ACCUUGGCUUCAAAGAAGUUC (SEQ ID NO: 14), ACCUUGGCUUCAAAGAAGUUCUU (SEQ ID NO: 16), AAACUUACUGGCCGAUGACAA (SEQ ID NO: 18), AAACUUACUGGCCGAUGACAAGG (SEQ ID NO: 20), GAACAUGCUCUCCAGGUCCUU (SEQ ID NO: 22).
[0467] GAACAUGCUCUCCAGGUCCUUGA (SEQ ID NO: 24), ACAGUUUGAACAUGCUCUCCA (SEQ ID NO: 26), ACAGUUUGAACAUGCUCUCCAGG (SEQ ID NO: 28), UCUGCUUCAAACUUACUGGCC (SEQ ID NO: 30), UCUGCUUCAAACUUACUGGCCGA (SEQ ID NO: 32), ATTORNEY DOCKET NO 21101.0493P1
[0468] GCUCAGCUUUCAACUCUGCUU (SEQ ID NO: 34), GCUCAGCUUUCAACUCUGCUCCA (SEQ ID NO: 36), or GUUGGCCUUGAGUUUCUGGAA (SEQ ID NO: 38).
[0469] As used herein, the term '‘pharmaceutically acceptable carrier” refers to solvents, dispersion media, coatings, antibacterial, isotonic and absorption delaying agents, buffers, excipients, binders, lubricants, gels, surfactants that can be used as media for a pharmaceutically acceptable substance. The pharmaceutically acceptable carriers can be lipid-based or a polymer-based colloid. Examples of colloids include liposomes, hydrogels, microparticles, nanoparticles and micelles. The compositions can be formulated for administration by any of a variety of routes of administration, and can include one or more physiologically acceptable excipients, which can vary depending on the route of administration. Any of the nucleic acids, vectors, siRNAs, antisense siRNAs, and sense siRNAs described herein can be administered in the form of a pharmaceutical composition.
[0470] As used herein, the term “excipient” means any compound or substance, including those that can also be referred to as '‘carriers” or “diluents.” Preparing pharmaceutical and physiologically acceptable compositions is considered routine in the art, and thus, one of ordinary skill in the art can consult numerous authorities for guidance if needed. The compositions can also include additional agents (e.g., preservatives).
[0471] The pharmaceutical compositions as disclosed herein can be prepared for oral or parenteral administration. Pharmaceutical compositions prepared for parenteral administration include those prepared for intravenous (or intra-arterial), intramuscular, subcutaneous, intrathecal or intraperitoneal administration. Paternal administration can be in the form of a single bolus dose, or may be, for example, by a continuous pump. In some aspects, the compositions can be prepared for parenteral administration that includes dissolving or suspending the nucleic acids, polynucleic sequences, vectors or siRNA molecules in an acceptable carrier, including but not limited to an aqueous carrier, such as water, buffered water, saline, buffered saline (e.g., PBS), and the like. One or more of the excipients included can help approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents, wetting agents, detergents, and the like. Where the compositions include a solid component (as they may for oral administration), one or more of the excipients can act as a binder or filler (e.g., for the formulation of a tablet, a capsule, and the like). Where the compositions are formulated for application to the skin or to a mucosal surface, one or more of the excipients can be a solvent or emulsifier for the formulation of a cream, an ointment, and the like. ATTORNEY DOCKET NO 21101.0493P1
[0472] In some aspects, the compositions disclosed herein are formulated for oral, intramuscular, intravenous, subcutaneous, intrathecal, intratumoral. or intraperitoneal administration.
[0473] The pharmaceutical compositions can be sterile and sterilized by conventional sterilization techniques or sterile filtered. Aqueous solutions can be packaged for use as is, or lyophilized, the lyophilized preparation, which is encompassed by the present disclosure, can be combined with a sterile aqueous carrier prior to administration. The pH of the pharmaceutical compositions typically will be between 3 and 11 (e.g., between about 5 and 9) or between 6 and 8 (e.g., between about 7 and 8). The resulting compositions in solid form can be packaged in multiple single dose units, each containing a fixed amount of the above-mentioned agent or agents, such as in a sealed package of tablets or capsules. The composition in solid form can also be packaged in a container for a flexible quantity, such as in a squeezable tube designed for a topically applicable cream or ointment. The compositions can also be formulated as powders, elixirs, suspensions, emulsions, solutions, syrups, aerosols, lotions, creams, ointments, gels, suppositories, sterile injectable solutions and sterile packaged powders. The active ingredient can be siRNA molecules, nucleic acids or vectors described herein in combination with one or more pharmaceutically acceptable carriers. As used herein “pharmaceutically acceptable” means molecules and compositions that do not produce or lead to an untoward reaction (i.e., adverse, negative or allergic reaction) when administered to a subject as intended (i.e., as appropriate).
[0474] In some aspects, the vectors, siRNAs and nucleic acid sequences as disclosed herein can be delivered to a cell of the subject. In some aspects, such action can be achieved, for example, by using polymeric, biodegradable microparticle or microcapsule delivery vehicle, sized to optimize phagocytosis by phagocytic cells (e.g., macrophages).
[0475] In some aspects, the formulations include any that are suitable for the delivery of a virus (e.g., adeno-associated virus) and cells. In some aspects, the route of administration includes but is not limited to direct injection into the brain. Such administration can be done without surgery, or with surgery.
[0476] The compositions described herein used in the disclosed methods can be formulated to include a therapeutically effective amount of any of the siRNAs disclosed herein. In some aspects, the siRNAs disclosed herein can be contained within a pharmaceutical formulation. In some aspects, the pharmaceutical formulation can be a unit dosage formulation.
[0477] The therapeutically effective amount or dosage of any of the siRNAs used in the methods as disclosed herein applied to mammals (e.g., humans) can be determined by one of ATTORNEY DOCKET NO 21101.0493P1
[0478] ordinary' skill in the art with consideration of individual differences in age, weight, sex, the severity’ of the subject’s symptoms, and the particular composition or route of administration selected, other drugs administered and the judgment of the attending clinician. Variations in the needed dosage may be expected. Variations in dosage levels can be adjusted using standard empirical routes for optimization. The particular dosage of a pharmaceutical composition to be administered to the patient will depend on a variety of considerations (e.g., the severity of the symptoms), the age and physical characteristics of the subject and other considerations known to those of ordinary skill in the art. Dosages can be established using clinical approaches known to one of ordinary’ skill in the art. A therapeutically effective dosage of any of the siRNAs can result in a decrease in severity of one or more disease symptoms, an increase in frequency and duration of disease symptom-free periods, or a prevention of impairment or disability due to the disease affliction. As disclosed therein, in some aspects a therapeutically effective amount of any of the siRNA molecules or compositions disclosed herein can reduce Ca2+-induced mitochondrial fission, reduce or decrease inflammation (in the liver; or reduce hepatitis), reduce fibrosis, reduce hepatocyte injury, increase mitochondrial size within cells or otherwise reduce or ameliorate one or more symptoms in a subject.
[0479] The duration of treatment with any composition in the methods disclosed herein can be any length of time from as short as one day to as long as the life span of the host (e.g., many years). For example, the compositions can be administered once a week (for, for example, 4 weeks to many months or years); once a month (for, for example, three to twelve months or for many years); or once a year for a period of 5 years, ten years, or longer. It is also noted that the frequency of treatment can be variable. For example, the present compositions can be administered once (or twice, three times, etc.) daily, weekly, monthly, or yearly.
[0480] In some aspects, the methods disclosed herein also include treating a subject having metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis. In some aspects, the methods disclosed herein can include the step of determining EFHD1 levels in a subject.
[0481] KITS
[0482] Disclosed herein are kits that comprise any combination of the compositions (e g., any of siRNAs) described above and suitable instructions (e.g., written and / or provided as audio-, visual-, or audiovisual material). Disclosed herein are kits that comprise any combination of the pharmaceutical compositions described above and suitable instructions (e.g., written and / or provided as audio-, visual-, or audiovisual material). In some aspects, the kit comprises a predetermined amount of a composition or pharmaceutical composition ATTORNEY DOCKET NO 21101.0493P1
[0483] comprising any of the siRNA molecules disclosed herein. The kit can further comprise one or more of the following: instructions, sterile fluid, syringes, a sterile container, delivery¬ devices, and buffers or other control reagents.
[0484] EXAMPLES
[0485] It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
[0486] Example 1. EFHD1 promotes hepatocyte injury in metabolic liver disease by triggering Ca2+-dependent mitochondrial fission
[0487] EFHD1 is expressed in hepatocytes and increases during MASH. Examination of several human single-cell RNA-seq datasets reveals that, within the liver. EFHD1 is preferentially expressed in hepatocytes (FIG. 1A, 8A) (Aizarani, N., et al. (2019). Nature 572, 199-204; Andrews, T. S., et al. (2022). Hepatol Commun 6, 821-840: Guilliams, M., et al. (2022). Cell 185, 379-396.e338; MacParland, S. A., et al. (2018). Nat Commun 9, 4383; and Ramachandran, P., et al. (2019). Nature 575, 512-518). Expression in other liver cell types (e.g., cholangiocytes and non-hepatocytes) is minimal or absent, and not consistent across datasets, demonstrating that EFHD1 is largely restricted to hepatocytes. Moreover, human EFHD1 expression was enriched in periportal hepatocyte clusters with high complement and immune pathway activation (Hong, S. E., et al. (2025). Nat Genet 57, 1638-1648; and MacParland, S. A., et al. (2018). Nat Commun 9, 4383). These findings were confirmed by staining of human liver sections (FIG. IB). Next, it was examined whether EFHD1 expression was changed during MASH. In data from recent RNA-seq analyses, EFHD1 expression was increased ~2-fold in hepatocytes from obese humans (Guilliams, M., et al. (2022). Cell 185, 379-396. e338). Though EFHD1 transcripts decrease in advanced MASH (Hong. S. E., et al. (2025). Nat Genet 57. 1638-1648; Govaere, O., et al. (2020). Sci Transl Med 72; and Suppli, M. P., et al. (2019). Am J Physiol Gastrointest Liver Physiol 316, G462-g472), it was confirmed that the EFHD1 protein itself is elevated (FIGS. 1C-D). Thus, EFHD1 is enriched specifically in hepatocytes involved in injury signaling and increases as MASH develops. ATTORNEY DOCKET NO 21101.0493P1
[0488] To investigate EFHD1 function further, mouse models were used. Three separate diets were implemented, a normal chow diet that does not produce liver injury, a high fat diet (HFD, 60% fat, 18% protein, 22% carbohydrate), which produces obesity but mild liver injury, and a Gubra Amylin MASH diet (40% fat, 2% cholesterol, 20% fructose), which leads to minimal obesity' but mimics hallmarks of human MASH injury' including hepatocyte ballooning, inflammation, and fibrosis (FIG. 8B) (Boland, M. L., et al. (2019). World J Gastroenterol 25, 4904-4920; and Clapper, J. R.. et al. (2013). Am J Physiol Gastrointest Liver Physiol 305, G483-495). For HFD and MASH, mice were started on the diet at 8 weeks of age for up to 28 weeks duration (36 weeks of age). In prior studies of MASH, EFHD1 was induced 2-to-6-fold under different obesogenic diets in mouse livers (Guilliams, M., et al. (2022). Cell 185. 379-396; and Loft. A., et al. (2021). Cell Metab 33, 1685-1700.el689). confirmed by the 2-4-fold increase in EFHD1 in wild-type animals on both HFD and MASH diets (FIGS. 1E-F, 8C-D). Taken together, human and mouse studies show that EFHD1 is expressed in hepatocytes and is upregulated during ovemutrition.
[0489] Deletion ofEFHDl does not affect energy balance but is protective in MASH. Human GWAS studies suggest diminished EFHD1 expression is associated with protection from liver injury. To investigate this, a whole-body EFHD1 knockout mouse (Efhdl'f was used (Eberhardt, D. R., et al. (2022). J Mol Cell Cardiol.). EFHD1 ablation in mouse livers was confirmed (FIGS. 1G-H). The mice did not have any significant changes in weight gain, body composition, feeding, activity, insulin resistance, and liver / body weight (FIGS. 8E-R). These results show that the loss ofEFHDl is well-tolerated, and, moreover, demonstrate that any changes in hepatic physiology are independent of global energy' balance.
[0490] Next, to examine EFHD1 effects on MASH progression, a range of serum and histological biomarkers of hepatic function were measured in mice after a 6-hour fast. First, hepatic lipid metabolism was assayed. In the three conditions (chow, HFD, MASH), serum triglycerides in Efhdl'^ animals were not significantly7different than controls, though there was a trend for Efhdl^' males to have lower circulating levels (FIGS. II, 9A-B). Next, the overall MASH activity score was assessed by blinded pathologist assessment of histology, as well as the individual contributions of hepatocyte ballooning, lipid droplets, and inflammation to this score (FIGS. 1J-M, 9C-G, J-L) (Asgharpour, A., et al. (2016). J Hepatol 65, 579-588; and Liang, W., et al. (2014). PLoS One 9, el 15922). This score is primarily driven by steatosis. These assessments were complimented with direct measurement of lipid droplet size and count (FIGS. 1N-O. FIGS. 9H-I, M-N). Interestingly, though there were differences in ballooning and lipid content primarily in the males for normal chow. ATTORNEY DOCKET NO 21101.0493P1
[0491] differences in steatosis disappeared under the HFD and MASH diet. These results show that EFHD1 effects on hepatic lipid metabolism are minor or indirect, and are consistent with the absence of EFHD1 in human MASH GWAS studies that focus solely on hepatic fat.
[0492] In contrast, EFHD1 is repeatedly identified in human GWAS studies that rely on measurement of serum liver enzymes as a proxy for liver injury'. Similarly, serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) levels in Eftidl'2' mice were observed to be nearly half of wild-type values under three diets (FIGS. 1P-Q. S2O-R), demonstrating that EfhdF' mice are protected from liver injury at baseline and during ovemutrition. Such protection was evident on tissue histology' (FIGS. 1R, 9S). Blinded assessment by a pathologist revealed decreases in liver inflammation score in the males in both HFD and MASH diets, which was confirmed by directly counting clusters of inflammatory' cells (FIGS. 1S-T, 9U-W). In EftidF'' livers, fewer inflammatory cells per cluster were also noted (FIGS. 1R, 9S). Female mice are known to be less injured by7ovemutrition, so their inflammation scores were lower and not statistically' different between genotypes, though reductions in nuclei clusters were still observed upon direct counting (FIG. IT). A similar sex-based dichotomy was evident when quantifying liver fibrosis after a MASH diet (FIGS. 1U-W). Males had decreases in fibrosis assessed both by blinded pathologist scoring as well as direct measurement, whereas the degree of injury' was less in females, with less fibrosis evident on direct assessment but not by clinical score. Pathological fibrosis was minimal after the chow or HFD (FIG. 9T), so these were not scored. To summarize, the findings here reveal that loss of EFHD1 is protective during MASH progression, but this protection is mediated by reduced susceptibility to liver injury' rather than pronounced changes in liver fat. These findings show that targeting hepatocyte injury directly may be an independent approach to treating MASH.
