A dual-channel real-time fluorescence quantitative PCR detection method for quantitative detection of HBV DNA and RNA in blood

Abstract

The present invention discloses a blood hepatitis B virus (HBV) DNA and RNA dual-channel real-time fluorescence quantitative PCR detection system, and a method for simultaneously detecting HBV DNA and RNA using the detection system. The detection system includes oligonucleotide primers, reverse anchor primers and probes for amplifying DNA and RNA. The detection system and method of the present invention can be used to prepare HBV diagnostic reagents or kits. The present invention can simultaneously detect HBV DNA and RNA in one detection, and the method is simple and fast.

Description

Technical Field

[0001] The present invention generally relates to the diagnosis and treatment of hepatitis B virus, as well as the fields of infectious diseases, molecular biology, cell biology, etc. More specifically, the present invention relates to a dual-channel real-time fluorescence quantitative PCR detection method for hepatitis B virus (HBV) DNA and RNA in blood. Background Art

[0002] Hepatitis B virus (HBV) infection is prevalent worldwide, but the prevalence of HBV infection varies greatly in different regions. my country belongs to the medium-to-high prevalence area. In the 2006 national hepatitis B serological epidemiological survey, the HBsAg carrier rate of the general population aged 1 to 59 in my country was 7.18%. Based on this, it is estimated that there are about 93 million chronic HBV infections in my country, including about 20 million chronic hepatitis B (CHB) patients.

[0003] In my country, chronic HBV infection is closely related to the occurrence of end-stage liver diseases such as cirrhosis and liver cancer. Currently, the drugs for treating chronic hepatitis B are mainly interferon and nucleoside (acid) analogs. Both types of drugs can effectively inhibit HBV replication, but due to the continued presence of covalently closed circular DNA (cccDNA) in hepatocytes, the current clinical cure rate of chronic hepatitis B treatment is very low (<5%), and the recurrence rate of chronic hepatitis B after drug withdrawal is high. Therefore, patients with chronic hepatitis B need to take medication for a long time or even for life. Long-term medication will bring great burden to patients and even society, and may lead to the emergence of HBV resistant strains during the treatment process.

[0004] Moreover, the HBV nucleic acid currently tested in clinical practice is only HBV DNA. The HBV DNA level in serum can reflect the replication level of HBV, can be used as a monitoring indicator for antiviral efficacy, and has good prognosis monitoring value (Martinot-Peignoux M, Marcellin P. Virological and serological tools to optimize the management of patients with chronic hepatitis B [J]. Liver International, 2016, 36 Suppl 1 (Supplement S1): 78–84.). In the "Guidelines for the Prevention and Treatment of Chronic Hepatitis B (2015 Update)", it is mentioned that HBV DNA quantitative detection is mainly used to determine the viral replication level of chronic HBV infection, which can be used to select indications for antiviral treatment and determine the efficacy, and it is recommended to use real-time fluorescent quantitative polymerase chain reaction with high sensitivity and accuracy. At present, in clinical practice, treatment endpoints are divided into ideal endpoints, satisfactory endpoints and basic endpoints: the ideal endpoint is that chronic hepatitis B patients achieve persistent HBsAg disappearance after stopping medication; the satisfactory endpoint varies according to the HBeAg status of chronic hepatitis B patients, and the final status is HBeAg negative, with sustained virological response and ALT normalization; the basic endpoint is long-term maintenance of virological response during antiviral treatment. Currently, HBsAg negative conversion is used as an indicator of clinical cure, and medication can be safely stopped when HBsAg turns negative, but the HBsAg negative conversion rate is too low, which greatly limits its clinical application.

[0005] Therefore, based on this, there is an urgent need for a more sensitive, accurate and effective hematological index to monitor the efficacy of chronic hepatitis B treatment and monitor safe drug withdrawal (Chinese Medical Association Hepatology Branch, Chinese Medical Association Infectious Diseases Branch. Guidelines for the prevention and treatment of chronic hepatitis B (2015 edition) [J]. Chinese Journal of Hepatology (Electronic Edition), 2015, 7(3): 1-18.).

