Nucleic acid amplification and chromatography detection kit based on totally-enclosed card box ureaplasma urealyticum and application of nucleic acid amplification and chromatography detection kit
By combining a fully enclosed cartridge reagent kit with RPA isothermal amplification and chromatography technology, the problem of the inability to detect Ureaplasma urealyticum nucleic acid on-site in existing technologies has been solved. This enables efficient and low-cost nucleic acid extraction and amplification detection, which is suitable for rapid detection in primary healthcare institutions.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-27
- Publication Date
- 2026-04-03
AI Technical Summary
Existing Ureaplasma urealyticum nucleic acid detection kits cannot be used for on-site testing and pose a risk of missed detection, especially when the sample size is small.
This fully enclosed cartridge kit, based on RPA isothermal amplification chromatography technology, contains lyophilized bulbs and liquid reagents. It utilizes RPA reagents to amplify lyophilized bulbs, primer probe lyophilized bulbs, magnesium ion lyophilized bulbs, and Bacillus genome lyophilized bulbs (internal standard). Combined with nucleic acid detection chromatography strips, it achieves integrated nucleic acid extraction and amplification detection, avoiding contamination, and amplification is performed in an environment of 39-42℃.
This method enables simultaneous amplification of UU and internal reference genes in the same tube. It is simple to operate, requires no sample addition step, reduces the cost of experimental instruments, and has good detection capability and high sensitivity for 14 serotypes of UU, making it suitable for rapid detection in primary healthcare institutions.
Smart Images

Figure CN121780731A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological detection equipment technology, and in particular to a nucleic acid amplification and chromatography detection kit based on a fully enclosed cassette containing Ureaplasma urealyticum and its application. Background Technology
[0002] Ureaplasma urealyticum (UU) is the smallest prokaryote, intermediate between bacteria and viruses. It lacks a cell wall and utilizes its own urease to break down urea for metabolic energy. Based on its phenotypic, genetic, and molecular biological characteristics, 14 standard serotypes can be divided into two groups: Group 1 includes serotypes 1, 3, 6, and 14; Group 2 includes the remaining 10 serotypes. Pathogenic bacteria are predominantly serotypes 1, 3, 6, and 14, primarily residing in the human urogenital tract. It is closely associated with many urogenital tract infections, perinatal infections, and infertility. The parasitism rate of Ureaplasma urealyticum in the male urogenital tract is approximately 25%, while in the female urogenital tract it ranges from 0% to 80%. Ureaplasma urealyticum can cause non-gonococcal urethritis, cervicitis, prostatitis, and infertility; infection in pregnant women can harm maternal health and fetal survival. Ureaplasma urealyticum can exist in healthy, asymptomatic individuals. It is an opportunistic pathogen that can cause disease under specific conditions. Its pathogenicity is related to a variety of factors, such as host immunity, pathogen serotype, or genotype.
[0003] In the prior art, the latest detection method is to detect Ureaplasma urealyticum nucleic acid using RNA isothermal amplification-gold probe chromatography technology. For example, patent publication number CN110923347A discloses a colloidal gold chromatography kit for detecting Ureaplasma urealyticum nucleic acid and its application. This patent scheme discloses a kit for detecting Ureaplasma urealyticum nucleic acid based on RNA isothermal amplification-gold probe chromatography technology and its application. However, this scheme does not include a nucleic acid extraction step and the sample input is small, which can easily lead to missed detection. Summary of the Invention
[0004] The first objective of this invention is to address the problem described in the background art that existing Ureaplasma urealyticum nucleic acid detection kits cannot achieve on-site detection of Ureaplasma urealyticum nucleic acid, and to provide a nucleic acid amplification and chromatography detection kit for Ureaplasma urealyticum based on a fully enclosed cartridge.
