Stabilized mRNA complexes and methods of use thereof

AU2025213912A1Pending Publication Date: 2026-08-27PARCEL BIOSCIENCES INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
AU2025213912
Authority / Receiving Office
AU · AU
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-01-30
Filing Date
2025-01-30
Publication Date
2026-08-27

Smart Images

  • Figure 00000040_0000
    Figure 00000040_0000
  • Figure 00000041_0000
    Figure 00000041_0000
  • Figure 00000042_0000
    Figure 00000042_0000
Patent Text Reader

Abstract

A non-viral, nanoparticle-free technology for targeted mRNA delivery in vivo is described herein. The technology described herein uses clinically validated nucleic-acid chemistry to stabilize mRNA molecules and specifically deliver them to target cell types. Targeting of mRNAs to the liver and beyond will be useful in many therapeutic applications.
Need to check novelty before this filing date? Find Prior Art

Description

Cross Reference to Related Application(s) This application claims priority to United States Provisional Application Number 63 / 626,938, filed January 30, 2024. The entire content of the application referenced above is hereby incorporated by reference herein. Background Delivery of mRNA is a longstanding problem in the therapeutic RNA space. Currently, few technologies exist to specifically deliver mRNA to desired cell-types, tissues or organs for expression of therapeutic proteins. Accordingly, improvements are needed for the delivery of mRNA. Summary A non-viral, nanoparticle-free technology for targeted mRNA delivery in vivo is described herein. The technology described herein uses clinically validated nucleic-acid chemistry to stabilize mRNA molecules and specifically deliver them to target cell types. Targeting of mRNAs to the liver and beyond will be useful in many therapeutic applications. As described herein, oligonucleotides have been designed that impart stabilization and targeting by annealing to mRNA. Examples of improvements described herein are: (1) imparting of double-strandedness to mRNA for stability in biofluids and translation in cells with one or more designed oligonucleotides, and (2) specific delivery of an mRNA cargo. The double strandedness of an mRNA can be reversible double strandedness. The specific delivery of an mRNA cargo can be attributed to the mRNA itself or through conjugation of targeting moieties to oligonucleotides that are hybridized to an mRNA. Briefly, an mRNA is hybridized to complementary oligos (e.g., 1-200 nucleotides (nt) in length, chemically modified, which may be conjugated to specific targeting moieties) that bind sequence specifically to the therapeutic mRNA molecule. These oligonucleotides impart stability to the mRNA while the mRNA is in transit to a desired cell-type and can allow for cell-type specific delivery of the mRNA via conjugation to targeting moieties. The oligonucleotides may bind reversibly and can dissociate once in the endosome and / or the cytoplasm of the target cell to allow for translation of an mRNA into protein. Accordingly, as described herein, certain embodiments of the current invention provide a complex comprising a mRNA molecule and at least one synthetic oligonucleotide hybridized to the mRNA molecule that imparts double-strandedness to the complex. Certain embodiments of the current invention provide a complex comprising a mRNA molecule and at least one synthetic oligonucleotide hybridized to the mRNA molecule that imparts reversible doublestrandedness to the complex. Brief Description Of Drawings Figure 1. Fig 1 depicts the experiments and results described in Example 1. Figure 2. Fig 2 depicts the experiments and results described in Example 2. Figure 3. Fig 3 depicts the experiments and results described in Example 3. Figure 4. Fig 4 depicts the experiments and results described in Example 4. Figure 5. Fig 5 depicts the experiments and results described in Example 5. Figure 6. Fig 6 depicts the experiments and results described in Example 6. Figure 7. Fig 7 depicts the experiments and results described in Example 7. Figure 8. Fig 8 depicts the experiments and results described in Example 8. Figure 9. Fig 9 depicts the experiments and results described in Example 9. Figure 10. Fig 10 depicts the experiments and results described in Example 10. Figure 11. Fig 11 depicts the experiments and results described in Example 11. Figure 12. Fig 12 depicts the experiments and results described in Example 12. Figure 13. Fig 13 depicts the experiments and results described in Example 13. Figure 14. Figure 14 provides a schematic overview of a complex of the invention. Detailed Description Accordingly, certain embodiments of the current invention provide a complex comprising a mRNA molecule and at least one synthetic oligonucleotide hybridized to the mRNA molecule that imparts double-strandedness to the complex. Certain embodiments of the current invention provide a complex comprising a mRNA molecule and at least one synthetic oligonucleotide hybridized to the mRNA molecule that imparts reversible double-strandedness to the complex. In certain embodiments, no synthetic oligonucleotide of the complex is conjugated to a targeting moiety. In certain embodiments, at least one synthetic oligonucleotide of the complex is conjugated to a targeting moiety. In certain embodiments, the targeting moiety is a sugar (e.g., GalNAc), a small molecule (e.g., Cl6), a peptide, an antibody (e.g., IgG), an antibody fragment (e.g., Fab), a nanobody / miniprotein (e.g., VHH, svFv), an anti-CD5 antibody, or a nucleic acid. In certain embodiments, the synthetic oligonucleotide of the complex is 1-200 nt in length. In certain embodiments, the synthetic oligonucleotide of the complex is 1-50 nt in length. In certain embodiments, the synthetic oligonucleotide of the complex is 2-25 nt in length. In certain embodiments, the synthetic oligonucleotide of the complex is 50-75 nt in length. In certain embodiments, the synthetic oligonucleotide of the complex is 75-100 nt in length. In certain embodiments, the synthetic oligonucleotide of the complex is 100-150 nt in length. In certain embodiments, the synthetic oligonucleotide of the complex is 150-200 nt in length. In certain embodiments, the synthetic oligonucleotide of the complex comprises a 2’-OH modification (e.g., 2’-OMe, 2’-M0E, 2’-F). In certain embodiments, the synthetic oligonucleotide of the complex comprises modifications to the phosphodiester backbone (e.g., phosphorothioate linkages). In certain embodiments, the synthetic oligonucleotide of the complex comprises 100% uridine modification (e.g., N1 -methylpseudouridine or 5-methyoxyuridine modifications). Certain embodiments of the current invention provide compositions comprising a complex as described herein. Certain embodiments of the current invention provide compositions comprising a synthetic oligonucleotide as described herein. In certain embodiments, the composition is a pharmaceutical composition. Certain embodiments of the current invention provide the use of a complex or composition as described herein as a medicament. Certain embodiments provide a complex comprising a mRNA molecule and at least one synthetic oligonucleotide hybridized to the mRNA molecule that imparts double-strandedness to the complex. In certain embodiments, the hybridization of the at least one synthetic oligonucleotide to the mRNA increases the stability of the complex as compared to mRNA that is not hybridized of the at least one synthetic oligonucleotide. The increase in stability can be as described in the Examples herein, e.g., in Example 1. In certain embodiments, the stability is increased at a certain time point, e.g., by at least 5%, e.g., by at least 10%, e.g., by at least 20%, e.g., by at least 25%, e.g., by at least 50%, e.g., by at least 75%, e.g., by at least 100%, e.g., by more than 100%. In certain embodiments, the complex comprises a plurality of synthetic oligonucleotides (e.g., more than 1, e.g., at least 5, e.g., at least 10, e.g., at least 15, e.g., 5-10, e.g., 5-15, e.g., 520, e.g., 5-30, e.g., 5-40, e.g., 5-50, e.g., 5-75). In certain embodiments, at least one synthetic oligonucleotide of the complex is conjugated to a targeting moiety. In certain embodiments, no synthetic oligonucleotide of the complex is conjugated to a targeting moiety. In certain embodiments, each targeting moiety is a sugar (e.g., GalNAc), a small molecule (e.g., Cl6), a peptide, an antibody (e.g., IgG), an antibody fragment (e.g., Fab), a nanobody / miniprotein (e.g., VHH, svFv), an anti-CD5 antibody, or a nucleic acid. In certain embodiments, at least one targeting moiety is Cl6. In certain embodiments, at least one targeting moiety is GalNAc. In certain embodiments, the complex comprises a plurality of synthetic oligonucleotides, wherein at least one synthetic oligonucleotide of the complex is conjugated to C16 and at least one synthetic oligonucleotide of the complex is conjugated to GalNAc. In certain embodiments, at least one of the synthetic oligonucleotides of the complex is 1-200 nt in length. In certain embodiments, at least one of the synthetic oligonucleotides is 1-50 nt in length. In certain embodiments, at least one of the synthetic oligonucleotides is 2-25 nt in length (e.g., 5-20 nt in length, e.g., 5-15 nt in length, e.g., 5-25 nt in length). In certain embodiments, at least one of the synthetic oligonucleotides is 50-75 nt in length. In certain embodiments, at least one of the synthetic oligonucleotides is 75-100 nt in length. In certain embodiments, at least one of the synthetic oligonucleotides is 100-150 nt in length. In certain embodiments, at least one of the synthetic oligonucleotides is 150-200 nt in length. In certain embodiments, at least one of the synthetic oligonucleotides of the complex comprises a 2’-OH modification (e.g., 2’-OMe, 2’-M0E, 2’-F). In certain embodiments, at least one of the synthetic oligonucleotides of the complex comprises modifications to the phosphodiester backbone (e.g., phosphorothioate linkages). In certain embodiments, at least one of the synthetic oligonucleotides of the complex comprises 100% uridine modification (e.g., N1 -methylpseudouridine or 5-methyoxyuridine modifications). In certain embodiments, the at least one synthetic oligonucleotide imparts reversible double-strandedness to the complex. In certain embodiments, the mRNA is therapeutic mRNA (e.g, encoding a therapeutic protein). In certain embodiments, the at least one synthetic oligonucleotide, or plurality thereof, is not hybridized to the 3’UTR of the mRNA. In certain embodiments, the at least one synthetic oligonucleotide, or plurality thereof, is not hybridized to the 5’UTR of the mRNA. In certain embodiments, the at least one synthetic oligonucleotide, or plurality thereof, is not hybridized to the 3’UTR or the 5’UTR of the mRNA. Certain embodiments provide a method for delivering therapeutic mRNA to a cell in vivo, comprising administering to a subject a complex as described herein to deliver the therapeutic mRNA to a cell. Certain embodiments provide a method for delivering therapeutic protein to a cell in vivo, comprising administering to a subject a complex described here to deliver the therapeutic mRNA to a cell, which therapeutic mRNA is translated to the therapeutic protein. In certain embodiments, the method is accomplished with the proviso that the administration is accomplished without the use of nanoparticles, e.g, lipid nanoparticles (e.g., the complex is not encapsulated in lipid nanoparticle for delivery). Certain embodiments provide a method for designing the synthetic oligonucleotides to prepare the complex for a target mRNA