RNA nanostructures, preparation methods and uses thereof

Abstract

Disclosed herein is a high Tm RNA nanostructure that can be composed of one or more modules or motifs for constructing a hierarchical or non-hierarchical RNA nanostructure. The RNA nanostructure can have a core domain and three or more double-stranded arms and formulations thereof to conjugate a large amount of therapeutic agents, pH-responsive or enzyme-cleavable drug cargoes. Also disclosed herein is a design strategy for generating synthetic RNA oligonucleotides that can self-assemble into highly thermostable RNA structures. Also disclosed herein is the use of the RNA nanostructure described herein.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application No. 62 / 628,591, filed on February 9, 2018, entitled “RNA Nanostructures with 70°C to 100°C Tm for Solubilizing and Carrying High Copy Numbers of Paclitaxel or Derivatives for Delivery to Tumors,” which is incorporated herein by reference in its entirety.

[0003] This application claims the benefit of U.S. Provisional Application No. 62 / 755,696, filed on November 5, 2018, entitled “RNA Nanostructures, Methods of Making and Uses Thereof,” which is incorporated herein by reference in its entirety.

[0004] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0005] This invention was made with government support under Grant Nos. CA207946, CA186100, CA151648, CA168505, CA209045, and EB019036 awarded by the National Institutes of Health and Grant No. W81XWH-15-1-0052 awarded by the Department of Defense. The government has certain rights in this invention.

[0006] Sequence Listing

[0007] This application contains a sequence listing submitted in electronic form as an ASCII.txt file named "321501-2160_ST25" created on November 9, 2018. The contents of the sequence listing are incorporated herein in their entirety. Background Art

[0008] Chemotherapy still plays a key role in cancer treatment. However, the most frequently used anticancer drugs, including paclitaxel, one of the most active chemotherapeutic agents for the treatment of multiple cancers, are hydrophobic small molecules. The poor water solubility of these small molecules often leads to serious side effects, nonspecific toxicity and low efficacy. An efficient and controlled drug delivery and release platform is needed. Summary of the invention

[0009] In some aspects, described herein is an RNA motif that can be composed of at least three segments of synthetic RNA oligonucleotides, wherein the at least three segments of synthetic RNA oligonucleotides can be coupled to each other, wherein the at least three segments of synthetic RNA oligonucleotides can form a central core domain, and at least three double-stranded arms arranged around the core domain and extending away from the central core domain, wherein the melting temperature of the RNA motif can be greater than 65 degrees Celsius. The modular RNA motif can include 3 to 9 synthetic RNA oligonucleotide chains. One or more segments of the at least three segments of synthetic RNA oligonucleotides can include one or more modified nucleotides. One or more modified nucleotides can be terminal nucleotides or non-terminal nucleotides. The modification can be an alkyne connected to one or more modified nucleotides. The modification can be a linker connected to one or more modified nucleotides. The modular RNA motif can further include a cargo compound molecule connected to the synthetic RNA oligonucleotides of the at least three segments of synthetic RNA oligonucleotides. At least 3 to 100 cargo compound molecules can be connected to the synthetic RNA oligonucleotides. The modular RNA motif can further include a functional group connected to the nucleotides of one or more segments of the at least three segments of synthetic RNA oligonucleotides. The functional group can be connected to the terminal nucleotide. The functional group may be attached to a non-terminal nucleotide. The modular RNA motif may further include a cargo compound attached to the functional group. Each of the at least three synthetic RNA oligonucleotides may include an oligonucleotide sequence having a sequence that is approximately 80-100% identical to any one of SEQ ID NOs: 1-54. The at least three synthetic RNA oligonucleotides may be configured to self-assemble to form the modular RNA motif. The Tm of the modular RNA motif may be greater than about 70 degrees Celsius. The Tm of the modular RNA motif may be in the range of about 70 degrees Celsius to about 100 degrees Celsius. The Tm of the modular RNA motif may be in the range of about 65 degrees Celsius to about 100 degrees Celsius.

[0010] In some aspects, also described herein is a modular RNA motif that can be composed of at least four synthetic RNA oligonucleotides, wherein the at least three synthetic RNA oligonucleotides can be coupled to each other, wherein the at least three synthetic RNA oligonucleotides can form a central core domain, and at least three double-stranded arms can be arranged around the core domain and can extend away from the central core domain. The modular RNA motif can include 4 to 9 synthetic RNA oligonucleotide chains. One or more of the at least three synthetic RNA oligonucleotides can include one or more modified nucleotides. One or more modified nucleotides can be terminal nucleotides or non-terminal nucleotides. The modification can be an alkyne connected to one or more modified nucleotides. The modification can be a joint connected to one or more modified nucleotides. The modular RNA motif can further include a cargo compound molecule connected to the synthetic RNA oligonucleotides of the at least three synthetic RNA oligonucleotides. In some aspects, at least 3 to 100 cargo compound molecules can be connected to the synthetic RNA oligonucleotides. The modular RNA motif can further include a functional group connected to the nucleotides of one or more of the at least three synthetic RNA oligonucleotides. The functional group can be connected to the terminal nucleotide. The functional group is linked to a non-terminal nucleotide. The modular RNA motif may further include a cargo compound linked to the functional group. Each of the at least three synthetic RNA oligonucleotides may consist of an oligonucleotide sequence having a sequence that is about 70-100% identical to any one of SEQ ID NOs: 1-54. The at least three synthetic RNA oligonucleotides may be configured to self-assemble to form the modular RNA motif.

[0011] In some aspects, RNA nanostructures are also described herein, which may include at least two modular RNA motifs as described herein, wherein the at least two modular RNA motifs may be connected to each other. The RNA nanostructure may include a central core, wherein the central core may include a first modular RNA motif; a first layer, wherein the first layer may include at least three modular RNA motifs, wherein each modular RNA motif in the at least three modular RNA motifs of the first layer may be connected to the first modular RNA motif; and a second layer, wherein the second layer comprises at least three modular RNA motifs, wherein each of the at least three modular RNA motifs of the second layer may be connected to the modular RNA motifs in the at least three modular motifs of the first layer. In some aspects, all of the modular RNA motifs in the nanostructure may have the same number of double-stranded arms. In some aspects, the number of double-stranded arms on the modular RNA motifs of the first layer may be different from the number of double-stranded arms on the modular RNA motifs of the first modular RNA motif, the modular RNA motifs of the second layer, or the modular RNA motifs of the first modular RNA motif and the second layer. In some aspects, the number of double-stranded arms on the modular RNA motif of the second layer can be different from the number of double-stranded arms on the modular RNA motif of the first layer, the modular RNA motif of the first layer, or the modular RNA motif of the first layer and the modular RNA motif of the first layer. The number of double-stranded arms on the first modular RNA motif can be different from the number of double-stranded arms on the modular RNA motif of the first layer, the modular RNA motif of the second layer, or the modular RNA motif of the first layer and the second layer. The melting temperature (Tm) of the RNA nanostructure can be greater than 70 degrees Celsius. The Tm of the RNA nanostructure can range from 70 degrees Celsius to about 100 degrees Celsius. The first modular RNA motif can have a larger Tm than the modular RNA motif of the first layer and the modular RNA motif of the second layer. The modular RNA motif of the first layer can have a larger Tm than the modular RNA motif of the second layer. One or more of the RNA motifs can be coupled to one or more cargo compounds. One or more of the RNA motifs can be coupled to one or more functional groups. The cargo compound can be an anticancer compound, a chelator, a radioisotope, a fluorophore, a miRNA, an anti-miRNA, a siRNA, a pH-responsive prodrug, an enzyme-cleavable prodrug, or any combination thereof. One or more of the RNA motifs are coupled to two or more cargo compounds, wherein at least two of the two or more cargo compounds are different types of cargo compounds.

[0012] In some aspects, methods are also described herein that can include the step of administering to a subject a modular RNA motif as described herein or an RNA nanostructure as described herein. The subject can be suffering from or suspected of having cancer.

[0013] In some aspects, described herein are methods of treating cancer or disease in a subject, which may include the step of administering to the subject a modular RNA motif as described herein or an RNA nanostructure as described herein.

[0014] In some aspects, also described herein are RNA nanostructures as described herein for use in the preparation of a medicament for treating a disease or cancer.

[0015] In some aspects, the present invention also describes a system that may include a computing device and an application executable on the computing device, wherein, when executed, the application may cause the computing device to at least: generate a theoretical double-stranded arm (DA) sequence, which may be based at least in part on the GC content of the theoretical DA sequence, the melting temperature (Tm) of the theoretical DA sequence, and the ability to spontaneously dimerize; select one or more DAs for a set of oligomers, which may be based at least in part on the calculated cross-complementarity of a stored set of DAs, wherein the DA with the lowest overall complementarity is selected; calculate oligomer sequences, which may include calculating the reverse complement sequence of the DA sequence, calculating the extension oligomer sequence, and calculating the termination oligomer sequence; and select oligomers based at least in part on the ability of the oligomers to spontaneously dimerize or form dimers, wherein those oligomers that do not spontaneously dimerize and do not form dimers are selected.

[0016] In some aspects, the present invention also describes a method comprising at least the following steps: generating a theoretical double-stranded arm (DA) sequence based at least in part on the GC content of the theoretical DA sequence, the melting temperature (Tm) of the theoretical DA sequence, and the ability to spontaneously dimerize; selecting one or more DAs for a set of oligomers based at least in part on the calculated cross-complementarity of a stored set of DAs, wherein the DA with the lowest overall complementarity is selected; calculating the oligomer sequence, which may include calculating the reverse complement sequence of the DA sequence, calculating the extension oligomer sequence, and calculating the termination oligomer sequence; and selecting oligomers based at least in part on the ability of the oligomers to spontaneously dimerize or form dimers, wherein those oligomers that do not spontaneously dimerize and do not form dimers are selected.

[0017] In some aspects, the present invention also describes the use of the nucleotides, RNA or RNA structures described herein for making hydrophobic or poorly soluble drugs soluble, thereby reducing the drug dosage, reducing drug toxicity or side effects, or avoiding the use of oils or organic solvents to dissolve drugs in cancer chemotherapy.

[0018] In some aspects, the present invention also describes the use of hydrophobic materials for generating RNA micelle structures to carry anti-cancer compounds, therapeutic agents, miRNA, anti-miRNA, siRNA, chelators, radioisotopes, fluorophores, pH-responsive prodrugs or enzyme-cleavable prodrugs.

[0019] The details of one or more aspects of the invention are set forth in the following drawings and description. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figures 1A to 1E The structural basis and assembly principle of pRNA-3WJ-PTX micelles are shown. Figure 1A .The pRNA-3WJ motif is derived from the packaging RNA of bacteriophage phi29. Figure 1B .Angled branching structure of pRNA-3WJ. Figure 1C pRNA-3WJ was conjugated with a lipophilic module (cholesterol, blue), a therapeutic module (PTX, green), and a reporter module (Alexa dye, red). Figure 1D . Schematic diagram of the formation of pRNA-3WJ in aqueous solution through hydrophobic interactions of conjugated lipophilic modules. Figure 1E . The assembly of pRNA-3WJ micelles was analyzed by 1% TAE agarose gel electrophoresis. Upper gel: EtBr channel; lower gel: Alexa647 channel (M: 1 kb plus DNA molecular weight standard (DNA ladder)).

[0021] Figures 2A to 2D The characteristics of pRNA-3WJ micelles are shown. Figure 2A .AFM image. Scale bar: 200 nm. Figure 2B Apparent hydrodynamic diameter measurement by DLS. Top: 3WJ in TMS buffer; Bottom: pRNA-3WJ-PTX micelles in TMS buffer. Figure 2C . Zeta potential measurements by DLS. Figure 2D . Validation of pRNA-3WJ micelle assembly by Nile Red binding assay.

[0022] Figures 3A to 3D RNA-PTX conjugates are shown. Figure 3A .Design principle of RNA-PTX conjugate. PTX-N3 can react with terminal alkyne-labeled RNA through click chemistry, and PTX can be subsequently released from the RNA chain by hydrolysis. Figure 3B Successful RNA-PTX conjugation was analyzed by 20% 8 M urea PAGE in TBE buffer. Figure 3C. Experimental mass prediction of a3WJ-PTX conjugate by mass spectrometry. Figure 3D . In vitro PTX release profile over time.

[0023] Figure 4A and 4B Flow cytometry ( Figure 4A ) and confocal microscopy ( Figure 4B ) Analysis of tumor cell binding and internalization of pRNA-3WJ-PTX micelles in vitro. Shown are nuclear staining (blue); cytoskeleton staining (green); and pRNA-3WJ-PTX micelle binding (red).

[0024] Figures 5A to 5D The cytotoxic and apoptotic effects of PTX-loaded pRNA-3WJ micelles in vitro were shown. Figure 5A The cytotoxic effect of pRNA-3WJ-PTX micelles was determined by MTT assay. Figure 5B The apoptotic effect of pRNA-3WJ-PTX micelles was determined by PI / Annexin V-FITC double staining and FACS analysis. Figure 5C .Caspase-3 assay. Figure 5D In vivo tumor targeting of pRNA-3WJ-PTX micelles in mouse xenografts is shown. Left: Whole body images obtained 4 hours after injection. Right: Organ images obtained 24 hours after injection.

[0025] Figure 6A-6R RNA micelles for micro RNA delivery. Figures 6A-6D .3WJ motif, illustration of 3WJ RNA micelle formation, 2D structure of 3WJ / FA / anti-miR21 micelle, assembly of RNA micelles analyzed by 2% agarose gel (lanes from left to right: 3WJ, 3WJ micelle, 3WJ / anti-miR21, 3WJ / anti-miR21 micelle, 3WJ / FA / anti-miR21, 3WJ / FA / anti-miR21 micelle), size distribution and zeta potential of 3WJ / FA / anti-miR21 micelles. Figure 6E-6G CMC determined by Nile Red encapsulation assay and stability study of RNA micelles at different temperatures, pH and RNase conditions. Figures 6H-6I In vitro binding and internalization of RNA micelles into cancer cells are shown. Binding affinity to KB cells was compared by flow cytometry after 1 hour of treatment. Confocal microscopy shows the internalization distribution. Blue: nucleus; green: cytoskeleton; red: RNA nanoparticles. Figure 6J-6LIn vitro studies of RNA micelles carrying anti-miR21 are shown. Dual luciferase assay demonstrates delivery of anti-miR21 to KB cells. qRT-PCR shows the effect of miR21 knockdown on target gene PTEN expression. Caspase-3 assay shows apoptosis induction after treatment. Figure 6M-6N Shown is an in vivo biodistribution study in mice with xenografts. Whole body images. Ex vivo organ images 8 hr after injection. Figure 6O-6R Figure 2 shows the in vivo therapeutic effect of RNA microclusters in mice with xenografts. Tumor regression curves during 5 injections (red arrows show injection days). Body weight curves of mice during treatment. qRT-PCR and Western blot show PTEN upregulation after in vivo delivery of anti-miR21.

[0026] Fig. 7A and 7C The induction of pro-inflammatory cytokines and chemokines by pRNA-3WJ micelle preparations is shown. Fig. 7A In vitro evaluation of TNF-α, IL6, and IFN-α production by ELISA analysis following incubation of pRNA-3WJ micelles with mouse macrophage-like RAW 264.7 cells. Figure 7B In vivo evaluation of TNF-α, IL6, and IFN-α production by ELISA analysis following injection of pRNA-3WJ mice into C57BL / 6 mice. Figure 7C In vivo chemokine induction profile for pRNA-3WJ micelle preparation.

[0027] Figure 8 The stability of pRNA-3WJ micelle formulations with respect to different pH and temperature is shown.

[0028] Figures 9A to 9C Showing the synthesis of PTX-N3 ( Fig. 9A ), PTX( Fig. 9B ) and PTX-N3( Fig. 9C )'H NMR (400 MHz) spectrum.

[0029] Fig. 10A and 10B RNA-PTX conjugates are shown. Fig. 10A . Stepwise assembly of pRNA-3WJ using unmodified a3WJ chain, 5'-alkyne-modified a3WJ chain, and 5'-PTX-modified a3WJ chain. (M: ultra-low DNA molecular weight standard). Fig. 10B .Solubility of 1 mM free PTX and RNA-PTX in DEPC water.

[0030] Figures 11A-11CGraphs and gel images demonstrating micelle formation are shown. Fig.11A and 11B The concentration of micelle formation according to the Nile red binding assay is shown. Fig. 11C 1% TAE agarose gel electrophoresis (molecular weight standard: 1 kb plus DNA molecular weight standard) is shown.

[0031] Figures 12A to 12F The time course of apoptosis induced by pRNA-3WJ-paclitaxel micelles is shown in a caspase-3-dependent manner.

[0032] Fig.13 Results from a time course of tumor targeting in pRNA-3WJ-PTX microgroups are shown. P: PBS; M-PTX: pRNA-3WJ-PTX microgroups.