[0005] To achieve the above objectives, the present invention provides the following technical solution: A nucleic acid amplification and chromatography detection kit based on a fully enclosed cassette containing ureaplasma urealyticum, the kit being a kit based on RPA isothermal amplification chromatography technology, the kit containing lyophilized bulb reagents, liquid reagents and nucleic acid detection chromatography strips; 1) The lyophilized pellet reagents include RPA reagent amplification lyophilized pellets, primer probe lyophilized pellets, magnesium ion lyophilized pellets, and Bacillus genome lyophilized pellets as internal standard; 1.1) The RPA reagent lyophilized pellets contain recombinase UvsX, coenzyme UvsY, single-stranded DNA binding protein GP32, DNA polymerase Sau, endonuclease ExoIII, creatine kinase and lyophilization protection solution; 1.2) The primer-probe lyophilized pellet contains an upstream primer for Ureaplasma urealyticum, a downstream primer for Ureaplasma urealyticum, an RPA probe for Ureaplasma urealyticum, an upstream primer for internal standard, a downstream primer for internal standard, an internal standard probe, and a lyophilization protection solution; The 5' end of the Ureaplasma urealyticum RPA probe is labeled with digoxigenin, and its serial number is: UU 16s-P1:DIG-5'GTGCGACGTATCAGATAGTTGGTGAGGT[THF]ATGGCTCACCAAGTC(C3spacer); The sequence number of the upstream primer for Ureaplasma urealyticum is: UU 16s-F: 5'-ATAACATCAATATCGCATGAGAAGATGTAG-3'; The 5' end of the downstream primer for Ureaplasma urealyticum is labeled with biotin, and its sequence number is: UU 16s-R: biotn-5'-TCTCAGTCCCATTGTGGCTGTTC-3'; The internal standard Bacillus RPA probe 5' end is labeled with FAM, and its sequence number is: Bs-P: FAM-5'TCATTGTCGTTTCCCACAGCTGGTCCGCGTTC[THF]TCTCTCCAAGACCTTTG / C3spacer; The sequence number of the upstream primer for the internal standard is: Bs-F: 5'-CATTAACGTTGTCACACGTCTCCTACA; The 5' end of the downstream primer of the internal standard is labeled with biotin, and its sequence number is: Bs-R: biotn-5'TACGCCTGGTCTGACGAAGAGATGGATGA; The aforementioned lyophilized pellets are packed in different compartments inside the cartridge. Specifically, the RPA reagent amplification lyophilized pellets, primer probe lyophilized pellets, and magnesium acetate lyophilized pellets are packed in the amplification reagent compartment, while the Bacillus genomic DNA lyophilized pellets are packed in the internal standard compartment. 2) The liquid reagent includes lysis buffer, washing buffer, elution buffer and diluent; the lysis buffer, washing buffer, elution buffer and diluent are respectively contained in the corresponding lysis buffer compartment, washing buffer compartment, elution buffer compartment and diluent compartment inside the cartridge; 3) The nucleic acid detection chromatography test strip includes absorbent paper, NC membrane, sample pad and PVC base plate. The absorbent paper, NC membrane and sample pad are fixed to the PVC base plate from top to bottom. The NC membrane is coated with T2 detection line, T2 internal standard detection line and C line. The T2 detection line is coated with digoxigenin antibody for capturing digoxigenin markers; The T1 internal standard detection line is coated with FAM antibody for capturing FAM markers; The C line is coated with goat anti-mouse secondary antibody containing biotinylated antibodies for capturing coupled microspheres; The nucleic acid test chromatographic strip is placed in the test chamber on the test plate of the cartridge.
[0006] In the above scheme, the magnesium ion freeze-dried spheres contain magnesium ion compounds and freeze-drying protective liquid.
[0007] In the above scheme, the internal standard Bacillus genome lyophilized pellet contains Bacillus gene DNA and lyophilization protection solution.
[0008] The second objective of this invention is to provide an application of a nucleic acid amplification and chromatography detection kit based on a fully enclosed cartridge for the RPA amplification and nucleic acid detection of Ureaplasma urealyticum.