of interest. Reference will now be made in detail to certain embodiments of the invention, examples of which are illustrated in the accompanying structures and formulas. While the invention will be described in conjunction with the enumerated embodiments, it will be understood that they are not intended to limit the invention to those embodiments. On the contrary, the invention is intended to cover all alternatives, modifications, and equivalents, which may be included within the scope of the invention as defined by the claims. One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. The invention is in no way limited to the methods and materials described. Delivery of mRNA is a longstanding problem in the therapeutic RNA space. Currently, few technologies exist to specifically deliver mRNA to desired cell-types and / or tissues for expression of therapeutic proteins. Nanoparticles can be used to encapsulate mRNA, which allows for protection of the mRNA from serum nucleases. These nanoparticles (generally lipid nanoparticles, or LNPs) can interact with ApoE (a serum protein), which binds to the surface of the nanoparticle. ApoE also interacts with the liver-expressed LDLR receptor, which results in recruitment of the ApoE-LNP-mRNA complexes to the liver for subsequent endocytosis. These are typically targeted to the liver, and it can be difficult to re-target the delivery to specifically target other cell-types and tissues. Conjugating targeting moi eties to an LNP (e.g., GalNAc or antibodies on the surface of an LNP), modifying the lipid structure to alter the properties of the LNP, and introducing alternate nanomaterials (such as cationic monomers) to function distinctly from LNPs have been investigated as means for targeted delivery. Additionally, others have attempted to engineer viral delivery of nucleic acid cargo. This involves generating virus-like particles (VLPs) that express some viral proteins but have been engineered to also encapsulate a therapeutic (or otherwise desirable) nucleic acid cargo. However, improved targeting and delivery of mRNA is still needed. The technologies described herein provide an improvement over current technologies for a variety of reasons, including the following. Immunogenicity: Lipid nanoparticles are themselves immunogenic, which may limit their tolerability in certain applications (e.g., in re-dose LNP-mRNA therapeutics). Viral-like systems are generally limited to single dose applications due to immune recognition of a previously exposed antigen (i.e., the immune system can recognize surface receptors on the VLP, which results in antibodies that bind and neutralize the VLP upon the second dose of the VLP). The RNA technologies disclosed herein can be significantly less immunogenic than LNPs and VLPs. Such RNA, as described herein, can be chemically modified to reduce or prevent immune detection (e.g., with Nlm-pseudouridine on the mRNA and / or modifications to the ribose 2’-OH on the oligonucleotide), which allows for better re-dosing and tolerability. Manufacturing: Generating LNP with mRNA requires additional manufacturing overhead and steps. LNP size, composition and homogeneity must be controlled and checked by analytical methods. Viral-like delivery methods are generally produced by expressing the desired components in a human cell. This leads to issues with (1) specificity: it must be ensured that only the desired therapeutic cargo is present in the virus-like particle and, (2) scaling: it is difficult and costly to culture large volumes of human cells for VLP production. The technology described herein involves two components that are relatively inexpensive and can be manufactured by simple, established workflows: mRNA that is generated by in vitro transcription, and the oligonucleotides described herein that are generated by chemical synthesis. Once generated, the mRNA and oligonucleotides are annealed, purified and can be administered. Durability: Even for liver-targeting mRNA applications, mRNA delivered using the technologies described herein, e.g., using GalNAc, may be more durable than LNP delivery due to the stabilization imparted by the current technology (e.g., by providing some stability in endosomes that may allow for slow release into the cytoplasm over time) and / or due to the distinct endocytosis mechanism of GalNAc conjugates (as observed for therapeutic siRNAs). Subcutaneous administration: mRNA-LNPs delivered by subcutaneous administration can be inefficient and have adverse reactions, and instead are generally administered by intravenous infusions. The reason for this is not entirely clear, but it is thought that the large size of the LNP (generally about 100 nm in diameter) limits the LNP’s ability to penetrate cellular barriers that is necessary for subcutaneous injection. The only approved siRNA drug that utilizes LNPs is administered by IV infusion, while GalNAc-conjugated siRNAs are administered by subcutaneous administration. RNA delivery using the technologies described herein through subcutaneous administration represents an advantage over current LNP and VLP delivery systems (e.g., in terms of easier re-dosing and less invasiveness). Thus, the current technologies described herein provide improvements over current therapeutic mRNA delivery methods, e.g., those relying on encapsulating mRNA in nanoparticles (e.g., lipid nanoparticles, polymer nanoparticles, CARTs (charge-altering releasable transporters), dendrimers, hydrophilic nanoparticles, etc.). The current technologies described herein also provide improvements over conjugate-mediated methods (e.g., over GalNAc, Cl6, antibody fragments) that are chemically conjugated to the small RNA. An “effective amount” or “therapeutically effective amount” of an active agent or therapeutic agent such as a complex described herein is an amount sufficient to produce the desired effect, e.g., an increase of expression of a target protein in comparison to the normal expression level detected in the absence relative to the control is about 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, or 0%. Suitable assays for measuring expression of a target gene or target sequence include, e.g., examination of protein or RNA levels using techniques known to those of skill in the art such as dot blots, northern blots, in situ hybridization, ELISA, immunoprecipitation, enzyme function, as well as phenotypic assays known to those of skill in the art. “Substantial identity” refers to a sequence that hybridizes to a reference sequence under stringent conditions, or to a sequence that has a specified percent identity over a specified region of a reference sequence. The phrase “stringent hybridization conditions” refers to conditions under which a nucleic acid will hybridize to its target sequence, typically in a complex mixture of nucleic acids, but to no other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Probes, “Overview of principles of hybridization and the strategy of nucleic acid assays” (1993). Generally, stringent conditions are selected to be about 5-10° C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH. The Tm is the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal is at least two times background, preferably 10 times background hybridization. Exemplary stringent hybridization conditions can be as follows: 50% formamide, 5*SSC, and 1% SDS, incubating at 42° C., or, 5*SSC, 1% SDS, incubating at 65° C., with wash in 0.2*SSC, and 0.1% SDS at 65° C. For PCR, a temperature of about 36° C. is typical for low stringency amplification, although annealing temperatures may vary between about 32° C. and 48° C. depending on primer length. For high stringency PCR amplification, a temperature of about 62° C. is typical, although high stringency annealing temperatures can range from about 50° C. to about 65° C., depending on the primer length and specificity. Typical cycle conditions for both high and low stringency amplifications include a denaturation phase of 90° C.-95° C. for 30 sec.-2 min., an annealing phase lasting 30 sec.-2 min., and an extension phase of about 72° C. for 1-2 min. Protocols and guidelines for low and high stringency amplification reactions are provided, e.g., in Innis et al., PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc. N.Y. (1990). Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides which they encode are substantially identical. This occurs, for example, when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code. In such cases, the nucleic acids typically hybridize under moderately stringent hybridization conditions. Exemplary “moderately stringent hybridization conditions” include a hybridization in a buffer of 40% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 1 *SSC at 45° C. A positive hybridization is at least twice background. Those of ordinary skill will readily recognize that alternative hybridization and wash conditions can be utilized to provide conditions of similar stringency. Additional guidelines for determining hybridization parameters are provided in numerous references, e.g., Current Protocols in Molecular Biology, Ausubel et al., eds. The terms “substantially identical” or “substantial identity,” in the context of two or more nucleic acids, refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides that are the same (i.e., at least about 60%, preferably at least about 65%, 70%, 75%, 80%, 85%, 90%, or 95% identity over a specified region), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection. This definition, when the context indicates, also refers analogously to the complement of a sequence. Preferably, the substantial identity exists over a region that is at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 nucleotides in length. For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters. A “comparison window,” as used herein, includes reference to a segment of any one of a number of contiguous positions selected from the group consisting of from about 5 to about 60, usually about 10 to about 45, more usually about 15 to about 30, in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman, Adv. AppL Math., 2:482 (1981), by the homology alignment algorithm of Needleman and Wunsch, J. Mol. BioL, 48:443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci. USA, 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by manual alignment and visual inspection (see, e.g., Current Protocols in Molecular Biology, Ausubel et al., eds. (1995 supplement)). A preferred example of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., Nuc. Acids Res., 25:3389-3402 (1977) and Altschul et al., J. Mol. Biol., 215:403-410 (1990), respectively. BLAST and BLAST 2.0 are used, with the parameters described herein, to determine percent sequence identity for the nucleic acids of the invention. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / ). The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul, Proc. Natl. Acad. Sci. USA, 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001. The terms “treat”, “treatment”, or “treating” to the extent it relates to a disease or condition includes inhibiting the disease or condition, eliminating the disease or condition, and / or relieving one or more symptoms of the disease or condition. The terms “treat”, “treatment”, or “treating” also refer to both therapeutic treatment and / or prophylactic treatment or preventative measures, wherein the object is to prevent or slow down (lessen) an undesired physiological change or disorder, such as, for example, the development or spread of cancer. For example, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease or disorder, stabilized (i.e., not worsening) state of disease or disorder, delay or slowing of disease progression, amelioration or palliation of the disease state or disorder, and remission (whether partial or total), whether detectable or undetectable. “Treat”, “treatment”, or “treating,” can also mean prolonging survival as compared to expected survival if not receiving treatment. Those in need of treatment include those already with the disease or disorder as well as those prone to have the disease or disorder or those in which the disease or disorder is to be prevented. In one embodiment “treat”, “treatment”, or “treating” does not include preventing or prevention, The phrase "therapeutically effective amount" or “effective amount” includes but is not limited to an amount of mRNA complex described herein that (i) treats or prevents the particular disease, condition, or disorder, (ii) attenuates, ameliorates, or eliminates one or more symptoms of the particular disease, condition, or disorder, or (iii) prevents or delays the onset of one or more symptoms of the particular disease, condition, or disorder described herein. The term “mammal” as used herein refers to humans, higher non-human primates, rodents, domestic, cows, horses, pigs, sheep, dogs and cats. In one embodiment, the mammal is a human. The term “patient” as used herein refers to any animal including mammals. In one embodiment, the patient is a mammalian patient. In one embodiment, the patient is a human patient. The pharmaceutical compositions of the invention can comprise one or more excipients. When used in combination with the pharmaceutical compositions of the invention the term “excipients” refers generally to an additional ingredient to provide a corresponding composition. For example, when used in combination with the pharmaceutical compositions of the invention the term “excipients” includes, but is not limited to: carriers, binders, disintegrating agents, lubricants, sweetening agents, flavoring agents, coatings, preservatives, and dyes. The active compound may also be administered intravenously or intraperitoneally by infusion or injection. Solutions of the active compound or its salts can be prepared in water, optionally mixed with a nontoxic surfactant. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, triacetin, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. The pharmaceutical dosage forms suitable for injection or infusion can include sterile aqueous solutions or dispersions or sterile powders comprising the active ingredient which are adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes. In all cases, the ultimate dosage form should be sterile, fluid and stable under the conditions of manufacture and storage. The liquid carrier or vehicle can be a solvent or liquid dispersion medium comprising, for example, water, ethanol, a polyol (for example, glycerol, propylene glycol, liquid polyethylene glycols, and the like), vegetable oils, nontoxic glyceryl esters, and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions or by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, buffers or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin. Sterile injectable solutions are prepared by incorporating the active compound in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filter sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze drying techniques, which yield a powder of the active ingredient plus any additional desired ingredient present in the previously sterile-filtered solutions. Useful solid carriers include finely divided solids such as talc, clay, microcrystalline cellulose, silica, alumina and the like. Useful liquid carriers include water, alcohols or glycols or water-alcohol / glycol blends, in which the present compounds can be dissolved or dispersed at effective levels, optionally with the aid of non-toxic surfactants. Adjuvants such as fragrances and additional antimicrobial agents can be added to optimize the properties for a given use. The resultant liquid compositions can be applied from absorbent pads, used to impregnate bandages and other dressings, or sprayed onto the affected area using pump-type or aerosol sprayers. Thickeners such as synthetic polymers, fatty acids, fatty acid salts and esters, fatty alcohols, modified celluloses or modified mineral materials can also be employed with liquid carriers to form spreadable pastes, gels, ointments, soaps, and the like, for application directly to the skin of the user. Useful dosages of the compounds can be determined by comparing their in vitro activity, and in vivo activity in animal models. Methods for the extrapolation of effective dosages in mice, and other animals, to humans are known to the art; for example, see U.S. Pat. No. 4,938,949. The desired dose may conveniently be presented in a single dose or as divided doses administered at appropriate intervals, for example, as two, three, four or more sub-doses per day. The sub-dose itself may be further divided, e.g., into a number of discrete loosely spaced administrations; such as multiple inhalations from an insufflator or by application of a plurality of drops into the eye. An administration route may be made using any therapeutically effective means, including injection, and including intrathecal, intraparenchymal, intracerebroventricular, intramuscular, intravenous, intravitreal, intranasal and subcutaneous. For a selected mRNA sequence, synthetic oligonucleotides are designed against the mRNA sequence by identifying reverse-complement sequences that meet the following criteria: (1) bind to a desired set of nucleotides within the mRNA sequence (based on complementarity); (2) fall within a desired length range (e.g., 15-25 nucleotides); (3) have a predicted melting temperature within a desired range (e.g., 50-65 degrees Celsius); and (4) have a limited number of potential off-target binding sites within the mRNA sequence (based on number of mismatches). When a collection of synthetic oligonucleotides is being designed to simultaneously bind to an mRNA, an additional spatial constraint is imposed to achieve the desired spacing between adjacent synthetic oligonucleotides (e.g., 0 nucleotides between adjacent synthetic oligonucleotides for ‘fully complexed’ mRNA). In addition to the reversecomplement sequence, there can be additional sequence in the synthetic oligonucleotide that will intentionally not hybridize to the mRNA. For 2’-OH-containing synthetic oligonucleotides, the reverse complement sequence was composed of A, C, G, and U nucleotides. For 2’-0Me-containing synthetic oligonucleotides, the reverse complement sequence was composed of A, C, G, and U nucleotides. For 2’-MOE-containing synthetic oligonucleotides, the reverse complement sequence was composed of A, mC, G, and T nucleotides. Targeting moi eties are selected based on their propensity to bind a specific cell-surface receptor on a desired cell type (e.g., GalNAc binding to ASPGR on hepatocytes) or due to their general increased cellular uptake when delivered locally (e.g., C16 promoting uptake in the CNS). Targeting moieties were conjugated to the synthetic oligonucleotides at the 5’-end, 3’-end, or internal positions. For example, some synthetic oligonucleotides contain a 5’-GalNAc or a 5’-C16 moiety, and some contain an internal C16 moiety that is conjugated to the 2’-OH of an internal nucleotide. The placement of the targeting moiety is chosen based on ease of synthesis, consideration of its accessibility to the target receptor when the oligonucleotide is bound to the mRNA, and in some cases, avoiding interference with the cellular translation machinery. A ‘fully complexed’ mRNA refers to an mRNA that is maximally base paired with synthetic oligonucleotides (e.g., >80%; e.g., 85%-100%, e.g., 90%-100%, e.g., 95%-100%, e.g., 95% e.g., 96% e.g., 97% e.g., 98% e.g., 99%, e.g., 100%). Certain regions of the mRNA (e.g., homopolymers and low-complexity regions) may not be able to accurately base pair with synthetic oligonucleotides. For example, the repetitive nature of the poly(A) tail makes it difficult to precisely control the binding of synthetic oligonucleotides and maintain the register necessary for complete binding. These regions are not necessarily included when reference is made to an mRNA that is ‘fully complexed’. The invention will now be illustrated by the following non-limiting Examples. EXAMPLES Certain embodiments of the invention provide complexes and methods that can be used to express mRNA in a living cell (e.g., cells within a human body, e.g., in specific organs or cells within a human body). The mRNA molecules encode one or more polypeptides to be expressed within the living cells. In some embodiments, the polypeptides are to be expressed within a diseased organism (e.g., mammal, such as a human being), and expression of the polypeptide ameliorates one or more symptoms of a disease. The complexes and methods are useful for treating human diseases caused by the absence, or reduced levels, of a functional polypeptide within the human body. Generally, mRNA encoding a therapeutic protein will be synthesized from in vitro transcription using standard methods and can include a m7G-cap, a 5’UTR, a coding sequence, a 3’UTR and a poly(A) tail. Some of these components (e.g., 5’ or 3’UTR) may be chemically synthesized and ligated onto the rest of the mRNA molecule, e.g., to include stabilizing chemical modifications such as phosphorothioate linkages and / or 2'-OH modifications (e.g., 2’-OMe, 2’-F). The 3’UTR and / or poly(A) tail may not be required. The mRNA will optionally contain 100% uridine modification (e.g., N1 -methylpseudouridine or 5-methy oxyuri dine). The oligonucleotides described herein hybridize to a region of the mRNA. Generally, the oligonucleotides will be generated by chemical synthesis and will contain chemically modified nucleotides (e.g., 2’-0Me, 2’-M0E, and / or phosphorothioate linkages). The oligonucleotides can be about 1-200 nt in length (e.g. 40 nt to 50 nt, 50 nt to 75 nt, 75 nt to 100 nt, 100 nt to 125 nt, 125 nt to 150 nt, 150 nt to 175 nt, or 175 nt to 200 nt in length), and there will be at least one designed oligonucleotide for an mRNA molecule (although likely many more contemplated to be used); in certain embodiments, the mRNA molecule may be fully (e.g, 100%) hybridized to the oligonucleotide, leaving minimal to no single stranded region(s). Oligonucleotides that hybridize to a specific sequence on the mRNA will generally have greater than 50% sequence complementary to the given sequence on the mRNA (e.g, there could be intentional gaps or mismatches to limit immunogenicity and weaken the hybridization strength to promote reversibility). At least some of these oligonucleotides may be conjugated to targeting moieties to allow for specific delivery of the oligonucleotide and mRNA complex to desired cell types (e.g., at least one of the oligonucleotides hybridized to the mRNA will include a targeting moiety, but it could be all of them). An oligonucleotide could, in certain embodiments, be conjugated to 0, 1, or 2 targeting moieties (e.g., by using the 5’ and 3’ ends for conjugation). Additional targeting moieties on an oligonucleotide are possible if internal modifications are utilized. The oligonucleotides will optionally contain 100% uridine modification (e.g., Nl-methylpseudouridine or 5-methyoxyuridine). The synthetic oligonucleotides may comprise modifications to the 2’-OH (e.g., 2’-0Me, 2’-MOE, 2’-F). The synthetic oligonucleotides may comprise modifications to the phosphodiester backbone (e.g., phosphorothioate linkages). Targeting moieties: The targeting moiety may be a sugar (e.g., GalNAc), a small molecule (e.g., Cl6), a