[0033] Fig.14 Blot images of pRNA-3WJ micelle-treated mouse sera and control PBS-treated mouse sera are shown.

[0034] Figures 15A to 15D The shape, size and orientation of the modular RNA motif towards high melting temperature (Tm) are shown. Fig.15A .3WJS with different sequences and thermal stabilities. Fig. 15B . Tm analysis by TGGE (thermal gradient gel electrophoresis). Fig. 15C .Tm determination by qPCR. Fig.15D .Exemplary RNA designs that vary shape and cholesterol labeling strategies to optimize membrane anchoring efficiency.

[0035] Fig.16A and 16B The secondary structure of a multi-branched or multi-armed modular RNA motif modified by multiple alkyne groups is shown. Fig.16A .3WJ modular RNA motif modified by 18 alkyne groups. Fig. 16B .4WJ modular RNA motif modified by 24 alkyne groups.

[0036] Fig.17 The optimal ratio of water / organic medium for efficient conjugation of multiple paclitaxel to RNA strands is shown.

[0037] Fig.18 Shown is the stepwise self-assembly of 3WJ and 4WJ RNA nanostructures conjugated with 18-paclitaxel and 24-paclitaxel, respectively, according to native PAGE (molecular weight standard: ultra-low range DNA marker).

[0038] Fig.19 The Tm of 3WJ nanostructures conjugated with 18 paclitaxel according to TGGE is shown (M: monomer).

[0039] Fig. 20A and 20B Sequence design and drug conjugation of synthetic RNA oligonucleotides are shown. Fig. 20A Sequence design of extended 3WJ and 4WJ RNA vectors with paclitaxel (PTX) conjugation. 6-PTX was conjugated to a 4WJ synthetic RNA oligonucleotide. Fig. 20B HPLC chromatograms of purified 4WJ synthetic RNA oligonucleotides with and without 6-PTX conjugation.

[0040] Figures 21A to 21C In vitro characterization is shown. Fig.21A .Stepwise self-assembly of 3WJ with 18PTX and 4WJ with 24PTX (M, D, T represent monomer, dimer, and trimer, respectively). Fig.21B . Size distribution of 4WJ-24PTX measured by DLS. Fig. 21C . Improved solubility of PTX by conjugation to RNA.

[0041] Fig.22A and 22B Shows thermal stability. Fig.22A .TGGE of 4WJ empty vector and 4WJ-24PTX. Fig. 22B .qPCR of 4WJ empty vector and 4WJ-24PTX.

[0042] Fig.23 In vitro cytotoxicity of 4WJ with multiple Taxols using MTT assay is shown. At the same PTX concentration, 4WJ with 24PTX showed higher cytotoxicity compared to PTX alone.

[0043] Fig.24A and 24B Shows the results of animal trials used to test the effectiveness of treatments. Fig.24A . Daily records of tumor volume and body weight of mice. Fig. 24B Comparison of tumor weights before and after sacrifice. The 4WJ-FA-Taxol group showed slower tumor growth compared to the negative control group. No significant decrease in mouse body weight was observed after treatment, which may indicate no significant toxicity.

[0044] Figures 25A to 25C Design and drug conjugation are shown. Fig.25A . Click reaction scheme of modified oligonucleotides and camptothecin (CPT) prodrugs. Fig.25B . Denaturing PAGE was used to monitor conjugation (* indicates 2'-F 4 alkyne; < indicates 2'-F 4CPT). Fig.25CHPLC chromatograms of purified 3WJ chains with and without 4CPT conjugation (black: 2'-Fb 4-alkyne; red: 2'-Fb 4CPT).

[0045] Figures 26A to 26C Assembly and in vitro characterization of a 3-arm modular RNA motif loaded with cargo compounds is shown. Fig.26A .Diagram 3WJ-FA-7CPT. Fig.26B .Non-denaturing PAGE of step-wise assembly of FA-7CPT-3WJ and 3WJ control (lane 1, 2'-Fa 3CPT; lane 2, 2'-Fa3CPT+2'-Fc folate; lane 3, FA-7CPT-3WJ; lane 4, 7CPT-3WJ; lane 5, FA-3CPT-3WJ; lane 6, FA-4CPT-3WJ; lane 7, FA-3WJ; lane 8, 3WJ). Fig.26C .Temperature gradient gel electrophoresis of FA-7CPT-WJ.

[0046] Fig. 27 KB cell viability assay of RNA with one CPT is shown. At the same CPT concentration, 3WJ with one CPT was observed to be slightly more cytotoxic compared to CPT alone.

[0047] Fig.28 Comparison of tumor growth between 3WJ-FA-7CPT and PBS is shown. It was observed that 3WJ-FA-CPT resulted in slower tumor growth compared to the negative control group.

[0048] Figures 29A to 29C Shown are the design and sequence of the branched 3WJ modular RNA motif with three different cores (Phi29, SF5, M2) and four sets of helices (WT, Mod, 30, 32). Fig.29A .Schematic diagram of the design showing different combinations of core and helix. Fig.29B .Sequence design of seven 3WJ modular RNA motifs (Phi29-Mod, Phi29-30, SF5-30, M2-30, Phi29-32, SF5-32, M2-32). Fig.29C . Comparison of branched 3WJ modular RNA motifs with the same set of helices (DA) and different protrusions separating the DA in the core.

[0049] Figures 30A to 30C Showing the thermal stability of the branched 3WJ modular RNA motif in TES buffer. Fig. 30A .qPCR shows annealing curve. Fig. 30B .TGGE shows the melting curve. Fig. 30C . Comparison of Tms measured for annealing and melting of the branched 3WJ modular RNA motif.

[0050] Fig.31A and 31B Showing the enzymatic stability of the branch 3WJ modular RNA motif. Fig.31A . Serum degradation curve. Fig.31B .3WJ half-life in 50% serum.

[0051] Figures 32A to 32D Shown are the design and construction of branched 3WJ RNA nanostructures made from branched 3WJ modular RNA motifs. Fig.32A Three 3WJ modular RNA motifs with different thermal stabilities that serve as structural elements of branched 3WJ RNA nanostructures. Fig.32B . 2D schematic diagram of branched 3WJ RNA nanostructures with different layering. Fig.32C .3D schematic diagram of branched 3WJ RNA nanostructures with different layering. Fig.32D Each branch is composed of 3WJ modular RNA motifs and coupled to form a 3-layer branched nanostructure.

[0052] Figures 33A to 33D Showing the thermal stability of branched 3WJ RNA nanostructures. Fig.33A .qPCR shows annealing curve. Fig.33B .TGGE shows the melting curve. Fig.33C .Comparison of annealing and melting Tm. Fig.33D TGGE shows the thermodynamic stacking release curve of the branched 3WJ RNA module.

[0053] Fig.34A and 34B In vitro characterization of branched 3WJ RNA nanostructures is shown. Fig.34A Size comparison gels showing assembly of 2-layer and 3-layer 3WJ RNA nanostructures. Fig.34B .Size distribution of 2-layer and 3-layer 3WJ RNA nanostructures measured by dynamic light scattering (DLS).

[0054] Figures 35A to 35C Showing the enzymatic stability of branched 3WJ RNA nanostructures. Fig.35A . Serum stable gel. Fig.35B . Serum degradation curve. Fig.35C .3WJ RNA nanostructure half-life in 50% serum.

[0055] Fig.36A and Fig.36B Flow cytometry ( Fig.36A ) and confocal microscopy ( Fig.36B) in vitro cellular binding comparison of 3L-no FA, 3L-core FA, and 3L-external FA.

[0056] Figures 37A to 37C Shown are the design and construction of a modular RNA motif based on branched 3WJ and variants with different numbers of arms. Fig.37A .Different higher-order junctions (cores) serve as structural elements of modular RNA motifs. Fig.37B .Nucleotide sequence of the synthetic modular RNA motif. Fig.37C .3D structure of a modular RNA motif using 6WJ as the core and 4WJ as arms (or branches).

[0057] Figures 38A to 38G Show 3WJ( Fig.38A )、4WJ( Fig.38B )、5WJ( Fig.38C )、6WJ( Fig.38D )、7WJ( Fig.38E )、8WJ( Fig.38F ) and 9WJ( Figure 38G ) 2D structure of a modular RNA motif showing an example synthetic RNA oligonucleotide sequence.

[0058] Figures 39A to 39C Showing the thermal stability of various modular RNA motifs. Fig.39A .qPCR shows annealing curve. Fig.39B .TGGE shows the melting curve. Fig.39C . Comparison of Tm for annealing and melting of modular RNA motifs.

[0059] Fig.40A and Fig.40B In vitro characterization of modular RNA motifs based on branch 3WJ is shown. Fig.40A Size comparison gel: 2% agarose gel showing the assembly of 4-6WJ (from left to right: molecular weight standard, phi29-3WJ, monomer, dimer, trimer, 4WJ, 5WJ, 6WJ). Fig.40B . Size distribution of 4-6WJ measured by dynamic light scattering (DLS).

[0060] Figures 41A to 41G Aspects of modular RNA motifs are shown. The black region identifies the double-stranded arm (DA), and the grey region indicates the core domain of the modular RNA motif. The core domain is also designated as the modular RNA motif region contained within the dotted box.

[0061] Figures 42A to 42GAspects of RNA nanostructures each containing a single type of modular RNA motif are shown. Black modular RNA motifs indicate core or primary modular RNA motifs contained in the RNA nanostructure. Dark grey modular RNA motifs indicate secondary or intermediate level modular RNA motifs contained in the RNA nanostructure. Light grey modular RNA motifs indicate terminal or outermost level modular RNA motifs contained in the RNA nanostructure.

[0062] Fig.43 An aspect of an RNA nanostructure containing different types of modular RNA motifs is shown. Black modular RNA motifs indicate core or primary modular RNA motifs contained in the RNA nanostructure. Dark grey modular RNA motifs indicate secondary or intermediate levels of modular RNA motifs contained in the RNA nanostructure. Light grey modular RNA motifs indicate terminal or outermost levels of modular RNA motifs contained in the RNA nanostructure.

[0063] Figures 44A to 44B Aspects of an RNA nanostructure loaded with a single type of cargo compound or functional group are shown. The black modular RNA motifs indicate the core or primary modular RNA motifs contained in the RNA nanostructure. The dark grey modular RNA motifs indicate the secondary level or intermediate level modular RNA motifs contained in the RNA nanostructure. The light grey modular RNA motifs indicate the terminal or outermost level modular RNA motifs contained in the RNA nanostructure.

[0064] Figures 45A to 45B Aspects of RNA nanostructures loaded with various types of cargo compounds and / or functional groups (including but not limited to active agents) are shown. The black modular RNA motifs indicate the core or primary modular RNA motifs contained in the RNA nanostructure. The dark gray modular RNA motifs indicate the secondary or intermediate level modular RNA motifs contained in the RNA nanostructure. The light gray modular RNA motifs indicate the terminal or outermost level modular RNA motifs contained in the RNA nanostructure.

[0065] Figures 46A to 46B Aspects of RNA nanostructures loaded with various types of cargo compounds and / or functional groups, including but not limited to paclitaxel, are shown. Fig.46A . A nanostructure having a modular RNA motif comprising an extended core with internal modifications that allow specific attachment of an active agent to the core of the nanostructure. Fig.46B .Nanostructures with different functional groups attached to the 5' end or 3' end of the oligonucleotides in each layer.

[0066] Fig.47A to 47D showing computer-derived design concepts for RNA nanostructures. Fig.47A . 2D and 3D representations of RNA nanostructures showing 3-6 branches. Fig.47B Oligomeric sequences and designs of interlocking domains for 3-6 branched RNA nanostructures are shown. Fig.47C Shown are the compositions of individual RNA nanostructure oligomers.

[0067] Fig.48 Flowchart showing the computational algorithm used for computer design of RNA nanostructure oligomer sequences.

[0068] Figures 49A to 49C .Conjugating fluorophores to nucleic acid nanoparticles for in vivo cancer imaging. Fig.49A .PAGE analysis demonstrated that RNA oligomers and nanoparticles can carry multicolor fluorescent materials. Fig.49B .Assembly gel, demonstrating that oligomers can be efficiently assembled after being modified with fluorophores. Fig.49C .Biodistribution of Phi29 3WJ nanoparticles conjugated with ICG fluorophore.

[0069] Figures 50A to 50C .DOTA chelators are conjugated to RNA oligomers and nanoparticles at high density. Fig.50A Figures 50B to 50C. Comparison of RNA nanoparticles with different densities of DOTA conjugates with and without chelated Gd 3+ .

[0070] Figures 51A to 51C .NOTA chelators are conjugated to oligomers and nanoparticles at high density. Fig.51A .Schematic diagram of NOTA chelating Cu64 to RNA nanoparticles for PET imaging. Figures 51B to 51C . Assembly gel and reverse phase HPLC purification of NOTA-conjugated RNA nanoparticles.

[0071] Figures 52A to 52E Shown is the design and synthesis of a pRNA strand with multiple aldehyde groups for conjugation of drugs for pH-responsive drug release. Fig.52A . Schematic diagram of conjugating multiple drugs on the 3WJ core. Fig.52B Examples of drugs containing free amine groups for imine bonding. Fig.52C .Examples of drugs containing a hydroxyl group for acetal linkage. Fig.52D .An example of pH-sensitive linker design using hydrazine bonds. Fig.52E . Example of an acid-labile linker for coupling PI103 prodrug to a nucleic acid oligomer.

[0072] Figures 53A to 53H Shown is the design and preparation of RNA-based thermostable micelles for the delivery of erlotinib for cancer treatment. Fig.53A .Amphiphilic RNA chains with adjustable hydrophobic modifications for the formation of RNA micelles. Fig.53B . Schematic representation of RNA-tocopherol micelles conjugated with functional ligands. Figures 53C to 53H .Determination of critical micelle concentration of five amphipathic RNA chains with tunable hydrophobic modifications.

[0073] Figures 54A to 54P Shown is the design and preparation of CPT-RNA conjugates for inhibiting the growth of KB tumor xenografts. Figures 54A to 54C .CPT-RNA conjugation. Figures 54B-54D .Dissolution of drugs by conjugation to RNA. Figures 54C to 54H .Assembly, thermodynamic stability and size distribution of CPT-carrying RNA nanoparticles. Figures 54D to 54I .Release curve of CPT from RNA nanoparticles. Figures 54J to 54K .Cellular binding and internalization of CPT-RNA nanoparticles. Figures 54L to 54M .Cytotoxic and apoptotic effects of CPT RNA nanoparticles. Figures 54N to 54P .Tumor suppression by CPT RNA NPs in a KB tumor xenograft mouse model. DETAILED DESCRIPTION

[0074] Before describing the present application in more detail, it should be understood that the present disclosure is not limited to the particular aspects described and as such may vary. It should also be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting.

[0075] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present disclosure belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure, only preferred methods and materials are described at present.

[0076] All publications and patents cited in this specification are cited to disclose and describe the methods and / or materials to which the cited publications are related. All such publications and patents are incorporated herein by reference, which is equivalent to specifically and individually specifying that each individual publication or patent is incorporated by reference. This incorporation by reference is explicitly limited to the methods and / or materials described in the cited publications and patents, and does not extend to any dictionary definitions derived from the cited publications and patents. Any dictionary definitions in the cited publications and patents that are not explicitly repeated in this application should not be regarded as such, and should not be understood to define any terms that appear in the attached claims. References to any publications are directed to their disclosures before the filing date, and should not be interpreted as admitting that the present application is not entitled to precede these publications due to prior disclosure. In addition, the publication date provided may be different from the actual publication date that may require independent confirmation.

[0077] After reading this application, it will be apparent to those skilled in the art that each of the various aspects described and illustrated herein has independent elements and features that can be easily separated or combined with the features of any other several aspects without departing from the scope or spirit of the present disclosure. Any described method can be executed in the order of events described or in any other order that is logically feasible.

[0078] It should be noted that ratios, concentrations, amounts and other numerical data can be expressed in the form of ranges herein. It should also be understood that the endpoints of each range are both significantly related to another endpoint and significantly independent of another endpoint. It should also be understood that many values ​​are disclosed herein, and each value is also described herein as "about" this particular value in addition to the value itself. For example, if the value "10" is disclosed, "about 10" is also disclosed. In this article, ranges can be expressed as from "about" a particular value, and / or to "about" another particular value. Similarly, when a value is expressed as an approximate value by using the antecedent "about", it will be understood that the specific value shown forms a further aspect. For example, if the value "about 10" is disclosed, "10" is also disclosed.