[0009] This invention offers several advantages: 1) By employing RPA isothermal amplification, this invention can simultaneously amplify two indicators—UU and internal reference genes—in the same tube. The amplification product is double-stranded DNA with molecular markers at both ends. Compared to fluorescent PCR, this kit integrates nucleic acid extraction and amplification detection in a closed environment, eliminating the need for sample loading, effectively preventing contamination. The operation is simple and fully automated. RPA isothermal amplification is performed at 39-42℃, eliminating the need for temperature fluctuations, significantly saving energy and minimizing experimental instrument costs. 2) Due to the significant variation in the MBA gene among the 14 UU serotypes, this invention designs primers and probes on the 16S ribosomal RNA of UU. This ensures both the amplification of UU nucleic acid from all 14 serotypes and the specificity of UU, amplifying only the 16S ribosomal DNA sequence, providing full coverage of all 14 UU serotypes. Furthermore, the primers were designed using multiple rounds of testing to ensure high amplification efficiency for each individual primer, minimal interference between different primers, and excellent overall amplification results. Example 6 shows that the kit of the present invention has excellent detection capability for a total of 14 serotypes of different strains of Ureaplasma urealyticum. 3) The kit of the present invention showed negative results for all 8 negative reference materials listed in the national reference list, proving that the kit of the present invention has no cross-reactivity with other microorganisms. The limit of detection of UU (ATCC number 27815) by the kit of the present invention is 1.00E+04 copies / mL. The sensitivity and specificity of the detection of Ureaplasma urealyticum in 203 clinical reproductive tract swab samples are higher than those of a commercially available fluorescent quantitative PCR kit for the detection of Ureaplasma urealyticum. 4) The present invention adopts RPA isothermal amplification technology and test strip chromatography technology, which has the advantages of low instrument requirements of RPA isothermal amplification and successfully integrates the advantages of colloidal gold rapid detection. Nucleic acid detection by test strip can be interpreted in about 10 minutes. It is also very simple to operate, with low technical requirements for experimental personnel and no special instruments or equipment required, making it easy to promote the detection of Ureaplasma urealyticum nucleic acid to grassroots and remote rural medical institutions. Attached Figure Description
[0010] Figure 1 This describes the internal chamber structure of the reagent kit of the present invention.
[0011] Figure 2 This is a reference diagram showing the status of a test kit when the test strip result is negative.
[0012] Figure 3 This is a reference diagram showing the status of a test kit that has shown a positive result.
[0013] The attached diagram is labeled as follows: 1. Box body; 2. Test strip; 3. Amplification reagent compartment; 4. Internal standard compartment; 5. Sample compartment; 6. Washing compartment; 7. Elution buffer compartment; 8. Diluent compartment; 9. Detection plate. Detailed Implementation
[0014] The technical solution of the present invention will be clearly and completely described below through embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Example 1
[0015] 1. Design of RPA target for Ureaplasma urealyticum 16S (reference gene sequence SEQ ID NO.1) and design of target for internal standard Bacillus subtilis 16S (reference gene sequence SEQ ID NO.2).
[0016] The amplification method of this invention is RPA isothermal amplification, and the detection method is chromatography strip.
[0017] The 5' end of the probe for Ureaplasma urealyticum RPA is labeled with digoxigenin, and its sequence is as follows: UU 16s-P1: DIG-5'GTGCGACGTATCAGATAGTTGGTGAGGT[THF]ATGGCTCACCAAGTC(C3spacer); The sequence of its upstream primer is as follows: UU 16s-F: 5'-ATAACATCAATATCGCATGAGAAGATGTAG-3'; Biotin was labeled at the 5' end of the downstream primer, and its sequence is as follows: UU 16s-R: biotn-5'-TCTCAGTCCCATTGTGGCTGTTC-3'; The 5' end of the RPA probe of the internal standard Bacillus subtilis was labeled with FAM, and its sequence is as follows: Bs-P: FAM-5'TCATTGTCGTTTCCCACAGCTGGTCCGCGTTC[THF]TCTCTCCAAGACCTTTG / C3spacer; The sequence of its upstream primer is as follows: Bs-F 5'-CATTAACGTTGTCACACGTCTCCTACA; The downstream primer is labeled with biotin at its 5' end, and its sequence is as follows: Bs-R: biotn-5'TACGCCTGGTCTGACGAAGAGATGGATGA.