[0006] According to our previous research results and related reports, it has been confirmed that HBV RNA exists in serum, and its dynamic changes are closely related to the efficacy and prognosis of chronic hepatitis B treatment. In our previous studies, we clarified the existence form and production mechanism of HBV RNA in serum, and confirmed that HBV RNA in serum is 3.5kb long HBV Pregenome RNA (pgRNA), which exists in the nucleocapsid of virus particles similar to Dan's particles. Its source is the acquisition of viral envelope and secretion to the extracellular space without reverse transcription or incomplete reverse transcription (Jie W, Tao S, Huang X, et al. Serum hepatitis B virus RNA is encapsidated pregenome RNA that may be associated with persistence of viral infection and rebound [J]. Journal of Hepatology, 2016.). It can be seen that the HBV viral nucleic acid in serum includes both HBV DNA in Dan's particles and pgRNA in RNA virus-like particles. Since nucleoside (acid) analogs act on the reverse transcription and DNA synthesis process of hepatitis B virus, they can inhibit the production of HBV DNA, but have no direct inhibitory effect on the production of pgRNA virus-like particles. Therefore, the dynamic changes of HBV DNA and HBV RNA can well reflect the efficacy of antiviral treatment.

[0007] The full length of the HBV genome is 3.2kb, and pgRNA is a template for the reverse transcription of the virus to synthesize progeny viral DNA, and its size is 3.5kb. It is formed by partial repeated transcription based on the HBV cccDNA in the nucleus of infected hepatocytes, while the integrated HBV genome cannot be produced. Therefore, quantitative detection of serum HBV pgRNA levels can better monitor the level and transcriptional activity of HBV cccDNA in hepatocytes, and is a good predictive indicator for detecting the efficacy of chronic hepatitis B treatment and safe drug withdrawal. In addition, previous studies in our laboratory have shown that the level of HBV RNA is related to the recurrence of patients after drug withdrawal. Therefore, HBV RNA can be used as a potential monitoring indicator for judging the safe withdrawal of nucleoside (acid) analogues during treatment (Jie W, Tao S, Huang X, et al. Serum hepatitis B virus RNA is encapsidated pregenome RNA that may be associated with persistence of viral infection and rebound [J]. Journal of Hepatology, 2016.).

[0008] Therefore, the present invention aims to establish a highly sensitive and specific dual-channel fluorescence quantitative PCR method that can simultaneously detect HBV DNA and HBV RNA in the blood, which is used to clinically evaluate the efficacy of antiviral treatment for chronic hepatitis B and guide its safe drug withdrawal. The development of sensitive, accurate, and more effective dual-channel diagnostic reagents or kits for quantitatively detecting RNA and DNA in the blood has important guiding significance for the effective treatment and safe drug withdrawal of chronic hepatitis B in the clinic. Summary of the invention

[0009] On the one hand, the present invention provides an oligonucleotide set for simultaneous detection of HBV DNA and RNA in body fluids by dual-channel real-time fluorescence PCR, characterized in that the oligonucleotide set includes dedicated primers for specific amplification of dual-channel real-time fluorescence PCR detection of HBV DNA and RNA in body fluids and a reverse anchor primer.

[0010] In some embodiments, the oligonucleotide set as described above further comprises a dedicated probe for specific amplification used in conjunction with the dedicated primer.

[0011] In some specific embodiments, the dedicated primers for specifically amplifying body fluid HBV DNA are selected from a pair of oligonucleotides consisting of an upstream primer of SEQ ID NOs﹕1, 2, 3 and 4 and a downstream primer selected from SEQ ID NOs﹕5 and 6; the dedicated primers for specifically amplifying body fluid HBV RNA are selected from a pair of oligonucleotides consisting of an upstream primer of SEQ ID NO﹕8 and a downstream primer selected from SEQ ID NOs﹕9, 10 and 16; the reverse anchor primer is selected from SEQ ID NOs﹕11 and 12.

[0012] In some specific embodiments, the dedicated primers for specifically amplifying body fluid HBV DNA are selected from a pair of oligonucleotides consisting of an upstream primer of SEQ ID NO﹕1 and a downstream primer selected from SEQ ID NO﹕6; the dedicated primers for specifically amplifying body fluid HBV RNA are selected from a pair of oligonucleotides consisting of an upstream primer of SEQ ID NO﹕8 and a downstream primer selected from SEQ ID NOs﹕9; and the reverse anchor primer is selected from SEQ ID NO﹕11.