[0079] In the case of stating a range, further aspects include from a specific value and / or to another specific value. In the case of providing a range of values, it should be understood that each intermediate value (unless the context clearly states otherwise) between the upper and lower limits of the range and the value or intermediate value of any other statement in the stated range is included in the present application. The upper and lower limits of these smaller ranges can be independently included in the smaller range, and are also included in the present application, subject to any special exclusion limits in the described range. When the stated range includes one or two of the limits, the scope excluding any one or two of those included limits is also included in the present disclosure. For example, when the stated range includes one or two limits, the scope excluding any one or two of those included limits is also included in the present application, such as the phrase "x to y" includes the scope from "x" to "y", and the scope greater than "x" and less than "y". The range may also be expressed as an upper limit, for example, "about x, y, z or less", and should be interpreted as including specific ranges of "about x", "about y", and "about z", as well as ranges of "less than x", "less than y", and "less than z". Similarly, the phrase "about x, y, z or more" should be interpreted as including specific ranges of "about x", "about y", and "about z", as well as ranges of "greater than x", "greater than y", and "greater than z". In addition, the phrase "about 'x' to 'y'", where 'x' and 'y' are numerical values, includes "about 'x' to about 'y'".

[0080] It should be understood that such range format is used for convenience and brevity and, therefore, should be interpreted in a flexible manner to include not only the values ​​explicitly recited as the limits of the range, but also all individual values ​​or sub-ranges contained within the range, as if each value and sub-range were explicitly recited. For illustration, a numerical range of "about 0.1% to 5%" should be interpreted as including not only the values ​​explicitly recited as about 0.1% to about 5%, but also the individual values ​​(e.g., about 1%, about 2%, about 3%, and about 4%) and sub-ranges (e.g., about 0.5% to about 1.1%; about 5% to about 2.4%; about 0.5% to about 3.2%, and about 0.5% to about 4.4%, as well as other possible sub-ranges) within the indicated range.

[0081] As used in the specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0082] As used herein, "about", "approximately", "substantially", and the like, when used in conjunction with a numerical variable, can generally refer to the value of the variable and all values ​​of the variable within experimental error (e.g., within a 95% confidence interval for the mean) or within ±10% of the indicated value, whichever is greater. As used herein, the terms "about", "approximately", "for or about", and "substantially" can indicate that the amount or value in question can be an exact value, or a numerical value that provides an equivalent result or equivalent effect as described in the claims or taught herein. That is, it should be understood that the amount, size, formula, parameter, and other quantities and characteristics are not and need not be exact, but can be approximated and / or larger or smaller as needed, reflecting tolerances, conversion factors, rounding, measurement errors, etc., and other factors known to those skilled in the art, so as to obtain equivalent results or effects. In some cases, the value that provides an equivalent result or effect cannot be reasonably determined. Generally, whether or not it is explicitly stated as such, the amount, size, formula, parameter, or other quantity or characteristic is "about", "approximately", or "for or about". It should be understood that when "about," "approximately," or "is or approximately" is used before a quantitative value, the parameter also includes the specific quantitative value itself, unless specifically stated otherwise.

[0083] Unless otherwise indicated, aspects of the present disclosure will employ techniques of molecular biology, microbiology, organic chemistry, biochemistry, physiology, cell biology, cancer biology, physics, and the like, which are within the skill of the art and are fully explained in the literature.

[0084] Before describing various aspects of the present disclosure in detail, it should be understood that, unless otherwise stated, the present disclosure is not limited to specific materials, reagents, reaction materials, manufacturing methods, etc., because these can vary. It should also be understood that the terms used herein are only for the purpose of describing specific aspects and are not intended to be limiting. Unless the context clearly indicates otherwise, it is also possible in the present application that steps are performed in different orders where it is logically possible.

[0085] definition

[0086] As used herein, "active agent" or "active ingredient" refers to a component of a composition to which all or part of the effect of the composition is attributed. An active agent can be a pharmaceutically active compound, a molecule (including but not limited to a chemical molecule and a biological molecule), or other substance that can induce an effect (e.g., a pharmaceutical effect and / or a biological effect) in a subject to which it is administered when it is in contact with an RNA nanostructure and / or when it is not in contact with an RNA nanostructure.

[0087] As used herein, the term "administering" refers to any method of providing a composition to a subject. Such methods are well known to those skilled in the art and include, but are not limited to, intracardiac administration, oral administration, transdermal administration, inhalation administration, nasal administration, topical administration, intravaginal administration, ocular administration, intraauricular administration, intracerebral administration, rectal administration, sublingual administration, oral administration, and parenteral administration, including injection administration such as intravenous administration, intraarterial administration, intramuscular administration, and subcutaneous administration. Administration may be continuous or intermittent. In various aspects, the preparation may be administered therapeutically; that is, administered to treat an existing disease or condition. In further various aspects, the preparation may be administered prophylactically; that is, administered for the prevention of a disease or condition.

[0088] As used herein, "anti-infective agents" may include, but are not limited to, antibiotics, antibacterial agents, antifungal agents, antiviral agents, and antiprotozoal agents.

[0089] As used herein, "aptamer" may refer to a single-stranded DNA or RNA molecule that can bind to a preselected target, including a protein, with high affinity and specificity. Their specificity and properties are not directly determined by their primary sequence, but by their tertiary structure.

[0090] As used herein, "connected", "connected" and the like can refer to the formation of covalent or non-covalent binding (e.g., bond) between two or more molecules, or the conjugation of two or more molecules. As used herein, "connected", "connected" and the like can refer to two or more molecules directly binding together, without intermediate molecules between those molecules connected together, or refer to two or more molecules indirectly connected together mediated by one or more joints. In the case where the binding is non-covalent, this can encompass charge interactions, affinity interactions, metal coordination, physical adsorption, host-guest interactions, hydrophobic interactions, TT stacking interactions, hydrogen bonding interactions, van der Waals interactions, magnetic interactions, electrostatic interactions, dipole-dipole interactions and / or combinations thereof. In the case where the binding is covalent, this can encompass a bond that shares a pair of electrons between one or more atoms in each molecule involved.

[0091] As used herein, the term "contacting" refers to bringing together a disclosed composition or peptide or pharmaceutical preparation and a cell, target receptor or other biological entity in such a way that the compound can affect the activity of the target (e.g., receptor, transcription factor, cell, etc.) directly (i.e., by interacting with the target itself) or indirectly (i.e., by interacting with another molecule, cofactor, factor or protein on which the target activity depends).

[0092] As used herein, a "control" is an alternative subject or sample used in an experiment for comparison purposes and is included to minimize or differentiate the effects of variables other than the independent variable. A "control" can be a positive control or a negative control.

[0093] As used herein, "coupled" or "coupled to" refers to the direct or indirect connection or joining or other joining of two or more components of a larger structure or system.

[0094] As used herein, "conjugated" has the same meaning as "linked".

[0095] As used herein, "deoxyribonucleic acid (DNA)" and "ribonucleic acid (RNA)" may generally refer to any polyribonucleotide or polydeoxyribonucleotide, which may be unmodified RNA or DNA, or modified RNA or DNA. RNA may be in the form of non-coding RNA or coding mRNA (messenger RNA), non-coding RNA such as tRNA (transfer RNA), snRNA (small nuclear RNA), rRNA (ribosomal RNA), antisense RNA, RNAi (RNA interference construct), siRNA (short interfering RNA), micro RNA (miRNA) or ribozyme, aptamer, guide RNA (gRNA).

[0096] As used herein, "dose," "unit dose," or "dosage" refers to physically discrete units suitable for administration into a subject, each unit containing a predetermined quantity of a nanoparticle composition or formulation calculated to produce the desired response associated with its administration.

[0097] As used herein, the term "effective amount" refers to an amount sufficient to achieve a desired result or to have an effect on an undesirable state. For example, in one aspect, an effective amount of polymeric nanoparticles is an amount that kills and / or inhibits cell growth without causing additional damage to surrounding non-cancerous cells. For example, a "therapeutically effective amount" refers to an amount sufficient to achieve a desired therapeutic result or to have an effect on undesirable symptoms, but generally not sufficient to cause adverse side effects. The specific therapeutically effective dosage level for any particular patient will depend on a variety of factors, including the condition being treated and the severity of the condition; the specific composition used; the patient's age, weight, overall health, sex and diet; the time of administration; the route of administration; the excretion rate of the specific compound used; the duration of treatment; drugs used in combination or simultaneously with the specific compound used and similar factors well known in the pharmaceutical field.

[0098] As used herein, "identity", "identity" and the like may refer to the relationship between two or more nucleotide or polypeptide sequences as determined by comparing the sequences. In the art, "identity" also refers to the degree of sequence relatedness between nucleotides or polypeptides as determined by the match between such sequence strings. "Identity" can be readily calculated by known methods, including but not limited to those described in (Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and the Genome Project, Smith, DW, ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, AM and Griffin, HG, ed., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, Von Heinje, G., Academic Press, 1987; and Primer of Sequence Analysis, Gribskov, M. and Devereux, J., ed., Stockton Press, New York, 1991; and Carillo, H. and Lipman, D., SIAM J. Appl. Math., 1988, 48: 1073). Preferred methods for determining identity are designed to give the largest match between the sequences tested. Methods for determining identity are encoded in publicly available computer programs. The percent identity between two sequences can be determined by using analysis software (e.g., Sequence Analysis Software Package of the Genetics Computer Group in Madison, Wisconsin, USA) that incorporates the Needelman and Wunsch (J. Mol. Biol., 1970, 48: 443-453) algorithm (e.g., NBLAST and XBLAST). Unless otherwise stated, the default parameters are used to determine the identity of the polypeptides of the present disclosure.

[0099] As used herein, an "immunomodulatory agent" may refer to an agent, such as a therapeutic agent, that is capable of regulating or modulating one or more immune functions or responses.

[0100] As used herein, the term "motif" with respect to the nanoparticle stage is intended to refer to double-stranded or single-stranded RNA or its analogs. Individual motifs are joined together into larger particles by linking to each other. Linking can occur by non-covalent bonding.

[0101] The term "nanoparticle" as used herein is intended to refer to particles having a diameter from 1 nm to up to 1,000 nm. The nanoparticle may be 5 nm to 30 nm, 10 nm to 50 nm, 10 nm to 40 nm, 10 nm to 30 nm, 10 nm to 20 nm, and 10 nm to 15 nm. RNA may be obtained from any source, such as bacteriophage phi 29, HIV, fruit flies, ribosomes, or may be synthetic RNA.

[0102] As used herein, the term "nanostructure" is intended to refer to a structure of 1 nm to up to 1,000 nm when measured along its largest dimension in any direction. As measured along its largest dimension in any direction, a nanostructure may be 5 nm to 30 nm, 10 nm to 50 nm, 10 nm to 40 nm, 10 nm to 30 nm, 10 nm to 20 nm, and 10 nm to 15 nm.

[0103] As used herein, the terms "nucleic acid" and "polynucleotide" generally refer to a sequence string of at least two base-sugar-phosphate combinations, and particularly refer to single-stranded and double-stranded DNA, DNA mixed with single-stranded and double-stranded regions, single-stranded and double-stranded RNA, and RNA mixed with single-stranded and double-stranded regions, hybrid molecules comprising DNA and RNA, the DNA and RNA can be single-stranded, or more typically double-stranded, or a mixture of single-stranded and double-stranded regions. In addition, as used herein, polynucleotide refers to a triple-stranded region comprising RNA or DNA or both RNA and DNA. The chains in such a region can be derived from the same molecule or from different molecules. The region can include all of one or more of the molecules, but more typically only involves regions of some of the molecules. One of the molecules with a triple helical region is typically an oligonucleotide. "Polynucleotide" and "nucleic acid" also include such chemically modified, enzymatically modified or metabolically modified polynucleotide forms, as well as chemical forms of DNA and RNA characteristic of viruses and cells, particularly including simple cells and complex cells. For example, the term polynucleotide includes DNA or RNA comprising one or more modified bases as described above. Thus, DNA or RNA including unusual bases such as inosine, or modified bases such as tritylated bases (to name just two examples) are polynucleotides as used herein. "Polynucleotide nucleic acid" and "nucleic acid" also include PNA (peptide nucleic acid), phosphorothioate and other variants of the phosphate backbone of natural nucleic acids. Natural nucleic acids have phosphate backbones, and artificial nucleic acids may contain other types of backbones, but contain the same bases. Thus, DNA or RNA with a backbone modified for stability or other reasons is a "nucleic acid" or "polynucleotide" as that term is meant herein. In particular, "polynucleotide" and "nucleic acid" also include 2' fluoro, 2' O-methylation, LNA (locked nucleic acid), and other variants of 2' modification of the ribose (sugar) portion of natural nucleic acids. Natural nucleic acids (DNA and RNA, respectively) have protons or hydroxyls at the 2' ribose position, and artificial nucleic acids may contain other forms of 2' modification to increase thermodynamic and enzymatic stability. Thus, a DNA or RNA with a modified 2' ribose position for stability or other reasons is a "nucleic acid" or "polynucleotide" as that term is intended herein. "Nucleic acid sequence" and "oligonucleotide" as used herein also encompass nucleic acids and polynucleotides as defined above.

[0104] The term "pharmaceutically acceptable" describes a material that is not biologically or otherwise undesirable, that is, does not induce unacceptable levels of undesired biological effects or interact with other materials in a deleterious manner.

[0105] As used herein, "pharmaceutically acceptable carrier or excipient" refers to a carrier or excipient that can be used to prepare a pharmaceutical formulation that is generally safe, non-toxic, and not biologically or otherwise undesirable, and includes carriers or excipients that are acceptable for veterinary use as well as human pharmaceutical use. "Pharmaceutically acceptable carrier or excipient" as used in the specification and claims includes one and more than one such carrier or excipient. As used herein, "pharmaceutically acceptable carrier" refers to a sterile aqueous or non-aqueous solution, dispersion, suspension or emulsion, and a sterile powder for reconstitution into a sterile injectable solution or dispersion prior to use. Examples of suitable aqueous and non-aqueous carriers, diluents, solvents or carriers include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), carboxymethylcellulose and suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate. For example, by using a coating material such as lecithin, by maintaining the desired particle size in the case of a dispersion, and by using a surfactant, appropriate fluidity can be maintained. These compositions may also include adjuvants, such as preservatives, wetting agents, emulsifiers and dispersants. By including various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid and the like, it is possible to ensure that the action of microorganisms is prevented. It is also desirable to include isotonic agents, such as sugars, sodium chloride and the like. Extended absorption of injectable drug forms may be caused by including agents such as aluminum monostearate and gelatin (which delay absorption). Injectable depots are prepared by forming drug microcapsule matrices in biodegradable polymers such as polylactide-polyglycolide, poly(orthoesters) and poly(anhydrides). Depending on the ratio of drug to polymer and the properties of the specific polymer used, the rate of drug release can be controlled. Injectable depot preparations are also prepared by trapping the drug in liposomes or microemulsions compatible with body tissues. Injectable preparations can be sterilized, for example, by filtering through a bacteria-retaining filter or by adding a sterilizing agent in the form of a sterile solid composition that can be dissolved or dispersed in sterile water or other injectable sterile media before use. Suitable inert carriers can include sugars such as lactose. In some aspects, at least 95% by weight of the active ingredient particles have an effective particle size in the range of 0.01 to 10 microns.

[0106] As used herein, the term "prevention" refers to excluding, avoiding, eliminating, preventing, stopping or hindering something (e.g., a disease or its symptoms) from happening, particularly by acting in advance. It should be understood that, unless otherwise specifically noted, where "reduce," "inhibit," or "prevent" is used herein, the application of the other two words is also explicitly disclosed. For example, in one aspect, "prevention" can refer to preventing the replication of cancer cells or preventing the metastasis of cancer cells. The term "prevention" includes maintaining or limiting a disease in a subclinical state.

[0107] As used herein, "self-assembly" refers to the ability of nucleic acid (and in some cases preformed nucleic acid nanostructures (for example, crystals)) to anneal to each other in a sequence-specific manner, in a predicted manner, and in the absence of external control. In some respects, nucleic acid nanostructure self-assembly methods include combining nucleic acids (such as single-stranded nucleic acids or oligonucleotides) in a single container and allowing nucleic acids to anneal to each other based on sequence complementarity. In some respects, this annealing process involves placing nucleic acid under high temperature, then gradually reducing the temperature to facilitate sequence-specific binding. Various nucleic acid nanostructures or self-assembly methods are known and recorded in this article.

[0108] As used herein, the term "subject" refers to a target of administration, for example, an animal, a human, a cell or a cell population. Therefore, the subject of the methods disclosed herein can be a vertebrate, such as a mammal, a fish, a bird, a reptile or an amphibian. The subject of the methods disclosed herein can be a human, a non-human primate, a horse, a pig, a rabbit, a dog, a sheep, a goat, a cow, a cat, a guinea pig or a rodent. The term does not specify a specific age or gender. Therefore, it is intended to cover adult and newborn subjects, as well as embryos, and whether male or female. In one aspect, the subject is a patient. A patient refers to a subject suffering from a disease or condition (such as, for example, cancer and / or abnormal cell growth). The term patient includes human and veterinary subjects. In one aspect, the subject has been diagnosed as needing treatment of cancer and / or abnormal cell growth.