peptide, an antibody (e.g, IgG), an antibody fragment (e.g., Fab), a nanobody / miniprotein (e.g., VHH, svFv), an anti-CD5 antibody, or a nucleic acid. Generally, the targeting moiety will bind to specific receptors on a given cell type to allow for internalization of the cargo. They may also bind non-specifically to membranes, but still allow for internalization through unknown mechanisms. For example, C16 conjugates allow for internalization of small RNAs in the lung, eye, and the CNS. C16 allows for non-specific uptake of nucleic acid but the specificity is imparted by local administration of the RNA to the location of interest (e.g., inhaled into the lung, injected into the eye, or injected into the cerebrospinal fluid). Targeting moieties may be naturally occurring or engineered. Alternative or additional modes of stabilization: In certain embodiments, and in certain embodiments ideally, the entire mRNA will not be covered with oligonucleotides. In certain embodiments, the entire mRNA or substantially the entire mRNA is complexed with oligonucleotides. Regions of the mRNA may be stabilized with the use of the oligonucleotides described herein, and other methods including: Engineering structure into the mRNA itself: e.g., by designing hairpins or using LinearDesign-type approaches to maximize overall secondary structure, (see, e.g, Zhang et al., Nature, 621, 396-403 (2023)) In one example, a 3’UTR that is complementary to the entire coding sequence (with sufficient mismatches to avoid dsRNA sensors) may be designed; Irreversible chemical modifications: including phosphorothioate linkages and / or 2'-OH modifications (2’-0Me, 2’-F); Reversible chemical modifications: There are examples of 2’-OH modifications that are chemically reversible, and the use of these are envisioned, which can be reversed in the biofluid, endosome, and / or cytoplasm; and / or Sequence engineering: Certain sequence motifs of the mRNA may be more or less prone to degradation by nucleases in biofluids, endosomes, and / or the cytoplasm. The following table provides certain sequences referred to in the application. Name Sequence 5' -3' Modification HiBiT AGGAGACUUGCCACCAUGGUGAGCGGCU GGCGGCUGUUCAAGAAGAUUAGCUAGAA AAAAAAAACAAAAAAAAAA Nl- Methyipseudouridine Flue[opt] AGGAGAAAUAAACUAGUAUUCUUCUGGU C C C CACAGACUCAGAGAGAAC C C GC GAG CAUGGAAGAUGCCAAAAACAUUAAGAAG GGGCCAGCGCCAUUCUACCCACUCGAAG ACGGGACCGCAGGAGAGCAGCUGCACAA AGCCAUGAAGAGAUACGCACUGGUGCCU GGCACUAUCGCCUUUACCGACGCACAUA Nl- Methyipseudouridine UAGAGGUGGAUAUUACCUAUGCCGAGUA CUUUGAGAUGUCCGUUCGGCUGGCAGAA GCUAUGAAGCGCUAUGGGUUAAAUACAA AUCAUCGGAUUGUCGUGUGUAGCGAAAA UUC CUUGCAGUUCUUUAUGC C C GUC CUU GGGGCCCUCUUCAUCGGUGUGGCUGUGG C C C CAGCUAAC GACAUCUACAAC GAGC G UGAGCUGCUGAACUCUAUGGGAAUCAGC CAGCCUACCGUCGUAUUUGUGAGCAAGA AAGGGCUGCAAAAGAUCCUCAAUGUUCA GAAGAAACUAC C GAUCAUACAGAAGAUA AUUAUCAUGGAUUC CAAAAC C GACUAC C AGGGCUUCCAGUCAAUGUAUACCUUCGU GACUUC C CAUUUGC GAG CUGGCUUUAAU GAGUACGAUUUUGUGCCUGAAUCGUUCG AUG GGGAUAAAACUAUUG C C CUGAUCAU GAACAGUUCUGGAAGUACUGGAUUGCCC AAGGGCGUAGCACUUCCGCAUCGAACUG CUUGUGUCCGAUUCAGUCAUGCUAGAGA UCCCAUCUUCGGCAACCAGAUUAUUCCU GAUACCGCUAUACUCUCAGUCGUUCCAU UUCAUCACGGAUUCGGCAUGUUCACGAC GCUGGGCUACUUGAUCUGCGGCUUUAGG GUCGUGCUCAUGUACAGGUUUGAGGAGG AGCUAUUCUUAAGGUCCUUGCAAGACUA UAAGAUUCAAUCUGCCCUGCUGGUGCCC ACACUUUUUAGCUUUUUUGCUAAGUCUA CUCUCAUUGACAAAUAUGACCUAUCCAA CUUACACGAGAUAGCCAGCGGAGGGGCG CCGCUCUCUAAAGAGGUAGGUGAGGCCG UGGCGAAAAGGUUUCACCUUCCAGGAAU ACGCCAGGGGUACGGGCUGACAGAAACA ACAUCAGC CAUUCUGAUCAC C C C C GAAG GGGACGACAAACCUGGCGCAGUAGGCAA GGUGGUGCCCUUCUUCGAGGCUAAGGUG GUGGAUUUGGAUACCGGUAAAACACUGG GUGUGAAUCAGAGAGGGGAACUGUGCGU CCGUGGACCCAUGAUCAUGUCAGGCUAU GUUAACAAUCCCGAGGCUACAAAUGCUC UCAUCGACAAGGACGGCUGGCUGCACUC GGGAGACAUUGCAUAUUGGGACGAAGAU GAGCACUUCUUCAUAGUCGAUCGGCUGA AGAGUUUAAUCAAAUACAAGGGCUACCA GGUAGCACCAGCUGAACUUGAGAGCAUC CUUCUUCAACAC C C CAACAUUUUC GAG G CAGGGGUCGCGGGACUGCCUGACGAUGA UGCCGGCGAACUGCCUGCCGCAGUCGUC GUGCUCGAACACGGUAAAACUAUGACGG AGAAGGAAAUCGUGGACUAUGUGGCCAG CCAGGUUACAACCGCCAAGAAGCUGCGC GGUGGUGUUGUGUUUGUUGAUGAGGUUC CUAAAGGACUGACCGGCAAAUUGGACGC GCGCAAGAUCAGAGAAAUUCUCAUUAAG GCCAAAAAAGGCGGAAAGAUCGCCGUGU GAUGAGCUGGAGCCUCGGUGGCCUAGCU UCUUGCCCCUUGGGCCUCCCCCCAGCCC CUCCUCCCCUUCCUGCACCCGUACCCCC GUGGUCUUUGAAUAAAGUCUGAGUGGGC GGCA Flue[opt2] AGGAGAAAUAAACUAGUAUUCUUCUGGU C C C CACAGACUCAGAGAGAAC C C GC GAG CAUGGAGGACGCCAAGAACAUCAAGAAG GGCCCCGCCCCCUUCUACCCCCUGGAGG ACGGCACCGCCGGCGAGCAGCUGCACAA GGCCAUGAAGCGGUACGCCCUGGUGCCC GGCACCAUCGCCUUCACCGACGCCCACA UCGAGGUGGACAUCACCUACGCCGAGUA CUUCGAGAUGAGCGUGCGGCUGGCCGAG GCCAUGAAGCGGUACGGCCUGAACACCA ACCACCGGAUCGUGGUGUGCAGCGAGAA CAGCCUGCAGUUCUUCAUGCCCGUGCUG GGCGCCCUGUUCAUCGGCGUGGCCGUGG CCCCCGCCAACGAGAUCUACAACGAGCG GGAGCUGCUGAACAGCAUGGGCAUCAGC CAGCCCACCGUGGUGUUCGUGAGCAAGA AGGGCCUGCAGAAGAUCCUGAACGUGCA GAAGAAGCUGCCCAUCAUCCAGAAGAUC AUCAUCAUGGACAGCAAGAC C GACUAC C AGGGCUUCCAGAGCAUGUACACCUUCGU GACCAGCCACCUGCCCCCCGGCUUCAAC GAGUACGACUUCGUGCCCGAGAGCUUCG ACCGGGACAAGACCAUCGCCCUGAUCAU GAACAGCAGCGGCAGCACCGGCCUGCCC AAGGGCGUGGCCCUGCCCCACCGGACCG CCUGCGUGCGGUUCAGCCACGCCCGGGA CCCCAUCUUCGGCAACCAGAUCAUCCCC GACACCGCCAUCCUGAGCGUGGUGCCCU UCCACCACGGCUUCGGCAUGUUCACCAC CCUGGGCUACCUGAUCUGCGGCUUCCGG GUGGUGCUGAUGUACCGGUUCGAGGAGG AGCUGUUCCUGCGGAGCCUGCAGGACUA CAAGAUCCAGAGCGCCCUGCUGGUGCCC ACCCUGUUCAGCUUCUUCGCCAAGAGCA CCCUGAUCGACAAGUACGAGCUGAGCAA CCUGCACGAGAUCGCCAGCGGCGGCGCC CCCCUGAGCAAGGAGGUGGGCGAGGCCG UGGCCAAGCGGUUCCACCUGCCCGGCAU CCGGCAGGGCUACGGCCUGACCGAGACC ACCAGCGCCAUCCUGAUCACCCCCGAGG GCGACGACAAGCCCGGCGCCGUGGGCAA GGUGGUGCCCUUCUUCGAGGCCAAGGUG GUGGACCUGGACACCGGCAAGACCCUGG GCGUGAACCAGCGGGGCGAGCUGUGCGU GCGGGGCCCCAUGAUCAUGAGCGGCUAC Nl- MethyIpseudouridine GUGAACAACCCCGAGGCCACCAACGCCC UGAUCGACAAGGACGGCUGGCUGCACAG CGGCGACAUCGCCUACUGGGACGAGGAC GAGCACUUCUUCAUCGUGGACCGGCUGA AGucCCUGAUCAAGUACAAGGGCUACGA GGUGGCCCCCGCCGAGCUGGAGAGCAUC CUGCUGCAGCAC C C CAACAUCUUC GAG G CCGGCGUGGCCGGCCUGCCCGACGACGA CGCCGGCGAGCUGCCCGCCGCCGUGGUG GUGCUGGAGCACGGCAAGACCAUGACCG AGAAGGAGAUCGUGGACUACGUGGCCAG CCAGGUGACCACCGCCAAGAAGCUGCGG GGCGGCGUGGUGUUCGUGGACGAGGUGC CCAAGGGCCUGACCGGCAAGCUGGACGC CCGGAAGAUCCGGGAGAUCCUGAUCAAG GCCAAGAAGGGCGGCAAGAUCGCCGUGU GAUGAGCUGGAGCCUCGGUGGCCUAGCU UCUUGCCCCUUGGGCCUCCCCCCAGCCC CUCCUCCCCUUCCUGCACCCGUACCCCC GUGGUCUUUGAAUAAAGUCUGAGUGGGC GGCAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAA SecNanoLuc AGGAGAAAUAAACUAGUAUUCUUCUGGU C C C CACAGACUCAGAGAGAAC C C GC GAG CAUGAACAGCUUCAGCACCAGCGCCUUC GGCCCCGUGGCCUUCAGCCUGGGCCUGC UGCUGGUGCUGCCCGCCGCCUUCCCCGC CCCCGUGUUCACCCUGGAGGACUUCGUG GGCGACUGGCGGCAGACCGCCGGCUACA ACCUGGACCAGGUGCUGGAGCAGGGCGG CGUGAGCAGCCUGUUCCAGAACCUGGGC GUGAGCGUGACCCCCAUCCAGCGGAUCG UGCUGAGCGGCGAGAACGGCCUGAAGAU C GACAUC GAG GUGAUCAUC C C CUAC GAG GGCCUGAGCGGCGACCAGAUGGGCCAGA UCGAGAAGAUCUUCAAGGUGGUGUACCC CGUGGACGACCACCACUUCAAGGUGAUC CUGCACUACGGCACCCUGGUGAUCGACG GCGUGACCCCCAACAUGAUCGACUACUU CGGCCGGCCCUACGAGGGCAUCGCCGUG UUC GAG GGCAAGAAGAUCAC C GUGAC C G GCACCCUGUGGAACGGCAACAAGAUCAU CGACGAGCGGCUGAUCAACCCCGACGGC AGCCUGCUGUUCCGGGUGACCAUCAACG GCGUGACCGGCUGGCGGCUGUGCGAGCG GAUCCUGGCCUGAUGAGCUGGAGCCUCG GUGGCCUAGCUUCUUGCCCCUUGGGCCU CCCCCCAGCCCCUCCUCCCCUUCCUGCA CCCGUACCCCCGUGGUCUUUGAAUAAAG Nl- MethyIpseudouridine UCUGAGUGGGCGGCAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAA TWWWWWWWWWWWWWkA AAAAAAAAAAAAAAAAAAAAAAA P0OO1 GGUGGCAAGUCUCCU RNA PO002 CCAGCCGCUCACCAU RNA PO003 CUUCUUGAACAGCCG RNA PO004 UUUUUUUUUUGUUUUUUUUUUCUAGCUA AU RNA PO006 GGUGGCAAGUCUCCU 2'-OMe PO007 CCAGCCGCUCACCAU 2'-OMe PO008 CUUCUUGAACAGCCG 2'-OMe PO009 UUUUUUUUUUGUUUUUUUUUUCUAGCUA AU 2'-OMe POOH GGTGGCAAGTCTCCT 2'-MOE PO012 CCAGCCGCTCACCAT 2'-MOE PO013 CTTCTTGAACAGCCG 2'-MOE PO014 TTTTTTTTTTGTTTTTTTTTTCTAGCTA AT 2'-MOE PO064 GGTGGCGGGTTCTCT 2'-MOE PO065 CCAGAAGAATACT 2'-MOE POO 6 6 AGTTTATTTCTCCT 2'-MOE PO067 CTGAGTCTGTGGGGA 2'-MOE PO075 CACCGAGGCTCCAGCTCA 2'-MOE PO076 GGCAAGAAGCTAGGC 2'-MOE PO077 GGGGGAGGCCCAAGG 2'-MOE PO078 GGGGAGGAGGGGCTG 2'-MOE PO079 GTACGGGTGCAGGAA 2'-MOE PO080 TATTCAAAGACCACGGGG 2'-MOE PO081 TGCCGCCCACTCAGACTT 2'-MOE PO2 8 0 CCCCTTCTTAATGTTTTTGGCATCTTCC AT 2'-MOE PO2 81 GTGGGTAGAATGGCGCTGG 2'-MOE PO282 CCTGCGGTCCCGTCTTCGA 2'-MOE PO283 GCTTTGTGCAGCTGCTCT 2'-MOE PO284 CACCAGTGCGTATCTCTTCATG 2'-MOE PO285 CGGTAAAGGCGATAGTGCCAGG 2'-MOE PO2 8 6 ATAGGTAATATC CAC CTCTATATGTGCG T 2'-MOE PO287 ACGGACATCTCAAAGTACTCGGC 2'-MOE PO2 8 8 TTCATAGCTTCTGCCAGCCGA 2'-MOE PO2 8 9 C AAT CCGATGATTTGTATT T AAC C CATA GCGC 2'-MOE PO290 TGCAAGGAATTTTCGCTACACACGA 2'-MOE PO291 CCAAGGACGGGCATAAAGAAC 2'-MOE PO292 ACACCGATGAAGAGGGCC 2'-MOE PO293 TTAGCTGGGGCCACAGCC 2'-MOE PO294 AGCTCACGCTCGTTGTAGATGTCG 2'-MOE PO295 CTGGCTGATTCCCATAGAGTTCAGC 2'-MOE PO296 TGCTCACAAATACGACGGTAGG 2'-MOE PO297 GAACATTGAGGATCTTTTGCAGCCCTTT CT 2'-MOE PO298 AATTATCTTCTGTATGATCGGTAGTTTC TTCT 2'-MOE PO299 CTGGTAGTCGGTTTTGGAATCCATGAT 2'-MOE PO300 AAGGTATACATTGAGTGGAAGCC 2'-MOE PO301 AGGTGGCAAATGGGAAGTCACG 2'-MOE PO302 AAC GATT GAG G CACAAAAT C G TAC T CAT TAAAGCC 2'-MOE PO303 TGATCAGGGCAATAGTTTTATCCCGATC G 2'-MOE PO304 CAAT C CAG TAC T T C CAGAACT GT T CA 2'-MOE PO305 AAGTGCTACGCCCTTGGG 2'-MOE PO306 ACACAAGCAGTTCGATGCGG 2'-MOE PO307 AAGATGGGATCTCTAGCATGACTGAATC GG 2'-MOE PO308 GCGGTATCAGGAATAATCTGGTTGCCG 2'-MOE PO309 G T GAT GAAAT G GAAC GAC T GAGAG TATA 2'-MOE PO310 AGCGTCGTGAACATGCCGAATCC 2'-MOE P0311 AGCCGCAGATCAAGTAGCCC 2'-MOE PO312 AAACC T GTAGAT GAGCAC GACCC TAA 2'-MOE PO313 GGACCTTAAGAATAGCTCCTCCTC 2'-MOE PO314 CAGCAGGGCAGATTGAATCTTATAGTCT TGCAA 2'-MOE PO315 TAGAC T TAG CAAAAAAGC TAAAAAGT GT GGGCAC 2'-MOE PO316 GTTGGATAGGTCATATTTGT CAAT GAGA G 2'-MOE PO317 CCTCCGCTGGCTATCTCGTGTAA 2'-MOE PO318 TACCTCTTTAGAGAGCGGCGCC 2'-MOE PO319 TTTTCGCCACGGCCTCACC 2'-MOE PO320 GCGTATTCCTGGAAGGTGAAACC 2'-MOE PO321 TTTCTGTCAGCCCGTACCCCTG 2'-MOE PO322 GGGGGTGATCAGAATGGCTGATGTTG 2'-MOE PO323 CGCCAGGTTTGTCGTCCCCTTC 2'-MOE PO324 AAGGGCACCACCTTGCCTACTG 2'-MOE PO325 TATCCAAATCCACCACCTTAGCCTCGAA G 2'-MOE PO326 ATTCACACCCAGTGTTTTACCGG 2'-MOE PO327 ACGCACAGTTCCCCTCTCTG 2'-MOE PO328 TGACATGATCATGGGTCCACGG 2'-MOE PO329 GTAGCCTCGGGATTGTTAACATAGCC 2'-MOE PO330 AGCCGTCCTTGTCGATGAGAGCATTT 2'-MOE PO331 ATATGCAATGTCTCCCGAGTGCAGCC 2'-MOE PO332 ATGAAGAAGTGCTCATCTTCGTCCCA 2'-MOE PO333 CTTGTATTTGATTAAACTCTTCAGCCGA TCGACT 2'-MOE PO334 TGGTGCTACCTGGTAGCC 2'-MOE PO335 AAGAAGGATGCTCTCAAGTTCAGC 2'-MOE PO336 CCTGCGTCGAAAATGTTGGGGTGTTG 2'-MOE PO337 TCAGGCAGTCCCGCGACC 2'-MOE PO338 AGTTCGCCGGCATCATCG 2'-MOE PO339 ACGACGACTGCGGCAGGC 2'-MOE PO340 GTCATAGTTTTACCGTGTTCGAGC 2'-MOE PO341 ACATAGTCCACGATTTCCTTCTCC 2'-MOE PO342 CGGTTGTAACCTGGCTGGCC 2'-MOE PO343 ACCACCGCGCAGCTTCTTGG 2'-MOE PO344 AG T C C T T TAGGAACC T CAT CAACAAACA CAAG 2'-MOE PO345 CGCGTCCAATTTGCCGGTC 2'-MOE PO346 tttttggccttaatgagaatttctctga TCTTGCG 2'-MOE PO347 TCACACGGCGATCTTTCCGCCT 2'-MOE PO374 AAGTACTCGGCGTAGGTGAT 2'-MOE, internal C16 PO375 CTGTTCTCGCTGCACACCAC 2'-MOE, internal C16 PO376 AGGCCCTTCTTGCTCACGAA 2'-MOE, internal C16 PO377 GTGTACATGCTCTGGAAGCC 2'-MOE, internal C16 PO378 GAACCGGTACATCAGCACCA 2'-MOE, internal C16 PO379 AGGGTGCTCTTGGCGAAGAA 2'-MOE, internal C16 PO380 ACGATGAAGAAGTGCTCGTC 2'-MOE, internal C16 PO381 CGAAGATGTTGGGGTGCTGC 2'-MOE, internal C16 PO382 GTAGTCCACGATCTCCTTCT 2'-MOE, internal C16 PO082 GGCAAGAAGCUAGGC 2'-0Me, 5' GalNAc PO083 GGGGAGGAGGGGCUG 2'-0Me, 5' GalNAc PO084 UAUUCAAAGACCACGGGG 2'-0Me, 5' GalNAc PO088 CUCAGCACGAUCCGCUGGAU 2'-0Me, 5' GalNAc PO090 CGGCCGAAGUAGUCGA 2'-0Me, 5' GalNAc PO085 GGGGGAGGCCCAAGG 2'-0Me, 5' C16 PO086 GUACGGGUGCAGGAA 2'-0Me, 5' C16 PO087 UGCCGCCCACUCAGACUU 2'-0Me, 5' C16 PO089 AGGCCGUUCUCGCCG 2'-0Me, 5' C16 PO091 AUGCCCUCGUAGGGC 2'-0Me, 5' C16 PO102 CCAGGGTGAACACCAT 2'-MOE PO103 CGCCCACGAAGTCCT 2'-MOE PO104 CGGTCTGCCGCCAGT 2'-MOE PO105 CCAGGTTGTAGCCGG 2'-MOE PO106 GCTCCAGCACCTGGT 2'-MOE PO107 TGCTCACGCCGCCCT 2'-MOE PO108 CCCAGGTTCTGGAACAGGC 2'-MOE PO109 GGGGGTCACGCTCACG 2'-MOE P011O CTCAGCACGATCCGCTGGAT 2'-MOE P0111 AGGCCGTTCTCGCCG 2'-MOE PO112 ATGATCACGTGGATGTCGATCTTC 2'-MOE PO113 AGGCCCTCGTAGGGG 