[0493] EFHD1 is important for Ca2+-induced mitochondrial fission. Next, the molecular mechanism by which inhibition of EFHD1 is protective was established. First, EFHD1 subcellular localization was examined. In situ proximity-labeling, currently the most rigorous assay for suborganellar localization, identifies EFHD1 at the outer membrane, cytoplasm, and ER membrane, but not within the mitochondria, in multiple independent compendia (FIG. 10A) (Antomcka, H., et al. (2020). Cell Metab 32, 479-497; Hung, V., et al. (2017). Elife 6; Kwak, C., et al. (2020). Proc Natl Acad Sci U S A 117, 12109-12120; and Go, C. D., et al. (2021). Nature 595, 120-124). Using proteinase K protection assays, EFHD1 is present primarily at the outer mitochondrial membrane (OMM), with a minor fraction in the intermembrane space, and none in the matrix (Eberhardt, D. R., et al. (2022). J Mol Cell Cardiol.; ATTORNEY DOCKET NO 21101.0493P1
[0494] and Delgado de laHerran, H., et al. (2024). Embo j.). On the OMM, EFHD1 is also present at ER-mitochondrial contact sites (ERMCS). where mitochondrial fission occurs (Eberhardt, D. R., et al. (2022). J Mol Cell Cardiol.). In agreement with these studies, these assays confirmed EFHD1 was present at hepatic ERMCS (FIG. 10B). Integrating this data with the well-established link between Ca2+signals, ERMCS, and mitochondrial fission shows EFHD1 might regulate mitochondrial shape (Fung, T. S., et al. (2023). Nat Rev Mol Cell Biol 24. 651-667; Quintana-Cabrera, R., and Scorrano. L. (2023). Mol Cell 83, 857-876; and Kraus, F., et al. (2021). Nature 590, 57-66).
[0495] Cultured hepatocytes were examined wi thin 24 hours of extraction and isolation from mouse livers (FIGS. 10C-E), a period prior to hepatocyte de-differentiation. Intriguingly, whereas mitochondria from WT hepatocytes appeared bean-shaped, mitochondria from Eflidl'1' hepatocytes were longer and spaghetti-shaped (FIGS. 2A-B). MitoTracker Orange, which will label active, polarized mitochondria, was used and confirmed this was not due to differences between injured versus healthy mitochondria in each phenotype. This difference was notable even in hepatocytes isolated from mice subject to MASH diet, which causes substantial mitochondrial fission (FIG. 2C). Further, direct measurement of mitochondrial length from transmission electron micrographs (TEM) revealed a similar increase in Ejhdl'^ hepatocytes in both normal and MASH diets (FIGS. 2D-F, 10F). Finally, this effect was not specific to hepatocytes as mitochondria were also longer than controls in cultured EFHD1' ' HepG2 and HAP1 cells, and this effect could be rescued by re-expression of EFHD1 (FIGS.
[0496] 2G-I, 10G-J).
[0497] Ca2+is a central trigger for mitochondrial fission during normal physiology, but the molecular mechanism transducing this signal has not been well established (Fung, T. S., et al. (2023). Nat Rev Mol Cell Biol 24. 651-667; Quintana-Cabrera, R., and Scorrano, L. (2023). Mol Cell 83, 857-876; and Kraus, F., et al. (2021). Nature 590, 57-66). In contrast, Ca2+does not directly trigger fusion. The findings of longer mitochondria in cells lacking EFHD1, a Ca2+-binding protein, led to testing whether EFHD1 could be the transducer between Ca2+signals and mitochondrial fission. To test this, ImM ATP was used to trigger Gq’ and IP3 receptor-mediated intracellular Ca2+release from ER stores37. The results show that WT mitochondria underwent fission when exposed to ATP, evident as a robust decrease in mitochondrial size (FIGS. 2A-B, 2G-H). In contrast, after EFHD1 deletion, mitochondria failed to show similar decreases in mitochondrial size. The blunting of fission could be replicated with direct application of the Ca2+ionophore ionomycin (FIG. 10K). In addition, the link to nutritional state, seen as the blunted fission in both normal chow and MASH-diet ATTORNEY DOCKET NO 21101.0493P1
[0498] fed mice, could be replicated in vitro. Starved WT hepatocytes had mitochondria that fissioned after incubation with high glucose and palmitate, but this effect was blunted in Ejhd '' hepatocytes (FIG. 10L).
[0499] To decisively link EFHD1 to fission, the fission events were quantified directly. Live cells were imaged over a three-minute time period and individual fission events were counted before and after adding ATP (FIGS. 2J, K). The results show that ATP significantly increased the frequency of fission events observed in both WT hepatocytes or HepG2 cells, but failed to do so in cells where EFHD1 had been deleted. Moreover, the frequency of fission events was also reduced at baseline in cells without EFHD1 compared to WT.
[0500] An important question is whether the Ca2+signal triggering fission needs to enter mitochondria, or acts primarily at the outer membrane (Fung, T. S., et al. (2023). Nat Rev Mol Cell Biol 24, 651-667; and Chakrabarti, R„ et al. (2018). J Cell Biol 217, 251-268). In the experiments described herein, cells were incubated with 1 pM Ru360, a selective blocker of the mitochondrial Ca2+uniporter, the channel allowing Ca2+entry into the mitochondrial matrix, implying that fission did not require Ca2+transport into the matrix. To confirm this further, a genetic approach with short-hairpin RNA was used to silence MCU, the channelforming subunit of the uniporter (FIGS. S3M, N) (Chaudhuri, D., et al. (2013). Elife 2, e00704). Even with this alternate approach, it was found that depleting MCU had no effect on ATP -induced fission events, confirming that the effect of deleting EFHD1 was independent of Ca2+transport into the matrix. Finally, to confirm that the effects seen were directly due to Ca2+acting on mitochondria, isolated hepatocytes were permeabilized with 0.002% digitonin, which at these low concentrations selectively permeabilizes the plasma membrane of the cell, leaving mitochondria intact. This was confirmed as a lack of mitochondrial shape change after digitonin addition. A 100 pM Ca2+bolus was then added directly to these permeabilized cells in the presence of 1 pM Ru360 to prevent matrix Ca2+uptake. In WT cells, this protocol led to both a shape transition as mitochondria rounded up, as well as fission events (FIGS. 2L, M). In contrast, these effects w ere substantially blunted in cells lacking EFHD1. Taken together, these results establish EFHD1 as a transducer of ER Ca2+release into a mitochondrial fission signal.
[0501] EFHD1 is important for Ca2+-dependent actin bundling during mitochondrial fission. Next, it was investigated how EFHD1 drives Ca2+-dependent mitochondrial fission.
[0502] Mitochondrial fission during normal physiology involves the cy toplasmic GTPase Drpl, which is recruited to the outer membrane by receptors, and constricts the mitochondrion until it divides. In the initial stages of fission, actin filaments are polymerized by the ER-associated ATTORNEY DOCKET NO 21101.0493P1
[0503] protein INF2 and assembled on the mitochondrial surface by SpirelC, leading to early constriction and aiding mitochondria-bound Drpl recruitment to fission sites (FIG. 3 A) (Fung, T. S., et al. (2023). Nat Rev Mol Cell Biol 24, 651-667; Korobova, F„ et al. (2013). Science 339, 464-467; and Manor, U., et al. (2015). Elife 4). Prior studies have suggested Ca2+can drive INF2-dependent actin polymerization and / or aid in the recruitment of Drpl to fission sites (Chakrabarti, R., et al. (2018). J Cell Biol 217, 251-268; Ji. W. K., et al. (2015). Elife 4. el 1553; Cereghetti, G. M.. et al. (2008). Proc Natl Acad Sci U S A 105, 15803-15808; and Bo, T., et al. (2018). Biochem Biophys Res Commun 495, 1601-1607). However, it is unclear at which step Ca2+signals are important, as some of these signals have been limited to pathological mitochondrial depolarization while the Ca2+transducers during normal physiology remain undefined.
[0504] The relative expression levels of proteins known to be involved in mitochondrial dynamics in the livers from WT and Eftidl'1' mice were tested (FIG. 3B). The most prominent change was a marked increase in DRP1 in Eftidl’1’ livers compared to WT. This was not due to changes in mitochondrial content, as markers of the inner (NDUFS3) and outer membrane (TOMM20) were unchanged. This result is counterintuitive, since increased DRP1 would be expected to produce excessive fission, rather than the elongated mitochondria observed in Eftidl'^ mitochondria. An explanation might be that DRP1 is being expressed but not migrating to the OMM, for which two possible mechanisms exist. First, during cell damage, Ca2+controls DRP1 migration to the OMM by altering its phosphorylation state, with CaMKII-dependent phosphorylation at Ser-616 and Ca27calcineurin-dependent dephosphorylation at Ser-627 both enhancing DRP1 fission activity’ (Cereghetti, G. M., et al. (2008). Proc Natl Acad Sci U S A 105, 15803-15808; and Bo, T., et al. (2018). Biochem Biophys Res Commun 495, 1601-1607), and perhaps EFHD1 is involved in these regulatory pathways. Second, in a proximity ligation proteormc compendium, EFHD1 was found to interact with the OMM adaptor FIS1 (Antonicka, H., et al. (2020). Cell Metab 32, 479-497). Though FIS1 is important for DRP1 recruitment in yeast but not mammals, perhaps its interaction with EFHD1 is relevant for adequate fission.
[0505] Thus, it was examined whether DRP1 recruitment to the OMM was blunted in Eftidl' ' livers. Contrary to expectation, it was found that DRP1 Ser-616 phosphorylation was increased, while Ser-637 phosphorylation was reduced, in Eftidl_ / _livers relative WT, demonstrating that DRP1 was in a hyperactive state (FIG. 3B). Moreover, DRP1 puncta localized robustly to mitochondria in both WT and Eftidl '' cells, further showing no defect in its activity (FIG. HA). Turning to FIS 1, an interaction with EFHD1 was confirmed via co- ATTORNEY DOCKET NO 21101.0493P1
[0506] immunoprecipitation in HepG2 cells (FIG. 3C). If the block in fission was at the level of FIS1. it would be expected that overexpressing FIS1 in WT cells would lead to excessive fission, whereas it would have no effect in EFHDT' cells. In contrast, we saw no difference between WT and EFHD1 '' cells after FIS1 overexpression, consisting of the established phenofi pe of a dense perinuclear localization of fissioned mitochondria (Stojanovski, D., et al. (2004). J Cell Sci 117, 1201-1210; and Yu. R., et al. (2019). Emboj 38) (FIG. 11B). In sum, EFHD1 is not directly interfering with DRP1 recruitment or activity. Rather, the increased expression of hyperactive DRP1 likely represents a cellular compensatory response for mitochondrial fission impaired at some other step, and is likely the reason a lower degree of fission is still present in the Efhdl^' hepatocytes. Such a compensatory response likely also explains the decreased expression of MFN2 and possibly OPA1 (FIG. 3B). mitochondrial fusion proteins that may be downregulated to prevent further elongation of mitochondria in cells lacking EFHD1.
[0507] Having established that EFHD1 is not involved in DRP1 activation or recruitment, the earlier events involving actin structural rearrangements that help ER straddle mitochondria, fixing them in place for fission, were assessed. In this process, the inverted formin INF2 induces polymerization of actin at ERMCS in a Ca2+-dependent manner, though INF2 itself is not a Ca2+-binding protein (Chakrabarti, R., et al. (2018). J Cell Biol 217, 251-268; and Korobova, F., et al. (2013). Science 339, 464-467). Unlike DRP1, MFN2, or OPA1, INF2 expression followed a pattern which would be expected in cells with impaired fission, showing a reduction in expression in EflidE'' mitochondria (FIG. 3B). It did not co-immunoprecipitate with EFHD1, though their expression patterns do overlap (FIGS. 3C, D), and showed that EFHD1 is be involved in actin rearrangements.
[0508] In fact, EFHD1 is known to bind actin, and bundles actin filaments in the presence of Ca2+(Mun, S. A., et al. (2020). Front Cell Dev Biol 8, 628222). A closely related homolog, EFHD2, crosslinks actin networks in a Ca2+-dependent manner during epithelial wound closure (Lehne, F., et al. (2022). Nat Commun 13, 2492). Moreover, despite its initial identification as a mitochondrial protein, in recent protein-protein interaction compendia assembled both from co-immunoprecipitation or proximity ligation proteomics, EFHD1 is annotated primarily as an actin-binding protein (FIG. 11 C) (Go, C D., et al. (2021). Nature 595, 120-124; and Hein, M. Y., et al. (2025). Cell 188, 1137-1155). Following these results, actin binding was confirmed via coimmunoprecipitation (FIG. 3C). To investigate binding further. AlphaFold3 was used to model EFHDl-actin binding (Abramson, J., et al. (2024). Nature 630, 493-500). In the presence of 2 Ca2+ions and one ATP molecule, AlphaFold3 ATTORNEY DOCKET NO 21101.0493P1
[0509] predicted a high-confidence interaction (ipTM 0.84, with pLDDT > 90 at the interface) (FIGS. 3E, 1 ID). The Ca2+ion and ATP were placed as expected in the EFHD1 EF hands and actin nucleotide-binding cleft, respectively. Besides the EF hands, EFHD1 possesses both an intrinsically-disordered domain (IDR) at its N terminus, and a helical coiled-coil domain at its C terminus (FIG. 3E). In the predicted structure, EFHD1 was primarily bound between domains 1 and 2 of actin, leaving free the plus and minus ends, similar to other actin bundling proteins such as fimbrin or a-actinin (FIG. 1 IE). EFHD1 bound via a helical sequence linking the IDR to the EF hands, with some further interactions extending to the proximal portion of the coiled-coil domain. The greatest uncertainty in the prediction was the localization of the initial helical domain and IDR, with several models suggesting it could interact with the plus end within the target-binding cleft, potentially regulating actin polymerization (FIG. 1 ID). Structures with other stoichiometries or without Ca2+or ATP each had actin and EFHD1 in the same interaction pose, but with slightly lower ipTM values (some below the 0.8 cutoff).