[0013] In some embodiments of the present invention, the forward primer SEQ ID NO: 8 for amplifying RNA is AGACCACCAAATGCCCCT; the reverse primer SEQ ID NO: 16 is (N) 16-30 . (N) 16-30 Refers to the nucleotide sequence used as a random anchor sequence, N can be A, T, C or G, and the subscript 16-30 indicates the number of bases. Reverse anchor primer SEQ ID NO: 17 is (N) 16-30 -AGGCGAGGGAGTTCTTCTTCTA. (N) in SEQ ID NO﹕16 and SEQ ID NO﹕17 16-30 The same random anchor sequence is indicated. Those skilled in the art know that although (N) 16-30 is a random sequence, in order to ensure the efficiency of amplification, it should be avoided to be designed to form a primer dimer with HR-F or Probe-HR. In addition, in order to increase the efficiency of amplification, the primer sequence formed by adding random bases at both ends of the primer is also included in the present invention.

[0014] In some specific embodiments, the dedicated probe for specifically amplifying body fluid HBV DNA is selected from the nucleotide sequence shown in SEQ ID NO﹕7; the dedicated probe for specifically amplifying body fluid HBV RNA is selected from the nucleotide sequence shown in SEQ ID NO﹕13.

[0015] In some specific embodiments, the probe is one of a TaqMan probe, an MGB probe, and a hybridization probe.

[0016] In some specific embodiments, a fluorescent reporter group is connected to the 5' end of the probe, and the fluorescent reporter group is selected from any one of FAM, VIC, TET, JOE, ROX, CY3, CY5, and HEX, and the dedicated probe for amplifying DNA and the dedicated probe for amplifying RNA have different fluorescent reporter groups; and a fluorescent quenching group is connected to the 3' end of the probe, and the fluorescent quenching group is selected from any one of BHQ1, BHQ2, BHQ3, TAMRA, DABCYL, NFQ, and Eclipse.

[0017] On the other hand, the present invention also provides a dual-channel real-time fluorescence quantitative PCR detection system for simultaneously detecting HBV DNA and RNA in body fluids, characterized in that the system comprises the oligonucleotide group described in any of the above items.

[0018] The present invention also provides the use of the oligonucleotide group as described in any of the above items or the detection system as described in the above items in the preparation of HBV diagnostic reagents or kits.

[0019] The present invention also provides the use of the oligonucleotide group as described in any of the above items or the detection system as described in the above items in the preparation of HBV diagnostic reagents or kits for evaluating the efficacy of antiviral treatment of chronic hepatitis B and / or monitoring safe drug withdrawal and treatment endpoints.

[0020] The HBV DNA level in serum can reflect the replication level of HBV, can be used as a monitoring indicator of antiviral efficacy, and has good prognosis monitoring value. Therefore, the oligonucleotide group or the detection system described in the present invention is used in the preparation of HBV diagnostic reagents or kits, and the HBV diagnostic reagents or kits used for the efficacy evaluation of chronic hepatitis B antiviral treatment and / or safe drug withdrawal and treatment endpoint monitoring also fall within the scope of protection of the present invention.

[0021] On the other hand, the present invention also provides a dual-channel real-time fluorescence quantitative PCR kit for simultaneously detecting HBV DNA and RNA in body fluids, characterized in that the kit comprises the oligonucleotide set as described in any of the preceding items.

[0022] In some embodiments of the present invention, the kit further comprises DNA standards and RNA standards.

[0023] In some specific embodiments of the present invention, the DNA standard is a pESAY-Blunt plasmid comprising the nucleotide sequence shown in SEQ ID NO:14; the amplification primers of the DNA standard are a pair of oligonucleotides consisting of an upstream primer shown in SEQ ID NO﹕1 and a downstream primer shown in SEQ ID NO﹕6; the amplification primers of the RNA standard are a pair of oligonucleotides consisting of an upstream primer shown in SEQID NO﹕8 and a downstream primer shown in SEQ ID NO﹕9.

[0024] On the other hand, the present invention also provides a dual-channel real-time fluorescence quantitative PCR detection method for simultaneously detecting HBV DNA and RNA in body fluids for non-diagnostic purposes, characterized in that the dual-channel real-time fluorescence PCR detection method uses the oligonucleotide group as described in any of the preceding items or the detection system as described in any of the preceding items or the kit as described in any of the preceding items.

[0025] In some specific embodiments, the annealing temperature of the dual-channel real-time fluorescence PCR detection method is 58-60°C.