[0109] discuss

[0110] RNA nanotechnology provides great prospects for treating diseases including but not limited to cancer. RNA nanoparticles can be used as carriers of various active agents. However, current RNA nanoparticles cannot be delivered based on RNA nanotechnology. For example, current RNA nanoparticles are limited to that they can only be conjugated with a kind of active agent with each RNA chain of RNA nanoparticles. Because RNA nanoparticles are larger in size than the conjugated active agent, the molar concentration of the active agent carried by RNA nanoparticles is low. In other words, the loading efficiency of RNA nanoparticles is low. This causes the active agent delivered to the subject by these RNA particles to be low in amount and ineffective, thereby making the current RNA nanoparticles not a suitable carrier for delivering active agents to treat and / or prevent diseases.

[0111] Although the direct method to solve this problem is to conjugate more active agent molecules to each RNA nanoparticle, the attempt to solve the problem of low loading efficiency in this way fails. This failure can be attributed at least in part to the folding energy and melting temperature (Tm) of RNA. The dissociation of RNA nanoparticles is caused by conjugating multiple active agent molecules to each RNA nanoparticle through covalent bonding.

[0112] In addition to the low loading efficiency of current RNA nanoparticles, current RNA nanoparticles also dissociate after systemic injection. This may be due to physical hindrance, low Tm and / or low thermal stability of current RNA nanoparticles.

[0113] In view of the defects of current RNA nanoparticles, described herein is the RNA nanostructure that can be composed of one or more modular RNA motifs.This RNA nanostructure can load one or more activating agents and can have ultrahigh thermal stability, ultrahigh melting temperature and other physical properties that contribute to increase loading efficiency and / or capacity.The RNA nanostructure containing or not containing activating agent described herein can be administered to a subject.By reviewing the accompanying drawings, specific embodiments and examples below, other compositions, compounds, methods, features and advantages of the present disclosure will be apparent or become apparent to those of ordinary skill in the art.All these additional compositions, compounds, methods, features and advantages are intended to be included in this specification, and are within the scope of the present disclosure.

[0114] RNA Nanostructures

[0115] Described herein is the RNA nanostructure that can be composed of one or more modular RNA motifs. The modular RNA motifs can each be composed of 3-9 separate synthetic RNA oligonucleotides designed (or configured) to self-assemble into highly ordered modular RNA motifs. During assembly, the modular RNA motifs can be composed of multiple double-stranded arms (DA) that can be arranged around the core domain. Multiple modular RNA motifs can be connected to each other to form RNA nanostructures. Figures 41A-45B Various aspects of modular RNA motifs and RNA nanostructures are shown. With a general understanding of RNA nanostructures in mind, various aspects of modular RNA motifs and RNA nanostructures are now described in more detail.

[0116] Modular RNA motifs

[0117] As described above, RNA nanostructures may include one or more modular RNA motifs. Figures 41A-41G Displays aspects of modular RNA motifs. Figures 41A-41G As shown, modular RNA motifs can be composed of 3, 4, 5, 6, 7, 8 or 9 synthetic single-stranded RNA oligonucleotides, which can be self-assembled into modular RNA motifs by hybridization. The length of each synthetic single-stranded RNA oligonucleotide can be about 16 to about 120 bases. The exact sequence of each synthetic single-stranded RNA oligonucleotide in each modular RNA motif can be designed so that they obtain specific physical properties when assembled with 2 or more other synthetic single-stranded RNA oligonucleotides. RNA motifs can be composed of 3, 4, 5, 6, 7, 8 or 9 synthetic RNA oligonucleotides. Synthetic RNA oligonucleotides can be designed so that they form highly ordered 2-D and / or 3-D structures after self-assembly. During self-assembly, synthetic RNA oligonucleotides form highly ordered structures, which are referred to as modular RNA motifs in this article. For example, Figures 41A-41G As shown, the 2-D structure can depend at least in part on the number of synthetic RNA oligonucleotides. The RNA nanostructure can have 3, 4, 5, 6, 7, 8 or 9 double-stranded arms (DA) from the core domain. The DA can be arranged symmetrically or asymmetrically around the core domain.

[0118] The core domain can have 0-4 symmetrical or asymmetrical protruding nucleotides that separate each DA, which can allow optimization of the thermodynamic stability, spatial confinement, and / or structural arrangement of each ring. Changes in the number of double-stranded sequences (DA) and unpaired core nucleotides can affect the thermodynamic stability of modular RNA motifs and / or RNA nanostructures. Therefore, physical properties and functional properties can be optimized by changing the sequence of synthetic RNA oligonucleotides that form modular RNA motifs. For example, Figure 1BA modular RNA motif is shown with 3 DAs, and an asymmetric protrusion (5'UUU3') between H2 and H3 DA and an asymmetric protrusion (5'U3') between H1 and H2 DA. In another example, Fig.29C A modular RNA motif containing three DAs with different asymmetric protrusions but identical DAs (U|UUU|-, -|GG|-, and -|C|CU between their H1|H2|H3DAs, respectively) was shown, resulting in different annealing Tm values ​​( Fig. 30A ).in addition, Figures 38A to 38G A modular RNA motif with 3-9 DAs is shown with a symmetrical protrusion (5'UG3') between each DA.

[0119] As shown in 41A to 41G, the RNA oligonucleotides self-assemble so that the modular RNA motif comprises 3, 4, 5, 6, 7, 8 or 9 DA ( Figures 41A to 41B The core domain (shown in black in Figures 41A to 41G DAs can be arranged around the core region so that an angle (θ) is formed between any two adjacent DAs. Fig.41A In the example, the modular RNA motif contains three synthetic RNA oligonucleotides that self-assemble to form a modular RNA motif with three DAs. The angle formed between DA1 and DA2 is recorded as θ. 2 , the angle formed between DA1 and DA3 is recorded as θ 3 , and the angle formed between DA3 and DA2 is recorded as θ 1 . Figures 41B to 41G The modular RNA motifs shown in each figure have similar symbol labels. DA can be substantially symmetrically positioned around the core domain. In other aspects, DA is not symmetrically positioned around the core domain. Table 1 shows Figures 41A to 41G Angular range for each modular RNA motif cited in .

[0120] Table 1. Perspectives on modular RNA motifs.

[0121]

[0122]

[0123] The melting temperature (Tm) of the modular RNA motif can be about 65° C. or higher. In some aspects, the melting temperature of the modular RNA motif can be greater than 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the Tm of the modular RNA motif can be 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100°C. In some aspects, the melting temperature of the modular RNA motif can range from 65°C to 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100°C. In some aspects, the melting temperature of the modular RNA motif can range from 66 to 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 67 to 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 68 to 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 69 to 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C.In some aspects, the melting temperature of the modular RNA motif can range from 70 to 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 71 to 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 72 to 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 73 to 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 74 to 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 75 to 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 76 to 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 77 to 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 78 to 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100°C.In some aspects, the melting temperature of the modular RNA motif can range from 79 to 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 80 to 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 81 to 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 82 to 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 83 to 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 84 to 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 85 to 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 86 to 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 87 to 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 88 to 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 89 to 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 90 to 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 91 to 92, 93, 94, 95, 96, 97, 98, 99, or 100° C.In some aspects, the melting temperature of the modular RNA motif can range from 92 to 93, 94, 95, 96, 97, 98, 99 or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 93 to 94, 95, 96, 97, 98, 99 or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 94 to 95, 96, 97, 98, 99 or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 95 to 96, 97, 98, 99 or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 96 to 97, 98, 99 or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 97 to 98, 99 or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 98 to 99 or 100° C. In some aspects, the melting temperature of the modular RNA motif can range from 99 to 100°C.

[0124] Synthetic RNA oligonucleotides

[0125] As mentioned above, modular RNA motifs can be composed of 3-9 sections of independent synthetic RNA oligonucleotides, which can self-assemble to form modular RNA motifs. Synthetic RNA oligonucleotides can be single-stranded. Each section of independent synthetic RNA oligonucleotides can be composed of 16-120 nucleotides. Nucleotides can be natural ribonucleotides or can be modified. In some aspects, synthetic RNA oligonucleotides can be 2' modified. 2' modification or other modifications can be 2' fluoro-, 2' O-methylation-, LNA- or any other backbone, sugar or base modified ribonucleotides, or any combination of natural ribonucleotides, backbones, sugars and base modified ribonucleotides. Modification is further discussed in other parts of this article. Each synthetic RNA oligonucleotide can be composed of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 19, 20, 21, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119 or 120 nucleotides or any range of nucleotides therein. Each section of synthetic RNA oligonucleotide can be designed and configured so that it can self-assemble into a modular RNA motif as described in other parts of this paper with 2, 3, 4, 5, 6, 7 or 8 other synthetic RNA oligonucleotides. The rational design of synthetic RNA oligonucleotides is described in other parts of this

[0126] The nucleotides may be unmodified nucleotides or modified nucleotides. The modification may be a 5'-terminal modification and / or a 3'-terminal modification and / or a 2'-internal sugar modification and / or an internal base modification. Typical 5'-terminal modifications include amino, carboxyl, phosphate, thiol, maleimide, alkyne, cholesterol, aldehyde, carbon spacer, PEG-spacer, doubler, trebler, photolyzable amino, photolyzable spacer, fluorophore (e.g., anthocyanidin 3, 3.5, 5, 5.5, 7, fluorescein, etc.), biotin, desthiobiotin, digoxin, quencher (dabcyl, dabsyl, BlackHole, BBQ650, etc.) or other 5' modifications known to experienced users in the art. Typical 3' terminal modifications include amino, carboxyl, phosphate, thiol, alkyne, cholesterol, carbon spacer, PEG-spacer, fluorophore (e.g., cyanidin 3, 3.5, 5, 5.5, 7, fluorescein, etc.), biotin, desthiobiotin, digoxigenin, quencher (dabcyl, dabsyl, BlackHole, BBQ650, etc.) or other 3' modifications known to users experienced in the art. Typical internal modifications include amino-dA, amino-dC, amino-dT, carboxyl-dT, 2'O-propargyl, 2'-amino, 2'-fluoro, 2'-methoxy, 5-ethynyl-dU, C8-alkyne-dC, C8-alkyne-dT, carbon spacers, PEG-spacers, fluorophores (e.g., cyanidins 3, 3.5, 5, 5.5, 7, fluorescein, etc.), biotin, desthiobiotin, digoxin, quenchers (dabcyl, dabsyl, BlackHole, BBQ650, etc.), or other 5' modifications known to experienced users in the art. The modification may be an alkynyl group attached to a nucleotide. The modification may be a functional group attached to a nucleotide. Suitable functional groups are described elsewhere herein. The alkynyl group or functional group present in each synthetic RNA oligonucleotide can facilitate conjugation of the cargo compound at a site containing an alkynyl group via, for example, click chemistry. See, for example Figure 3A. In a synthetic RNA oligonucleotide, one or more terminal (e.g., 5' end and / or 3' end) nucleotides can be modified. One or both ends of a synthetic RNA oligonucleotide can be modified. In some aspects, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, or 120 nucleotides may be modified. In some aspects, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, or 120 nucleotides may be unmodified.48,49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110 114, 115, 116, 117, 118, 119 or 120, or any combination thereof. Where multiple modified nucleotides are present, the modified nucleotides may be adjacent to each other or may be separated by one or more unmodified nucleotides. In some aspects, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more unmodified nucleotides can be between two modified nucleotides.

[0127] In some aspects, the synthetic RNA oligonucleotide can have a sequence according to any one of SEQ ID NOs: 1-54. In some aspects, the synthetic RNA oligonucleotide can have a sequence that is 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or about 99 percent identical to any one of SEQ ID NOs: 1-54.

[0128] Method for preparing synthetic RNA oligonucleotides

[0129] The synthetic RNA oligonucleotides, polynucleotide functional groups and polynucleotide cargo compounds can be synthesized using standard molecular biology and biochemical techniques. In other words, the various nucleic acids that can form RNA nanoparticles can be synthesized de novo or produced or transcribed in vitro by various nucleic acid expression vectors as needed. Such synthetic techniques are known to those skilled in the art.

[0130] RNA Nanostructures

[0131] In some aspects, a single modular RNA motif can be an RNA nanostructure. RNA nanostructures that can include two or more modular RNA motifs are also described herein. For example, Figures 42A to 42G As shown, RNA nanostructures can be ordered. Primary modular RNA motifs (e.g. Fig.42A to the black modular RNA motif in 42G) can be linked or otherwise coupled to 3-9 additional modular RNA motifs to form an intermediate layer (e.g. Figures 42A to 42G Each modular RNA motif in the middle layer can be connected or otherwise coupled to 3-9 additional modular RNA motifs. In some aspects, the modular RNA motifs connected or otherwise coupled to the middle layer of the RNA nanostructure can form the terminal layer or outer layer of the RNA nanostructure (e.g. Figures 42A to 42G In other embodiments, the modular RNA motifs connected or otherwise coupled to the middle layer of the RNA nanostructure can form another middle layer. In some aspects, the RNA nanostructure can have 1 middle layer of modular RNA motifs. It will be understood that the total number of modular RNA motifs that can be connected or otherwise coupled thereto is only limited by the number of DAs in the modular RNA motifs. The connection or coupling can occur at the 3' end and / or the 5' end of the synthetic oligonucleotides that constitute the modular RNA motifs.

[0132] In some aspects, the RNA nanostructure can be homogeneous (e.g., all modular RNA motifs contained in the RNA nanostructure can be the same). In some aspects, the RNA nanostructure can be heterogeneous (e.g., at least two modular RNA motifs contained in the RNA nanostructure differ from each other in one or more of the following features: the number of DAs, the length of the oligonucleotide sequence, and / or the oligonucleotide sequence). The layer of the RNA nanostructure can be homogeneous (e.g., each modular RNA motif in a given layer can be the same). The layer of the RNA nanostructure can be heterogeneous (e.g., at least two modular RNA motifs contained in the layer differ from each other in at least one of the following features: the number of DAs, the length of the oligonucleotide sequence, and / or the oligonucleotide sequence). In some aspects, one or more layers of the RNA nanostructure can each be homogeneous, but the RNA nanostructure can be heterogeneous because two or more modular RNA motifs in the RNA nanostructure differ from each other with respect to one or more of the following features: the number of DAs, the length of the oligonucleotide sequence, and / or the oligonucleotide sequence. Figures 42A to 42G Aspects of a homogeneous RNA nanostructure comprising a homogeneous layer are shown. Fig.43 An aspect of a heterogeneous RNA nanostructure comprising a homogeneous layer is shown. Fig.43As shown in , in some aspects, each layer can be composed of modular RNA motifs with different numbers of DAs. In some aspects, a heterogeneous RNA nanostructure can contain homogeneous layers and at least one heterogeneous layer. In some aspects, an RNA nanostructure can be considered heterogeneous if it is loaded with one or more different cargo compounds in the motif, in the layer, or across one or more layers.

[0133] The RNA nanostructures described herein may have high thermal stability or ultra-high thermal stability, as defined herein by Tm measurement via particle annealing in qPCR or particle dissociation in thermal gradient gel analysis (TGGE). The RNA nanostructures described herein may have high melting temperatures or ultra-high melting temperatures (Tm). RNA oligonucleotides typically exhibit length-dependent melting temperatures, which are stable at 70-75°C for long hybrid double strands. The modification of the double strands and the conjugation of hydrophobic molecules reduce the stability of the RNA double strands and thus result in lower melting temperatures and dissociation to form separate chains, resulting in enzymatic digestion in vivo. RNA nanostructures suitable for carrying high-density functional groups have Tm of about 70°C or higher. In some aspects, the melting temperature of the RNA nanostructure can be above 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can be 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 65° C. to 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 66 to 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 67 to 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100°C.In some aspects, the melting temperature of the RNA nanostructure can range from 68 to 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 69 to 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 70 to 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 71 to 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 72 to 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 73 to 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 74 to 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 75 to 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C.In some aspects, the melting temperature of the RNA nanostructure can range from 76 to 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 77 to 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 78 to 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 79 to 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 80 to 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 81 to 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 82 to 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 83 to 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 84 to 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 85 to 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 86 to 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C.In some aspects, the melting temperature of the RNA nanostructure can range from 87 to 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 88 to 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 89 to 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 90 to 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 91 to 92, 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 92 to 93, 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 93 to 94, 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 94 to 95, 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 95 to 96, 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 96 to 97, 98, 99, or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 97 to 98, 99 or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 98 to 99 or 100° C. In some aspects, the melting temperature of the RNA nanostructure can range from 99 to 100° C.