[0018] 2. Preparation of freeze-dried balls.
[0019] This kit contains RPA reagent amplification lyophilized pellets, primer and probe lyophilized pellets, magnesium ion lyophilized pellets, and Bacillus genome lyophilized pellets as internal standard.
[0020] 2.1 The RPA reagent lyophilized pellets contain recombinant enzyme UvsX, coenzyme UvsY, single-stranded DNA binding protein GP32, DNA polymerase Sau, endonuclease ExoIII, creatine kinase, and lyophilization protection solution (3.2% PEG35000, 12% trehalose, 50mM Trizma-acetate). The concentrations for each group are shown in the table below:
[0021] 2.2 The primer and probe lyophilized pellets contain upstream primers for Ureaplasma urealyticum, downstream primers for Ureaplasma urealyticum, Ureaplasma urealyticum probes, upstream primers for internal standards, downstream primers for internal standards, internal standard probes, lyophilization protection solution, and other components. See the table below for details:
[0022] 2.3. Magnesium acetate lyophilized pellets contain magnesium acetate and a lyophilization protectant (3.2% PEG35000, 12% trehalose, 50mM Trizma-acetate). See the list:
[0023] 2.4 The internal standard lyophilized pellets contain Bacillus gene DNA and lyophilization protection solution, etc. See the table below for each component:
[0024] The above-mentioned reagent components are processed into microspheres using a microsphere generator, and then freeze-dried into microspheres using a freeze dryer. These microspheres are then packaged into different compartments of the cartridge. Specifically, the RPA reagent amplification lyophilized microspheres, primer probe lyophilized microspheres, and magnesium acetate lyophilized microspheres are packaged in the amplification reagent compartment, while the internal standard Bacillus genomic DNA lyophilized microspheres are packaged in the internal standard compartment. In addition to the lyophilized microspheres, locating microspheres and drying microspheres are also packaged in the compartments to prevent the microspheres from getting damp and to ensure long-term storage.
[0025] 3. Preparation of nucleic acid extraction reagents In addition to the lyophilized bulbs, this cartridge also includes liquid reagents to complete the nucleic acid extraction function, including lysis buffer, washing buffer, elution buffer, and diluent.
[0026] 3.1 The main function of the lysis buffer is to lyse Ureaplasma urealyticum in the sample to release nucleic acids. Its main component is guanidine salt. It is filled into the sample compartment of the cartridge. The component concentrations are shown in the table below:
[0027] 3.2 The main function of the cleaning solution is to clean guanidine salts and impurities on the nucleic acid binding matrix. It is filled into the cleaning chamber of the cartridge, and the component concentrations are shown in the table below:
[0028] 3.3 The main function of the elution buffer is to elute the nucleic acids bound to the matrix for subsequent isothermal amplification. It is filled into the elution buffer compartment of the cartridge, and the component concentrations are shown in the table below:
[0029] 4. Preparation of nucleic acid detection chromatography test strips The main raw materials needed to prepare nucleic acid test strips include: nitrocellulose membrane (NC membrane), sample pad, absorbent paper, and PVC base plate.
[0030] Its preparation methods include: S1, Spray film: T2 detection line: Digoxin antibody capable of capturing digoxin-labeled substances, with a coating concentration of 1 mg / ml and a spray volume of 1 μL / cm; T2 internal standard detection line: FAM antibody capable of capturing FAM markers, coating concentration of 1 mg / ml, spray volume: 1 μL / cm; Control line (C line): Biotin antibody capable of capturing coupled microspheres, coating concentration of 1 mg / ml, spray volume: 1 μL / cm; S2. After the film is sprayed, place it in a clean constant temperature oven at 37℃ for 2 hours to dry, and store it in a dry environment for later use.
[0031] S3. Cut 2cm lengths of absorbent paper, coated NC film, and sample pad and fix them to the PVC base plate from top to bottom to form the test strip.