[0510] With these insights into EFHD1 -actin binding, it was investigated whether loss of EFHD1 would alter actin networks, ERMCS, and Ca2+-dependent actin remodeling. First, whereas control cells had diffuse filamentous actin staining in the cytoplasm, both hepatocytes or HAP1 cells lacking EFHD1 possessed prominent actin stress fibers within the cytoplasm, away from the cortical actin networks at the cell periphery (FIGS. 3F, 11F). Since cellular actin networks were altered. ERMCS. defined as structures where mitochondria and ER membranes are typically <30 pm apart (Diokmetzidou, A., and Scorrano, L. (2025). Febs j), were examined. If the INF2-actin machinery is impaired by EFHD1 ablation, changes in ER-mitochondria membrane proximity on TEM images would be expected (FIGS. 3G-H). Two separate analyses, measuring either the distance at contact sites below the 50 pm threshold, or distances whenever there were stretches of apposed ER and OMM <200 pm were performed. In animals fed a chow diet, ER and OMM were closer together in the ERMCS of Eflid1’ hepatocytes compared to WT. Notably, ERMCS distances were stable for WT animals fed either normal chow or a MASH diet. In contrast, Efhd '' hepatocytes showed an increase in the ER-mitochondrial distance at ERMCS on a MASH diet. Intriguingly, this pattern held true when any ER-OMM was considered in close apposition. Again, while WT hepatocytes showed no change between chow and MASH, Efhdl'^ hepatocytes had increased ER-OMM distances in MASH. Moreover, in MASH Efl dl'1' hepatocytes, there was a distinct population where the ER-OMM distance was greatly increased (FIG. 3H). Next, Camdependent actin rearrangements were directly measured. Actin activity is often difficult to ATTORNEY DOCKET NO 21101.0493P1
[0511] measure in the cytoplasm, so a well-established methodology for a Ca2+- and INF2-driven cellular actin response was used (Chakrabarti, R., et al. (2018). J Cell Biol 277. 251-268; Ji, W. K., et al. (2015). Elife 4, el 1553; Shao, X., et al. (2015). Proc Natl Acad Sci U S A 772, E2595-2601; and Wales, P., et al. (2016). Elife 5). In this assay, increases of cytoplasmic Ca2+induced by the Ca2+ionophore ionomycin drive dynamic actin rearrangements dependent on initial INF2 polymerization, observed as a formation of an actin ring around the nucleus. In WT hepatocytes, a clear and robust nuclear actin ring was observed, whereas this effect was entirely absent in Eftidl'1’ hepatocytes (FIGS. 31, J). From these experiments, it was concluded that EFHD1 transduces ER Ca2+release into the signal driving actin bundling and constriction for mitochondrial fission during normal physiology (FIG. 12). In the absence of EFHD1. ERMCS tethering is more prone to disruption during MASH.
[0512] EFHD1 ablation protects hepatocyte mitochondria without directly altering Ca2+uptake. Having established how EFHD1 affected mitochondrial fission, it was next investigated how it affects hepatocyte health. Mitochondrial morphology is known to affect respiratory rates, with fissioned mitochondria featuring greater fatty acid oxidation (FAO) (Shao, X., et al. (2015). Proc Natl Acad Sci U S A 772, E2595-2601; and Wales. P„ et al. (2016). Elife 5). In prior studies loss of EFHD1 was associated with reduced glycolysis and respiration, with variable effects on lipid metabolism, in various cell types (Pandey, G. K., et al. (2024). HGG Adv 5, 100275; Hong, S. E., et al. (2025). Nat Genet 57, 1638-1648; Stein, M._ et al. (2017). Cell Death Differ 24, 1239-1252; and Ulisse, V., et al. (2020). Life Sci Alliance 3). When hepatocyte oxygen consumption was examined using a Seahorse assay, reductions in FAO, given less fissioned mitochondria, was expected. Surprisingly, an increase in basal, ATP-linked respiratory' rates on both glycolytic and fatty acid substrates was found (FIGS. 4A-B). For glycolysis, part of the difference was driven by increased proton leak, whereas this was less evident in palmitic-acid driven respiration. To place these findings in context, other parameters of mitochondrial function were also examined. Different mitochondria-targeted fluorophores were used to image reactive oxygen species production, Ca2+levels, and mitochondrial membrane potential using confocal microscopy (FIGS. 4C-E). MitoS OX (5 pM) reports the production of a variety of mitochondrial reactive oxygen species, and a decrease in these in Eftidl'2' hepatocytes was found. Similarly, X-rhod-1 (5 pM) staining revealed lower basal mitochondrial Ca2+levels m ' Eftidl ^hepatocytes (FIG. 4D), though the distribution was wide, and moreover, this did not translate into changes in the phosphorylation of pyruvate dehydrogenase, one of the main mechanisms by which Ca2+levels can regulate fuel substrate use for oxidative phosphorylation (FIG. 13A) (Lee, S. H., et ATTORNEY DOCKET NO 21101.0493P1
[0513] al. (2023). Biochem Soc Trans 51, 1661-1673). TMRM staining (20 nM) showed that Eftidr'' mitochondria were more hyperpolarized (FIG. 4E). This was also unexpected given the Seahorse findings of slightly greater proton leak, which should depolarize membranes.
[0514] Nevertheless, the decrease in reactive oxygen species and Ca2+showed Eftidr'' hepatocytes are protected from Ca2+overload, a pathologic phenotype caused by Ca2+-dependent opening of an inner membrane channel, the mitochondrial permeability transition pore, which leads to mitochondrial disruption. Sensitivity to Ca2+overload was assayed by measuring the number of Ca2+pulses that isolated mitochondria could tolerate before depolarizing due to the permeability transition, visible as a sudden increase in TMRM signal (Ca2+retention capacity [CRC], FIGS. 4F-G, 13C-F). As in prior studies in hearts, Eftidr'' liver mitochondria were resistant to Ca2+overload (Eberhardt, D. R., et al. (2022). J Mol Cell Cardiol). Taken together, the results show Eftidr'' hepatocyte mitochondria are protected from injury. Their elevated respiration may be due to this resiliency, though notably a similar change in respiration was not seen in Eftidr'' cardiomyocytes (Eberhardt, D. R., et al. (2022). J Mol Cell Cardiol), nor did these changes in isolated hepatocytes translate into organismal differences in energy balance or lipid storage.
[0515] Though the downstream functional assays described herein are unlikely to be linked to EFHD1 by a single mechanism, several of them may be affected by mitochondrial Ca2+uptake. In fact, Ca2+signals within mitochondria may be important for inner membrane fission (Chakrabarti, R., et al. (2018). J Cell Biol 217. 251-268), and the EFHD1 fraction found in the intermembrane space interacts with the mitochondrial Ca2+uniporter (Delgado de laHerran, H., et al. (2024). Embo j). Therefore, it was examined if mitochondrial Ca2+uptake was altered in Eftidr ' hepatocytes. Unexpectedly, no significant changes were observed in uniporter subunits MCU or MICU1 (FIGS. 4H-I). Then, mitochondrial Ca2+uptake was directly measured in intact hepatocytes. The cytoplasm and mitochondria were labeled with Ca2+-sensitive dyes Cal520 (2 pM) and Xrhod-1 (5 pM), respectively, and ER Ca2+release was triggered with ATP, observing no clear difference between WT and Eftidr'' in Ca2+uptake (FIGS. 4J-L). This also further confirmed that differences in fission seen in FIG. 2 were not due to differences in ER Ca2+release. Because these measurements were done in intact cells with different mitochondrial morphology between WT and Eftidr'', Ca2uptake was further examined in isolated mitochondria purified by differential centrifugation. In these preparations, mitochondrial networks are disrupted, so differences in morphology are less relevant. Even in these conditions, no clear differences in Ca2+uptake was observed (FIGS. 4M-N). Lastly, direct measurement of mitochondrial Ca2+currents with whole- ATTORNEY DOCKET NO 21101.0493P1
[0516] mitoplast electrophysiology offers the most rigorous approach to quantify MCU-dependent fluxes (Chaudhuri, D., et al. (2013). Elife 2, e00704; and Kirichok, Y., et al. (2004). Nature 427, 360-364). With this approach as well, no difference between WT and EftidE'' in Ca2+transport was observed (FIGS. 4O-P). In summar\-. the results show that loss of hepatocyte EFHD1 confers protection from mitochondrial injury; but, at least in hepatocytes, this occurs through indirect means not dependent on changes in the mitochondrial Ca2uniporter.
[0517] EFHD1 ablation reduces hepatocyte inflammation and the integrated stress response. Next, to define the link connecting EFHD1 -dependent mitochondrial fission to inflammation and fibrosis seen in MASH livers, a multi-omic approach was used. First, RNA-seq of total RNA collected from whole livers of WT and Efhdl'^ mice was performed. For mice fed a normal diet, there were limited differences between WT and Eftid '' in global gene expression (FIGS. 14A-B), despite the marked alteration of mitochondrial fission. This was consistent with the relatively benign phenotype of EFHD1 deletion. Nevertheless, on gene set expression analysis, there was upregulation of selected metabolism pathways, and a clear decrease in interferon inflammatory pathways (FIG. 5A). For MASH diets, male animals were analyzed, since their liver damage was most severe, to maximize the chance of identifying how EFHD1 ablation was conferring protection from injury (FIGS. 5B, 14C-D). Common pathways upregulated in Efhdrf' livers in both normal and MASH diets were bile acid metabolism and the androgen response, but, more notably, an even stronger decrease in inflammatory’ pathways was seen in MASH livers from Eftidr' relative to WT.
[0518] To gain deeper insight into these pathways, label -free proteomic analysis of entire livers was carried out. Male mice from both normal and MASH diet cohorts were analyzed. The proteomic data showed clear separation between genoty pes and diet conditions (FIGS.
[0519] 14E-G). The data was analyzed in three separate ways: looking at changes between WT and Eftidr' for both diet conditions, but also examining changes in WT between normal and MASH diets. This additional analysis allows specific pathways affected by MASH that are rescued by EFHD1 ablation to be examined (FIGS. 5C-L). Using REACTOME pathway analysis, the most prominent changes caused by MASH relative to normal diets were in increased fibrosis and decreased mitochondrial metabolism, though injury pathways involving complement were also activated (FIGS. 5D, G). For Eflidl" livers, decreases in interferon inflammatory pathyvays (SARS-CoV-2-host interactions, IRF3-mediated induction of Type I IFN, IL-3, IL-5, and GM-CSF signaling) were found regardless of diet, while decreased fibrosis pathways (collagen biosynthesis and modification) and improved mitochondrial metabolism (respiratory electron transport, cristae formation) were noted in ATTORNEY DOCKET NO 21101.0493P1
[0520] MASH. This preserved mitochondrial metabolism in Efhdl'^ relative to WT during MASH can underlie the improved respiration found in the Seahorse assays (FIGS. 3A-B). To examine such changes further, the fold change was plotted for each pathway within REACTOME parental groups for MASH versus normal diets (WT animals) against the fold change for that pathway in Eflid / ' MASH versus WT MASH (FIGS. 5I-L). This graph revealed a significant negative slope when mapping REACTOME pathways. The negative slope shows that pathways upregulated by MASH in WT animals are downregulated in EftidT'' livers, and vice versa, confirming that pathways dysregulated in MASH tend to recover in the Eftidl^' animals globally. Focusing in on specific parental REACTOME groups of interest, Fat Metabolism was one cluster that did not show a significant relationship (FIG.
[0521] 5J). Most Fat Metabolism pathways were upregulated during MASH, but remained upregulated after EFHD1 ablation, further reinforcing the finding that changes to lipid metabolism are likely well downstream of EFHD1 activity. In striking contrast, there were broad increases in Immune System pathways during MASH that were downregulated in Eftidr'' animals (FIG. 5K).
[0522] In these analyses, an unexpected set of MASH-dysregulated pathways were those related to eukaryotic and mitochondrial translation (FIG. 5L). Global decreases in mRNA translation are a hallmark of the integrated stress response. In the ISR, phosphorylation of the elongation initiation factor 2A (EIF2A) globally downregulates protein translation, with the preferential expression of ATF4-dependent genes that promote cellular recovery (Costa-Mattioli, M., and Walter, P. (2020). Science 368). Whereas temporary activation of the ISR is protective, prolonged activation can lead to cell death. The ISR and a closely -related mechanism, the unfolded protein response (UPR), are known to be activated in the liver due to ER stress caused by lipotoxicity (Ajoolabady, A., et al. (2023). Hepatology 77, 619-639; and Hom, P., and Tacke, F. (2024). Cell Metab 36, 1439-1455). ISR activation is via the kinase PERK, but ISR can also be activated by severe mitochondrial dysfunction (HRI kinase), double-stranded RNA (PKR kinase) typically associated with viral infection (such as hepatitis C), or starvation (GCN2 kinase). Examining the proteomic dataset, it was observed that translation was decreased in MASH compared to a normal diet, consistent with ISR activation, while ablating EFHD1 led to increases in translation during MASH relative to WT, demonstrating reductions in ISR in Efhcl' ' mice. Taken together, the transcriptomic and proteomic data are consistent with histological and GWAS data, showing that loss of EFHD1 primarily affects inflammation and fibrosis, with much less pronounced effects on lipid ATTORNEY DOCKET NO 21101.0493P1
[0523] metabolism. Furthermore, these data points toward the ISR as a mechanism linking mitochondrial function to hepatocyte injury.
[0524] PKR activation via pathological release of mitochondrial double-stranded RNA. To investigate the ISR further, the expression and phosphorylation state of EIF2a, upstream kinases, and ATF4 target genes (Neill, G., and Masson, G. R. (2023). Front Mol Neurosci 16, 1112253) were assessed. The results show substantial upregulation of EIF2a phosphorylation, and PERK expression and phosphorylation (FIGS. 6A-B). These were associated with increases in the expression of ATF4 targets detected in the proteomics dataset (FIG. 15 A). In contrast, Eftidl'^ livers showed reduced ISR, with decreased phosphorylation of EIF2a (FIGS. 6C-D), and increases in mRNA translation (FIGS. 5H, L). Though there was not a clear decrease in ATF4 targets in proteomics data (FIG. 15B). decreases in targets such as FGF21 (FIG. 15C), and most ATF4 target genes were downregulated in Efhdr'' livers in the RNA-seq data (FIG. 15D) were observed.
[0525] During hepatocyte mitochondrial injury7, the release of damage-associated signals may be a potent immune stimulator (Rodriguez-Nuevo, A., and Zorzano, A. (2019). Cell Stress 3, 195-207). However, the most common trigger, release of mitochondrial DNA (mtDNA) from injured mitochondria, fails to activate an innate inflammatory response in the cytoplasm because hepatocytes have poor expression of the STING, requiring instead release of mtDNA-containing vesicles for detection by nearby inflammatory7cells (Garcia-Martinez, I., et al. (2016). J Clin Invest 126, 859-864; and Thomsen, M. K., et al. (2016). Hepatology 64, 746-759). Another damage signal may arise from improper processing of mitochondrial RNA. Normally, this RNA is transcribed as two separate but complementary strands, each cleaved to release specific transcripts. During mitochondrial dysfunction, mt-RNA is inadequately processed, and can hybridize and leak out into the cytoplasm as a long dsRNA (Dhir, A., et al. (2018). Nature 560, 238-242; and Kim, Y, et al. (2018). Mol Cell 71, 1051-1063). Within the cytoplasm, mt-dsRNA may be recognized by' the dsRNA-sensor PKR (Protein kinase RNA-activated, EIF2AK2 gene), another kinase that triggers the ISR independently of PERK and ER lipotoxicity. Notably, it has long been recognized that HCV RNA can modulate hepatic PKR binding and the innate immune response (Dabo, S., and Meurs, E. F. (2012). Viruses 4, 2598-2635; and Taylor, D. R., et al. (1999). Science 285, 107-110).