[0026] In some specific embodiments, the reaction conditions of the dual-channel real-time fluorescence PCR are: 50°C, 5 minutes; 95°C, 10 minutes; 94°C, 15 seconds; 50°C, 45 seconds, for a total of 45 cycles.

[0027] In some specific embodiments, the steps of the detection method include:

[0028] Step 1. extracting HBV nucleic acid (including HBV DNA and RNA) from body fluids, wherein HBV RNA is reverse transcribed into cDNA using a reverse anchor primer; and

[0029] Step 2. Using HBV DNA and reverse transcription products as templates, amplify DNA and RNA using dedicated primers and dedicated probes for specific amplification of HBV DNA and RNA dual-channel real-time fluorescence PCR detection; or using HBV DNA and reverse transcription products as templates, amplify using dedicated primers for specific amplification of HBV DNA and RNA dual-channel real-time fluorescence PCR detection, and incorporate fluorescent dyes to quantitatively detect HBV DNA and RNA in body fluids using the SYBR Green method.

[0030] In the present invention, the body fluids include blood, urine and saliva.

[0031] Beneficial effects of the present invention

[0032] The present invention is the first to simultaneously detect blood HBV DNA and RNA through dual channels in one system, which greatly reduces the detection time while maintaining good sensitivity and specific repeatability, and the actual operation is simple and fast. In addition, the present invention also adds an artificially designed anchor sequence to the reverse transcription primer to eliminate possible interference caused by HBV DNA during the detection process, ensuring the specificity of blood HBV RNA detection.

[0033] The specific primers and probes of the present invention can detect all genotypes of HBV of AH, including AD type HBV which mainly exists in my country.

[0034] The primers, probes and anchor sequences of the present invention are sequences with the best specificity and sensitivity determined after multiple rounds of screening and optimization based on multiple sequences designed initially. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 The figure shows the conservation of upstream and downstream primers and probe sequences for detecting different genotypes of HBV DNA analyzed by MegAlign software.

[0036] Figure 2 The flowchart of the detection of blood HBV DNA and RNA using the serum HBV DNA and RNA dual-channel real-time fluorescence quantitative PCR detection method implemented by the present invention is shown.

[0037] Figure 3 The figure shows the amplification efficiency of 8 pairs of HBV DNA quantitative detection primers (HD-F+HD-R, HD-F1+HD-R, HD-F2+HD-R, HD-F3+HD-R, HD-F+HD-R1, HD-F1+HD-R1, HD-F2+HD-R1, HD-F3+HD-R1) evaluated by the SYBR Green method.

[0038] Figure 4 The amplification efficiency of HBV RNA and HBV DNA primers is shown. (A) and (B) are the test results of HBV RNA samples after gradient dilution of 10, 100, 1000, 10000 times, and the final amplification efficiency is: 0.88665; (C) and (D) are the test results of HBV DNA samples after gradient dilution of 10, 100, 1000, 10000 times, and the final amplification efficiency is: 0.88665.

[0039] Figure 5The content of HBV DNA detection probe in the dual-channel system is shown. In the dual-channel system, when 1.0 μL of 10 μM HBV DNA and RNA detection primers were added, respectively, 0.4 μL, 0.6 μL, 0.8 μL and 1.0 μL of 10 μM HBV DNA detection probe and 0.6 μL of 10 μM HBV RNA detection probe were added.

[0040] Figure 6 The content of HBV DNA detection primers in the dual-channel system is shown. In the dual-channel system, when 0.6 μL of 10 μM HBV DNA and RNA detection probes were added, 0.5 μL, 1.0 μL, 1.5 μL of 10 μM HBV DNA detection primers (HD-F and HD-R1) and 1.0 μL of 10 μM HBV RNA detection primers were added. .

[0041] Figure 7 The annealing temperatures of the dual-channel quantitative amplification reaction are shown. (A) Amplification curves of quantitative PCR reactions performed at annealing temperatures of 56, 58, 60, and 62°C; (B) Ct values ​​obtained by performing quantitative PCR reactions at annealing temperatures of 54, 56, 58, and 60°C.

[0042] Figure 8 The sequencing results of the standards are shown. (A) Sequencing results of DNA standards; (B) Sequencing results of RNA standards.

[0043] Fig. 9 The sensitivity of dual-channel fluorescence quantitative PCR in detecting HBV DNA standard is shown. (A) Ct value of HBV DNA plasmids with different final concentrations after detection; (B) Standard curve constructed using concentration and Ct value. (C) Amplification curve finally obtained by fluorescence quantitative PCR.