2'-MOE PO114 CATCTGGTCGCCGCTC 2'-MOE PO115 GAAGATCTTCTCGATCTGGCC 2'-MOE PO116 CACGGGGTACACCACCTT 2'-MOE PO117 ACCTTGAAGTGGTGGTCGTC 2'-MOE PO118 TGCCGTAGTGCAGGATC 2'-MOE PO119 CCGTCGATCACCAGGG 2'-MOE PO120 TCATGTTGGGGGTCACG 2'-MOE PO121 CGGCCGAAGTAGTCGA 2'-MOE PO122 ATGCCCTCGTAGGGC 2'-MOE PO123 TGCCGTCGAACACGGCG 2'-MOE PO124 CCGGTCACGGTGATCTTCT 2'-MOE PO125 GTTGCCGTTCCACAGGGTG 2'-MOE PO126 ATCAGCCGCTCGTCGATGATCTT 2'-MOE PO127 CTGCCGTCGGGGTTG 2'-MOE PO128 GTCACCCGGAACAGCAGG 2'-MOE PO129 CCGGTCACGCCGTTGATG 2'-MOE PO130 CTCGCACAGCCGCCAG 2'-MOE PO131 TCAGGCCAGGATCCG 2'-MOE PO349 CTGGTGCTGAAGCTGTTCAT 2'-MOE PO350 CACGGGGCCGAAGGCG 2'-MOE PO351 GCCCAGGCTGAAGGC 2'-MOE PO352 GCAGCACCAGCAGCAG 2'-MOE PO353 CGGGGAAGGCGGCGG 2'-MOE PO354 CCAGGGTGAACACGGGGG 2'-MOE Regarding the table above, it is noted that the C’s in the 2’-M0E synthetic oligonucleotides are 5mC’s. The following Examples depict certain aspects of certain embodiments of the invention wherein mRNA complexed with synthetic oligonucleotides imparts stability to a therapeutic mRNA and allows for conjugation of interchangeable targeting moieties on the oligonucleotides described herein. Example 1. Serum Stability of Complexed mRNA This study examined the effect of human serum on the integrity of naked or complexed HiBiT mRNA with ParcelOligos. HiBiT mRNA containing a 5’ Untranslated Region (UTR) inclusive of a Kozak sequence, Coding Sequence (CDS), a 33 nucleotide HiBiT tag, 3’ UTR, and a 10 nucleotide (nt) poly(A) tail. HiBiT mRNA was synthesized through in vitro transcription of template DNA encoding the HiBiT mRNA using a modified form of uracil, Nl-methyl-pseudouridine (Nlm-y) along with a co-translational 5’ Cap-1 structure (CleanCap). The resulting transcribed mRNA contains 100% Nlm-y modification containing a 5’ CleanCap. HiBiT mRNA was complexed with the following ParcelOligos: PO001-004 (unmodified RNA oligos), PO006 through PO009 (100% 2’-0Me modified oligos), or POOH through POO 14 (100% 2’-MOE modified oligos). Complexed HiBiT mRNA with ParcelOligos was placed in a refolding buffer with a final composition of 50 millimolar (mM) Tris pH 7, 1 mM Ethylenediaminetetraacetic acid (EDTA), 150 mM Sodium Chloride (NaCl). The solution containing HiBiT mRNA and ParcelOligos was heated to 95 degrees Celsius for 3 minutes, followed by a cooling phase to 25 degrees Celsius at a rate of 0.1 degrees Celsius per second. The refolded HiBiT mRNA and ParcelOligos was then mixed with human serum at a final concentration of 5 percent. The solution of 5 percent human serum with refolded HiBiT mRNA and ParcelOligos was then incubated 37 degrees Celsius for either 1, 3, 5, 7.5, or 15 minutes. To halt the reaction, 6 molar (M) Urea, 1 unit of proteinase K, and 50 mM EDTA was added to the 5 percent human serum solution containing HiBiT mRNA refolded with ParcelOligos and was heated to 50 degrees Celsius for 5 minutes. Upon quenching, the solution was mixed with glyoxal loading dye, containing Ethidium Bromide. The solution was then heated to 50 degrees Celsius for 20 minutes before loading onto a glyoxal agarose gel for separation. After electrophoretic separation, the gel was visualized using a 300 nm ultraviolet gel imager. As depicted in Fig 1, naked HiBiT mRNA was incubated with 5 percent human serum. The HiBiT mRNA rapidly begins to degrade after 1 minute of incubation and is visually undetectable after 5 minutes of incubation in 5 percent human serum. HiBiT mRNA complexed with PO001 through PO004 (unmodified RNA oligos) was partially degraded following incubation with 5 percent human serum and remains detectable and intact through at least 5 minutes of incubation. The majority of HiBiT mRNA complexed with PO006 through PO009 (100% 2’-0Me modified oligos) or POOH through PO014 (100% 2’-M0E modified oligos) remained intact after incubation with 5 percent human serum through at least 15 minutes. These results indicate that the presence and complex formed by PO006 through 009 or POOH through POO 14 protects HiBiT mRNA from degradation in human serum, in vitro. Example 2. Immunogenicity of Complexed mRNA This study examined the immunogenicity via innate immune sensing of RNA species by intracellular RNA sensors of naked or complexed HiBiT mRNA with ParcelOligos. HiBiT mRNA containing a 5’ Untranslated Region (UTR) inclusive of a Kozak sequence, Coding Sequence (CDS), a 33 nucleotide HiBiT tag, 3’ UTR, and a 10 nucleotide (nt) poly(A) tail. HiBiT mRNA was synthesized through in vitro transcription of template DNA encoding the HiBiT mRNA using a modified form of uracil, Nl-methyl-pseudouridine (Nlm-y) along with a co-translational 5’ Cap-1 structure (CleanCap). The resulting transcribed mRNA contains 100% Nlm-y modification containing a 5’ CleanCap. HiBiT mRNA was delivered either naked or complexed with the following ParcelOligos: PO001 through PO004 (unmodified RNA oligos), PO006 through PO009 (100% 2’-0Me modified oligos), or PO011 through PO014 (100% 2’-M0E modified oligos). Complexed HiBiT mRNA with ParcelOligos was placed in a refolding buffer with a final composition of 50 millimolar (mM) Tris pH 7, 1 mM Ethylenediaminetetraacetic acid (EDTA), 150 mM Sodium Chloride (NaCl). The solution containing HiBiT mRNA and ParcelOligos was heated to 95 degrees Celsius for 3 minutes, followed by a cooling phase to 25 degrees Celsius at a rate of 0.1 degrees Celsius per second. To evaluate immunogenicity, 30 nanograms (ng) of refolded HiBiT mRNA, without oligos, or in complex with indicated oligos, were transfected into the adherent A549-Dual cell line, utilizing the mRNA lipofection reagent Lipofectamine Messenger Max (LMM). Positive (unmodified immunogenic RNA) and negative (5-moU-modified mRNA) controls were included, along with a vehicle only (LMM) control. A549-Dual cells are a human lung epithelial carcinoma cell line that expresses a secreted luciferase reporter gene under the control of a fusion promoter of an interferon stimulated gene 54 (ISG54) minimal promoter fused to five interferon-stimulated response elements (ISREs). Briefly, immunogenic nucleic acids sensed by endosomal / intracellular sensors such as TLR3, RIG-I, MDA5, PKR, etc. will signal through a type I interferon (IFN) pathway, leading to a transcriptional complex (e.g. Interferon Stimulated Gene Factor 3 (ISGF3)) binding to the aforementioned fusion promoter stimulating luciferase gene transcription, which is secreted into the media. Following the transfection, supernatant from A549-Dual cells was collected 72 hours post-transfection and mixed with the Quanti-Luc reagent. The level of luminescence detected directly correlates with the relative level of IFN activation within the cell. Following 72h incubation post-transfection, the only condition which gave a positive IFN response was HiBiT mRNA complexed to PO001 through PO004 (unmodified RNA) (Fig. 2). Naked HiBiT mRNA or HiBiT mRNA complexed to PO006 through PO09 (2’- OMe modification) or POOH through PO014 (2’-M0E modification) had similar levels of luminescence to negative controls. These data indicate modification of the RNA backbone of a ParcelOligo with 2-OMe or 2’-M0E configurations aids in innate immune evasion. Example 3. Elution of Complexed mRNA This study examined elution time of either naked or complexed Fluc[opt] mRNA with ParcelOligos following size exclusion chromatography. Fluc[opt] mRNA was synthesized through in vitro transcription of template DNA encoding the Fluc[opt] mRNA using a modified form of uracil, Nl-methyl-pseudouridine (Nlm-y) along with a co-translational 5’ Cap-1 structure (CleanCap). The resulting transcribed mRNA contains 100% Nlm-y modification containing a 5’ CleanCap. Fluc[opt] mRNA was complexed to the following ParcelOligos: PO064 through PO067, PO075 through PO081, and PO280 through PO347 (to form mRNA349). This combination of ParcelOligos is complementary to the entirety of the Fluc[opt] mRNA, resulting in complete binding of the Fluc[opt] mRNA to ParcelOligos. Complexed Fluc[opt] mRNA with ParcelOligos were placed in a refolding buffer with a final composition of 50 millimolar (mM) Tris pH 7, 1 mM Ethylenediaminetetraacetic acid (EDTA), 150 mM Sodium Chloride (NaCl). The solution containing Fluc[opt] mRNA and ParcelOligos was heated to 95 degrees Celsius for 3 minutes, followed by a cooling phase to 25 degrees Celsius at a rate of 0.1 degrees Celsius per second. Following the annealing of Fluc[opt] mRNA to ParcelOligos, the complex was purified by size exclusion chromatography on a SRT-SEC 2000 column (7.8 by 300 millimeters). TrisEthylenediaminetetraacetic acid (TE) buffer of pH 8 was used as the mobile phase and eluted at a flow rate of 1 milliliter (mL) per minute. Fig 3 depicts the elution of either naked Fluc[opt] mRNA (mRNA365) or complexed Fluc[opt] mRNA with above indicated ParcelOligos (mRNA349). The x-axis represents time to elution of a given peak(s). mRNA349 elutes sooner than mRNA365. This indicates that complexing ParcelOligos to Fluc[opt] mRNA such that the mRNA that is 100% tiled allows for faster elution relative to naked Fluc[opt] mRNA. This difference in elution pattern allows for purification for mRNA-ParcelOligo complexes. Example 4. Protection of Complexed mRNA This study examined the protection afforded by ParcelOligos from RNases that cleave guanosine residues on single-stranded RNA (ssRNA). The mRNAs used in this study were derived from EXP2400138 (see Examples 3 and 5). 75 nanograms (ng) of naked mRNA365 or fully complexed mRNA349 that were purified by size exclusion chromatography were treated with a solution 20 millimolar (mM) Tris with a pH of 7, 50 mM Ethylenediaminetetraacetic acid (EDTA), and 40 units of RNase T1 or 0 units of RNase T1 for 15 minutes at a temperature of 37 degrees Celsius. To quench the reaction, 1 microliter (uL) of Proteinase K was added to the solution for 15 minutes at a temperature of 37 degrees Celsius. Subsequently, urea loading dye was added to a lx concentration and run on a Tris-Borate-EDTA (TBE)-Urea 6 percent polyacrylamide gel. The gel was visualized using a 300 nm ultraviolet or 254 nm epi- or transillumination gel imager with SYBR Gold reagent. Fig 4 depicts an image of a gel with mRNA365 or mRNA349 prior to size exclusion chromatography (Input) or following size exclusion chromatography (under conditions treated with RNase Tl). The fxn# refers to different elution fractions from the sizing column purification. Fxnl corresponds to early peak elution fractions on the chromatogram, with each subsequent Fxn corresponding to later elution fractions within the sizing column chromatogram peak. Naked mRNA365 displays a very high band in the input sample without RNase Tl. This band disappears completely in all fractions containing RNase Tl. 100% tiled mRNA349 displays a slightly lower band in the input sample without RNase Tl. This band is retained across all fractions with RNase Tl. This indicates that 100% tiling of the mRNA protects from degradation by RNase Tl and confirms the presence of ParcelOligos across the entirety of the mRNA. Example 5. Immunogenicity of Complexed mRNA This study examined the immunogenicity via innate immune sensing of RNA species by intracellular RNA sensors of naked or complexed mRNA with ParcelOligos. Fluc[opt] mRNA was synthesized through in vitro transcription of template DNA encoding the Fluc[opt] mRNA using a modified form of uracil, Nl-methyl-pseudouridine (Nlm-y) along with a co-translational 5’ Cap-1 structure (CleanCap). The resulting transcribed mRNA contains 100% Nlm-y modification containing a 5’ CleanCap. Fluc[opt] mRNA was delivered either naked or complexed with the following ParcelOligos: PO064 through PO067, PO075 through PO081, and