[0526] The possibility that PKR might link a mitochondrial damage signal (mt-dsRNA) to the ISR during MASH was interesting for additional reasons. Most importantly, marked increases in PKR and phospho-PKR in MASH diet fed mice, comparable to the increases in ATTORNEY DOCKET NO 21101.0493P1
[0527] PERK, were observed (FIGS. 6A, B, 15A). Moreover, whereas PERK signaling was not substantially affected by EFHD1 deletion, decreases in the phosphor-PKR / PKR ratio in MASH-fed EftidE'' mice relative to WT, were also observed (FIGS. 6C-D). In contrast, two other dsRNA sensors involved in innate immunity, RIGI and MDA5, were not substantially altered between Efhdl'^ and WT (FIG. 15E). Studies of HFD-fed mice repeatedly found that PKR deletion reduced markers of inflammation, but disagreed on whether energy and lipid metabolism were beneficially affected, and failed to identify a clear trigger for PKR activation. This pattern of protection from inflammation with variable effects on metabolism was notable because it closely mimics the phenotype of EFHD1 ablation.
[0528] To determine whether mt-dsRNA release occurs during MASH, human liver tissue sections were stained for dsRNA with the well-established rJ2 antibody65. This revealed a clear increase in dsRNA signal, most notable during early MASH stages (FIGS. 6E, F). In later stages, the dsRNA signal waned, though it remained above the nearly undetectable levels seen in in healthy human liver tissue. Widespread dsRNA staining was also evident in isolated hepatocytes from WT mice fed a MASH diet, and localized primarily to the cytoplasm FIGS. 6G, 15F, G). In contrast, there was minimal dsRNA staining in both normal chow-fed mice and in Eftidr'' mice fed a MASH diet. Next, tissue sections were co-stained for both dsRNA and PKR (FIGS. 6H, 15H). The dsRNA stain was over-exposed in healthy liver tissue to examine any specific localization, but staining appeared to be homogenous, indicating a non-specific background. In healthy tissue, PKR staining localized to the condensed nuclei of non-hepatocyte cells, likely leukocytes, where it is known to be sequestered during normal physiology (Chen, Y. G., and Hur, S. (2022). Nat Rev Mol Cell Biol 23, 286-301). Conversely, a different pattern emerged in human MASH tissue. Here, dsRNA staining was evident in hepatocyte cytoplasm. Moreover, PKR staining was now also present in hepatocytes and overlapped the dsRNA stain. Turning to the mouse models, the staining phenotype mimicked that seen in human tissue (FIGS. 61, 151). In chow-fed mice, dsRNA and PKR staining localized to the condensed nuclei of non-hepatocyte cells (FIGS.
[0529] 61, 151). Conversely, in hepatocytes from MASH-diet fed animals, both PKR and dsRNA staining was diffuse throughout the cytoplasm. Thus, in both humans and mice, ovemutrition triggers the release of endogenous dsRNAs into the cytoplasm, where they are sensed by PKR.
[0530] Deletion of EFHD1 prevented the pathological increase in cytoplasmic dsRNA, indicating that it might be mitochondrial in origin. To confirm this, hepatocytes were isolated, fixed, and lysed from mouse livers, and then immunoprecipitated either dsRNA or PKR. ATTORNEY DOCKET NO 21101.0493P1
[0531] Releasing the dsRNA from the purified sample allowed the degree of mt-dsRNA enrichment to be assayed via quantitative reverse transcription polymerase chain reaction (qRT-PCR). Compared to a nucleus-encoded mitochondrial gene (Mcu), mt-DNA encoded RNAs were profoundly enriched (5-10-fold) in the dsRNA immunoprecipitated fraction in MASH-fed WT mice (FIG. 6J). In EfhdP ' mice fed a MASH diet, the degree of mt-dsRNA enrichment was much reduced, to -20% of WT MASH values (FIG. 6K). Examining the RNA bound to immunoprecipitated PKR, it was found again that mt-dsRNA was substantially enriched during MASH, and this enrichment was abrogated in Eftidl'^ hepatocytes (FIGS. 6L, M). Finally, to confirm that the mt-dsRNA release was associated with increased mitochondrial fission occurring during MASH, the localization of the dsRNA signal relative to DRP1 was examined. On subcellular immunofluorescence imaging, a close relationship was observed between the localization of dsRNA, DRP1, and mitochondria (FIG. 6N), showing that pathological mt-dsRNA release is exacerbated by fission. In Eftidr ' MASH hepatocytes, though dsRNA could be visualized near DRP1 when increasing imaging acquisition settings, the distance was increased compared to WT animals (FIG. 60). This occurred despite the increases in DRP1 density seen in EfhdP'' livers, and confirmed the protective effect of EFHD1 ablation. Taken together, the results show that the pathological release of mt-dsRNA during MASH is the trigger for PKR-dependent ISR activation, and loss of EFHD1 inhibits this pathway.
[0532] Identification of AST-associated variants and cis-eQTLs at the human PKR (EIF2AK2) locus. PKR deletion during ovemutrition in mice produces a phenotype similar to EFHD1 deletion, preferentially affecting inflammation caused by injury rather than metabolism (Lancaster, G. I., et al. (2016). Nat Commun 7, 10626; and Nakamura, T., et al. (2010). Cell 140. 338-348). To investigate whether PKR produces a similar phenotype in humans, genetic data in the Common Metabolic Diseases Knowledge Portal was examined. A similar phenotype to EFHD1, with variation in the PKR (EIF2AK2) locus associated with serum liver enzy mes but not triglycerides, liver fat, or other lipid metabolism parameters, was found (FIG. 15 J). Furthermore, analyzing the UK Biobank, statistically significant associations (p-value < 8.87xl0’6) were identified between 35 genetic variants spanning a 105.8 kilobase region at the EIF2AK2 locus and serum AST levels in unrelated individuals (FIG. 6P). The strongest associations were observed at rsl 1904602 (p-value = 3.10xl0'8) and rsl 1899117 (p-value = 3.24xl0'8), two highly correlated variants (^>0.90) located at intron 1 of EIF2AK2. Significant associations were also identified at variants located in intergenic and intronic regions near GPATCH11 and HEATR5B, two neighboring genes telomeric of ATTORNEY DOCKET NO 21101.0493P1
[0533] EIF2AK2. Significant eQTLs (p-value < 8.23xl0'4) for EIF2AK2 expression in liver were observed at 34 of these AST-associated variants (FIG. 6Q). Twenty-one of these variants were also computationally predicted to have a high likelihood of being functional, achieving a RegulomeDB rank score and model prediction score of If or higher and > 0.50, respectively (Boyle, A. P., et al. (2012). Genome Res 22, 1790-1797). Among these, rsl7020213, located in the 3’UTR of EIF2AK2. had the highest likelihood of being functional (RegulomeDB rank score and model prediction score of lb and 1.0, respectively, predicted to disrupt a BARHL1 motif). Taken together, the results identify a pathway in mice and humans whereby MASH induces excessive hepatocyte mitochondrial fission, mediated partly by EFHD1, which leads to pathological cytoplasmic mt-dsRNA release and activation of a PKR-dependent ISR. This pathway is associated with hepatocyte injury’, liver inflammation, and fibrosis.
[0534] Liver-specific EFHD1 inhibition is hepatoprotective. It was tested whether the protective effects of EFHD1 deletion could be replicated by liver-specific inhibition. First, mice with liver-specific EFHD1 ablation (EfhdlhKa) were created by crossing albumin-Cre (Alb-Cre) animals with mice containing a floxed Eftidl exon 2, which deletes the EF hands and introduces a frame-shift (FIGS. 7A, B). As with EFHD1 deletion in other cell types, EfhdlhKOhepatocytes had elongated mitochondria resistant to Ca2+-induced fission, compared toA / b-Cre controls (FIGS. 7C, D, 16A-B). 8-10 week old male EfhdlhKOor Alb-Cre control mice were injected with carbon tetrachloride (0.5 pL / g CCI4, 2x week) intraperitoneally for 4 weeks. CCI4 injection is an alternative model of liver injury to the MASH diet, and produces toxic liver injury much faster, characterized by marked fibrosis rather than steatosis (Scholten, D., et al. (2015). Lab Anim 49, 4-11). With this model, EfhdlhK0mice had reduced serum liver enzymes, consistent with milder liver injury (FIGS. 7E, F). Histological analyses showed low levels of steatosis and inflammation, with no significant difference between genotypes (FIGS. 7G, H, 16C-E). Nevertheless, fibrosis was reduced in EfhdlhK0livers, confirming protection conferred by liver-specific EFHD1 ablation (FIGS. 71, J).
[0535] Next, it was investigated whether acute inhibition of Eftidl could confer a similar degree of protection. Six- week old male mice were fed a MASH diet for 16 weeks before a single injection of Eftidl -targeting short hairpin RNA, or a non-targeting control, packaged in a hepatotrophic adeno-associated virus serotype (AAV8) (FIGS. 16F, G). Animals were sacrificed 12 weeks later for endpoint analyses. The injection timing allowed the MASH diet to produce steatosis, inflammation, and fibrosis, but allowed enough time to observe the effects of Eftidl inhibition (Chaurasia. B., et al. (2019). Science 365, 386-392). Two independent shRNAs were used targeting Eftidl, with s Eftidl#\. producing greater inhibition ATTORNEY DOCKET NO 21101.0493P1
[0536] than sh / '.’ / 7?<7 / #2 (FIGS. 16H-I). The viruses also encoded GFP, allowing to confirm robust liver transduction by tissue staining and flow cytometry of isolated hepatocytes (FIGS. 16J, K). Consistent with prior results, even this relatively brief period of Efhdl inhibition resulted in larger mitochondria in MASH diet-fed hepatocytes (FIGS. 7K, L).
[0537] Turning to liver health, after Efhdl inhibition, significant decreases in AST and ALT, and surprisingly, in serum triglycerides, were observed (FIGS. 7M, N, 16L), indicative of reduced liver injury. In addition, direct measures but not histolopathological scores showed decreases in lipid content (FIGS. 70, 1 M-O). Finally, both histopathological and direct scoring showed substantial improvements in inflammation and fibrosis (FIGS. 7P-T, 16P). In these analyses, there was a tendency for shA’ / Zic / / # I to produce more extreme effects than s Efhdl#2. consistent with a dose-response relationship between the degree of Efhdl inhibition and hepatic protection. In summary, inhibition of EFHD1 can be used to prevent liver injui7by blunting Ca2+-dependent mitochondrial fission, a pathway independent of lipid metabolism.
[0538] Described herein, is EFHDL which was identified as the transducer for ER Ca2+release into a mitochondrial fission signal. EFHD1 acts by triggering actin bundling at ERMCS, an early IFN2-dependent process necessary for efficient fission. Moreover, the results show that EFHD1 is a significant contributor to hepatocyte injury in the setting of metabolic disease. Its expression increases during ovemutrition in animal models and humans, leading to increased hepatocyte mitochondrial fission during the course of MASH. Notably, rather than primarily affecting liver lipid metabolism or organismal energy balance, EFHD1 promotes injury, inflammation, and fibrosis by the release of damage signals associated with frequent fission. In the liver, the release of mt-dsRNA was observed, which is then sensed by PKR and transduced into an integrated stress response independently of ER stress. Inhibiting EFHD1, on the other hand, reverses this pathway to injury and slows the progression of MASH.
[0539] That EFHD1 is important for actin-dependent fission, a process localized to OMM, stands in contrast to prior reports that localized EFHD1 within the mitochondrial inner membrane (Tominaga. M.. et al. (2006). J Neurochem 96. 292-304). This initial determination was based on immunogold staining using an antibody with limited validation, and has not been replicated. Most importantly, EFHD1 lacks transmembrane domains and lacks a mitochondrial targeting sequence seen in matrix or IMM proteins. Instead, multiple independent studies using immunoprecipitation, proteinase protection assays, or proximity ligation point to EFHD1 localizing primarily to the cytoplasm and OMM, with a smaller ATTORNEY DOCKET NO 21101.0493P1
[0540] fraction in the intermembrane space (Eberhardt, D. R., et al. (2022). J Mol Cell Cardiol; Antoni cka, H., et al. (2020). Cell Metab 32, 479-497; Hung, V.. et al. (2017). Elife 6; Kwak, C„ et al. (2020). Proc Natl Acad Sci U S A 117, 12109-12120; Go, C. D., et al. (2021). Nature 595, 120-124; and Delgado de laHerran, H., et al. (2024). Embo j).
[0541] Although fission can occur through a variety of mechanisms, the most widespread physiological process involves an actin- and DRPl-assisted constriction at ERMCS. Earlier studies established that Ca2+helped recruit DRP1 to mitochondria via control of its phosphorylation state (Cereghetti, G. M., et al. (2008). Proc Natl Acad Sci U S A 105, 15803-15808; and Bo, T., et al. (2018). Biochem Biophys Res Commun 495, 1601-1607), though this mechanism required pathological stimuli such as mitochondrial uncouplers, ionizing radiation, or pro-apoptotic protein expression. In contrast, more recent studies established that ER Ca2+release was a trigger for mitochondrial fission during normal physiology as well, occurring at early stages of constriction driven by INF2-actin polymerization and early DRP 1 recruitment (Chakrabarti, R., et al. (2018). J Cell Biol 217, 251-268; and Ji, W. K., et al. (2015). Elife 4. el 1553). However, the Ca2+sensor in this process remained elusive. Here, the results show that EFHD1 acts as a Ca2+sensor. It binds Ca2+via its EF hands, is located at the OMM, including at ERMCS, binds actin, and bundles actin filaments in a Ca2+-dependent manner (Mun, S. A., et al. (2020). Front Cell Dev Biol 8, 628222). Modeling EFHDl-actin interactions computationally suggests it binds actin in a manner similar to other Cambundling proteins, including filamin and fimbrin (Galkin, V. E., et al. (2008). Proc Natl Acad Sci U S A 105, 1494-1498; and Gong, R„ et al. (2025). Nat Struct Mol Biol 32, 940-952). Moreover, loss of EFHD1 leads to stress-fiber development within the cytoplasm, showing actin networks have become rigid and unresponsive, while abolishing Ca2+-dependent actin rearrangements. Most importantly, Ca2+-dependent mitochondrial fission is abolished during normal physiology, even in the absence of pathological stimuli. These effects are consistent across a variety’ of cell ty pes and methods of EFHD1 inhibition. Finally, a residual amount of fission remains in Efhdl'^ cells that is largely insensitive to Ca2+. In this regard, it is also noteworthy that synaptic mitochondria in Efhdl'^ dorsal root ganglia (DRG) are smaller than controls (Ulisse, V., et al. (2020). Life Sci Alliance 3), in contrast to the phenotype seen here. Synaptic mitochondria form distinct subsets with small size due to strong DRP1 recruitment, reduced Ca2+sensitivity, and microtubule-dependent rather than actin-dependent motility' (Lewis, T. L., Jr., et al. (2018). Nat Commun 9, 5008; and Duarte, F. V., et al. (2023). Cell Mol Life Sci 80, 173). The residual fission in these different circumstances is due to the substantial upregulation of DRPL which may be driving fission inefficiently, along with the ATTORNEY DOCKET NO 21101.0493P1
[0542] reductions in MFN2 and possibly OPA1, which may also reduce fusion and help maintain divided mitochondrial networks. In fact, the current model of early fission involves direct interactions between the ER-bound actin polymerizing factor INF2 and the OMM-bound, actin-nucleating factor SpirelC (FIG. 12) (Fung, T. S., et al. (2023). Nat Rev Mol Cell Biol 24, 651-667; Quintana-Cabrera, R., and Scorrano, L. (2023). Mol Cell 83, 857-876; and Manor, U., et al. (2015). Elife 4). Such direct interactions may be relatively inefficient, since these two protein reside on different membranes. In contrast, actin filaments emanating from either membrane are more diffusely localized. During ER Ca2+release, EFHD1 acts by crosslinking these actin filaments arising from opposite membranes, more efficiently starting the constriction process at ERMCS.