[0044] Fig.10 The sensitivity of dual-channel fluorescence quantitative PCR in detecting HBV RNA standard is shown. (A) Ct value of HBV RNA plasmids with different final concentrations after detection; (B) Standard curve constructed using concentration and Ct value. (C) Amplification curve finally obtained by fluorescence quantitative PCR.

[0045] Fig.11 The sensitivity of the single-channel fluorescence quantitative PCR method for detecting HBV DNA standards is shown. (A) Ct values ​​of HBV DNA plasmids with different final concentrations after detection; (B) Standard curve constructed using concentration and Ct value. (C) Amplification curve finally obtained by fluorescence quantitative PCR.

[0046] Fig.12 The sensitivity of the single-channel fluorescence quantitative PCR method for detecting HBV RNA standards is shown. (A) Ct values ​​of HBV RNA plasmids with different final concentrations after detection; (B) Standard curve constructed using concentration and Ct value. (C) Amplification curve finally obtained by fluorescence quantitative PCR.

[0047] Fig.13 The reverse transcription samples without DNase I treatment are shown in the dual channel detection. (A) The amplification curves of DNA and RNA are displayed simultaneously. (B) The amplification curve of HBV DNA detected by VIC channel. (C) The amplification curve of HBV RNA detected by FAM channel (* indicates the amplification curve of HBV DNA and ▲ indicates the amplification curve of HBV RNA).

[0048] Fig.14 Shown are the reproducible results of dual-channel detection of reverse transcribed samples without DNase I treatment. DETAILED DESCRIPTION

[0049] Unless otherwise specified, the terms of the present invention have the meanings commonly used in the art.

[0050] The term "nucleotide" is intended to include those moieties that contain not only the known purine and pyrimidine bases but also other modified heterocyclic bases. Such modifications include methylated purines or pyrimidines, acylated purines or pyrimidines, alkylated ribose or other heterocyclic compounds. In addition, the term "nucleotide" includes those moieties that contain haptens or fluorescent labels and may contain not only conventional ribose and deoxyribose but also other sugars. Modified nucleosides or nucleotides may also include modifications on the sugar moiety, for example, wherein one or more hydroxyls are substituted by halogen atoms or aliphatic groups, functionalized as ethers, amines, etc.

[0051] The term "primer" refers to a short, chemically synthesized oligonucleotide, usually about 20 to 30 bases in length. They hybridize with the target DNA, which is then replicated by DNA polymerase to produce a complementary DNA strand. "Forward primer" and "reverse primer" constitute the "PCR primer set" used in PCR, where they hybridize with complementary DNA strands and guide replication toward each other, producing an upper strand and a lower strand, respectively, resulting in exponential growth of the target DNA fragment.

[0052] The method according to the present invention comprises a primer specific for the (preferably 3' poly-A) tail of RNA and the nearest 1 to 10 nucleotides, preferably 1 to 5 nucleotides, more preferably 3 to 5 nucleotides upstream of the (poly-A) tail for reverse transcription and / or an amplification primer specific for the corresponding (5' poly-thymidylic acid) sequence of cDNA, which sequence is complementary to the nearest 1 to 10 nucleotides, preferably 1 to 5 nucleotides, more preferably 3 to 5 nucleotides downstream of the (3' poly-A) tail of RNA and the corresponding (5' poly-thymidylic acid) sequence of cDNA. Accordingly, in addition to the primers disclosed above, the selectivity of the primer pair can be increased and thus the number of cDNA populations defined by the specific nucleotide closest to the terminal sequence anchor can be increased.

[0053] The term "anchor primer" refers to adding a modified sequence (including restriction sites, tag sequences, and artificially designed random sequences, etc.) to the 5' end of a gene-specific primer, then anchoring the modified sequence to the target gene through reverse transcription or PCR amplification, and finally using the anchor sequence as a primer for subsequent detection. To a certain extent, it can improve the specificity of specific gene detection.