[0032] like Figure 1 The diagram shows the internal chamber structure of the kit 1 of this invention. In the diagram, 2 is the test strip, 3 is the amplification reagent compartment, 4 is the internal standard compartment, 5 is the sample compartment, 6 is the washing compartment, 7 is the elution buffer compartment, 8 is the diluent compartment, and 9 is the detection plate. In the above reagents, the RPA reagent lyophilized bulbs, primer probe lyophilized bulbs, and magnesium acetate lyophilized bulbs are contained in the amplification reagent compartment 3. The Bacillus genomic DNA lyophilized bulbs, the internal standard, are contained in the internal standard compartment 4. In addition to the lyophilized bulbs, limiting bulbs and dried bulbs are also contained in the compartments to prevent the bulbs from getting damp and to ensure long-term storage. In the liquid reagents, the lysis buffer is contained in the sample compartment 5, the washing buffer in the washing compartment 6, the elution buffer in the elution buffer compartment 7, and the diluent in the diluent compartment 8. The test strip 2 is contained in the detection compartment on the detection plate 9. The structure and usage of the kit can be found in the structure of the vertical test kit and the nucleic acid extraction and amplification detection method described in Chinese patent application document No. 2025118180863.
[0033] Test Example 1: Detection Limit Test Using the detection line references L1, L2, L3, and L4 from the national reference list for second-generation human ureaplasma nucleic acid detection as the limit of detection, each sample was tested 20 times repeatedly, and all results were positive. The data are as follows:
[0034] The cutoff value for this kit is 201. Gray-scale response values greater than 201 are considered positive. Therefore, based on the data results, all the minimum detection reference materials provided in the national reference list tested positive (test results can be found in the appendix). Figure 3 The diagram showing the positive status meets the national standard YY / T 1256-2024 for the detection of Ureaplasma urealyticum nucleic acid.
[0035] Test Example 2, Repeatability Test: High, medium, and low concentration samples were tested 10 times each, with a coefficient of variation (CV) ≤ 5%. The data are as follows:
[0036] Test Example 3, Specificity Verification: Based on the eight negative reference materials listed in the national reference list—N1:NG, N2:MH, N3:HSV-II, N4:HPV18, N5:CT, N6:HCMV, N7:MP, and N8:GBS—the samples were tested, and the results are as follows:
[0037] The cutoff value for this kit is 201, and the response values of the negative reference samples are all less than 201. Therefore, based on the data results, all the negative test reference samples provided in the national reference list tested negative (test results can be found in the appendix). Figure 3 The diagram showing the positive status meets the national standard YY / T 1256-2024 for the detection of Ureaplasma urealyticum nucleic acid.
[0038] Test Example 4: Pathogen Detection Capability Verification This kit was used to detect positive reference samples of 14 different serotypes of Ureaplasma urealyticum from the national reference varieties, verifying the kit's ability to detect different serotypes of UU. The pathogen was obtained from the national reference reagent for human ureaplasma nucleic acid detection (batch number 370046-202402), purchased from the China National Institutes for Food and Drug Control. The test results are as follows:
[0039] The test results showed that the kit was positive for all 14 serotypes, proving that the kit covers all 14 serotypes and meets the national standard YY / T 1256-2024 for the detection of Ureaplasma urealyticum nucleic acid.
[0040] Test Example 5: Validation of Clinical Samples A total of 203 reproductive tract swabs from the Suzhou Dushu Lake Hospital Laboratory Center were tested using the kit of this invention and the Sansure Biotech UU fluorescence quantitative PCR kit. The results are as follows:
[0041] All samples that tested positive with the kit also tested positive with this kit. This demonstrates that the kit of this invention provides sufficiently high sensitivity and specificity for the detection of Ureaplasma urealyticum (UU) in clinical genital swab samples.
[0042] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.