[0134] In some aspects, the Tm of the core modular RNA motif can be greater than the Tm of the modular RNA motifs forming the middle layer, which can be greater than the Tm of the modular RNA motifs forming the terminal layer or the outermost layer. It should be understood that in the presence of multiple middle layers, the Tm of the modular RNA motifs forming the innermost middle layer can be greater than the Tm of the modular RNA motifs forming the outermost middle layer. Any middle layer between the innermost middle layer and the outermost middle layer can have a Tm lower than the Tm of the modular RNA motifs forming the innermost middle layer, higher than the Tm of the modular RNA motifs forming the outermost middle layer, and a modular RNA motif that can decrease with the distance from the innermost middle layer. This feature can lead to thermodynamically driven nanostructure assembly (which can occur at a temperature higher than the measured Tm value of the modular RNA motifs) Fig.33AThis further allows for a thermodynamic mechanism of payload release by shedding each layer at a rate proportional to the Tm of each modular RNA motif ( Fig.33D ).

[0135] When measured along its longest or largest dimension, the RNA nanostructure can have a size of up to micrometers. When measured along its longest or largest dimension, the RNA nanostructure can have a size of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 700, 700, 800, or about 900 nm. In some aspects, the size of the RNA nanostructure when measured along its longest or largest dimension can be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 In some aspects, the RNA nanostructures can have a size of about 1-30, 1-40, 1-50, 10-50, 10-40, 10-30, 30-50, 30-40, or 40-50 nm when measured along their longest or largest dimension. In some aspects, the RNA nanostructure can be substantially spherical. In other aspects, the RNA nanostructure can be triangular planar, triangular pyramid, T-shaped, tetrahedron, square planar, alternating, triangular bipyramid, quadrangular pyramid, pentagonal planar, octahedron, triangular prism, pentagonal pyramid, pentagonal bipyramid, quadrangular anti-prism, tri-cap triangular prism, single-cap quadrangular anti-prism, arrow-shaped, tail-shaped, X-shaped, or any deformation of these shapes.

[0136] Loaded and / or functionalized RNA nanostructures

[0137] The modular RNA motifs constituting the RNA nanostructure described herein can provide various sites, and cargo compounds and / or functional groups can be connected to or otherwise coupled to the modular RNA motifs at these sites. By cargo compounds and / or functional groups being connected to or otherwise coupled to the modular RNA motifs, the RNA nanostructure can load one or more cargo compounds and / or be functionalized with one or more functional groups. Cargo compounds and / or functional groups can be connected to or otherwise coupled to the modular RNA motifs before or after the RNA nanostructure is assembled.

[0138] The cargo compound and / or functional group can be attached or otherwise coupled to the 5' end and / or 3' end of one or more DAs of the modular RNA motifs in the RNA nanostructure (see e.g. Figure 1C As discussed above, one or more nucleotides of the synthetic RNA oligonucleotides that make up the modular RNA motif can be modified so that the attachment or coupling of a functional group or cargo compound can occur at that nucleotide. In some aspects, the modified nucleotides can be present in the RNA oligonucleotide at such a position that when assembled into the modular RNA motif, the modified nucleotides are present in the DA (see, e.g. Figures 16A-16B and Fig.18 ). Thus, the modular RNA motif can be loaded with cargo compounds and / or functional groups at one or more nucleotides in the DA of the modular RNA motif. The modular RNA motif present in the RNA nanostructure can be loaded at the 5' end and / or 3' end of each DA and / or at one or more internal nucleotides (e.g., modified nucleotides) in each DA.

[0139] In some aspects, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 , 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, to 600 or more ends can be used to connect or couple to a cargo compound or functional group. In some aspects, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93 , 94, 95, 96, 97, 98, 99, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 to 1000 or more nucleotides can be used for modification and / or attachment or coupling to a cargo compound or functional group. Thus, the number of cargo compounds and / or functional groups that can be attached or otherwise coupled to the RNA nanostructure can be the same as the number of sites available for loading, as long as the RNA nanostructure is stable when loaded and loading does not violate chemical or physical constraints (e.g., steric hindrance).

[0140] RNA nanostructures can carry a single type of cargo compound. RNA nanostructures can carry a single type of functional group. RNA nanostructures can carry 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more types of cargo compounds. RNA nanostructures can carry 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more types of functional groups.

[0141] In RNA nanostructures comprising multiple layers, all layers can be loaded with the same cargo compound and / or functional group type. In some aspects, in RNA nanostructures comprising multiple layers, two or more layers can be loaded with different cargo compounds and / or functional group types. In a non-limiting example, a three-layer RNA nanostructure can be loaded with one or more types of cargo compounds (e.g., 20 to 100 molecules of one or more types of cargo compounds) in a core layer, shielded by a second layer (or intermediate layer) that can load endosome escape and / or radiation-MRI-fluorescence imaging morphology, and ultimately protected by a terminal layer or outermost layer, which is exposed to the end of the terminal layer The functional group ( Fig.46B ).like Fig.32D As shown, the two layers are connected by coupling the synthetic oligonucleotide of the inner layer to one of the synthetic oligonucleotides of the outer layer. Thus, the binding of the layers is controlled by the Tm of the layers that make up the particle, which can then be used to determine the release profile of a specific functional group layer. Alternatively, the layers can be coupled by pH, light or enzyme sensitive chemical groups to induce release once the desired environmental conditions are met, such as cellular uptake into endosomes or lysosomes at low pH.

[0142] Figures 44A to 44B Aspects of RNA nanostructures loaded with a single type of cargo compound or functional group are shown. Modular RNA motifs in black indicate core or primary modular RNA motifs contained in the RNA nanostructure. Modular RNA motifs in dark grey indicate secondary or intermediate level modular RNA motifs contained in the RNA nanostructure. Modular RNA motifs in light grey indicate terminal or outermost level modular RNA motifs contained in the RNA nanostructure.

[0143] Figures 45A to 45BAspects of RNA nanostructures that display various types of cargo compounds and / or functional groups (including but not limited to activating agents) are loaded. The modular RNA motifs in black indicate the core or primary modular RNA motifs contained in the RNA nanostructure. The modular RNA motifs in dark grey indicate the modular RNA motifs at the secondary or intermediate levels contained in the RNA nanostructure. The modular RNA motifs in light grey indicate the modular RNA motifs at the end or outermost level contained in the RNA nanostructure.

[0144] Figures 46A to 46B Aspects of RNA nanostructures loaded with various types of cargo compounds and / or functional groups, including but not limited to paclitaxel, are shown. Fig.46A . A nanostructure having a modular RNA motif comprising an extended core with internal modifications that allow specific attachment of an active agent to the core of the nanostructure. Fig.46B .Nanostructures with different functional groups attached to the 5' end or 3' end of the oligonucleotides in each layer.

[0145] Cargo compounds and functional groups

[0146] As mentioned above, RNA nanostructures can include one or more cargo compounds and / or one or more functional groups. In some aspects, a single compound or molecule that can be connected or otherwise coupled to RNA nanostructures can be a cargo compound and a functional group. As used in this context, the term "cargo compound" refers to any molecule, compound or composition that can be loaded onto RNA nanostructures as described herein and can be delivered to a subject (e.g., by releasing from RNA nanostructures, or even when connected or otherwise coupled to RNA nanostructures, initiating a physiological response in a subject when in contact with a subject). The term "functional group" as used in this context refers to a compound that functionality is added to RNA nanostructures. Cargo compounds or functional groups can be any biomolecule, chemical molecule, synthetic molecule or any other molecule, which can be encapsulated by RNA nanostructures as described herein, connected to and / or bound to RNA nanostructures as described herein. Cargo compounds and / or functional groups can be active agents. In some aspects, cargo compounds can be encapsulated by RNA nanostructures or their components, connected to and / or bound to RNA nanostructures or their components.

[0147] In some aspects, the cargo compound and / or functional group can be a DNA, RNA, modified ribonucleotide, amino acid, peptide, polypeptide, antibody, aptamer, aptazyme, riboswitch, ribozyme, guide sequence of ribozymes that inhibit translation or transcription of essential tumor proteins and genes, hormones, immunomodulators, antipyretics, sedatives, antipsychotics, analgesics, spasmolytics, anti-inflammatory drugs, antihistamines, anti-infective agents and chemotherapeutic agents (anticancer drugs). Other suitable cargo compounds include sensitizers (e.g., radiation sensitizers) that can make cells or subjects more responsive (or sensitive) to treatment or prevention and imaging or other diagnostic agents. RNA nanostructures can be used as monotherapy or in combination with other active agents for the treatment or prevention of diseases or disorders.

[0148] Suitable hormones include, but are not limited to, amino acid-derived hormones (e.g., melatonin and thyroxine), small peptide hormones and protein hormones (e.g., thyrotropin-releasing hormone, vasopressin, insulin, growth hormone, luteinizing hormone, follicle-stimulating hormone, and thyroid-stimulating hormone), eicosanoids (e.g., arachidonic acid, lipoxins, and prostaglandins), and steroid hormones (e.g., estradiol, testosterone, tetrahydrotestosterone, and cortisol).

[0149] Suitable immunomodulators include, but are not limited to, prednisone, azathioprine, 6-MP, cyclosporine, tacrolimus, methotrexate, interleukins (e.g., IL-2, IL-7, and IL-12), cytokines (e.g., interferons (e.g., IFN-α, IFN-β, IFN-ε, IFN-κ, IFN-ω, and IFN-γ), granulocyte colony stimulating factor, and imiquimod), chemokines (e.g., CCL3, CCL26, and CXCL7), cytosine monophosphate, oligodeoxynucleotides, dextran, antibodies, and aptamers).

[0150] Suitable antipyretics include, but are not limited to, nonsteroidal anti-inflammatory drugs (e.g., ibuprofen, naproxen, ketoprofen, and nimesulide), aspirin and related salicylates (e.g., choline salicylate, magnesium salicylate, and sodium salicylate), acetaminophen / paracetamol, metamizole, nabdomylidene, antipyrine, and quinine.

[0151] Suitable sedatives include, but are not limited to, benzodiazepines (e.g., alprazolam, bromazepam, chlordiazepoxide, clonazepam, clorazepam, diazepam, flurazepam, lorazepam, oxazepam, temazepam, triazolam, and tofisopam), serotonergic antidepressants (e.g., selective serotonin reuptake inhibitors, tricyclic antidepressants and monoamine oxidase inhibitors), mebicar, afobazole, selank, bromantane, emoxypine, azaperone, barbiturates, hydroxyzine, pregabalin, varedol, and beta-blockers.

[0152] Suitable antipsychotics include, but are not limited to, benperidol, bromperidol, droperidol, haloperidol, moperone, pipeperone, tilmiperone, fluspirin, penfluridol, pimozide, acepromazine, chlorpromazine, cyanomemazine, dizyrazine, fluphenazine, levomepromazine, mesoridazine, properazine, percynanch, hydroxyperchlorpromazine, piperozine, prochlorperazine, promazine, promethazine, azithromycin, thioperazine, thioetherazine, trifluoperazine, triflupromazine, chlorprothixene, chlorpenthixol, flupenthixol, thiophene, thiophene, thiophene, thiophene, thiophene. Thioxanthene, zuclopenthixol, clothiapine, clothiapine, azithromycin, capipramine, clocapramine, molindone, mosapramine, sulpiride, vilapride, amisulpride, amoxapine, aripiprazole, asenapine, clozapine, blonanserin, iloperidone, lurasidone, melperone, nemopride, olanzapine, paliperidone, perospirone, quetiapine, remopride, risperidone, sertindole, trimipramine, ziprasidone, zotepine, alstonie, bifenazolidinone, biopterin, epiprazole, cannabidiol, cariprazine, pimavanserin, pomaglumetad methionil, pencaserin, nomeline, and zicronapine.

[0153] Suitable analgesics include, but are not limited to, acetaminophen / acetaminophen, nonsteroidal anti-inflammatory drugs (e.g., ibuprofen, naproxen, ketoprofen, and nimesulide), COX-2 inhibitors (e.g., rofecoxib, celecoxib, and etoricoxib), opioids (e.g., morphine, codeine, oxycodone, hydrocodone, dihydromorphine, pethidine, buprenorphine), tramadol, norepinephrine, fluoxetine, nefopam, orphenadrine, pregabalin, gabapentin, cyclobenzaprine, scopolamine, methadone, ketobemidone, pirithromide, and aspirin and related salicylates (e.g., choline salicylate, magnesium salicylate, and sodium salicylate).

[0154] Suitable antispasmodics include, but are not limited to, mebeverine, paverine, cyclobenzaprine, carisoprodol, orphenadrine, tizanidine, metaxalone, methocarbamol, chlorzoxazone, baclofen, dantrolene, baclofen, tizanidine, and dantrolene.

[0155] Suitable anti-inflammatory drugs include, but are not limited to, prednisone, non-cholesterol anti-inflammatory drugs (e.g., ibuprofen, naproxen, ketoprofen, and nimesulide), COX-2 inhibitors (e.g., rofecoxib, celecoxib, and etoricoxib), and immunoselective anti-inflammatory derivatives (e.g., submandibular peptide-T and its derivatives).

[0156] Suitable antihistamines include, but are not limited to, H1-receptor antagonists (e.g., acrivastine, azelastine, bilastine, brompheniramine, buclizine, bromazine, carbinoxamine, cetirizine, chlorpromazine, cyclizine, chlorpheniramine, clemastine, cyproheptadine, desloratadine, dexbrompheniramine, dexchlorpheniramine, dimenhydrinate, dimethinidine, diphenhydramine, doxylamine, ebastine, embramine, fexofenadine, hydroxyzine, levocetirizine, levocetirizine, chlorpromazine, cyclizine, chlorpheniramine, clemastine, cyproheptadine, desloratadine, dexbrompheniramine, dexchlorpheniramine, dimenhydrinate, dimethinidine, diphenhydramine, doxylamine, ebastine, embramine, fexofenadine, hydroxyzine, levocetiriz ... tirzine), loratadine, meclizine, mirtazapine, olopatadine, orphenadrine, phenindrine, pheniramine, phenyltoloxamine, promethazine, pyrimidine, quetiapine, rupatadine, tripelenamine and triprolidine), H2-receptor antagonists (e.g., cimetidine, famotidine, lafutidine, nizatidine, rafitidine and roxatidine), triptoquine, catechins, cromoglicate, nedocromil, and beta2-adrenergic agonists.

[0157] Suitable anti-infective agents include, but are not limited to, anti-amoebic agents (e.g., nitazoxanide, paromomycin, metronidazole, tnidazole, chloroquine, and iodoquinol), aminoglycosides (e.g., paromomycin, tobramycin, gentamicin, amikacin, kanamycin, and neomycin), anthelmintics (e.g., pyrantel, mebendazole, ivermectin, praziquantel, albendazole, miltefosine, thiabendazole, olaminoquine), antifungals (e.g., azole antifungals (e.g., itraconazole, fluconazole, posaconazole, ketoconazole, clotrimazole, miconazole, and voriconazole), echinocandins (e.g., caspofungin, anidulafungin, and micafungin), griseofulvin, terbinafine, flucytosine), , and polyenes (e.g., nystatin and amphotericin B), antimalarials (e.g., pyrimethamine / sulfadoxine, artemisinin methyl / lumefantrine, atovaquone / proguanil, quinine, hydroxychloroquine, mefloquine, chloroquine, doxycycline, pyrimethamine, and halofantrine), antituberculosis agents (e.g., aminosalicylates (e.g., aminosalicylic acid), isoniazid / rifampicin, isoniazid / pyrazinamide / rifampicin, bedaquiline, isoniazid, ethambutol, rifampicin, rifabutin, rifapentine, capreomycin, and cycloserine), antivirals (e.g., amantadine, rimantadine, abacavir / lamivudine, emtricitabine / tenofovir, cobicistat / elvitegravir / emtricitabine / tenofovir, efavirenz Abacavir / emtricitabine / tenofovir, abacavir / lamivudine / zidovudine, lamivudine / zidovudine, emtricitabine / tenofovir, emtricitabine / lopinavir / ritonavir / tenofovir, interferon α-2v / ribavirin, peginterferon α-2b, maraviroc, raltegravir, dolutegravir, enfuvirtide, foscarnet, fomivirsen, oseltamivir, zanamivir, nevirapine, efavirenz, etravirine, rilpivirine, delavirdine, nevirapine, entecavir, lamivudine, adefovir, sofosbuvir, didanosine, tenofovir, abacavir (avacivr), zidovudine, stavudine, emtricitabine, zalcitabin (xalcitabin), telbivudine, simvastatin ritonavir, fosamprenavir, darunavir, ritonavir, tipranavir, atazanavir, nelfinavir, amprenavir, indinavir, sawuinavir, ribavirin, valcyclovir, acyclovir, famciclovir, ganciclovir, and valganciclovir), carbapenems (e.g., doripenem, meropenem, ertapenem, and cilastatin / imipenem), cephalosporins (e.g., cefadroxil, cefradine, cefazolin, cephalexin, cefepime, ceflaroline, loracarb, cefotetan, cefuroxime, cefuroxime, loracarb, cefoxitin,cefaclor, ceftibuten, ceftriaxone, cefotaxime, cefpodoxime, cefdinir, cefixime, cefditoren, cefazolin, and ceftazidime), glycopeptide antibiotics (e.g., vancomycin, dalbavancin, oritavancin, and telvancin), glycine cyclines (e.g., tigecycline), antileprosy drugs (e.g., clofazimine and thalidomide), lincomycin and its derivatives (e.g., clindamycin and lincomycin), macrolides and their derivatives (e.g., telithromycin, fidaxomicin, erythromycin, azithromycin, clarithromycin, dirithromycin, and troleandomycin), ), linezolid, sulfamethoxazole / trimethoprim, rifaximin, chloramphenicol, fosfomycin, metronidazole, aztreonam, bacitracin, beta-lactam antibiotics (benzathine penicillin (benzacetyl and benzylpenicillin), phenoxymethylpenicillin, cloxacillin, flucoxacillin, methicillin, temocillin, mecillinam, azlocillin, mezlocillin, piperacillin, amoxicillin, ampicillin, bacampicillin, carbenicillin, piperacillin, ticarcillin, amoxicillin / clavulanic acid, ampicillin / sulbactam, piperacillin / tazobactam, clavulanic acid / ticarcillin, penicillin, procaine penicillin, oxacillin, bicyclidine Cloxacillin, nafcillin, cefazolin, cephalexin, cephalosporin C, cephalosporin, cefaclor, cefadroxil, cefuroxime, cefotetan, cefoxitin, cefiximine, cefotaxime, cefpodoxime, ceftazidime, ceftriaxone, cefepime, cefpirome, ceftaroline, biapenem, doripenem, ertapenem, faropenem, imipenem, meropenem, panipenem, azupenem, tebipenem, thanamycin, azrewonam, tigemonam, nocardiamycin A, taboxinine, and beta-lactams), quinolones (e.g., lomefloxacin, norflurazon floxacin, ofloxacin, qatifloxacin, moxifloxacin, ciprofloxacin, levofloxacin, gemifloxacin, moxifloxacin, cinoxacin, nalidixic acid, enoxacin, grefloxacin, gatifloxacin, trovafloxacin, and sparfloxacin), sulfonamides (e.g., sulfamethoxazole / trimethoprim, sulfasalazine, and sulfisoxazole), tetracyclines (e.g., doxycycline, demeclocycline, minocycline, doxycycline / salicylic acid, doxycycline / omega-3 polyunsaturated fatty acids, and tetracycline), and urinary tract anti-infectives (e.g., nitrofurantoin, methenamine, fosfomycin, cinoxacin, nalidixic acid, trimethoprim, and methylene blue).