[0543] Importantly, inhibition of EFHD1 protects against hepatocyte injury’ in MASH, but, in contrast to most other targets investigated in MASH, appears to do so without substantially affecting organismal lipid metabolism or energy' balance. At the cellular level, glycolysis and fatty7acid oxidation rates increased within hepatocytes, and changes were seen in lipid metabolism pathways, with increases in gene targets of the carbohydrate response element binding protein (ChREBP) transcription factor. These findings are interesting for several reasons. First, ChREBP, a transcription factor primarily found in the liver, adipose tissue, and pancreas, promotes de novo lipogenesis in response to high-carbohydrate diets, and excessive ChREBP activity can promote hepatic steatosis and MASH (Regnier, M.. et al. (2023). Nat Rev Endocrinol 19, 336-349). Such an effect would stand in contrast to the protective effect seen for EFHD1 inhibition. However, across different cell types, there is no consistent effect on fatty acid metabolism or glycolysis after EFHD1 inhibition. Although similar increases in fatty' acid synthesis genes were seen in liver organoids, lipogenesis was unaffected in HepG2 cells (Pandey, G. K., et al. (2024). HGG Adv 5, 100275; and Hong, S. E., et al. (2025). Nat Genet 57, 1638-1648). In liver organoids and DRG neurons, glycolysis appears reduced, whereas it is increased in immune cells and unaffected in HepG2 cells (Pandey, G. K., et al. (2024). HGG Adv 5, 100275; Hong, S. E., et al. (2025). Nat Genet 57, 1638-1648; Stein, M., et al. (2017). Cell Death Differ 24, 1239-1252; and Ulisse, V., et al. (2020). Life Sci Alliance 3). Second, there is a general relationship between mitochondrial size and energy supply, with mitochondria fissioning during nutrient-rich states (Liesa, M., and Shirihai, O S. (2013). Cell Metab 17, 491-506). This fissioning can lead to an increase in fatty' acid metabolism via reduced CPT1 inhibition by malonyl-CoA (Ngo, J., et al. (2023). Embo j 42, el 11901). The results described herein show, in contrast, that hepatocyte fatty acid oxidation has increased, despite the decrease in fission. This finding demonstrates that regulatory pathways ATTORNEY DOCKET NO 21101.0493P1
[0544] connecting nutrient supply to fission can be disrupted, and the mechanism by which this occurs in EFHD1 -deficient hepatocytes remains to be established. In this regard, it is important to note that studies of metabolism in cells manipulated to have differing mitochondrial morphology are generally otherwise healthy. In contrast, MASH hepatocytes with heavily fissioned mitochondria are subject to lipid overload and mitochondrial dysfunction. The increase in respiration seen in Efhdl^' MASH hepatocytes relative to WT reflects reductions in ISR-induced translation suppression, visible as increases in OXPHOS pathways in the proteomics data (FIG. 5H). Third, the changes in metabolism found at the hepatocyte level did not translate into substantial changes in hepatocyte lipid content, steatosis, or organismal energy metabolism, though reduced circulating triglyceride levels were observed. This is consistent with human genetic data, since EFHD1 is not identified in GWAS of hepatic fat. Taken together, the results described herein show that EFHD1 does not directly regulate fat or glucose metabolism, with dow nstream effects on these processes depending on the exact cellular context.
[0545] Instead. EFHD1 inhibition is protective in metabolic liver disease via a pathophysiological pathway that involves a PKR-dependent 1SR. Unlike the variable effects on metabolism described above, loss of EFHD1 across cell types consistently reduces mitochondrial ROS production and susceptibility7to Ca2+overload, phenoty pes that are associated with reduced cellular injury (Eberhardt, D. R., et al. (2022). J Mol Cell Cardiol; and Hou. T., et al. (2016). Cell Calcium 59, 262-270). In the proteomics data, pathway analysis showed that the protection was mediated by reductions in the ISR and associated inflammatory' pathways. mt-dsRNA and PKR were the focus as triggers of these pathw ays because viral dsRNA, especially in hepatitis C infection, has long been recognized to modulate hepatic PKR binding and the innate immune response (Dabo, S., and Meurs, E. F. (2012Viruses 4, 2598-2635; and Taylor, D. R., et al. (1999). Science 285, 107-110). There have been hints of this pathway in the literature: dsRNA has been found in the livers of mice fed a HFD, though its mitochondrial origin was not established nor its link to PKR (Huang, Y. H., et al. (2022). Int J Mol Sci 23); mt-dsRNA has been found in extracellular vesicles in models of alcohol-induced injury (Lee, J. H.. et al. (2020). Hepatology 72, 609-625); and loss of PKR has been found to be protective in metabolic liver disease (Lancaster, GT, et al. (2016). Nat Commun 7, 10626; and Nakamura, T., et al. (2010). Cell 140, 338-348). The PKR data is particularly notable because, as with EFHD1, investigators have found consistent effects on inflammation but differed on changes in metabolism. In addition, the trigger for PKR activation in metabolic disease has remained undefined. As described herein, the data ATTORNEY DOCKET NO 21101.0493P1
[0546] show that the dsRNA released during obesogenic diets is mitochondrial in origin, that it binds to PKR, and that loss of EFHD1 inhibits this damage-inducing pathway. These findings are confirmed in mouse models and human MASH samples. Importantly, the importance of this pathway was further established in human MASH by finding an association between PKR genetic variants and serum liver biomarkers, similar to what has already been established for EFHD1. The results described herein clarify the controversy over PKR activity in metabolic disease by establishing an injury pathway not directly related to lipid metabolism. Finally, though the data establish that the mt-dsRNA-PKR axis activates the ISR in MASH, it does not discount the well-established importance of UPR or ISR activation via ER lipotoxicity and PERK. In fact, these inputs to the ISR appear to be separable, since loss of EFHD1 reduces PKR activation without affecting PERK. Taken together, the findings disclosed herein establish an important pathophysiological pathway by which the release of mt-dsRNA during excessive mitochondrial fission in MASH activates PKR and subsequently the ISR.
[0547] Finally, targeting EFHD1 can be a useful therapeutic approach for preventing hepatocyte injury in MASH, to complement the pipeline of drugs targeting lipid metabolism (Noureddin, M. (2024). Hepatology). The phenotype of reduced fibrosis is preserved when EFHD1 is selectively deleted in the liver, even with the more pro-fibrotic CCfi injury model. Moreover, acute inhibition of EFHD1 with AAVs during MASH progression appears to be effective as well, with reduced biomarkers of injury and fibrosis. In these experiments, a discrepancy between clinical versus directly-measured assessments of inflammation was noted, partly due to the increased density of small inflammatory clusters in the control livers that contributed to the image analysis but not to the clinical score. This effect may be due to limited or transient effects from a single injection of AAV, or possibly mild inflammatory effects of the viral particles themselves. Nevertheless, across multiple models of disease and multiple modes of inhibition, it was consistently found that loss of EFHD1 slows liver injury, inflammation, and fibrosis in MASH, a phenotype that mimics human genetic data.
[0548] Example 2. EFHD1 promotes hepatocyte injury in metabolic liver disease by triggering Ca2+-dependent mitochondrial fission
[0549] Single-stranded RNA oligomers were produced by the DNA synthesis core at the University of Utah. They were diluted and hybridized in nuclease-free TE buffer to create duplex siRNA stocks. HepG2 or HAP- 1 cells w ere grown to 75% confluence on 6-well plates in standard media. The cells were transfected with 25-50 pmol / w ell of target siRNA using Lipofectamine RNAiMax (Thermo Fisher), following the manufacturer's instructions. Two days following transfection, RNA was purified using the Direct-Zol RNA purification kit ATTORNEY DOCKET NO 21101.0493P1
[0550] (Zymo Research), converted into cDNA using the SuperScript VILO kit (Thermo Fisher). 10-20 ng cDNA was used per PCR reaction to quantify EFHD1 and housekeeping genes GAPDH or RPLPO. Knockdown efficacy was quantified using the 2-DDCt method.
[0551] The results are shown in Table 3 as fractional inhibition (the lower the number, the more inhibited the target). HepG2 cells were used in Trial 1 and HAP-1 cells were used for Trial 2.
[0552] Table 3. Fractional inhibition using siRNAs in two different cell lines.
[0553] Name Sense Antisense Trial 1 Trial 2 UCGACCUGAUGGAGCUGAAGC UUCAGCUCCAUCAGGUCGAUG 0.43 la (SEQ 1D NO: 1) (SEQ ID NO: 2)
[0554] CAUCGACCUGAUGGAGCUGAA UUCAGCUCCAUCAGGUCGAUGAA 1.10 lb (SEQ ID NO: 3) (SEQ ID NO: 4) UGAAGCUGAUGAUGGAGAAGC UUCUCCAUCAUCAGCUUCAGC 0.33
[0555] 2a (SEQ ID NO: 5) (SEQ ID NO: 6)
[0556] GCUGAAGCUGAUGAUGGAGAA UUCUCCAUCAUCAGCUUCAGCUC 0.67 2b (SEQ ID NO: 7) (SEQ ID NO: 8)
[0557] AGACCCACCUGGGCCUGAAGA UUCAGGCCCAGGUGGGUCUGG 0.55
[0558] 3a (SEQ ID NO: 9) (SEQ ID NO: 10)
[0559] CCAGACCCACCUGGGCCUGAA UUCAGGCCCAGGUGGGUCUGGUG 0.89 3b (SEQ ID NO: 11) (SEQ ID NO: 12) ACUUCUUUGAAGCCAAGGUCC ACCUUGGCUUCAAAGAAGUUC 0.43
[0560] 4a (SEQ ID NO: 13) (SEQ ID NO: 14)
[0561] GAACUUCUUUG A AGC C AAGGU ACCUUGGCUUCAAAGAAGUUCUU 1.04 4b (SEQ ID NO: 15) (SEQ ID NO: 16) GUCAUCGGCCAGUAAGUUUGA AAACUUACUGGCCGAUGACAA 0.46
[0562] 5a (SEQ ID NO: 17) (SEQ ID NO: 18) UUGUCAUCGGCCAGUAAGUUU AAACUUACUGGCCGAUGACAAGG 0.98 5b (SEQ ID NO: 19) (SEQ ID NO: 20) GGACCUGGAGAGCAUGUUCAA GAACAUGCUCUCCAGGUCCUU 0.47
[0563] 6a (SEQ ID NO: 21) (SEQ ID NO: 22) AAGGACCUGGAGAGCAUGUUC GAACAUGCUCUCCAGGUCCUUGA 0.88 6b (SEQ ID NO: 23) (SEQ ID NO: 24) GAGAGCAUGUUCAAACUGUAU ACAGUUUGAACAUGCUCUCCA 0.54
[0564] 7a (SEQ ID NO: 25) (SEQ ID NO: 26) UGGAGAGCAUGUUCAAACUGU ACAGUUUGAACAUGCUCUCCAGG 0.84 7b (SEQ ID NO: 27) (SEQ ID NO: 28) CCAGUAAGUUUGAAGCAGAGU UCUGCUUCAAACUUACUGGCC 0.40
[0565] 8a (SEQ ID NO: 29) (SEQ ID NO: 30) GGCCAGUAAGUUUGAAGCAGA UCUG CUUC A AACUUACUG G CCG A 0.89 8b (SEQ ID NO: 31) (SEQ ID NO: 32) GCAGAGUUGAAAGCUGAGCAA GCUCAGCUUUCAACUCUGCUU 0.40
[0566] 9a (SEQ ID NO: 33) (SEQ ID NO: 34) GAGCAGAGUUGAAAGCUGAGC GCUCAGCUUUCAACUCUGCUCCA 0.80 9b (SEQ ID NO: 35) (SEQ ID NO: 36) CCAGAAACUCAAGGCCAACUU GUUGGCCUUGAGUUUCUGGAA 0.44
[0567] 10a (SEQ ID NO: 37) (SEQ ID NO: 38) UUCCAGAAACUCAAGGCCAAC GUUGGCCUUGAGUUUCUGGAAGG 0.71
[0568]
[0569] 10b (SEQ ID NO: 39) (SEQ ID NO: 40) ATTORNEY DOCKET NO 21101.0493P1
[0570] Example 3. Targeting EFHD1 in liver disease
[0571] New treatments for liver disease may arise by examining genes identified in genomewide association studies (GW AS). Variation in one such gene, EF-hand domain family member DI (EFHD1), has been associated with liver injury biomarkers in multiple GWAS analyses. In these studies, higher serum biomarkers correlate with increased EFHD1 expression. EFHD1 is a poorly studied mitochondrial Ca2+-binding protein, and how it regulates liver function is unknown. It was assessed whether inhibiting hepatic EFHD1 could represent a therapy for treating metabolic liver disease.
[0572] In human and mouse livers, EFHD1 is expressed at low levels preferentially in hepatocytes, with little to no expression in other cell ty pes. It is found primarily on the outer mitochondrial membrane and inter-membrane space. To study the effects of EFHD1 inhibition on liver injury, wild-type (WT) and EFHD1 whole body knockout (Efhdlfa mice were fed diets which induced metabolic-associated steatotic liver disease (MASLD). The results show that EFHDfa' mice with MASLD exhibited lower levels of serum AST and ALT compared with WT which corresponded with reduced inflammation and fibrosis in EFHD1' ' livers. Moreover, RNA sequencing of EfhdD' livers from mice with MASLD revealed a significant reduction in genes associated with inflammation and fibrosis, relative to WT animals. To confirm that this was a liver-specific response, mice suffering from MASLD were treated with a liver-targeting AAV containing a short-hairpin RNAi against EFHD1 (shEFHDl). The results show that the mice treated with shEFHDl exhibited significantly lower liver damage and lower AST and ALT levels compared to control animals.