[0054] The term "probe" refers to labeling a primer with a capture label or a detection label, and detecting the primer product. The probe sequence is used to hybridize with the sequence generated by the primer sequence, and usually hybridizes with a sequence that does not include the primer sequence. Similar to the primer sequence, the probe sequence is also labeled with a capture label or a detection label. It should be noted that when the primer is labeled with a capture label, the probe is labeled with a detection label, and vice versa. In the present invention, the probe can be one of a TaqMan probe, an MGB probe, and a hybridization probe. For example, the probe is a TaqMan probe, and the 5' end of the labeled probe is a fluorescent luminescent group, which is one of FAM, VIC, TET, JOE, ROX, CY3, CY5, and HEX; the 3' end of the labeled probe is a fluorescent quenching group, which is one of BHQ1, BHQ2, BHQ3, TAMRA, DABCYL, and NFQ.

[0055] The present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified; the materials used are purchased from conventional biochemical reagent companies unless otherwise specified.

[0056] Example 1. Primer design

[0057] At present, HBV is divided into at least 10 genotypes, and there are 4 genotypes A to D in my country. According to the HBV genotypes existing in my country and the common genotypes abroad, the inventors downloaded multiple A to H genotype HBV reference sequences from GenBank and analyzed the conserved sequences of HBV genomes of different genotypes using MegAlign software. Following the design principles of primers and probes, multiple pairs of primers for HBV DNA detection were designed in these conserved regions using Primer Premier 5 software (Table 1). These sequences are all conserved sequences of different genotypes of HBV ( Figure 1 ). At the same time, specific primers and probe sequences for HBV RNA detection were designed (Table 2). In order to eliminate the interference of HBV DNA, the inventors added a random anchor sequence to the 5' end of the reverse transcription primer. In the design process of the above primers, probes and random anchor sequences, the formation of hairpin structures, primer internal dimers, primer inter-dimers and mismatches was avoided as much as possible. In addition, the inventors compared and analyzed the above-designed HBV specific primers and probe sequences and random anchor sequences through the NCBI Blast online database (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to avoid non-specific binding with other viruses or human genes. Through multiple rounds of screening and optimization, a set of primers, probes and random anchor sequences with optimal sensitivity and specificity were finally determined, and the sequences are shown in Table 2.

[0058] Table 1. Primer and probe sequences for HBV DNA detection

[0059] sequence name SEQ ID NO sequence HD-F 1 CGGCGTTTTATCATMTTCCTCT HD-F1 2 CGGCGTTTTATCATMTTCCTC HD-F2 3 GCGGCGTTTTATCATMTTCCT HD-F3 4 TGTCTGCGGCGTTTTATCAT HD-R 5 GAGGACAAACGGGCAACATAC HD-R1 6 GACAAACGGGCAACATACCTT Probe-HD 7 CATCCTGCTGCTATGCCTCATCTTCTT

[0060] The 5' end fluorescent probe of Probe-HD is VIC, and the 3' end fluorescent probe is BHQ1.

[0061] Table 2. Primer and probe sequences for HBV RNA detection

[0062]

[0063] Among them, the 5' end fluorescent probe of Probe-HR is FAM, and the 3' end fluorescent probe is BHQ1. The underlined parts of the HR-R1 and HR-RT1 sequences are the same random anchor sequences, and the underlined parts of the HR-R2 and HR-RT2 sequences are the same random anchor sequences. As known to those skilled in the art, the inventors further confirmed through experiments that the random anchor sequence does not affect the efficiency of detection, as long as it tries not to form primer dimers with HR-F or Probe-HR.

[0064] Example 2, establishment of detection method

[0065] HBV nucleic acid (including HBV DNA and RNA) was extracted from the blood, and the extracted HBV RNA was reverse transcribed into cDNA using a specific reverse transcription primer HR-RT, and then the levels of HBV DNA and RNA were simultaneously detected using a quantitative PCR method ( Figure 2 ).

[0066] The specific operation of reverse transcription of HBV RNA into cDNA is as follows: HBV RNA extracted from blood is reverse transcribed into cDNA using RevertAid First Strand DNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA).

[0067] The reverse transcription reaction system (20 μL) is:

[0068]

[0069] The reaction conditions were: 25°C for 5 minutes, 42°C for 60 minutes, and 70°C for 5 minutes.