[0158] Suitable chemotherapeutic agents include, but are not limited to, paclitaxel, camptothecin, brentuximab vedotin, doxorubicin, 5-FU (fluorouracil), everolimus, pemetrexed, melphalan, pamidronate, anastrozole, exemestane, nelarabine, ofatumumab, bevacizumab, belinostat, tositumomab, carmustine, bleomycin, bosutinib, busulfan, alemtuzumab, irinotecan, Con, vandetanib, bicalutamide, lomustine, daunomycin, clofarabine, cabozantinib, actinomycin D, ramucirumab, cytarabine, cyclophosphamide, cyclophosphamide mustard, decitabine, dexamethasone, docetaxel, hydroxyurea, dacarbazine, leuprolide, epirubicin, oxaliplatin, asparaginase, estramustine, cetuximab, vilmodegib, Erwinia chrysanthemi asparaginase, amifostine, etoposide, flutamide, toremifene , fulvestrant, letrozole, degarelix, pralatrexate, methotrexate, floxuridine, atozumab, gemcitabine, afatinib, imatinib mesylate, carmustine, eribulin, trastuzumab, altretinoin, topotecan, ponatinib, idarubicin, ifosfamide, ibrutinib, axitinib, interferon α-2a, gefitinib, romidepsin, ixabepilone, ruxolitinib, cabazitaxel, ado-trastuzumab emtansine New conjugates, carfilzomib, chlorambucil, sargramostim, cladribine, mitotane, vincristine, procarbazine, megestrol acetate, trametinib, mesna, strontium-89 chloride, dichloromethyl diethylamine, mitomycin, busulfan, gemtuzumab ozogamicin, vinorelbine, filgrastim, PEG-filgrastim, sorafenib, nilutamide, pentostatin, tamoxifen, mitoxantrone, pegaspargase, deneukin diftitox), alitretinoin, carboplatin, pertuzumab, cisplatin, pomalidomide, prednisone, aldesleukin, mercaptopurine, zoledronic acid, lenalidomide, rituximab, octreotide, dasatinib, regorafenib, histrelin, sunitinib, sildenafil, homoharringtonine, thioguanine (tioguanine), dabrafenib, erlotinib, bexarotene, temozolomide, thiotepa, thalidomide, BCG, temsirolimus, bendamustine hydrochloride, triptorelin, trioxane aresnictrioxide, lapatinib, valrubicin, panitumumab, vinblastine, bortezomib, tretinoin, azacitidine, pazopanib, teniposide, folinic acid, crizotinib, capecitabine, enzalutamide, ipilimumab, goserelin, vorinostat, idelalisib, ceritinib, abiraterone, epothilone, tafluposide, azathioprine, doxifluridine, vindesine, all-trans retinoic acid, and other anticancer agents listed elsewhere herein.

[0159] Suitable sensitizers may include, but are not limited to, radiosensitizers, insulin sensitizers (e.g., metformin, thiazolidinediones,) and photosensitizers for photodynamic therapy (e.g., aminolevulinic acid (ALA), silicon phthalocyanine Pc4, m-tetrahydroxyphenylchlorin (mTHPC), and mono-L-aspartylchlorin e6 (NPe6).

[0160] Suitable imaging agents include, but are not limited to, fluorescent molecules (e.g., Cy3, Cy5, ICG, and other commercially available fluorophores), paramagnetic ions, nanoparticles that may contain paramagnetic ions, superparamagnetic iron oxide molecules and nanoparticles thereof, 18F-fluorodeoxyglucose and other PET imaging agents, gadolinium-containing contrast agents, radionuclides, and combinations thereof.

[0161] In some aspects, the functional group can be a targeting moiety. As used in this context, the phrase "targeting moiety" refers to a compound, molecule or any other composition that can cause the RNA nanostructure to be specifically directed to a position, cell type, organ, or structure in a subject after being delivered to the subject. The targeting moiety can include compounds and molecules, such as antibodies, aptamers, and receptor ligands.

[0162] Suitable targeting moieties include, but are not limited to, aptamers and ligands that bind to epidermal growth factor receptor (EGFR), prostate specific membrane antigen receptor (PSMA), epithelial cell adhesion molecule (EpCam), vascular endothelial growth factor (VEGF), galactose receptor, folate receptor, G protein coupled receptor (GPCR), CD receptor, integrin, transferrin receptor, fibroblast growth factor (FGFR), sigma receptor (SR), and / or epidermal growth factor receptor (EGFR), or chemical ligands such as folate, galactose, and GalNAc.

[0163] In some aspects, the functional group / cargo compound can be a chelating agent. Suitable chelating agents include, but are not limited to, NOTA, DOTA, EDTA, Exjade, succimer, deferoxamine mesylate, deferiprone, Jadenu, and Syprine.

[0164] In some aspects, the functional groups / cargo compounds can be hydrophobic. In some aspects, the functional groups and / or cargo compounds can be hydrophilic. In some aspects, the functional groups and / or cargo compounds can be positively charged. In some aspects, the functional groups and / or cargo compounds can be negatively charged. In some aspects, the functional groups and / or cargo compounds can be neutrally charged. In some aspects, the functional groups and / or cargo compounds can be uncharged.

[0165] In some aspects, the targeting moiety specifically targets cancer cells. In some aspects, the targeting moiety is EGFR, HER2, and / or EP-CAM aptamer or PSM antigen, or folic acid. In some aspects, the targeting moiety is a ligand of EGFR. In other aspects, the targeting moiety targets blood, lungs, kidneys, brain tissue, neurons, muscles, heart, tendons, ligaments, liver, pancreas, or other specific tissues.

[0166] In some aspects, functional groups can promote the connection of cargo molecules. As described in other parts of this article, the nucleotides constituting the synthetic RNA oligonucleotides can be modified. In addition to alkynes, synthetic RNA oligonucleotides can be modified by functional groups such as joints. Using thermodynamic, acid-labile, photosensitive, or enzyme-labile chemical groups for timed triggered release, individual functional groups can be connected or otherwise coupled to synthetic RNA oligonucleotides and / or cargo compounds or additional functional groups. In some aspects, the functional group can be a stimulus-responsive joint, such as a photodegradable joint, a pH-responsive joint, or an enzyme-cleavable joint. A photodegradable joint is a molecule containing a photolabile group that can be degraded by light of a specific wavelength. The photodegradable joint can cleave cargo molecules or other functional parts (e.g., targeting parts) to RNA nanoparticles. This is another mechanism in which the release of cargo molecules from RNA nanoparticles can be regulated and controlled. The photodegradable joint can be activated (e.g., cleaved) by an electromagnetic radiation source (including but not limited to visible light, infrared radiation, ultraviolet radiation). The use of a photodegradable joint allows the release of cargo molecules from RNA nanoparticles to be controlled in time and space.Exemplary photodegradable linkers can include, but are not limited to, phosphoramidites (see, e.g., Olejnik et al., Nucleic Acids Res. (1998); 26:3572-3576; Olejnik et al. Nucleic Acid Res. (1999), 27:4626-4631; and Tang et al., Nucleic Acid Res (2002), 38:3848-3855, Gene Link Catalog No. 26-6888), photodegradable biotin (see, e.g., Olejnik et al., Nucleic Acids Res. (1998); 26:3572-3576; Olejnik et al. Nucleic Acid Res. (1999), 27:4626-4631; and Tang et al., Nucleic Acid Res (2002), 38:3848-3855, Gene Link Catalog No. 26-6888), photodegradable biotin (see, e.g., Olejnik et al., Nucleic Acids Res. (1998); 26:3572-3576; Olejnik et al. Nucleic Acid Res. (1999), 27:4626-4631; and Tang et al., Nucleic Acid Res (2002), 38:3848-3855, Gene Link Catalog No. 26-6888). Res (2002), 38:3848-3855, Gene Link Catalog No. 26-6691), a photolyzable amino C6 (see, e.g., Olejnik et al., Nucleic Acids Res. (1998); 26:3572-3576; Olejnik et al. Nucleic Acid Res. (1999), 27:4626-4631; and Tang et al., Nucleic Acid Res (2002), 38:3848-3855, Gene Link Catalog No. 26-6890), a photolyzable spacer (see, e.g., see, e.g., Olejnik et al., Nucleic Acids Res. (1998); 26:3572-3576; Olejnik et al. Nucleic Acid Res. (1999), 27:4626-4631; and Tang et al., Nucleic Acid Res (2002), 38:3848-3855, Gene Link Catalog No. 26-6890). Res. (1999), 27:4626-4631; and Tang et al., Nucleic Acid Res (2002), 38:3848-3855, Gene Link catalog number 26-6889); 2-nitrobenzyl linker (see, for example, Bai et al., (2003) PNAS, 100:409-413). Those of ordinary skill in the art will appreciate other suitable photodegradable linkers.

[0167] In some aspects, the linker can be a pH responsive linker. A pH responsive linker can be any compound that can degrade (e.g., hydrolyze) at a certain pH. Thus, a pH responsive linker can be acid responsive or alkaline responsive. The pH responsive linker can be a polymer. Suitable pH-responsive linkers are generally known in the art and include, but are not limited to, those described in Choy et al. (Bioconjugate. Chem. (2016) 27:824-830; Schmaljohann (2008) Adv. Drug Deliv. Rev. (2006) 58:1655-1670, Balamuralidhara et al. (2011) Am. J. Drug Disc. Devel. 1:24-48; Biomedical Nanomaterials, ed. Zhao and Shen (2016), Chapter 6; Masson et al. (2004) J. Control Release. 99:423-434; Karimi et al., Nanomed. and Nanobiotech. (2016) 8:696-716; International Patent Application Publication No. WO2016 / 028700; and Patilet et al. (2013) 58:1655-1670. al., 2012. Int. J. Mol. Sci. 13:11681-11693.

[0168] In some respects, the joint can be an enzyme cleavable joint. An enzyme cleavable joint is a joint containing a cleavage site of an enzyme. In some respects, the joint can be a nucleic acid containing a sequence for an endonuclease. One of ordinary skill in the art will understand endonuclease cleavage sites and how to produce nucleic acid molecules containing them. Other cleavage sites that may be included may be RNA enzyme or DNA enzyme cleavage sites. In some respects, the enzyme cleavable site may be a cleavage site for an enzyme specific to a target cell. Therefore, in this way, release may be controlled so that it occurs only at the target cell by interaction with a target cell specific enzyme. In some respects, the joint may be a chemical group that may be cleaved or hydrolyzed by an enzyme such as an esterase. One of ordinary skill in the art will immediately understand other cleavage sites that may be added to the enzyme cleavable joint.

[0169] Rational design of modular RNA motifs and RNA nanostructures

[0170] The principle of designing self-assembling nucleic acid nanostructure is the sequence complementarity in the coding nucleic acid chain, so that the nucleic acid chain is self-organized into a predetermined nanostructure by pairing complementary fragments under appropriate physical conditions. According to this basic principle (see, for example, Seeman NCJ Theor. Biol. 99: 237, 1982, incorporated herein by reference), researchers have created various synthetic nucleic acid nanostructures (see, for example, Seeman NC Nature 421: 427, 2003; Shih W. M. et al. Curr. Opin. Struct. Biol. 20: 276, 2010, each of which is incorporated herein by reference).Examples of nucleic acid (e.g., DNA) nanostructures and methods of producing such structures that can be used in accordance with the present disclosure are known and include, but are not limited to, grids (see, e.g., Winfree E. et al. Nature 394:539, 1998; Yan H. et al. Science 301:1882, 2003; Yan H. et al. Proc. Natl. Acad. of Sci. USA 100; 8103, 2003; Liu D. et al. J. Am. Chem. Soc. 126:2324, 2004; Rothemund PWK et al. PLoS Biology 2:2041, 2004, each of which is incorporated herein by reference), ribbons (see, e.g., Park SH et al. Nano Lett. 5:729, 2005; Yin P. et al. Science 321:824, 2008, each of which is incorporated herein by reference), tubular (see, e.g., Yan H. Science, 2003; P. Yin, 2008, each of which is incorporated herein by reference), finite two-dimensional and three-dimensional objects with defined shapes (see, e.g., Chen J. et al. Nature 350:631, 1991; Rothemund PWK, Nature, 2006; He Y. et al. Nature 452:198, 2008; Ke Y. et al. Nano. Lett. 9:2445, 2009; Douglas SM et al. Nature 459:414, 2009; Dietz H. et al. Science 325:725, 2009; Andersen E Set al. Nature 459:73, 2009; Liedl T. et al. Nature Nanotech. 5:520, 2010; Han D. et al. Science 332:342, 2011, each of which is incorporated herein by reference), and macroscopic crystals (see, e.g., Meng JP et al. Nature 461:74, 2009, incorporated herein by reference). Synthetic RNA oligonucleotides can be single-stranded nucleic acids, double-stranded nucleic acids, or a combination of single-stranded and double-stranded nucleic acids.

[0171] RNA nanostructure components (synthetic RNA oligonucleotides and modular RNA motifs) can be designed using the computer-aided design methods described herein. Although computer design is demonstrated using specific RNA nanostructures, it should be understood that one skilled in the art will be able to extrapolate the principles taught therein to any desired RNA nanostructure.

[0172] Each synthetic RNA oligonucleotide can be designed so that when it is combined with 2 or more additional synthetic RNA oligonucleotides, base pairing occurs to produce a highly ordered 2-D and 3-D structure with 3 or more DAs surrounding a core domain, the core domain may or may not contain base pairing between chains, and may include 0-4 nucleotides forming symmetrical or asymmetrical protrusions between DAs. Each synthetic RNA oligonucleotide can be designed to include 16-120 nucleotides. Each synthetic RNA oligonucleotide can be designed to include 1 or more modified nucleotides. Nucleotide modifications are described elsewhere herein. Designed to include more than one modified synthetic RNA oligonucleotide can be designed so that the modified nucleotides are separated by one or more unmodified nucleotides. In some aspects, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more unmodified nucleotides can separate two modified nucleotides.

[0173] The rational design of synthetic RNA oligonucleotides and / or RNA nanostructures described herein can be carried out in a computing environment. The computing environment may include one or more computing devices, which may include at least one processor circuit, for example, which may have a processor and a memory. According to various aspects of the present disclosure, various applications and / or other functions may be performed in the computing environment. Moreover, various data may be stored in one or more data stores accessible by the computing environment.