[0573] Mitochondria continuously undergo fission and fusion, and increased fission has been correlated with liver injury. It was found that EFHD1 was present at sites of ER-mitochondrial contact on the outer membrane, where fission and fusion occur. It was also found that mitochondria in Efhdl'!~ hepatocytes were around 100.03±0.32% larger than controls and showed less remodeling after activating cytoplasmic Ca2+signals. Thus, reducing fission by deleting EFHD1 can prevent mitochondrial damage and subsequent liver injury, representing a mechanism whereby EFHD1 ablation is protective in liver injury.
[0574] These findings demonstrate that EFHD1 inhibition can be a useful therapy for liver injury.
[0575] Methods. Efhdl -knockout (Eftidl- / -) mice were obtained from the Jackson Laboratory. Hepatocytes were isolated via the 2-step isolation method (Suryaprakash et al., ATTORNEY DOCKET NO 21101.0493P1
[0576] Cell Metabolism, 2014. 20(4): 687-69). Mice were fed a high fat diet (HFD) or Gubra-Amylin NASH (GAN) diet for 28 weeks.
[0577] Results. FIG. 17 shows effect of whole body EFHD1- - on mouse livers. FIG. 18 shows EFHD1 ablation reduces liver damage in mice fed high-fat diets. FIG. 19 shows that EFHD1 ablation alters mitochondrial morphology' by increasing the MAM-ER distance in hepatocytes.
[0578] Conclusions. EFHD1 levels are elevated in mouse livers following a high-fat diet (FIGS. 18B and 18C). Indicating a link between EFHD1 expression levels and liver disease in mice. Serum from mice lacking EFHD1 exhibit lower levels of disease markers in both healthy mice and mice fed a high-fat diet (FIGS. 17D, 18E and 18G). This demonstrates that EFHD1 ablation can be beneficial in preventing diet-induced liver damage. Treatment of mice with an AAV8 virus containing an shRNA molecule to knockdow n EFHD1 in livers proved to be highly effective in reducing liver damage in mice (FIGS. 18H and 181). EFHD1 ablation resulted in larger mitochondria in isolated mouse hepatocytes and inhibited the morphological effect of calcium (FIGS. 19A and 19B). This effect was also observed in hepatocytes isolated from EFHD1- / -, and shEFHDl -treated mice fed a GAN diet (FIGS. 19C and 19D). This finding provides a link between longer mitochondria and healthier livers in mice lacking EFHD1. DRP1, MFN2 and INF2 expression w as altered in EFHD1- / - livers, however, INF2 expression changes matched longer mitochondria demonstrating an EFHD1-INF2 axis (FIG. 19E). MAM-ER distance was found to be greater in EFHD1- / - livers (FIGS.
[0579] 19G and 19H). Increased MAMER distances are modulated by INF2 and have been associated with impaired mitochondrial fission, showing that EFHD1 ablation inhibits mitochondrial fission by lowering INF2 expression.
[0580] Example 4. Targeting EFHFD1
[0581] EFHD1 is a poorly -characterized mitochondrial Ca2+-binding protein whose expression decreased in mouse models of mitochondrial cardiomyopathies (Kuhl, I., et al., Elife, 2017. 6, PMC5703644). As in humans, EFHD1 is expressed at vary ing levels across several mouse tissues, including the liver (Eberhardt, D. R., et al., J Mol Cell Cardiol, 2022, PMID 35304170). Subcellular fractionation showed expression in mitochondria localized primarily to the outer membrane and intermembrane space, with substantial expression noted in mitochondria-associated membranes, which are locations of ER-mitochondrial membrane contact (Eberhardt, D. R., et al., J Mol Cell Cardiol, 2022, PMID 35304170).
[0582] Efhd' mice replicate human phenotypes and have altered mitochondrial Ca-handling and morphology. Given the human data showing the relevance of EFHD1 for liver ATTORNEY DOCKET NO 21101.0493P1
[0583] injur.-, hepatic phenotypes were assessed. As in humans, it was found that Eftid I''' mice had substantially reduced serum ALT levels compared to wild-type (FIG. 20 A). Hepatocytes were isolated from these mice and striking changes were found in mitochondrial shape, with elongated mitochondria (FIG. 20B). When treated with a Ca2+ionophore (1 pM ionomycin) and Ca2+, wild-ty pe mitochondria undergo rapid fission, but it was found that the response was substantially blunted in Eftidl' ' hepatocytes (FIG. 20C). To confirm that this was a phenotype intrinsic to cells lacking EfhdE ' and not due to indirect effects from other organs, the CRISPR-Cas9 system was used to delete EFHD1 in a human cell line (HAP-1). In these cells, as in isolated hepatocytes, mitochondrial networks were longer (FIG. 20D).
[0584] Mitochondria also had migrated into in lamellipodia-like structures, compared to a more perinuclear localization in wild-type cells (FIG. 20E). This showed that mitochondrial fission was reduced in these cells, so the levels of important proteins in fission / fusion were assayed. Paradoxically, in Eftid'' livers, it was found substantially elevated levels of DRP1, important for outer membrane fission, and reduced levels of MFN2, a mediator of mitochondrial fusion (FIGS. 20F-G). This implies that Efhdl' ' livers have upregulated fission machinery and reduced fusion proteins, but are prevented from successful fission due to the absence of EFHD1. In prior studies of murine liver injury, preventing mitochondrial fission was protective, while increasing fission exacerbated hepatic damage (Yang, X., et al., Redox Biol, 2017. 12: p. 264-273; and Zhou, H., et al, Signal Transduct Target Ther, 2019. 4: p. 56). Turning to Ca2+homeostasis, it was found that EFHD1 interacts with VDAC2, the outer membrane channel controlling Ca2+entry into mitochondria (FIG. 20H). Moreover, Eftidl' ' hepatocyte mitochondria were substantially protected from mitochondrial Ca2+overload, tested by repeatedly pulsing purified mitochondria with small Ca2+boluses (FIG. 201).
[0585] Eftid ' have reduced steatosis during high-fat diet. In recent RNA-seq analysis of hepatocytes under several different MAFLD-producing diets, Eftidl expression was induced 2-6-fold (Loft, A., et al, Cell Metab, 2021. 33(8): p. 1685-1700. e9); therefore, the response to metabolic stress was examined. Animals were placed on a HFD for up to 28 weeks.
[0586] Consistent with the prior study, an increase in EFHD1 was observed in wild-type animals on HFD (FIGS. 21 A, B). Notably, despite similar levels of activity, feeding, and insulin resistance, EftidE'' animals gained less weight (FIGS. 20C-H). Moreover, liver tissue in Efhdr^ had notable decreases in lipid content, fibrosis, and inflammatory' markers (FIGS. 21I-L). In addition, there was no increase in serum triglycerides (FIG. 20A). Therefore, in contrast to several other genes implicated via GWAS in human hepatic pathology’, but ATTORNEY DOCKET NO 21101.0493P1
[0587] difficult to study in model systems due to discordant phenotypes, loss of EFHD1 in mice produces a protective phenotype, similar to what is seen in humans.
[0588] Mice with floxed Eflidl will allow examination of liver -specific phenotypes. Some of the changes seen in hepatic lipid accumulation may reflect alterations in other organs, such as fat or the brain. Because the data showed hepatic loss of Efhdl can be protective, mice were developed allowing conditional Eflidl deletion, via a floxed cassette inserted around exon 2, producing a frameshift prior to the EF hands (FIG. 22). Pups were obtained with the floxed allele. By crossing these Efhd 7lox / loxmice with the mice expressing Cre recombinase from the albumin promoter (Alb-Crel+ driver), hepatocyte-specific loss of EFHD 1 (abbreviated Efhdl hKO henceforth) will be generated.
[0589] As described herein, it is tested whether EFHD1 is a putative regulator of several aspects of mitochondrial function, and its involvement in hepatic mitochondrial Ca2+homeostasis, mitochondrial fission, and response to metabolic stress. It will be further tested whether the loss of EFHD 1 may be well tolerated precisely because it is a regulator rather than a central component of these functions. It will also be tested whether EFHD1 regulation can impact several mitochondrial activities, loss of any of these individually will not entirely replicate the phenotypes associated with EFHD1. Thus, inhibition of EFHD1 can represent a new therapeutic approach.
[0590] Sex as a biological variable. There are strong sex-dependent differences in hepatic lipid metabolism and susceptibility’ to injury, with premenopausal women typically at higher risk of injury, though the fibrotic response may be more severe in males (Noureddin, M., et al., Am J Gastroenterol, 2018. 113(11): p. 1649-1659; Suzuki, A., et al., Liver Int, 2017. 37(11): p. 1723-1730; Vatsalya, V., et al., Alcohol Clin Exp Res, 2016. 40(10): p. 2085-2093; Yang, J. D.. et al., Clin Gastroenterol Hepatol, 2017. 15(1): p. 127-131; and Yang, J. D., et al., Hepatology, 2014. 59(4): p. 1406-14). Therefore, experiments will be performed in both males and females and results will be separately examined by sex.
[0591] To minimize animal numbers, we will use each mouse for at least two separate assays per tissue (e.g., histology, RNA extraction), and multiple tissues (liver and blood) per animal. For most of our assays, we performed sample size calculations for Student r-tests or one-way ANOVA using the smallest biologically-relevant effect in our preliminary data of -50% change. Assuming a coefficient of variation (SD / mean) of 20-30%, power=0.9, and two-sided significance^).05, sample size is -7-9 animals per condition per sex per timepoint, with smaller numbers in tests with greater effect sizes. We indicate n values per ATTORNEY DOCKET NO 21101.0493P1
[0592] condition / timepoint / sex in the approach. Wild-ty pe littermates (no Cre; EfhdfoyJ aii) will be used as controls.
[0593] Determine ifEFHDl regulates hepatocyte mitochondrial Ca2+homeostasis and reactive oxygen species (ROS) production. Mitochondrial Ca2+homeostasis is important for hepatocyte function, with both beneficial and detrimental effects. Within mitochondria, modest increases in Ca2+can stimulate the Krebs cycle, indirectly increasing the voltage gradient (AT) for ATP synthesis but also boosting the production of ROS within the electron transport chain (Glancy, B., and R. S. Balaban, Biochemistry, 2012. 51(14): p. 2959-73). However, excess mitochondrial Ca2+can trigger irreversible damage via the mitochondrial permeability transition (Bonora, M., et al., Biomolecules, 2020. 10(7); and Kim, J. S., et al., Curr Mol Med. 2003. 3(6): p. 527-35). A finding seen in multiple models of hepatic metabolic stress, whether due to high glucose exposure in cultured cells, genetic predisposition (pb / ob mice), or HFD, is an increase in mitochondrial Ca2+(Arruda, A. P., et al., Nat Med, 2014. 20(12): p. 1427-35; Panahi, G, et al., PLoS One, 2018. 13(4): p. e0196580; Theurey, P., et al., J Mol Cell Biol. 2016. 8(2): p. 129-43; Zhang, Z., et al., Br J Pharmacol, 2021, PM1D 34862596). Furthermore, inhibition of mitochondrial Ca2+uptake has proved protective in cellular or mouse models of metabolic stress (Panahi, G., et al., PLoS One, 2018. 13(4): p. e0196580; and Zhang, Z., et al., Br J Pharmacol, 2021, PMID 34862596). while promoting mitochondrial Ca2+entry or impairing mitochondrial tolerance to Ca2+worsens injury (Antony, A. N.. et aL. Nat Commun, 2016. 7: p. 10955; and Tubbs, E., et al., Diabetes, 2014. 63(10): p. 3279-94). In these studies, the main downstream consequence of excess mitochondrial Ca2+has been pathologic ROS production. Because EFHD1 is enriched in the outer mitochondrial membrane, present at sites of ER-mitochondria contact, it will be tested whether this protein is an important regulator of hepatocyte ER-to-mitochondrial Ca2+signaling. By inhibiting transfer of Ca2+from the ER into mitochondria, it is expected that the loss of EFHD1 will inhibit downstream Ca2+signaling to oxidative phosphorylation.
[0594] Identify changes in ER Ca2stores in Eftuil hKO hepatocytes. Efhdl hKO and wildtype littermates will be used (n = 7-9, n refers to numbers of mice per condition per sex per experiment, though multiple assays will be performed on tissues obtained from one mouse to reduce total numbers). Basal ER Ca2+levels will be measured in situ in primary hepatocyte cultures. Cells will be transduced with lentivirus expressing an ER-targeted Ca2+sensor (R-CEPIAer) (Suzuki. J., et al., Nat Commun, 2014. 5: p. 4153) and imaged via confocal microscopy. To quantify the Ca2+transfer machinery, levels of IP3R1, the Ca2+release ATTORNEY DOCKET NO 21101.0493P1
[0595] channel; SERCA2, the Ca2+reuptake transporter; and GRP75, the ER-to-mitochondrial tether, will be measured by Western blot. Although changes in IP3R1 and SERCA2 have been implicated in altered Ca2homeostasis in livers from obese mice (Arruda, A. P., et al., Nat Med, 2014. 20(12): p. 1427-35; and Fu, S., et al., Nature, 2011. 473(7348): p. 528-31), it is not expected that alterations in these parameters in Efhdl hKO livers will be found at baseline.
[0596] Identify changes in ER-to-mitochondrial Ca2+transfer in Efhdl hKO hepatocytes. Efhdl hKO and wild-type littermates will be used (n = 7-9). Ca2+levels in the intermembrane space (IMS) at rest and after ER release will be measured in situ in primary' hepatocyte cultures. Cells will be transduced with lentivirus expressing an IMS-targeted Ca2+sensor (IMS-targeted GEMGECO1) (Waldeck-Weiermair, et al.. Front Cell Neurosci. 2019. 13: p.
[0597] 449) and imaged via confocal microscopy. Stimulated ER Ca2+release will be accomplished by adding vasopressin or other Gq activator (Rooney, T. A., et al., J Biol Chem, 1989.
[0598] 264(29): p. 17131-41; Mine, T., et al., Am J Physiol, 1991. 261(6 Pt 1): p. G1000-4; and Tordjmann, T.. et al., Embo j, 1998. 17(16): p. 4695-703). The two main channels allowing Ca2+entry to the intermembrane space, VDAC1 and VDAC2, will also be quantified by Western blot. VDAC2 preferentially interacts with EFHD1, so changes are expected in its levels in Efhdl hKO liver mitochondria, as well as reduced Ca2+transfer from ER to mitochondria.
[0599] Identify changes in mitochondrial Ca2+levels in Efhdl hKO hepatocytes. Efhdl hKO and wild-type littermates will be used (n = 7-9 except n = 4-6 for electrophysiology). Basal mitochondrial Ca2+levels will be measured in situ in primary hepatocyte cultures. Cells will be transduced with lentivirus expressing a mitochondrially-targeted ratiometric Ca2+sensor (mito-GCaMP6m-mCherry) (Balderas, E.. et al., Nature Communications, 2022; ( 10.21203 / rs.3.rs-378028 / vl) and imaged via confocal microscopy. Similarly, the voltage gradient (AW) driving mitochondrial Ca2+entry will be measured by labeling primary' hepatocytes with tetramethylrhodamine methyl ester (TMRM), a potentiometric dye (Eberhardt, D. R., et al., bioRxiv. 2021: p. 2021). Mitochondrial Ca2+uptake will be measured in mitochondria isolated from livers (FIG. 23). To examine changes in the inner membrane mitochondrial Ca2+machinery, Western blot will be used to measure levels of MCU, MICU1, and EMRE, subunits of the mitochondrial Ca2+uniporter, and NCLX, the main Ca2+exporter. Finally, we isolated uniporter activity will be measured by performing whole-mitoplast electrophysiology to directly measure mitochondrial Ca2+uptake currents. It is expected that ATTORNEY DOCKET NO 21101.0493P1
[0600] mitochondrial Ca2+levels will be reduced, associated with less polarized A'P, and mitochondrial Ca2+uptake in Efhdl hKO hepatocytes will also be reduced.