PO280 through PO347. Fluc[opt] mRNA with or without indicated ParcelOligos was placed in a refolding buffer with a final composition of 50 millimolar (mM) Tris pH 7, 1 mM Ethylenediaminetetraacetic acid (EDTA), 150 mM Sodium Chloride (NaCl). The solution containing Fluc[opt] mRNA with or without ParcelOligos was heated to 95 degrees Celsius for 3 minutes, followed by a cooling phase to 25 degrees Celsius at a rate of 0.1 degrees Celsius per second. To evaluate immunogenicity, 100 nanograms (ng) of fully complexed or naked Fluc[opt] mRNA was transfected into the adherent A549-Dual cell line, utilizing the mRNA lipofection reagent Lipofectamine Messenger Max (LMM). Positive (unmodified immunogenic RNA) and negative (5-moU-modified mRNA) controls were included, along with a vehicle only (LMM) control. A549-Dual cells are a human lung epithelial carcinoma cell line that express a secreted luciferase reporter gene under the control of a fusion promoter of an interferon stimulated gene 54 (ISG54) minimal promoter fused to five interferon-stimulated response elements (ISREs). Briefly, immunogenic nucleic acids sensed by endosomal / intracellular sensors such as TLR3, RIG-I, MDA5, PKR, etc. will signal through a type I interferon (IFN) pathway, leading to a transcriptional complex (e.g. Interferon Stimulated Gene Factor 3 (ISGF3)) binding to the aforementioned fusion promoter stimulating luciferase gene transcription, which is secreted into the media. Following the transfection, supernatant from A549-Dual cells was collected 72 hours post-transfection and mixed with the Quanti-Luc reagent. The level of luminescence detected directly correlates with the relative level of IFN activation within the cell. Following 72h incubation post-transfection, Fig 5 shows naked Fluc[opt] mRNA results in a level of luminescence similar to the positive control. Fully complexed Fluc[opt] mRNA results in a level of luminescence similar to the negative controls. This suggests that fully complexing ParcelOligos to naked mRNA aids in innate immune evasion. Example 6. Translation of Complexed mRNA This study examined the translation of mRNA complexed to ParcelOligos tiled over different regions of mRNA, such as the 5’ Untranslated region (UTR), coding sequence (CDS), and 3 ’ UTR. Fluc[opt] mRNA was synthesized through in vitro transcription of template DNA encoding the Fluc[opt] mRNA using a modified form of uracil, Nl-methyl-pseudouridine (Nlm-y) along with a co-translational 5’ Cap-1 structure (CleanCap). The resulting transcribed mRNA contains 100% Nlm-y modification containing a 5’ CleanCap. Fluc[opt] mRNA was delivered either naked or complexed with the following ParcelOligos: PO075 through PO081 (3’ UTR tiling), PO075 through PO081 plus PO280-347 (CDS + 3’ UTR tiling), or PO064 through PO067 plus PO075 through PO08 plus PO280-PO347 (5’ UTR+ CDS + 3’ UTR tiling). Fluc[opt] mRNA with or without indicated ParcelOligos were placed in a refolding buffer with a final composition of 50 millimolar (mM) Tris pH 7, 1 mM Ethylenediaminetetraacetic acid (EDTA), 150 mM Sodium Chloride (NaCl). The solution containing Fluc[opt] mRNA with or without ParcelOligos was heated to 95 degrees Celsius for 3 minutes, followed by a cooling phase to 25 degrees Celsius at a rate of 0.1 degrees Celsius per second. Following the refolding of Fluc[opt] mRNA with or without ParcelOligos, the complex was purified by size exclusion chromatography on a SRT-SEC 2000 column (7.8 by 300 millimeters). Tris-Ethylenediaminetetraacetic acid (TE) buffer of pH 8 was used as the mobile phase and eluted at a flow rate of 1 milliliter (mL) per minute. 100 nanograms of naked or complexed Fluc[opt] mRNAs were transfected into the HepG2 cell line using Lipofectamine Messenger Max (LMM). 24 hours post-transfection, cells were lysed with Promega Gio Lysis Buffer (Cat#E266A). Luciferase signal was quantified using the Promega One-Gio Luciferase Assay System (Cat#E6120). The results in Fig 6 demonstrate Fluc[opt] mRNA complexed with ParcelOligos tiling the 3’ UTR (PO075 through PO081) has similar levels of luminescence compared to naked Fluc[opt] mRNA. Tiling the CDS with the 3’ UTR or complete tiling of the 5’ UTR, CDS, and 3’ UTR resulted in reduced luminescence signal. These results indicate that minimally tiling the mRNA only at 3’ UTR results in equivalent translation compared to naked mRNA. Example 7. Protection of Complexed mRNA This study examined the protection afforded by ParcelOligos from RNases that cleave guanosine residues on single-stranded RNA (ssRNA). Fluc[opt2] mRNA was synthesized through in vitro transcription of template DNA encoding the Fluc[opt2] mRNA using a modified form of uracil, Nl-methyl-pseudouridine (Nlm-y) along with a co-translational 5’ Cap-1 structure (CleanCap). The resulting transcribed mRNA contains 100% Nlm-y modification containing a 5’ CleanCap. Fluc[opt2] mRNA was complexed to the following ParcelOligos: PO374 through PO382. PO374 through PO382 are nine 20 nucleotide ParcelOligos that are complementary to Fluc[opt2] mRNA across the coding sequence and 3’ untranslated region. PO374 through PO382 contain an internal 2’-Cl6 modification. Fluc[opt2] mRNA with or without ParcelOligos was placed in a refolding buffer with a final composition of 50 millimolar (mM) Tris pH 7, 1 mM Ethylenediaminetetraacetic acid (EDTA), 150 mM Sodium Chloride (NaCI). The solution containing Fluc[opt2] mRNA with or without ParcelOligos was heated to 95 degrees Celsius for 3 minutes, followed by a cooling phase to 25 degrees Celsius at a rate of 0.1 degrees Celsius per second. Following refolding of Fluc[opt2] mRNA with or without ParcelOligos, the complexed mRNA was purified by oligo-dT affinity chromatography on a CIMmultus Oligo dT18 (C12 Linker) using a 1 milliliter (mL) Monolithic column with a 2 micron diameter. Peak fractions eluted were pooled for subsequent studies. 75 nanograms (ng) of refolded Fluc[opt2] mRNA was treated with a solution 20 millimolar (mM) Tris with a pH of 7, 50 mM Ethylenediaminetetraacetic acid (EDTA), and 40 units of RNase T1 or 0 units of RNase T1 for 15 minutes at atemperature of 37 degrees Celsius. To quench the reaction, 1 microliter (uL) of Proteinase K was added to the solution for 15 minutes at a temperature of 37 degrees Celsius. Subsequently, urea loading dye was added to a lx concentration and run on a Tris-Borate-EDTA (TBE)-Urea 6 percent polyacrylamide gel. The gel was visualized using a 300 nm ultraviolet or 254 nm epi- or transillumination gel imager with SYBR Gold reagent. Fig 7 depicts complexing Fluc[opt2] mRNA with 9 ParcelOligos spanning the CDS and 3’ UTR protects the mRNA from enzymatic degradation by RNase Tl, as indicated by the presence of the lower bands in the (+) lane. The higher bands present in both the untreated (-) and treated (+) lanes represent the poly(A) tail which is not degraded by RNase Tl, due to the lack of guanosine nucleotides. Example 8. Immunogenicity of Complexed mRNA This study examined the immunogenicity via innate immune sensing of RNA species by intracellular RNA sensors of naked or complexed mRNA with ParcelOligos. Fluc[opt2] mRNA was synthesized through in vitro transcription of template DNA encoding the Fluc[opt2] mRNA using a modified form of uracil, Nl-methyl-pseudouridine (Nlm-y) along with a co-translational 5’ Cap-1 structure (CleanCap). The resulting transcribed mRNA contains 100% Nlm-y modification containing a 5’ CleanCap. Fluc[opt2] mRNA was complexed to the following ParcelOligos: PO374 through PO382. PO374 through PO382 are nine 20-nucleotide ParcelOligos that are complementary to Fluc[opt2] mRNA across the coding sequence and 3’ untranslated region. PO374 through PO382 contain an internal 2’-Cl6 modification. Fluc[opt2] mRNA with or without ParcelOligos were placed in a refolding buffer with a final composition of 50 millimolar (mM) Tris pH 7, 1 mM Ethylenediaminetetraacetic acid (EDTA), 150 mM Sodium Chloride (NaCI). The solution containing Fluc[opt2] mRNA with or without ParcelOligos was heated to 95 degrees Celsius for 3 minutes, followed by a cooling phase to 25 degrees Celsius at a rate of 0.1 degrees Celsius per second. Following refolding of Fluc[opt2] mRNA with or without ParcelOligos, the complexed mRNA was purified by oligo-dT affinity chromatography on a CIMmultus Oligo dT18 (C12 Linker) using a 1 milliliter (mL) Monolithic column with a 2 micron diameter. Peak fractions eluted were pooled for subsequent studies. To evaluate immunogenicity, 100 nanograms (ng) of Fluc[opt2] mRNA with or without above indicated ParcelOligos were transfected into the adherent A549-Dual cell line, utilizing the mRNA lipofection reagent Lipofectamine Messenger Max (LMM). Positive (unmodified immunogenic RNA) and negative (5-moU-modified mRNA) controls were included, along with a vehicle only (LMM) control. A549-Dual cells are a human lung epithelial carcinoma cell line that express a secreted luciferase reporter gene under the control of a fusion promoter of an interferon stimulated gene 54 (ISG54) minimal promoter fused to five interferon-stimulated response elements (ISREs). Briefly, immunogenic nucleic acids sensed by endosomal / intracellular sensors such as TLR3, RIG-I, MDA5, PKR, etc. will signal through a type I interferon (IFN) pathway, leading to a transcriptional complex (e.g., Interferon Stimulated Gene Factor 3 (ISGF3)) binding to the aforementioned fusion promoter stimulating luciferase gene transcription, which is secreted into the media. Following the transfection, supernatant from A549-Dual cells was collected 72 hours post-transfection and mixed with the Quanti-Luc reagent. The level of luminescence detected directly correlates with the relative level of IFN activation within the cell. In Fig 8, naked Fluc[opt2] mRNA elicited an IFN response as indicated by the induction of luminescence signal (le7 RLU). C16 ParcelOligo complexed Fluc[opt2] mRNA demonstrated a level of luminescence equivalent to the negative control. These data indicate that complexing C16 ParcelOligos to the CDS and 3’ UTR of the mRNA aids in innate immune evasion. Example 9. Detection of Translated Complexed mRNA This study examined the level of in vivo detection of translated luciferase of Fluc[opt2] mRNA refolded with C16-containing ParcelOligos over time. Female Balb / c mice, 7-9 weeks of age from Charles River Laboratories, were used for this study. Mice were acclimated for 4 days prior to intradermal administration of 4 micrograms LNP containing Fluc[opt2] mRNA without ParcelOligos or 20 micrograms Fluc[opt2] mRNA refolded with C16-containing ParcelOligos. A negative control of saline (Quality Biological catalog # 114-055-101) was included in this study as a baseline for luciferase detection via Perkin Elmer IVIS imaging. Fluc[opt2] (+) C16 ParcelOlgios (20ug) refers to mRNA (Fluc[opt2]) that was refolded with ParcelOligos (PO374 through PO382) and was not formulated into lipid nanoparticles. PO374 through PO382 are nine 20-nucleotide ParcelOligos that are complementary to Fluc[opt2] mRNA across the coding sequence and 3’ untranslated region. PO374 through PO382 contain an internal 2’-C16 modification. LNP refers to mRNA (Fluc[opt2]) that does not contain ParcelOligos but was formulated with SM-102 lipids to form a lipid nanoparticle. LNP is the positive control for expression. Mice were anesthetized with isofluorane and given a 30 microliter (uL) intradermal dose of the above test articles. Five timepoints for IVIS imaging were chosen over a timeframe of nearly 100 hours. At each timepoint, mice were intraperitoneally injected with 200 uL of 15 milligrams per milliliter D-Luciferin (Gold Bio catalog # LUCK-100; solubilized