[0070] Then, quantitative PCR was performed using HBV DNA and RNA forward and reverse primers and probe sequences. The amplification efficiency of different primer combinations for HBV DNA detection was evaluated using the SYBR Green method. The results showed that there was no significant difference in the amplification efficiency of different primer combinations ( Figure 3 ). Subsequently, we compared and analyzed the amplification efficiency of HBV DNA detection primers (HD-F and HD-R1) and HBV RNA detection primers and found that there was no significant difference in the amplification efficiency of the two groups of primers ( Figure 4 ). Based on the previously optimized HBV RNA detection system, the following mainly explores the detection system of HBV DNA in the dual-channel detection method, determines the probe concentration and primer concentration for HBV DNA quantitative detection, and determines the temperature of the dual-channel amplification reaction. The results show that when determining the probe concentration, the curve indicated by the arrow is the amplification curve when 0.6μL of a 10μM probe is added, indicating that the HBV DNA amplification efficiency is best when 0.6μL of a 10μM probe is added to the system ( Figure 5 ); When determining the primer concentration, the curve indicated by the arrow is the amplification curve when 1 μL of 10 μM primer is added, indicating that the amplification efficiency of HBV DNA is best when 1.0 μL of 10 μM primer is added to the system ( Figure 6 ); When determining the annealing temperature of the dual-channel amplification reaction, the amplification efficiency at 58°C and 60°C is better than that at other temperatures ( Figure 7 ).

[0071] The final reaction system and amplification conditions are as follows:

[0072]

[0073] The amplification cycle parameters in the ABI Step One Plus fluorescent quantitative PCR instrument are 50°C, 5 minutes, 94°C, 10 minutes; then 94°C, 15 seconds, 58°C, 45 seconds, 45 cycles; in the extension phase (58°C) of each cycle, fluorescence is collected synchronously multiple times (both FAM and VIC signals are collected).

[0074] Example 3: Construction of HBV DNA plasmid standard

[0075] HBV DNA was extracted from the culture supernatant of HepAD38 cells, a stable HBV replication cell line, and PCR amplified using HD-F and HD-R1 primers. The amplified target fragment was recovered by gel excision and connected to the pEASY-Blunt cloning vector. After sequencing verification, it was used as a standard for the internal laboratory detection of serum HBV DNA.

[0076] The final target fragment sequence is:

[0077] CGGCGTTTTACATCTTCCTCTTCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTACCAAGGTATGTTGCCCGTTTGTC (SEQ ID NO﹕14)

[0078] The peak diagram of sequencing verification is as follows Figure 8 As shown in A.

[0079] HBV RNA was extracted from the culture supernatant of HepAD38 cells, a stable HBV replication cell line. After reverse transcription using HR-RT reverse transcription primers, it was amplified using HR-F and HR-R. The amplified target fragment was recovered by gel excision and connected to the pEASY-Blunt cloning vector. After sequencing verification of the loaded target fragment, it was used as a standard for the internal laboratory detection of blood HBV RNA.

[0080] The final target fragment sequence is:

[0081] AGACCACCAAATGCCCCTATCCTATCAACACTTCCGAAACTACTGTTGTTAGACGACGAGGCAGGTCCCCTAGAAGAAGAACTCCCTCGCCTGTGTCGTGTGTTACGGTGTGA (SEQ ID NO﹕15)

[0082] The peak diagram of sequencing verification is as follows Figure 8 As shown in B.

[0083] Embodiment 4, sensitivity detection

[0084] The constructed HBV DNA standard and HBV RNA standard were diluted 10 times, and the concentrations were 3.00E+09, 3.00E+08, 3.00E+07, 3.00E+06, 3.00E+05, 3.00E+04, 3.00E+03, and 3.00E+02 copies / mL, respectively. The above-determined detection system and cycle parameters were used to quantitatively detect the diluted HBV DNA and HBV RNA standards. The results showed that when detecting HBV DNA standards, the linear range could be as low as 3.00E+03 copies / mL; the linear regression equation of the standard curve was: y=-3.3589x+50.371, and the square of the correlation coefficient R 2 =0.9929( Fig. 9 ). When detecting HBV RNA standards, the linear range can be as low as 3.00E+02 copies / mL; the linear regression equation of the standard curve is: y=-3.3431x+48.671, and the square of the correlation coefficient R 2 =0.999( Fig.10 ).

[0085] In addition, the single-channel detection method was used to detect the HBV DNA and HBV RNA standards in multiple dilutions. The results showed that when detecting the HBV DNA standard, the linear range could be as low as 3.00E+03 copies / mL; the linear regression equation of the standard curve was: y=-3.0297x+47.853, and the square of the correlation coefficient R 2 =0.9974( Fig.11 ). When detecting HBV RNA standards, the linear range can be as low as 3.00E+03 copies / mL; the linear regression equation of the standard curve is: y=-3.4843x+42.71, and the square of the correlation coefficient R 2 =0.9992( Fig.12 ). The above results show that in the dual-channel detection process, its sensitivity is not significantly different from that of single-channel detection. The above results show that the dual-channel quantitative detection method of HBV DNA and RNA has high sensitivity.