[0601] Identify alterations in mitochondrial respiration and ROS production in Efhdl hKO hepatocytes. Efhdl hKO and wild-tj pe littermates will be used (n = 7-9). The experiments will assay primary hepatocyte cultures. Oxygen consumption will be measured on the Agilent Seahorse platform. Mitochondrial ROS levels will be quantified by staining with mitoSOX and measuring fluorescence (Eberhardt, D. R.. et al.. bioRxiv. 2021: p. 2021). Finally, hepatic mitoflash production will be measured using TMRM dye (Eberhardt, D. R., et al., bioRxiv, 2021: p. 2021). Mitoflashes are transient mitochondrial depolarizations integrating excessive Ca2+signaling and ROS production, and their increased frequency is an early marker for mitochondrial dysfunction (Eberhardt. D. R.. et al., bioRxiv. 2021: p. 2021; Wang, W., et al.. Cell, 2008. 134(2): p. 279-90; and Wang, X., et al., J Mol Cell Cardiol, 2012. 52(5): p. 940-8). In cultured cells and cardiomyocytes, loss of EFHD1 is associated with reduced mitoflash frequency (Eberhardt, D. R., et al., bioRxiv, 2021: p. 2021; and Hou, T., et al., Cell Calcium, 2016. 59(5): p. 262-70), so it is expected that reductions in mitoflashes and mitochondrial ROS levels in Efhdl hKO hepatocytes will be found. Interestingly, respiration levels in Efhdl KO cardiomyocytes are not significantly different from controls at baseline (Eberhardt, D. R., et al., bioRxiv, 2021: p. 2021), whereas those in B-cell precursors are (Stein, M., et al., Cell Death Differ. 2017. 24(7): p. 1239-1252), which may reflect the preference for fatty acid fuels in the heart versus glycolysis in immune cells. Given the metabolic flexibility of hepatocytes, it is expected that respiration levels in the Seahorse assay to be unchanged in Efhdl hKO.
[0602] Determine if changes in ER-to-mitochondrial Ccr transfer in Efhdl hKO livers are due to altered VDAC2 function. The results show that EFHD1 preferentially interacts with VDAC2, but not VDAC1, on the mitochondrial outer membrane (FIG. 20H). It will be tested if the alterations in mitochondrial Ca2+signal in Efhdl hKO are due to loss of this interaction.
[0603] First, it will be determined if VDAC2 localization on the outer mitochondrial membrane changes in Efhdl hKO mitochondria compared to WT. Outer membrane and mitochondria-associated-membrane (MAMs, which are enriched for membranes at ER-mitochondria contact sites) will be purified by differential ultracentrifugation, and VDAC2 levels measured by Western blot in both fractions. The purification can be performed after exposing mitochondria to Ca2+, to see if there are Ca2-induced changes in VDAC2 localization as well. Second, it will be determined if loss of hepatic VDAC2 alters mitochondrial Ca2+uptake. Floxed VDAC2 mice will be used and their cardiac mitochondrial ATTORNEY DOCKET NO 21101.0493P1
[0604] Ca2+uptake was analyzed revealing impaired mitochondrial Ca2+uptake (Shankar, T. S., et al., Nat Commun, 2021. 12(1): p. 4583). Hepatic Vdac2 KO will be generated by crossing with theA / b-Cre strain. EFHD1 levels will be measured in their livers, and also mitochondrial Ca2+uptake will be assessed. It is expected that loss of hepatic VDAC2 will mimic loss of hepatic EFHD1, with reduced Ca2+transfer to the mitochondria.
[0605] In some aspects, Ca2+uptake can be assessed directly isolating mitochondria and challenging them with small Ca2+pulses to directly measure uptake. To assess the reason for reduced ER Ca2+stores, ER stress response (e g., unfolded protein response) can be assessed along with quantification of Ca2+transporting ER proteins (and their phosphorylation states). If in some aspects, experiments can be performed with X-rhod-1, to measure mitochondrial Ca2+. Amplex Red is an alternative for ROS assays, and Oroboros-based respiration or luciferase-based ATP synthesis are alternatives for OXPHOS (Sommakia, S., et al., J Mol Cell Cardiol, 2017. 113: p. 22-32). If reduced A'P in cardiomyocytes are found, it is possible that loss of EFHD1 is enhancing uncoupling, which is known to be protective in MAFLD (Goedeke, L., and G. E Shulman. Mol Metab, 2021. 46: p. 101178). In this case, levels of uncoupling proteins 1-3, the ATP / ADP translocase, and other known proton-conducting SLC25 family transporters, will be assayed. In some aspects, the interaction domain on EFHD1 will be mapped for VDAC2 by creating deletion mutants for the intrinsically-disordered region or coiled-coil domains, and determining if these still co-immunoprecipitate with VDAC2 as in FIG. 20H.
[0606] In some aspects, it will be established that hepatic EFHD1 ablation inhibits ER-to-mitochondrial Ca2+signaling, leading to reduced ROS production and partly explaining the effects of Eftidl hKO on hepatic physiology.
[0607] Determine ifEFHDl alters hepatic mitochondrial morphology. Increased mitochondrial fission has been consistently associated with worsened liver injury (Zhou, H., et al., Signal Transduct Target Ther, 2019. 4: p. 56; Du, Y. D., et al., Cell Death Dis, 2021. 12(5): p. 442; Huang, J., et al., Cell Death Differ, 2021. 28(4): p. 1174-1192; Lou, G, et al., Cell Biosci, 2021. 11(1): p. 9; and Xu, S., et al., Cell Death Dis, 2013. 4(3): p. e540). In a recent high-density mitochondrial proximity interaction compendium, performed in HEK-293 cells (Antonicka, H., et al., Cell Metab, 2020. 32(3): p. 479-497. e9), two outer mitochondrial membrane proteins important for fission / fusion, Mitochondrial fission 1 protein (FIS 1 ) and Mitofusin-2 (MFN2), were found to interact w i th EFHD1. Moreover, the data described herein shows expression of Dynamin-related protein 1 (DRP1, Dnmll gene) is profoundly increased. DPR1 is a GTPase that interacts with mitochondrial adaptors to form constriction ATTORNEY DOCKET NO 21101.0493P1
[0608] rings at sites of mitochondrial outer membrane division. FIS 1 is an integral protein of the outer mitochondrial membrane, where it is one of several adaptors to recruit DRP1 for fission (Kleele, T., et al., Nature, 2021. 593(7859): p. 435-439). Conversely, MFN2, a dynamin-like GTPase embedded in the outer membrane protein and MAMs, is important for mediating mitochondrial fusion. Consistent with potential EFHD1 regulation of mitochondrial fission, it is possible that EFHD1 and FISlinteract in the presence of Ca2+but not its absence (FIG. 24 A). Moreover, the data show that EFHD1 knockout cells appear to have reduced fission, with elongated and peripherally-located mitochondria (FIGS. 20B-E). Paradoxically, this phenotype is present despite increases in fission proteins (DRP1) and reductions in fusion proteins (MFN2), strongly showing that EFHD1 is an important transducer for the fission machinery, which is stymied in its absence. Therefore, it will be tested whether EFHD1 is an adaptor protein linking ER Ca2+release to mitochondrial fission. The mechanism by which loss of EFHD1 alters mitochondrial morphology will be examined.
[0609] Determine whether mitochondrial morphology and localization are altered after EFHD1 ablation in primary hepatocytes and cultured hepatocyte lines. Efhdl hKO primary hepatocytes and EEHD1 KO HepG2 (hepatocellular carcinoma-derived cells) will be used (at least 50 cells per condition; n = 4-6 for animal studies). EFHD1 KO cells were generated using CRISPR / Cas9 technology (FIGS. 20D-E). Mitochondrial morphology7, cytoskeletal actin structure, and endoplasmic reticulum (ER) structure will be studied in these cells after fixing using immunocytochemistry and confocal microscopy. Mitochondria and actin will be labeled as in FIG. 20E (MitoTracker, Phalloidin), while ER will be labeled with calreticulin. It is expected that mitochondria will be more tubular and less fissioned and mitochondrial localization will be less perinuclear after EFHD1 ablation. Because mitochondria will be redistributed within the cell, it is also expected that fewer sites of ER-mitochondrial will have contact after EFHD1 ablation. These differences will be rescued with EFHD1 expression using lentiviral transduction.
[0610] Determine whether mitochondrial motility is altered are altered after EFHD1 ablation in primary hepatocytes and cultured hepatocyte lines. Ejhdl hKO primary hepatocytes and EFHD1 KO HepG2 will be used. For live cell imaging with minimal phototoxicity, a spinning disk confocal microscope and heterologous expression of targeted fluorescent proteins will be used. Mitochondria will be labeled by transducing mito-Gold (Lee, J., et al., Sci Adv, 2020. 6(43), PMC7608836), actin by transducing LifeAct-mScarlet (Bindels, D. S., et al.. Nat Methods, 2017. 14(1): p. 53-56), and ER by transducing ER-E2-Crimson (Strack, R. L., et al., Biochemistry, 2009. 48(35): p. 8279-81), which are all bright, ATTORNEY DOCKET NO 21101.0493P1
[0611] spectrally-separated fluorescent proteins with improved photostability for long-term imaging at low, minimally -toxic laser powers. Movement of individual mitochondria, actin fibers, and ER will ...
Claims
ATTORNEY DOCKET NO. 21101.0493P1CLAIMS WHAT IS CLAIMED IS:
1. A composition comprising a nucleic acid sequence or molecule wherein the nucleic acid comprises or consists of a sequence having at least 90% identity to the sequence set forth in:UUCAGCUCCAUCAGGUCGAUG (SEQ ID NO: 2), UUCAGCUCCAUCAGGUCGAUGAA (SEQ ID NO: 4), UUCUCCAUCAUCAGCUUCAGC (SEQ ID NO: 6), UUCUCCAUCAUCAGCUUCAGCUC (SEQ ID NO: 8), UUCAGGCCCAGGUGGGUCUGG (SEQ ID NO: 10), UUCAGGCCCAGGUGGGUCUGGUG (SEQ ID NO: 12), ACCUUGGCUUCAAAGAAGUUC (SEQ ID NO: 14), ACCUUGGCUUCAAAGAAGUUCUU (SEQ ID NO: 16), AAACUUACUGGCCGAUGACAA (SEQ ID NO: 18), AAACUUACUGGCCGAUGACAAGG (SEQ ID NO: 20), GAACAUGCUCUCCAGGUCCUU (SEQ ID NO: 22), GAACAUGCUCUCCAGGUCCUUGA (SEQ ID NO: 24), ACAGUUUGAACAUGCUCUCCA (SEQ ID NO: 26), ACAGUUUGAACAUGCUCUCCAGG (SEQ ID NO: 28), UCUGCUUCAAACUUACUGGCC (SEQ ID NO: 30), UCUGCUUCAAACUUACUGGCCGA (SEQ ID NO: 32), GCUCAGCUUUCAACUCUGCUU (SEQ ID NO: 34), GCUCAGCUUUCAACUCUGCUCCA (SEQ ID NO: 36), or GUUGGCCUUGAGUUUCUGGAA (SEQ ID NO: 38).
2. A siRNA molecule wherein the siRNA molecule specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242 and reduces expression of EF -hand domain-containing protein 1 (EFHD1) gene in a cell, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence having at least 90%ATTORNEY DOCKET NO. 21101.0493P1sequence identity selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236.
3. The siRNA molecule of claim 2, wherein at least one nucleotide of the siRNA molecule comprises a chemical modification.
4. The siRNA molecule of claim 3, wherein the modified nucleotide is selected from a 2'- O-methyl-modified nucleotide, a 2'-deoxy-2'-fluoro-modified nucleotide, a 2'- deoxynucleotide, a 2'-methoxyethyl-modified nucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a 2'-alkoxy-modified nucleotide, a 2'-F- arabinonucleotide, a phosphorothioate-modified nucleotide, an a basic nucleotide, a morpholino nucleotide, and a locked nucleotide.
5. The siRNA molecule of claim 3, wherein the chemical modification is on the sense strand, the antisense strand or on both strands of the siRNA molecule.
6. The siRNA molecule of claim 2, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 - SEQ ID NO: 236.
7. The siRNA molecule of claim 2, wherein the siRNA molecule comprises or consists of a sense strand which comprises or consists of at least one sequence selected from the group of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59 SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQATTORNEY DOCKET NO. 21101.0493P1ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ ID NO: 129, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, SEQ ID NO: 141, SEQ ID NO: 143, SEQ ID NO: 145, SEQ ID NO: 147, SEQ ID NO: 149, SEQ ID NO: 151, SEQ ID NO: 153, SEQ ID NO: 155, SEQ ID NO: 157, SEQ ID NO: 159, SEQ ID NO: 161, SEQ ID NO: 163, SEQ ID NO: 165, SEQ ID NO: 167, SEQ ID NO: 169, SEQ ID NO: 171, SEQ ID NO: 173, SEQ ID NO: 175, SEQ ID NO: 177, SEQ ID NO: 179, SEQ ID NO: 181, SEQ ID NO: 183, SEQ ID NO: 185, SEQ ID NO: 187, SEQ ID NO: 189, SEQ ID NO: 191, SEQ ID NO: 193, SEQ ID NO: 195, SEQ ID NO: 197, SEQ ID NO: 199, SEQ ID NO: 201, SEQ ID NO: 203, SEQ ID NO: 205, SEQ ID NO: 207, SEQ ID NO: 209, SEQ ID NO: 211, SEQ ID NO: 213, SEQ ID NO: 215, SEQ ID NO: 217, SEQ ID NO: 219, SEQ ID NO: 221, SEQ ID NO: 223, SEQ ID NO: 225, SEQ ID NO: 227, SEQ ID NO: 229, SEQ ID NO: 231, SEQ ID NO: 233, and SEQ ID NO: 235; and an antisense strand which is complementary to the sense strand which is selected from the group of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 122, SEQ ID NO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, SEQ IDNO: 146, SEQ IDNO: 148, SEQ ID NO: 150, SEQ ID NO: 152, SEQ ID NO: 154, SEQ ID NO: 156, SEQ ID NO: 158, SEQ ID NO: 160, SEQ ID NO: 162, SEQATTORNEY DOCKET NO. 21101.0493P1ID NO: 164, SEQ ID NO: 166, SEQ ID NO: 168, SEQ ID NO: 170, SEQ ID NO: 172, SEQ ID NO: 174, SEQ ID NO: 176, SEQ ID NO: 178, SEQ ID NO: 180, SEQ ID NO: 182, SEQ ID NO: 184, SEQ ID NO: 186, SEQ ID NO: 188, SEQ ID NO: 190, SEQ ID NO: 192, SEQ ID NO: 194, SEQ ID NO: 196, SEQ ID NO: 198, SEQ ID NO: 200, SEQ ID NO: 202, SEQ ID NO: 204, SEQ ID NO: 206, SEQ ID NO: 208, SEQ ID NO: 210, SEQ ID NO: 212, SEQ ID NO: 214, SEQ ID NO: 216, SEQ ID NO: 218, SEQ ID NO: 220, SEQ ID NO: 222, SEQ ID NO: 224, SEQ ID NO: 226, SEQ ID NO: 228, SEQ ID NO: 230, SEQ ID NO: 232, SEQ ID NO: 234, and SEQ ID NO: 236.