in sterile normal saline) while under isofluorane. Ten minutes after administration, mice were imaged on the Perkin Elmer IVIS instrument while the mice were in a lateral recumbent orientation. Image analysis was performed using Livingimage software. Animal health checks were conducted daily throughout the study. The results in Fig 9 show Fluc[opt2] mRNA formulated with LNPs exhibited a maximal Total Flux of lOelO. This fell over time to a final Total Flux of approximately 10e7.5. Fluc[opt2] mRNA complexed to C16 ParcelOligos had a maximal Total Flux of 10e7 which was sustained for nearly all timepoints, approximately 1 log above the saline only condition. Example 10. Detection of Translated Complexed mRNA This study examined the level of in vivo detection of translated luciferase of ParcelOligo- complexed Fluc[opt2] mRNA over time. Female Balb / c mice, 7-9 weeks of age from Charles River Laboratories, were used for this study. Mice were acclimated for 4 days prior to intramuscular administration of 4 micrograms of LNP or 20 micrograms Fluc[opt2] mRNA refolded with C16-containing ParcelOligos. A negative control of saline (Quality Biological catalog # 114-055-101) was included in this study as a baseline for luciferase detection via Perkin Elmer IVIS imaging. Fluc[opt2] (+) C16 ParcelOlgios (20ug) refers to mRNA (Fluc[opt2]) that was refolded with ParcelOligos (PO374 through PO382) and was not formulated into lipid nanoparticles. PO374 through PO382 are nine 20 nucleotide ParcelOligos that are complementary to Fluc[opt2] mRNA across the coding sequence and 3’ untranslated region. PO374 through PO382 contain an internal 2’-C16 modification. LNP refers to mRNA (Fluc[opt2]) that does not contain ParcelOligos but was formulated with SM-102 lipids to form a lipid nanoparticle. LNP is the positive control for expression. Mice were anesthetized with isofluorane and given a 50 microliter (uL) intramuscular dose of the above test articles. Five timepoints for IVIS imaging were chosen over a timeframe of nearly 100 hours. At each timepoint, mice were intraperitoneally injected with 200 uL of 15 milligrams per milliliter D-Luciferin (Gold Bio catalog # LUCK-100; solubilized in sterile normal saline) while under isofluorane. Ten minutes after administration, mice were imaged on the Perkin Elmer IVIS instrument while the mice were in a lateral recumbent orientation. Image analysis was performed using Livingimage software. Animal health checks were conducted daily throughout the study. The results in Fig 10 show Fluc[opt2] mRNA formulated with LNPs exhibited a maximal Total Flux of lOelO. This fell over time to a final Total Flux of approximately 10e8. Fluc[opt2] mRNA complexed to C16 ParcelOligos had a maximal Total Flux that was approximately half a log over the saline but remained stable throughout the experiment. Example 11. Detection of Translated Complexed mRNA This study examined the level of in vivo detection of translated luciferase of ParcelOligo-complexed Flux[opt2] mRNA over time. Female Balb / c mice, 8-10 weeks of age from Charles River Laboratories, were used for this study. Mice were acclimated for 7 days prior to intrathecal administration of 4 micrograms of LNP or 40 micrograms ParcelOligo-complexed Fluc[opt2] mRNA. A negative vehicle control was included in this study as a baseline for luciferase detection via Perkin Elmer IVIS imaging. Fluc[opt2] (+) C16 ParcelOlgios (40ug) refers to mRNA (Fluc[opt2]) that was complexed to ParcelOligos (PO374 through PO382) and was not formulated into lipid nanoparticles. PO374 through PO382 are nine 20 nucleotide ParcelOligos that are complementary to Fluc[opt2] mRNA across the coding sequence and 3’ untranslated region. PO374 through PO382 contain an internal 2’-C16 modification. LNP refers to mRNA (Fluc[opt2]) that does not contain ParcelOligos but was formulated with SM-102 lipids to form a lipid nanoparticle. LNP is the positive control for expression. Mice were anesthetized with isofluorane, given a dose of buprenorphine analgesic subcutaneously, and given a 10 microliter (uL) intrathecal dose of the above test articles. Six timepoints for IVIS imaging were chosen over a timeframe of 120 hours. At each timepoint, mice were intraperitoneally injected with 10 milliliter per kilogram of 15 milligram per milliliter luciferin while under isofluorane. Ten minutes after administration, mice were imaged on the Perkin Elmer IVIS instrument while the mice were in a ventral recumbent orientation. Image analysis was performed using Livingimage software. Animal health checks were conducted 30 minutes after test article administration and daily throughout the study. The results in Fig 11 show Fluc[opt2] mRNA formulated with LNPs exhibited a maximal Total Flux of nearly lOel 1. This fell over time to a final Total Flux of approximately 10e8. The luciferase signal originated from the mouse spinal cord, brain and liver. Fluc[opt2] mRNA complexed to C16 ParcelOligos had a maximal Total Flux that was approximately one log over the saline control condition over the first two timepoints, which then fell to background levels thereafter. The luciferase signal originated almost exclusively from the mouse spinal cord. Example 12. Detection of Translated Complexed mRNA This study examined the translation of mRNA complexed to ParcelOligos tiled over different regions of mRNA, such as the 5’ Untranslated region (UTR), coding sequence (CDS), and 3 ’ UTR. Fluc[opt2] mRNA was synthesized through in vitro transcription of template DNA encoding the Fluc[opt2] mRNA using a modified form of uracil, Nl-methyl-pseudouridine (Nlm-y) along with a co-translational 5’ Cap-1 structure (CleanCap). The resulting transcribed mRNA contains 100% Nlm-y modification containing a 5’ CleanCap. Fluc[opt2] mRNA was complexed with the following ParcelOligos: PO374 through PO382. PO374 through PO382 are nine 20 nucleotide ParcelOligos that are complementary to Fluc[opt2] mRNA across the coding sequence and 3’ untranslated region. PO374 through PO382 contain an internal 2’-Cl6 modification. Complexed Fluc[opt2] mRNA with ParcelOligos were placed in a refolding buffer with a final composition of 50 millimolar (mM) Tris pH 7, 1 mM Ethylenediaminetetraacetic acid (EDTA), 150 mM Sodium Chloride (NaCl). The solution containing Fluc[opt] mRNA and ParcelOligos was heated to 95 degrees Celsius for 3 minutes, followed by a cooling phase to 25 degrees Celsius at a rate of 0.1 degrees Celsius per second. Following refolding of ParcelOlgios to Fluc[opt2] mRNA, the complexed mRNA was purified by oligo-dT affinity chromatography on a CIMmultus Oligo dT18 (Cl2 Linker) using a 1 milliliter (mL) Monolithic column with a 2 micron diameter. Peak fractions eluted were pooled for subsequent studies. 100 nanograms of refolded Fluc[opt2] mRNAs with and without ParcelOligos was transfected into the A549-dual cell line using Lipofectamine Messenger Max (LMM). 72 hours post-transfection, cells were lysed with Promega Gio Lysis Buffer (Cat#E266A). Luciferase signal was quantified using the Promega One-Gio Luciferase Assay System (Cat#E6120). The results in Fig 12 demonstrate Fluc[opt2] mRNA complexed with C16 ParcelOligos has nearly the same luminescence as naked Fluc[opt2] mRNA. Naked Fluc[opt2] mRNA has equivalent luminescence to the positive control, which is a 5-moU-modified mRNA encoding Flue. These results indicate that C16 tiling the mRNA spanning the CDS and 3’ UTR allows for a “reversibly double stranded” mRNA complex that is efficiently translated. Example 13. Detection of Translated Complexed mRNA This study examined the translation of mRNA delivered to primary mouse cells, delivered in the absence of a transfection carrier. SecNanoLuc mRNA was synthesized through in vitro transcription of template DNA encoding the SecNanoLuc protein using a modified form of uracil, N1 -methyl -pseudouridine (Nlm-y) along with a co-translational 5’ Cap-1 structure (CleanCap). The resulting transcribed mRNA contains 100% Nlm-y modification containing a 5’ CleanCap. SecNanoLuc mRNA was complexed with the following ParcelOligos: (1) “5x GalNAc” GalNAc containing ParcelOligos: PO082, PO083, PO084, PO088; PO090, (2) “5x C16” C16-containing ParcelOligos: PO085, PO086, PO087, PO089; PO091, (3) “5x GalNAc + 5x Cl6” GalNAc containing ParcelOligos and C16-containing ParcelOligos: PO082, PO083, PO084, PO088; PO090; PO085, PO086, PO087, PO089; PO091, (4) “Full Complexing”: PO064 through 065; PO067; PO367; PO075 through PO081; PO102 through PO131; PO349 through PO354, (5) “Full Complexing + 5x GalNAc” GalNAc containing ParcelOligos: PO082, PO083, PO084, PO088; PO090; PO064 through 065; PO067; PO367; PO075; PO077; PO079; PO081; PO102 through PO109; PO111 through PO120; PO122 through PO131; PO349 through PO354, (6) “Full Complexing + 5x C16” C16-containing ParcelOligos: : PO085, PO086, PO087, PO089; PO091; PO064 through PO065; PO067; PO367; PO075; PO076; PO078; PO080; PO102 through PO110; PO112 through PO121; PO123 through PO131; PO349 through PO354, or (7) “Full Complexing + 5x GalNAc + 5x Cl6” GalNAc containing ParcelOligos and Cl 6-containing ParcelOligos: PO082, PO083, PO084, PO088; PO090; PO085, PO086, PO087, PO089; PO091; PO064 through PO065; PO067; PO367; PO075; PO102 through PO109; PO112 through PO120; PO123 through PO131; PO349 through PO354. SecNanoLuc mRNA with or without ParcelOligos are placed in a refolding buffer with a final composition of 50 millimolar (mM) Tris pH 7, 1 mM Ethylenediaminetetraacetic acid (EDTA), 150 mM Sodium Chloride (NaCl). The solution containing SecNanoLuc mRNA and ParcelOligos is heated to 95 degrees Celsius for 3 minutes, followed by a cooling phase to 25 degrees Celsius at a rate of 0.1 degrees Celsius per second. 100 nanograms of SecNanoLuc mRNA refolded with or without ParcelOligo indicated in the above conditions were transfected into primary mouse hepatocytes (Male ICR / CD-1 Mouse Cryoplateable Hepatocytes, Cat#M005052-P) using Lipofectamine Messenger Max (LMM). Additionally, lOOOng (10 microliters of a 100 nanogram per microliter stock solution of mRNA) of SecNanoLuc mRNA refolded with or without ParcelOligo were transfected without LMM carrier into primary mouse hepatocytes (25,000 cells in 100 microliters of media). 48 hours posttransfection, cell media was harvested and mixed with Nano-Glo®Luciferase Assay Reagent (Promega Cat#Nl 10). After 3-minute incubation, luciferase signal was quantified on the Promega GloMax plate reader. To account for the impact on translation previously seen by fully complexing mRNA, Equation 1 below was used to normalize the decreased translation of the fully complexed conditions. Equation 1. RLU (Carrier — free) ,,,,,,------------— = ParcelOliqo Translation Normalized RLU RLU (LMM - transfected)          a Using this equation, the inclusion of C16-containing ParcelOligos alone allowed for the highest uptake of SecNanoLuc mRNA, followed by GalNAc-containing ParcelOligos (Fig 13). Fully complexed SecNanoLuc mRNA with both GalNAc and C16-containing Parcel Oligos resulted in nearly the same uptake of mRNA as fully complexed SecNanoLuc mRNA alone. These results show that fully complexing mRNA is required for uptake into cells and that the inclusion of C16 Parcel Oligos allows for the maximum uptake of the tested conditions. All publications, patents, and patent documents are incorporated by reference herein, as though individually incorporated by reference. The invention has been described with reference to various specific and preferred embodiments and techniques. However, it should be understood that variations and modifications may be made while remaining within the spirit and 5 scope of the invention.