[0086] Although the sensitivity of dual-channel detection is not significantly different from that of single-channel detection, dual-channel detection has obvious advantages because the same high sensitivity as single-channel detection can be obtained after one detection in one system, which greatly shortens the detection time.

[0087] Example 5: Specificity Detection

[0088] The reverse transcription sample that has not been treated with DNase I was detected using dual channels. At this time, the sample contained HBV DNA and cDNA formed by the reverse transcription of HBV RNA. After dual channel detection, only the amplification curve of HBV RNA can be detected through the FAM channel; and only the amplification curve of HBV DNA can be detected through the VIC channel. It can be seen that there is no interference between the amplification signals of the two channels, and it has a high specificity. Fig.13 )

[0089] Example 6: Repeatability Detection

[0090] The reverse transcription samples that were not treated with DNase I were selected for detection and repeated 20 times. The results showed that the curves of the 20 repeated tests were basically coincident, and the standard deviation (SD value) of the ct values ​​of the repeated tests was 0.16466, with good repeatability ( Fig.14 ).

[0091] The above is an explanation based on the implementation mode of the present invention, but the present invention is not limited thereto. Those skilled in the art should understand that the present invention can be implemented in a modified and altered manner within the scope of the main purpose of the present invention, and such modified and altered manners should belong to the protection scope of the present invention.

Claims

1. Use of an oligonucleotide group in the preparation of an HBV diagnostic reagent or kit for monitoring safe discontinuation of antiviral treatment of chronic hepatitis B or treatment endpoint, characterized in that: The oligonucleotide set comprises the following components in the same detection system: Special primers for specifically amplifying serum HBV DNA, which are a pair of oligonucleotides consisting of an upstream primer HD-F of SEQ ID NO: 1 and a downstream primer HD-R1 of SEQ ID NO: 6; Special primers for specifically amplifying serum HBV RNA, which are a pair of oligonucleotides consisting of an upstream primer HR-F of SEQ ID NO: 8 and a downstream primer HR-R of SEQ ID NO: 9; A reverse anchor primer for reverse transcription of RNA into cDNA, the nucleotide sequence of which is shown in SEQ ID NO: 11; The dedicated probe HD-probe for specifically amplifying serum HBV DNA has a nucleotide sequence as shown in SEQ ID NO: 7; the dedicated probe HR-probe for specifically amplifying serum HBV RNA has a nucleotide sequence as shown in SEQ ID NO:

13. Further comprising DNA standards and RNA standards, wherein the DNA standard is a pESAY-Blunt plasmid comprising a nucleotide sequence shown in SEQ ID NO: 14; the amplification primers of the DNA standard are a pair of oligonucleotides consisting of an upstream primer shown in SEQ ID NO: 1 and a downstream primer shown in SEQ ID NO: 6; the amplification primers of the RNA standard are a pair of oligonucleotides consisting of an upstream primer shown in SEQ ID NO: 8 and a downstream primer shown in SEQ ID NO: 9; The composition of the detection system is as follows: The detection system can detect DNA and RNA in serum HBV by dual-channel real-time fluorescence PCR, and the reaction conditions of the dual-channel real-time fluorescence PCR are: 50°C, 5 minutes; 94°C, 10 minutes; then 94°C, 15 seconds; 58°C, 45 seconds, a total of 45 cycles.

2. The use according to claim 1, characterized in that The dedicated probe for specifically amplifying serum HBV DNA or the dedicated probe for specifically amplifying serum HBV RNA is one of a TaqMan probe, an MGB probe, and a hybridization probe.

3. The use according to claim 1, characterized in that Connected to the 5' end of the probe is a fluorescent reporter group, which is selected from any one of FAM, VIC, TET, JOE, ROX, CY3, CY5, and HEX, and the dedicated probe for amplifying DNA and the dedicated probe for amplifying RNA have different fluorescent reporter groups; and Connected to the 3' end of the probe is a fluorescence quenching group, and the fluorescence quenching group is selected from any one of BHQ1, BHQ2, BHQ3, TAMRA, DABCYL, NFQ, and Eclipse.

Images