8. A composition comprising one or more of the siRNA molecules of claims 2-7.
9. A pharmaceutical composition, comprising at least one siRNA molecule of any of the preceding claims.
10. The composition of claim 1 or 8, further comprising a pharmaceutically acceptable carrier.
11. The composition of claim 10, wherein the pharmaceutically acceptable carrier comprises a lipid-based or polymer-based colloid.
12. The composition of claim 11, wherein the colloid is a liposome, a hydrogel, a microparticle, a nanoparticle, or a block copolymer micelle.
13. The siRNA molecule of claims 2 to 7, further comprising a pharmaceutically acceptable carrier.
14. The siRNA molecule of claim 13, wherein the pharmaceutically acceptable carrier comprises a lipid-based or polymer-based colloid.
15. The siRNA molecule of claim 14, wherein the siRNA molecule is formulated for intravenous, intratumoral, intramuscular, or subcutaneous administration.ATTORNEY DOCKET NO. 21101.0493P116. An siRNA conjugate comprising the siRNA molecule according to any one of claims 2-7 or 13-14 and a targeting group.
17. The siRNA conjugate according to claim 16, wherein the targeting group is a ligand with affinity for an asialoglycoprotein receptor.
18. The siRNA conjugate according to claim 17, wherein the targeting group includes a group derived from a lipophil, wherein the lipophil is selected from cholesterol, cholic acid, amantanoacetic acid, 1 -pyrenebutanoic acid, dihydrotestosterone, 1,3-bis- O(hexadecyl)glycerol, geranyl oxy hexyl, hexadecyl glycerol, borneol, menthol, 1,3- propanediol, heptadecyl, palmitic acid, myristic acid, O-3-(oleoyl) lithocholic acid, 0-3- (oleoyl) cholic acid, dimethoxytribenzyl, and phenoxazine.
19. The siRNA conjugate according to claim 18, wherein the targeting group includes a group derived from a carbohydrate, wherein the carbohydrate is selected from allose, altrose, arabinose, cladinose, erythrose, erythrulose, fructose, D-fucitol, L-fucitol, fucosamine, fucose, fuculose, galactosamine, D-galactosaminol, N-acetyl-galactosamine (GalNAc), galactose, glucosamine, N-acetyl-glucosamine, glucosaminitol, glucose, glucose-6-phosphate, gulonoglyceraldehyde, L-glycero-D-mannose-heptose, glycerol, glycerone, gulose, idose, lyxose, mannosamine, mannose, mannose-6-phosphate, psicose, quinovose, quinovosamine, rhamnitol, rhamnosamine, rhamnose, ribose, ribulose, sedoheptulose, sorbose, tagatose, talose, tartaric acid, threose, xylose, and xylulose.
20. The siRNA conjugate according to any one of claims claim 16-20, further comprising a linker, wherein the siRNA molecule, the linker, and the targeting group are sequentially covalently or non-covalently linked.
21. The siRNA conjugate according to claim 20, wherein the linker includes: reactive groups, alkyl groups, abasic nucleotides, ribitol (abasic ribose), and / or PEG groups; or, one end of the linker is a carbonyl group, through which the linker is covalently linked to the targeting group, and the other end is an — O — group for covalent linkage to the siRNA through a phosphoester bond ( — O — P(O)OH — ).ATTORNEY DOCKET NO. 21101.0493P122. The siRNA molecule of any one of claims 2-7 or 13-15, the composition of claims 1, 8, or 10-12, the pharmaceutical composition of claim 9, or the siRNA conjugate of claims 16-22, wherein the siRNA, composition, pharmaceutical composition or siRNA conjugate is capable of inhibiting the expression of EF-Hand Domain Family Member DI (EFHD1) in a cell.
23. A method of treating metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis, the method comprising: administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a composition comprising the siRNA molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25- nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236, and wherein the therapeutically effective amount reduces Ca2+-induced mitochondrial fission.
24. A method of inhibiting expression of a EFHD1 polynucleotide in a subject, the method comprising administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a composition comprising the siRNA molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 25- to 28-nucleotide blunt-ended doublestranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236.ATTORNEY DOCKET NO. 21101.0493P125. A method of treating acute kidney disease, chronic kidney disease, diabetic kidney disease, or hypertensive kidney disease, the method comprising: administering to a subject with acute kidney disease, chronic kidney disease, diabetic kidney disease, or hypertensive kidney disease a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a composition comprising the siRNA molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236, and wherein the therapeutically effective amount reduces Ca2+-induced mitochondrial fission.
26. A method of treating breast cancer, the method comprising: administering to a subject with breast cancer a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a composition comprising the siRNA molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25- nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236, and wherein the therapeutically effective amount reduces Ca2+-induced mitochondrial fission.
27. A method of reducing Ca2+-induced mitochondrial fission in a subject, the method comprising administering to a subject with Alzheimer’s disease or dementia a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a composition comprising the siRNA molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-ATTORNEY DOCKET NO. 21101.0493P1nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236.
28. A method of suppressing expression of a EFHD1 polynucleotide in a subject, the method comprising administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended doublestranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236.
29. A method of reducing or decreasing inflammation in a subject, the method comprising administering to a subject with Alzheimer’s disease or dementia a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a composition comprising the siRNA molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt- ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236.
30. A method of reducing fibrosis in a subject, the method comprising administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a composition comprising the siRNA molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein theATTORNEY DOCKET NO. 21101.0493P1siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236.
31. A method of reducing hepatitis in a subject, the method comprising administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a composition comprising the siRNA molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236.
32. A method of reducing hepatocyte injury in a subject, the method comprising administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a composition comprising the siRNA molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236.
33. A method of increasing mitochondrial size within cells in a subject, the method comprising administering to a subject with metabolic liver disease, metabolic dysfunction-associated steatotic liver disease, or steatohepatitis a therapeutically effective amount of a small interfering RNA (siRNA) molecule, a composition comprising the siRNA molecule, a pharmaceutical composition comprising the siRNA molecule, or an siRNA conjugate comprising the siRNA molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242,ATTORNEY DOCKET NO. 21101.0493P1wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended doublestranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236.
34. The method of any of claims 23-33, wherein the subject is identified as being in need of treatment before the administration step.
35. The method of any one of claims 23-33, wherein the subject is a human.
36. The method of any one of claims 23-33, further comprising administering a glucagon - like peptide (GLP-1), GLP-l / glucose-dependent insulinotropic polypeptide (GIP), or GLP1 / GIP / GCG agonists; thyroid hormone receptor agonists; FGF21 analogs; PPAR agonists; fatty acid synthase inhibitors; metformin; thiazolidinediones, Vitamin E to the subject.
37. The method of any one of claims 23-36, wherein the subject has metabolic liver disease.
38. The method of claim 23-36, wherein the subject has metabolic dysfunction-associated steatotic liver disease.
39. The method of claim 22-36, wherein the subject has steatohepatitis.
40. The method of any one of claims 22-33, wherein the composition further comprises a pharmaceutically acceptable carrier.
41. The method of claim 40, wherein the pharmaceutically acceptable carrier comprises a lipid-based or polymer-based colloid.
42. The method of any one of claims 23-41, wherein the siRNA molecule is formulated for intravenous or subcutaneous administration.
43. The method of any one of claims 23-41, wherein the therapeutically effective amount of the siRNA molecule or a composition comprising the siRNA molecule is administered orally, intramuscularly, intraperitoneally, intravenously, or subcutaneously.ATTORNEY DOCKET NO. 21101.0493P144. A method of inhibiting expression of a EFHD1 polynucleotide, the method comprising contacting a cell with a small interfering RNA (siRNA) molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236, wherein the siRNA molecule reduces Ca2+-induced mitochondrial fission.
45. A method of suppressing expression of a EFHD1 polynucleotide, the method comprising contacting a cell with a small interfering RNA (siRNA) molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236, wherein the siRNA molecule reduces Ca2+-induced mitochondrial fission.
46. A method of reducing Ca2+-induced mitochondrial fission, the method comprising contacting a cell with a small interfering RNA (siRNA) molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236, wherein the siRNA molecule reduces Ca2+-induced mitochondrial fission.
47. A method of reducing or decreasing inflammation, the method comprising contacting a cell with a small interfering RNA (siRNA) molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended doublestranded structure, wherein the siRNA molecule comprises at least one sequence selectedATTORNEY DOCKET NO. 21101.0493P1from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236, wherein the siRNA molecule reduces Ca2+-induced mitochondrial fission.
48. A method of reducing hepatitis, the method comprising contacting a cell with a small interfering RNA (siRNA) molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236, wherein the siRNA molecule reduces Ca2+-induced mitochondrial fission.
49. A method of reducing fibrosis, the method comprising contacting a cell with a small interfering RNA (siRNA) molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236, wherein the siRNA molecule reduces Ca2+-induced mitochondrial fission.
50. A method of reducing hepatocyte injury, the method comprising contacting a cell with a small interfering RNA (siRNA) molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-ended double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236, wherein the siRNA molecule reduces Ca2+-induced mitochondrial fission.
51. A method of increasing mitochondrial size within cells, the method comprising contacting a cell with a small interfering RNA (siRNA) molecule that specifically targets at least one sequence selected from the group consisting of SEQ ID NO: 240 to SEQ ID NO: 242, wherein the siRNA molecule comprises a 20- to 25-nucleotide blunt-endedATTORNEY DOCKET NO. 21101.0493P1double-stranded structure, wherein the siRNA molecule comprises at least one sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 236, wherein the siRNA molecule reduces Ca2+-induced mitochondrial fission.
52. The method of any one of claims 44 to 51, wherein the cell is a mammalian cell.
53. The method of claim 52, wherein the mammalian cell is a liver cell.
54. The method of any one of claims 44 to 51, wherein at least one nucleotide of the siRNA molecule comprises a chemical modification.
55. The method of claim 54, wherein the chemical modification is on the sense strand, the antisense strand or on both.
56. The method of any one of claims 44 to 51, wherein the siRNA molecule comprises at least one sequence is selected from the group consisting of SEQ ID NO: 1 - SEQ ID NO: 236.
57. The method of any one of the preceding claims, wherein the siRNA molecule comprises or consists of a sense strand which comprises or consists of at least one sequence selected from the group of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59 SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 115, SEQ ID NO: 117,ATTORNEY DOCKET NO. 21101.0493P1SEQ ID NO: 119, SEQ ID NO: 121, SEQ ID NO: 123, SEQ ID NO: 125, SEQ ID NO: 127, SEQ IDNO: 129, SEQ IDNO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137, SEQ ID NO: 139, SEQ ID NO: 141, SEQ ID NO: 143, SEQ ID NO: 145, SEQ ID NO: 147, SEQ IDNO: 149, SEQ IDNO: 151, SEQ ID NO: 153, SEQ IDNO: 155, SEQ ID NO: 157, SEQ ID NO: 159, SEQ ID NO: 161, SEQ ID NO: 163, SEQ ID NO: 165, SEQ ID NO: 167, SEQ ID NO: 169, SEQ ID NO: 171, SEQ ID NO: 173, SEQ ID NO: 175, SEQ ID NO: 177, SEQ ID NO: 179, SEQ ID NO: 181, SEQ ID NO: 183, SEQ ID NO: 185, SEQ IDNO: 187, SEQ IDNO: 189, SEQ IDNO: 191, SEQ IDNO: 193, SEQ ID NO: 195, SEQ ID NO: 197, SEQ ID NO: 199, SEQ ID NO: 201, SEQ ID NO: 203, SEQ IDNO: 205, SEQ IDNO: 207, SEQ ID NO: 209, SEQ ID NO: 211, SEQ ID NO: 213, SEQ ID NO: 215, SEQ ID NO: 217, SEQ ID NO: 219, SEQ ID NO: 221, SEQ ID NO: 223, SEQ ID NO: 225, SEQ ID NO: 227, SEQ ID NO: 229, SEQ ID NO: 231, SEQ ID NO: 233, and SEQ ID NO: 235; and an antisense strand which is complementary to the sense strand which is selected from the group of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116, SEQ IDNO: 118, SEQ IDNO: 120, SEQ IDNO: 122, SEQ IDNO: 124, SEQ ID NO: 126, SEQ ID NO: 128, SEQ ID NO: 130, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138, SEQ ID NO: 140, SEQ ID NO: 142, SEQ ID NO: 144, SEQ ID NO: 146, SEQ ID NO: 148, SEQ ID NO: 150, SEQ ID NO: 152, SEQ ID NO: 154, SEQ IDNO: 156, SEQ IDNO: 158, SEQ ID NO: 160, SEQ IDNO: 162, SEQ ID NO: 164, SEQ ID NO: 166, SEQ ID NO: 168, SEQ ID NO: 170, SEQ ID NO:ATTORNEY DOCKET NO. 21101.0493P1172, SEQ ID NO: 174, SEQ ID NO: 176, SEQ ID NO: 178, SEQ ID NO: 180, SEQ ID NO: 182, SEQ ID NO: 184, SEQ ID NO: 186, SEQ ID NO: 188, SEQ ID NO: 190, SEQ ID NO: 192, SEQ ID NO: 194, SEQ ID NO: 196, SEQ ID NO: 198, SEQ ID NO: 200, SEQ ID NO: 202, SEQ ID NO: 204, SEQ ID NO: 206, SEQ ID NO: 208, SEQ ID NO: 210, SEQ ID NO: 212, SEQ ID NO: 214, SEQ ID NO: 216, SEQ ID NO: 218, SEQ ID NO: 220, SEQ ID NO: 222, SEQ ID NO: 224, SEQ ID NO: 226, SEQ ID NO: 228, SEQ ID NO: 230, SEQ ID NO: 232, SEQ ID NO: 234, and SEQ ID NO: 236.
Citation Information
Patent Citations
Method for improving blood-brain barrier permeability by regulating Swiprosin-1 expression
CN105031654A
Sarna compositions and methods of use
US20210363525A1