[0174] The components executed in the computing environment can for example include a reasonable RNA design system and other applications, services, processes, systems, engines, or functions not discussed in detail herein. The reasonable RNA design system can be executed to promote the design of synthetic RNA oligonucleotides and / or RNA nanostructures as described herein. The reasonable RNA design system can also perform various back-end functions that can be relevant to the design of RNA oligonucleotides (such as those synthetic RNA oligonucleotides and / or RNA nanostructures described herein).

[0175] like Fig.48As shown in, a rational RNA design system can be executed to dynamically create a synthetic RNA oligonucleotide sequence that can be used to produce RNA nanostructures as described herein. The rational RNA design system can produce, identify and / or select a synthetic RNA oligonucleotide sequence that can be compatible with one or more other synthetic RNA oligonucleotide sequences (which can also be produced by a rational RNA design system) and self-assemble to form an RNA nanostructure as described herein. The rational RNA design system can also identify a synthetic RNA oligonucleotide sequence that can not be compatible with one or more other synthetic RNA oligonucleotide sequences to form an RNA nanostructure as described herein.

[0176] The rational RNA design system can apply one or more optimization algorithms to determine suitable or optimal synthetic RNA oligonucleotide sequences that are compatible and form RNA nanostructures as described herein, the algorithms being based at least in part on the GC content of the RNA oligonucleotides and / or RNA nanostructures, the Tm of two or more RNA oligonucleotides and / or RNA nanostructures, the probability and / or ability of RNA oligonucleotides to spontaneously dimerize, the cross-complementarity of synthetic RNA oligonucleotides, conversions between RNA and oligonucleotides comprising modified nucleic acids, and / or other data or properties of synthetic RNA oligonucleotides.

[0177] like Fig.48 As shown in , a rational RNA design system can generate various theoretical double-stranded arms (DA) as described elsewhere in this article (in Fig.48 The DA sequence is generated in ). The rational RNA design system, when executed, can then determine whether the GC content of the theoretical DA formed is within a desired GC range. The desired GC range can be set by the user. In some aspects, the GC range can be from about 50% to 51, 52, 53, 54, 55, 56, 57, 58, 59, or about 60%. In some aspects, the GC range can be about 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or about 60%. If the theoretical DA formed is not within the desired GC range, within the desired Tm range and / or can spontaneously dimerize, the theoretical DA is discarded. If the theoretical DA is within the desired GC range, within the desired Tm, and does not spontaneously dimerize, the theoretical DA can be saved. The accepted DA can then be used by the rational RNA design system to select a set of oligomers that can form the accepted DA.

[0178] like Fig.48As shown in , the rational RNA design system can select DAs for a set of oligomers. The rational RNA design system can calculate the cross-complementarity of a set (two or more) of DAs that are saved. The DA with the highest cross-complementarity can be discarded, and the DA with the lowest overall cross-complementarity can be saved.

[0179] like Fig.48 As shown in, the rational RNA design system can use the DA with the lowest overall cross-complementarity to calculate the oligomer sequence. The rational RNA design system can calculate the reverse complement sequence of the DA sequence, calculate the extended RNA oligomer sequence, and can calculate the termination oligomer sequence. By determining whether the calculated RNA oligomer sequence spontaneously dimerizes and / or can form a dimer, the rational RNA design system can determine the appropriate oligomer sequence from the various calculated RNA oligomer sequences. The rational RNA design system can save those calculated RNA oligomer sequences that do not spontaneously dimerize and do not form dimers, and can discard those calculated RNA oligomer sequences that do spontaneously dimerize or form dimers. If the saved calculated RNA oligomer sequence is generated using a DNA sequence (e.g., cDNA), the rational RNA design system can be converted into an RNA sequence. The converted sequence can be saved.

[0180] Next, a discussion of the technical equipment of the computing environment is provided. Stored in the memory are data and several components that can be executed by the processor. Stored in the memory can also be data storage and other data. Many software components are stored in the memory and can be executed by the processor. In this regard, the term "executable" means a program file that exists in a form that can eventually be run by the processor. An example of an executable program can be, for example, a compiler that can be translated into machine code (which is a format that can be loaded into the random access portion of one or more memory devices and run by the processor), a code that can be expressed in a format such as an object code (which can be loaded into the random access portion of one or more memory devices and run by the processor), or a code that can be interpreted by another executable program to generate instructions to be executed by the processor in the random access portion of the memory device. The executable program can be stored in any part or component of a memory device, and the memory device includes, for example, a random access memory (RAM), a read-only memory (ROM), a hard drive, a solid-state drive, a USB flash drive, a memory card, an optical disk such as a high-density compact disk (CD) or a digital versatile disk (DVD), a floppy disk, a tape, or other memory components.

[0181] The memory can include both volatile and nonvolatile memory and data storage components. In addition, the processor can represent multiple processors and / or multiple processor cores, and one or more memory devices can represent multiple memories operated separately in a parallel processing circuit. The memory device can also represent a combination of various types of storage devices, such as RAM, mass storage devices, flash memory, or hard disk storage. In this case, the local interface can be a suitable network that helps to communicate between any two of the multiple processors or between any processor and any memory device. The local interface can include an additional system that is designed to coordinate this communication, including, for example, performing load balancing. The processor can have an electrical configuration or some other available configurations.

[0182] Although the rational RNA design system and other various systems described herein can be embodied in software or code executed by general hardware as discussed above, as an alternative, they can also be embodied in dedicated hardware or a combination of software / general hardware and dedicated hardware. If presented in dedicated hardware, each can be implemented as a circuit or state machine using any one or combination of many technologies. These technologies can include discrete logic circuits with logic gates for implementing various logic functions when one or more data signals are applied, application specific integrated circuits (ASICs) with appropriate logic gates, field programmable gate arrays (FPGAs), or other components.

[0183] The flow chart shows the functionality and operation examples of the implementation of the parts of the components described herein. If embodied in software, each box can represent a module, a fragment or a portion of the code, and the code can include program instructions that implement the specified logical functions. The program instructions can be embodied in the form of source code, and the source code can include human-readable statements or machine code written in a programming language, and the machine code can include digital instructions recognizable by a suitable execution system such as a processor in a computer system or other system. The machine code can be converted from the source code. If embodied in hardware, each box can represent a circuit or a plurality of interconnected circuits to implement the specified logical functions.

[0184] Although the flowchart shows a specific execution order, it should be understood that the execution order may be different from the described order. For example, the execution order of two or more frames can be disrupted relative to the displayed order. In addition, two or more frames displayed in succession can be executed simultaneously or partially simultaneously. Further, in some instances, one or more frames shown in the accompanying drawings can be skipped or omitted.

[0185] In addition, any logic or application described herein including software or code may be presented in any non-transitory computer-readable medium for use by or in conjunction with an instruction execution system (such as, for example, a processor in a computer system or other system). In this sense, the logic may include, for example, statements including program code, instructions, and declarations that can be obtained from a computer-readable medium and executed by an instruction execution system. In the context of the present application, a "computer-readable medium" can be any medium that can contain, store, or maintain the logic or application described herein, which is used by or in conjunction with an instruction execution system.

[0186] RNA Nanostructure Preparation

[0187] Also provided herein is a pharmaceutical formulation that can include a certain amount of RNA nanostructures described herein and a pharmaceutical carrier suitable for administration to an individual in need thereof. The individual in need thereof may suffer from or may be suspected of suffering from cancer, a genetic disease or disorder, a viral, bacterial, fungal and / or parasitic infection, or other diseases or disorders that require treatment or prevention. In some aspects, the subject in need thereof requires a diagnostic procedure, such as an imaging procedure. The pharmaceutical formulation can include a certain amount of RNA nanostructures described herein that can effectively treat or prevent cancer, a genetic disease or disorder, a viral, bacterial, fungal and / or parasitic infection, or other diseases or disorders, or imaging of the subject or a portion thereof is effective.

[0188] The preparation can be administered by any suitable route of administration. For example, the preparation (and / or composition) can be administered orally, intravenously, ocularly, intraocularly, intramuscularly, intravaginally, intraperitoneally, rectally, parenterally, topically, intranasally or subcutaneously to a subject in need thereof. Other suitable approaches are described herein. In some aspects, the RNA nanostructure comprises an effective amount of cargo molecules.

[0189] Parenteral preparations

[0190] RNA nanostructures can be formulated for parenteral delivery, such as injection or infusion, in the form of solutions or suspensions. The formulations can be administered by any route, such as the bloodstream or directly to the organ or tissue to be treated.

[0191] Parenteral formulations can be prepared as aqueous compositions using techniques known in the art. Typically, such compositions can be prepared as injectable formulations, e.g., solutions or suspensions; solid forms suitable for preparing solutions or suspensions upon addition of a reconstitution medium prior to injection; emulsions, such as water-in-oil (w / o) emulsions, oil-in-water (o / w) emulsions, and microemulsions, liposomes or creams thereof.

[0192] The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, one or more polyols (e.g., glycerol, propylene glycol and liquid polyethylene glycol), oils such as vegetable oils (e.g., peanut oil, corn oil, sesame oil, etc.), and combinations thereof. Appropriate fluidity can be maintained, for example, by using a coating (such as lecithin), by maintaining a desired particle size in the case of a dispersant and / or by using a surfactant. In many cases, it is preferred to include an isotonic agent, such as a sugar or sodium chloride.

[0193] Solutions and dispersions of RNA nanostructures as described herein can be prepared in water or another solvent or dispersion medium suitably mixed with one or more pharmaceutically acceptable excipients, including, but not limited to, surfactants, dispersants, emulsifiers, pH adjusters, and combinations thereof.

[0194] Suitable surfactants can be anionic surfactants, cationic surfactants, amphoteric surfactants or nonionic surfactants. Suitable anionic surfactants include but are not limited to those containing carboxylate, sulfonate and sulfate ions. Suitable anionic surfactants include sodium, potassium, ammonium salts of long-chain alkyl sulfonates and alkyl aryl sulfonates, such as sodium dodecylbenzene sulfonate; dialkyl sodium sulfosuccinate, such as bis-(2-ethylthioxy)-sodium sulfosuccinate; and alkyl sulfates, such as sodium lauryl sulfate. Suitable cationic surfactants include but are not limited to quaternary ammonium compounds, such as benzalkonium chloride, benzethonium chloride, cetrimonium bromide, stearyl dimethyl benzyl ammonium chloride, polyoxyethylene and coconut amine. Suitable nonionic surfactants include ethylene glycol monostearate, propylene glycol myristate, glyceryl monostearate, glyceryl stearate, polyglyceryl-4-oleate, acylated sorbitan esters, acylated sucrose, PEG-150 laurate, PEG-400 monolaurate, polyoxyethylene monolaurate, polysorbate, polyoxyethylene octylphenyl ether, PEG-1000 cetyl ether, polyoxyethylene tridecyl ether, polypropylene glycol butyl ether, 401, stearyl monoisopropanolamine, and polyoxyethylene hydrogenated tallow amide. Examples of amphoteric surfactants include sodium N-dodecyl-β-alanine, sodium N-lauryl-β-iminodipropionate, myristoyl amphoacetate, lauryl betaine, and lauryl sulfobetaine.

[0195] The formulation may contain a preservative to prevent microbial growth. Suitable preservatives include, but are not limited to, parabens, chlorobutanol, phenol, sorbic acid, and thimerosal. The formulation may also contain an antioxidant to prevent degradation of the RNA nanostructure.

[0196] The formulation may be buffered to pH 3-8 for parenteral administration after reconstitution. Suitable buffers include, but are not limited to, phosphate buffers, acetate buffers, and citrate buffers.

[0197] Water-soluble polymers can be used in preparations for parenteral administration. Suitable water-soluble polymers include, but are not limited to, polyvinyl pyrrolidone, dextran, carboxymethyl cellulose, and polyoxyethylene. Sterile injectable solutions can be prepared by adding the desired amount of RNA nanostructures to a suitable solvent or dispersion medium with one or more of the excipients listed above, followed by filtration sterilization. Dispersions can be prepared by adding various sterilized RNA nanostructures to a sterile carrier containing a basic dispersion medium and other components required from those listed above. Sterile powders for preparing sterile injectable solutions can be prepared by vacuum drying and freeze drying techniques, which produce a powder of any additional desired components of the RNA nanostructure plus a previously sterile filtered solution. The powder can be prepared in such a way that the particles are porous in nature, which can increase the dissolution of the particles. Methods for preparing porous particles are well known in the art.

[0198] Pharmaceutical preparations for parenteral administration can be in the form of sterile aqueous solutions or particle suspensions formed by one or more RNA nanostructures. Acceptable solvents include, for example, water, Ringer's solution, phosphate buffered saline (PBS), and isotonic sodium chloride solution. The preparation can also be a sterile solution, suspension or emulsion in a nontoxic parenterally acceptable diluent or solvent (e.g., 1,3-butanediol).

[0199] In some cases, the formulation can be dispersed or packaged in liquid form. In other aspects, the formulation for parenteral administration can be packaged as a solid, for example, obtained by freeze drying a suitable liquid formulation. The solid can be reconstituted with a suitable carrier or diluent before administration.

[0200] Solutions, suspensions or emulsions for parenteral administration may be buffered with an effective amount of a buffer necessary to maintain a pH suitable for ocular administration. Suitable buffers include, but are not limited to, acetate, borate, carbonate, citrate, and phosphate buffers.

[0201] Solutions, suspensions or emulsions for parenteral administration may also contain one or more tonicity agents to adjust the isotonic range of the formulation. Suitable tonicity agents include, but are not limited to, glycerol, mannitol, sorbitol, sodium chloride, and other electrolytes.

[0202] Solutions, suspensions or emulsions for parenteral administration may also contain one or more preservatives to prevent bacterial contamination of ophthalmic preparations. Suitable preservatives include, but are not limited to, polyhexamethylene biguanide hydrochloride (PHMB), benzalkonium chloride (BAK), stabilized chlorine oxygen complex (also known as ), phenylmercuric acetate, chlorobutanol, sorbic acid, chlorhexidine, benzyl alcohol, parabens, thimerosal, and mixtures thereof.

[0203] Solutions, suspensions, or emulsions used in nanotechnology (including nanoformulations for parenteral administration) may also contain one or more excipients, such as dispersing agents, wetting agents, and suspending agents.

[0204] Topical preparations

[0205] RNA nanostructures as described herein can be formulated for topical administration. Suitable dosage forms for topical administration include creams, ointments, salves, sprays, gels, lotions, emulsions, liquids, and transdermal patches. The preparations can be formulated for transmucosal, transepithelial, transendothelial, or transdermal administration. The topical preparations can include one or more chemical permeation enhancers, membrane permeation agents, membrane transport agents, emollients, surfactants, stabilizers, and combinations thereof.

[0206] In some aspects, the RNA nanostructures can be administered as liquid formulations (such as solutions or suspensions), semisolid formulations (such as lotions or ointments), or solid formulations. In some aspects, the RNA nanostructures can be formulated as liquids, including solutions and suspensions, such as eye drops, or as semisolid formulations, such as ointments or lotions for topical application to the skin, to mucous membranes (such as eyes), to the vagina, or to the rectum.

[0207] The formulation may contain one or more excipients, such as emollients, surfactants, emulsifiers, penetration enhancers, and the like.

[0208] Suitable softeners include, but are not limited to, almond oil, castor oil, carob extract, cetearyl alcohol, cetyl alcohol, cetyl ester wax, cholesterol, cottonseed oil, cyclomethicone, glycol palmitostearate, glycerol, glyceryl monostearate, glyceryl monooleate, isopropyl myristate, isopropyl palmitate, lanolin, lecithin, light mineral oil, medium chain triglycerides, mineral oil and lanolin alcohol, petrolatum, petrolatum and lanolin alcohol, soybean oil, starch, stearyl alcohol, sunflower oil, xylitol and combinations thereof. In some aspects, the softener may be ethylhexyl stearate and ethylhexyl palmitate.

[0209] Suitable surfactants include, but are not limited to, emulsifying wax, glyceryl monooleate, polyoxyethylene alkyl ethers, polyoxyethylene castor oil derivatives, polysorbates, sorbitan esters, benzyl alcohol, benzyl benzoate, cyclodextrin, glyceryl monostearate, poloxamer, povidone, and combinations thereof. In some aspects, the surfactant may be stearyl alcohol.