Claims

1. A complex comprising a mRNA molecule and at least one synthetic oligonucleotide hybridized to the mRNA molecule that imparts double-strandedness to the complex.

2. The complex of claim 1, wherein the hybridization of the at least one synthetic oligonucleotide to the mRNA increases the stability of the complex as compared to mRNA that is not hybridized of the at least one synthetic oligonucleotide.

3. The complex of claim 1 or 2, which comprises a plurality of synthetic oligonucleotides.

4. The complex of any one of claims 1-3, wherein at least one synthetic oligonucleotide of the complex is conjugated to a targeting moiety.

5. The complex of any one of claims 1-3, wherein no synthetic oligonucleotide of the complex is conjugated to a targeting moiety.

6. The complex of claim 4, wherein each targeting moiety is a sugar (e.g, GalNAc), a small molecule (e.g., Cl6), a peptide, an antibody (e.g., IgG), an antibody fragment (e.g., Fab), a nanobody / miniprotein (e.g., VHH, svFv), an anti-CD5 antibody, or a nucleic acid.

7. The complex of claim 6, wherein at least one targeting moiety is C16.

8. The complex of claim 6 or 7, wherein at least one targeting moiety is GalNAc.

9. The complex of any one of claims 6-8, which comprises a plurality of syntheticoligonucleotides, wherein at least one synthetic oligonucleotide of the complex is conjugated to C16 and at least one synthetic oligonucleotide of the complex is conjugated to GalNAc.

10. The complex of any one of claims 1-9, wherein at least one of the synthetic oligonucleotides of the complex is 1-200 nt in length.

11. The complex of any one of claims 1-10, wherein at least one of the synthetic oligonucleotides is 1-50 nt in length.

12. The complex of any one of claims 1-11, wherein at least one of the synthetic oligonucleotides is 2-25 nt in length (e.g., 5-20 nt in length, e.g., 5-15 nt in length, e.g., 5-25 nt in length).

13. The complex of any one of claims 1-10, wherein at least one of the synthetic oligonucleotides is 50-75 nt in length.

14. The complex of any one of claims 1-10, wherein at least one of the synthetic oligonucleotides is 75-100 nt in length.

15. The complex of any one of claims 1-10, wherein at least one of the synthetic oligonucleotides is 100-150 nt in length.

16. The complex of any one of claims 1-10, wherein at least one of the synthetic oligonucleotides is 150-200 nt in length.

17. The complex of any one of claims 1-16, wherein at least one of the synthetic oligonucleotides of the complex comprises a 2’-OH modification (e.g., 2’-0Me, 2’-M0E, 2’-F).

18. The complex of any one of claims 1-17, wherein at least one of the synthetic oligonucleotides of the complex comprises modifications to the phosphodiester backbone (e.g., phosphorothioate linkages).

19. The complex of any one of claims 1-18, wherein at least one of the synthetic oligonucleotides of the complex comprises 100% uridine modification (e.g., Nl-methylpseudouridine or 5-methyoxyuridine modifications).

20. The complex of any one of claims 1-19, wherein the at least one synthetic oligonucleotide imparts reversible double-strandedness to the complex.

21. The complex of any one of claims 1-20, wherein the mRNA is therapeutic mRNA (e.g., encoding a therapeutic protein).

22. A composition comprising the complex of any one of claims 1-21.

23. The composition of claim 22, which is a pharmaceutical composition.

24. Use of a complex or composition of any one of claims 1-23 as a medicament.

25. A method for delivering therapeutic mRNA to a cell in vivo, comprising administering to a subject the complex of claim 21 to deliver the therapeutic mRNA to a cell.

26. A method for delivering therapeutic protein to a cell in vivo, comprising administering to a subject the complex of claim 21 to deliver the therapeutic mRNA to a cell, which therapeutic mRNA is translated to the therapeutic protein.

27. The method of claim 25 or 26, with the proviso that the administration is accomplished without the use of nanoparticles, e.g., without the use of lipid nanoparticles.