Claims
1. A nucleic acid amplification and chromatography detection kit based on a fully enclosed cassette containing Ureaplasma urealyticum, characterized in that, The kit is based on RPA isothermal amplification chromatography technology and contains lyophilized bulb reagents, liquid reagents, and nucleic acid detection chromatography strips. 1) The lyophilized pellet reagents include RPA reagent amplification lyophilized pellets, primer probe lyophilized pellets, magnesium ion lyophilized pellets, and Bacillus genome lyophilized pellets as internal standard; 1.1) The RPA reagent lyophilized pellets contain recombinase UvsX, coenzyme UvsY, single-stranded DNA binding protein GP32, DNA polymerase Sau, endonuclease ExoIII, creatine kinase and lyophilization protection solution; 1.2) The primer-probe lyophilized pellet contains an upstream primer for Ureaplasma urealyticum, a downstream primer for Ureaplasma urealyticum, an RPA probe for Ureaplasma urealyticum, an upstream primer for internal standard, a downstream primer for internal standard, an internal standard probe, and a lyophilization protection solution; The 5' end of the Ureaplasma urealyticum RPA probe is labeled with digoxigenin, and its serial number is: UU 16s-P1: DIG-5'GTGCGACGTATCAGATAGTTGGTGAGGT[THF]ATGGCTCACCAAGTC(C3spacer); The sequence number of the upstream primer for Ureaplasma urealyticum is: UU 16s-F: 5'-ATAACATCAATATCGCATGAGAAGATGTAG-3'; The 5' end of the downstream primer for Ureaplasma urealyticum is labeled with biotin, and its sequence number is: UU 16s-R: biotn-5'-TCTCAGTCCCATTGTGGCTGTTC-3'; The internal standard Bacillus RPA probe was labeled with FAM at the 5' end, and its sequence number is: Bs-P: FAM-5'TCATTGTCGTTTCCCACAGCTGGTCCGCGTTC[THF]TCTCTCCAAGACCTTTG / C3spacer; The sequence number of the upstream primer for the internal standard is: Bs-F: 5'-CATTAACGTTGTCACACGTCTCCTACA; The 5' end of the downstream primer of the internal standard is labeled with biotin, and its sequence number is: Bs-R: biotn-5'TACGCCTGGTCTGACGAAGAGATGGATGA The aforementioned lyophilized pellets are packed in different compartments inside the cartridge. Specifically, the RPA reagent amplification lyophilized pellets, primer probe lyophilized pellets, and magnesium acetate lyophilized pellets are packed in the amplification reagent compartment, while the Bacillus genomic DNA lyophilized pellets are packed in the internal standard compartment. 2) The liquid reagent includes lysis buffer, washing buffer, elution buffer and diluent; the lysis buffer, washing buffer, elution buffer and diluent are respectively contained in the corresponding lysis buffer compartment, washing buffer compartment, elution buffer compartment and diluent compartment inside the cartridge; 3) The nucleic acid detection chromatography test strip includes absorbent paper, NC membrane, sample pad and PVC base plate. The absorbent paper, NC membrane and sample pad are fixed to the PVC base plate from top to bottom. The NC membrane is coated with T2 detection line, T2 internal standard detection line and C line. The T2 detection line is coated with digoxigenin antibody for capturing digoxigenin markers; The T1 internal standard detection line is coated with FAM antibody for capturing FAM markers; The C line is coated with goat anti-mouse secondary antibody for capturing biotinylated microspheres; The nucleic acid test chromatographic strip is placed in the test chamber on the test plate of the cartridge.
2. The nucleic acid amplification and chromatography detection kit based on Ureaplasma urealyticum in a fully enclosed cartridge according to claim 1, characterized in that: The magnesium ion freeze-dried pellets contain magnesium ion compounds and freeze-drying protective liquid.
3. The nucleic acid amplification and chromatography detection kit based on Ureaplasma urealyticum in a fully enclosed cartridge according to claim 1, characterized in that: The internal standard Bacillus genome lyophilized pellet contains Bacillus gene DNA and lyophilization protection solution.
4. The application of the nucleic acid amplification and chromatography detection kit based on Ureaplasma urealyticum in a fully enclosed cartridge as described in claim 1 or 2, characterized in that: RPA amplification nucleic acid detection for Ureaplasma urealyticum.
Citation Information
Patent Citations
M. urealyticum nucleic acid detection colloidal gold chromatography kit and application thereof
CN110923347A