[0210] Suitable emulsifiers include, but are not limited to, gum arabic, metallic soaps, certain animal and vegetable oils, and various polar compounds, anionic emulsifying waxes, calcium stearate, carbomer, cetearyl alcohol, cetyl alcohol, cholesterol, diethanolamine, glycol palmitostearate, glyceryl monostearate, glyceryl monooleate, hydroxypropylcellulose, hydroxypropylmethylcellulose, lanolin, hydrated, lanolin alcohols, lecithin, medium chain triglycerides, methylcellulose, mineral oil and lanolin alcohols, sodium dihydrogen phosphate, monoethanolamine, nonionic emulsifying waxes, oleic acid, poloxamers, various poloxamers, polyoxyethylene alkyl ethers, polyoxyethylene castor oil derivatives, polyoxyethylene sorbitan fatty acid esters, polyoxyethylene stearate, propylene glycol alginate, self-emulsifying glyceryl monostearate, sodium citrate dehydrate, sodium lauryl sulfate, sorbitan esters, stearic acid, sunflower oil, tragacanth gum, triethanolamine, xanthan gum, and combinations thereof. In some aspects, the emulsifier can be glyceryl stearate.

[0211] Suitable classes of penetration enhancers include, but are not limited to, fatty alcohols, fatty acid esters, fatty acids, fatty alcohol ethers, amino acids, phospholipids, lecithin, bile salts, enzymes, amines and amides, complexing agents (liposomes, cyclodextrins, modified celluloses, and imides), macrocyclic compounds (such as macrolides, ketones, and anhydrides and cyclic ureas), surfactants, N-methylpyrrolidone and its derivatives, DMSO and related compounds, ionic compounds, azone and related compounds, and solvents (such as alcohols, ketones, amides, polyols (e.g., diols).

[0212] Suitable emulsions include, but are not limited to, oil-in-water emulsions and water-in-oil emulsions. Either or both phases of the emulsion may include a surfactant, an emulsifier, and / or a liquid non-volatile non-aqueous material. In some aspects, the surfactant may be a nonionic surfactant. In other aspects, the emulsifier is an emulsifying wax. In further aspects, the liquid non-volatile non-aqueous material is a glycol. In some aspects, the glycol is propylene glycol. The oil phase may contain other suitable oily pharmaceutically acceptable excipients. Suitable oily pharmaceutically acceptable excipients include, but are not limited to, hydroxylated castor oil or sesame oil, which may be used as a surfactant or emulsifier in the oil phase.

[0213] Also provided is a lotion comprising an RNA nanostructure as described herein. In some aspects, the lotion is in the form of an emulsion with a viscosity of 100 centistokes to 1000 centistokes. The fluidity of the lotion can allow for rapid and uniform application over a wide surface area. The lotion can be formulated to dry on the skin, leaving a thin coating of its pharmaceutical component on the skin surface.

[0214] Also provided is a cream containing RNA nanostructures as described herein. The cream may contain an emulsifier and / or other stabilizer. In some aspects, the cream is in the form of a cream having a viscosity greater than 1000 centistokes (generally in the range of 20,000-50,000 centistokes). Compared with an ointment, a cream is easier to spread and easier to remove.

[0215] One difference between creams and lotions is the viscosity, which depends on the amount / use of various oils and the percentage of water used to prepare the formulation. Creams can be thicker than lotions, can have a variety of uses, and can have more different oils / butter, depending on the desired effect on the skin. In some aspects of cream formulations, the water base percentage can be about 60% to about 75% of the total, and the oil base can be about 20% to about 30% of the total, with the other percentages being emulsifiers, preservatives, and additives, to reach a total of 100%.

[0216] Also provided is an ointment containing RNA nanostructures as described herein and a suitable ointment base. Suitable ointment bases include hydrocarbon bases (e.g., vaseline, white vaseline, yellow ointment, and mineral oil); Absorbent bases (hydrophilic vaseline, anhydrous lanolin, lanolin, and cold cream); Water removable bases (e.g., hydrophilic ointments) and water-soluble bases (e.g., polyethylene glycol ointments). Pastes are generally different from ointments because they contain a larger percentage of solids. Pastes are generally more absorbent and less greasy than ointments prepared with the same components.

[0217] Also described herein are gels, gelling agents, and liquid carriers comprising RNA nanostructures as described herein. Suitable gelling agents include, but are not limited to, modified celluloses such as hydroxypropyl cellulose and hydroxyethyl cellulose; carbomer homopolymers and copolymers; thermoreversible gels and combinations thereof. Suitable solvents in liquid carriers include, but are not limited to: diethylene glycol monoethyl ether; alkylene glycols such as propylene glycol; isosorbide dimethyl; alcohols such as isopropanol and ethanol. The solvents may be selected based on their ability to dissolve the drug. Other additives that may improve the skin feel and / or emolliency of the formulation may also be added. Such additives include, but are not limited to, isopropyl myristate, ethyl acetate, C 12 -C 15 Alkyl benzoates, mineral oil, squalane, cyclomethicone, capric / caprylic triglyceride, and combinations thereof.

[0218] Also described herein are foams that may include RNA nanostructures as described herein. The foam may be an emulsion combined with a gas propellant. The gas propellant may include hydrofluoroalkanes (HFA). Suitable propellants include HFAs, such as 1,1,1,2-tetrafluoroethane (HFA 134a) and 1,1,1,2,3,3,3-heptafluoropropane (HFA 227), but mixtures and additives of these and other HFAs currently approved or approved for medical use are suitable. The propellant may lack hydrocarbon propellant gas, which may produce flammable or explosive vapors during the spraying process. In addition, the foam may not include volatile alcohols, which may produce flammable or explosive vapors during use.

[0219] A buffer can be used to control the pH of the composition. The buffer can buffer the composition from about pH 4 to about pH 7.5, from about pH 4 to about pH 7, or from about pH 5 to about pH 7. In some aspects, the buffer can be triethanolamine.

[0220] Preservatives may be included to prevent the growth of fungi and microorganisms. Suitable preservatives include, but are not limited to, benzoic acid, butyl paraben, ethyl paraben, methyl paraben, propyl paraben, sodium benzoate, sodium propionate, benzalkonium chloride, benzethonium chloride, benzyl alcohol, cetylpyridinium chloride, chlorobutanol, phenol, phenethyl alcohol, and thimerosal.

[0221] In certain aspects, the formulations may be provided by continuous delivery of one or more formulations to a patient in need thereof. For topical applications, repeated applications may be performed, or a patch may be used to provide continuous administration of the noscapine analog over an extended period of time.

[0222] Enteral preparations

[0223] RNA nanostructures described herein can be prepared in enteral formulations, such as for oral administration. Suitable oral dosage forms include tablets, capsules, solutions, suspensions, syrups and lozenges. Tablets can be prepared using compression or molding techniques known in the art. Gelatin or non-gelatin capsules can be prepared as hard capsule shells or soft capsule shells, using techniques known in the art, which can encapsulate liquid, solid and semi-solid fill materials.

[0224] Preparations containing RNA nanostructures as described herein can be prepared using pharmaceutically acceptable carriers. "Carriers" as generally used herein include, but are not limited to, diluents, preservatives, binders, lubricants, disintegrants, swelling agents, fillers, stabilizers, and combinations thereof. The polymers used in the dosage form include, but are not limited to, suitable hydrophobic or hydrophilic polymers and suitable pH-dependent or independent polymers. Suitable hydrophobic and hydrophilic polymers include, but are not limited to, hydroxypropyl methylcellulose, hydroxypropyl cellulose, hydroxyethyl cellulose, carboxymethyl cellulose, polyethylene glycol, ethyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, polyvinyl alcohol, polyvinyl acetate, and ion exchange resins. "Carrier" also includes all components of the coating composition, which may include plasticizers, pigments, colorants, stabilizers, and glidants.

[0225] Formulations containing RNA nanostructures as described herein can be prepared using one or more pharmaceutically acceptable excipients, including diluents, preservatives, binders, lubricants, disintegrants, swelling agents, fillers, stabilizers, and combinations thereof.

[0226] Delayed release dosage formulations containing RNA nanostructures as described herein can be prepared as described in standard references, such as "Pharmaceutical dosage form tablets", eds. Liberman et.al. (New York, Marcel Dekker, Inc., 1989), "Remington-The science and practice of pharmacy", 20th ed., Lippincott Williams & Wilkins, Baltimore, MD, 2000, and "Pharmaceutical dosage forms and drug delivery systems", 6th Edition, Ansel et al., (Media, PA: Williams and Wilkins, 1995). These references provide information on excipients, materials, equipment and methods for preparing delayed release dosage forms of tablets and capsules and tablets, capsules and granules. These references provide information on carriers, materials, equipment and methods for preparing delayed release dosage forms of tablets and capsules and tablets, capsules and granules.

[0227] The formulations comprising RNA nanostructures as described herein can be coated with a suitable coating material, for example, to delay release once the particles have passed through the acidic environment of the stomach. Suitable coating materials include, but are not limited to, cellulosic polymers such as cellulose acetate phthalate, hydroxypropyl cellulose, hydroxypropyl methylcellulose, hydroxypropyl methylcellulose phthalate, and hydroxypropyl methylcellulose acetate succinate; polyvinyl acetate phthalate, acrylic acid polymers and copolymers, and cellulose polymers available under the trade name Methacrylic resins, zein, shellac, and polysaccharides were commercially available from Roth Pharma, Westerstadt, Germany.

[0228] The coating can be formed with water-soluble polymers, water-insoluble polymers and / or pH-dependent polymers in different proportions, with or without water-insoluble / water-soluble non-polymer excipients, to produce the desired release profile. The coating can be applied on (matrix or simple) dosage forms including, but not limited to, tablets (compressed with or without coated pellets), capsules (with or without coated pellets), pellets, granular compositions, formulated "as is", but not limited to, suspension forms or in spray dosage forms.

[0229] In addition, the coating material may contain conventional carriers such as plasticizers, pigments, colorants, glidants, stabilizers, pore formers and surfactants. Optional pharmaceutically acceptable excipients include, but are not limited to, diluents, binders, lubricants, disintegrants, colorants, stabilizers, and surfactants.

[0230] Diluents, also known as "fillers," can be used to increase the volume of a solid dosage form to provide a practical size for tablet compression or formation of pills and granules. Suitable diluents include, but are not limited to, dicalcium phosphate dihydrate, calcium sulfate, lactose, sucrose, mannitol, sorbitol, cellulose, microcrystalline cellulose, kaolin, sodium chloride, dry starch, hydrolyzed starch, pregelatinized starch, silica gel, titanium oxide, magnesium aluminum silicate, and powdered sugar. Common diluents include inert powdered substances (such as starch), powdered cellulose (particularly crystalline and microcrystalline cellulose), sugars (such as fructose, mannitol, and sucrose), cereal flours, and similar edible powders. Typical diluents include, for example, various types of starch, lactose, mannitol, kaolin, calcium phosphates or sulfates, inorganic salts such as sodium chloride, and powdered sugar. Powdered cellulose derivatives are also useful.

[0231] Adhesive can give solid dosage form with cohesive property, and therefore can guarantee that tablet or pill or granule remain intact after forming dosage form.Suitable adhesive material includes, but not limited to, starch, pregelatinized starch, gelatin, sugar (including sucrose, glucose, dextrose, lactose and sorbitol), polyethylene glycol, wax, natural and synthetic gums such as gum arabic, tragacanth, sodium alginate, cellulose, including hydroxypropyl methylcellulose, hydroxypropyl cellulose, ethyl cellulose, and magnesium aluminum silicate (veegum), and synthetic polymers such as acrylic acid and methacrylic acid copolymer, methacrylic acid copolymer, methyl methacrylate copolymer, aminoalkyl methacrylate copolymer, polyacrylic acid / polymethacrylic acid and polyvinyl pyrrolidone.Typical tablet adhesive includes materials such as starch, gelatin and sugar (such as lactose, fructose and glucose).Natural gum and synthetic gum, including gum arabic, alginate, methylcellulose, and polyvinyl pyrrolidone can also be used.Polyethylene glycol, hydrophilic polymer, ethyl cellulose and wax can also be used as adhesive.

[0232] Lubricants can be included to facilitate tablet manufacture. Suitable lubricants include, but are not limited to, magnesium stearate, calcium stearate, stearic acid, glyceryl behenate, polyethylene glycol, talc, and mineral oil. Lubricants can be included in tablet formulations to prevent the tablet and punch from getting stuck in the die. The lubricant can be selected from, for example, talc, magnesium and calcium stearate, stearic acid, and a smooth solid of hydrogenated vegetable oil.

[0233] Disintegrants may be used to promote disintegration or "falling apart" of the dosage form after administration and typically include, but are not limited to, starch, sodium starch glycolate, sodium carboxymethyl starch, sodium carboxymethyl cellulose, hydroxypropyl cellulose, pregelatinized starch, clay, cellulose, alginine, gums, or cross-linked polymers such as cross-linked PVP ( XL).

[0234] Stabilizers can be used to inhibit or delay drug decomposition reactions, for example, including oxidation reactions. Suitable stabilizers include, but are not limited to, antioxidants, butylated hydroxytoluene (BHT); ascorbic acid, its salts and esters; vitamin E, tocopherol and its salts; sulfites such as sodium metabisulfite; cysteine ​​and its derivatives; citric acid; propyl gallate, and butylated hydroxyanisole (BHA).

[0235] Additional active agents

[0236] In some aspects, a certain amount of one or more additional activating agents are included in the pharmaceutical preparation containing RNA nanostructures. Suitable additional activating agents include, but are not limited to, DNA, RNA, modified ribonucleotides, amino acids, peptides, polypeptides, antibodies, aptamers, ribozymes, guide sequences of ribozymes that inhibit translation or transcription of essential tumor proteins and genes, hormones, immunomodulators, antipyretics, tranquilizers, antipsychotics, analgesics, spasmolytics, anti-inflammatory drugs, antihistamines, anti-infective agents and chemotherapeutics (anticancer drugs). Other suitable additional activating agents include, sensitizers (such as radiation sensitizers). RNA nanostructures can be used as monotherapy or in combination with other activating agents for the treatment or prevention of diseases or illnesses.

[0237] Suitable hormones include, but are not limited to, amino acid-derived hormones (e.g., melatonin and thyroxine), small peptide hormones and protein hormones (e.g., thyrotropin-releasing hormone, vasopressin, insulin, growth hormone, luteinizing hormone, follicle-stimulating hormone, and thyroid-stimulating hormone), eicosanoids (e.g., arachidonic acid, lipoxins, and prostaglandins), and steroid hormones (e.g., estradiol, testosterone, tetrahydrotestosterone, and cortisol).

[0238] Suitable immunomodulators include, but are not limited to, prednisone, azathioprine, 6-MP, cyclosporine, tacrolimus, methotrexate, interleukins (e.g., IL-2, IL-7, and IL-12), cytokines (e.g., interferons (e.g., IFN-α, IFN-β, IFN-ε, IFN-κ, IFN-ω, and IFN-γ), granulocyte colony stimulating factor, and imiquimod), chemokines (e.g., CCL3, CCL26, and CXCL7), cytosine monophosphate, oligodeoxynucleotides, dextran, antibodies, and aptamers).

[0239] Suitable antipyretics include, but are not limited to, nonsteroidal anti-inflammatory drugs (e.g., ibuprofen, naproxen, ketoprofen, and nimesulide), aspirin and related salicylates (e.g., choline salicylate, magnesium salicylate, and sodium salicylate), acetaminophen / paracetamol, metamizole, nabdomylidene, antipyrine, and quinine.

[0240] Suitable sedatives include, but are not limited to, benzodiazepines (e.g., alprazolam, bromazepam, chlordiazepoxide, clonazepam, clorazepam, diazepam, flurazepam, lorazepam, oxazepam, temazepam, triazolam, and tofisopam), serotonergic antidepressants (e.g., selective serotonin reuptake inhibitors, tricyclic antidepressants and monoamine oxidase inhibitors), mebicar, afobazole, selank, bromantane, emoxypine, azaperone, barbiturates, hydroxyzine, pregabalin, varedol, and beta-blockers.

[0241] Suitable antipsychotics include, but are not limited to, benperidol, bromperidol, droperidol, haloperidol, moperone, pipeperone, tilmiperone, fluspirin, penfluridol, pimozide, acepromazine, chlorpromazine, cyanomemazine, dizyrazine, fluphenazine, levomepromazine, mesoridazine, properazine, percynanch, hydroxyperchlorpromazine, piperozine, prochlorperazine, promazine, promethazine, azithromycin, thioperazine, thioetherazine, trifluoperazine, triflupromazine, chlorprothixene, chlorpenthixol, flupenthixol, thiophene, thiophene, thiophene, thiophene, thiophene. Thioxanthene, zuclopenthixol, clothiapine, clothiapine, azithromycin, capipramine, clocapramine, molindone, mosapramine, sulpiride, vilapride, amisulpride, amoxapine, aripiprazole, asenapine, clozapine, blonanserin, iloperidone, lurasidone, melperone, nemopride, olanzapine, paliperidone, perospirone, quetiapine, remopride, risperidone, sertindole, trimipramine, ziprasidone, zotepine, alstonie, bifenazolidinone, biopterin, epiprazole, cannabidiol, cariprazine, pimavanserin, pomaglumetad methionil, pencaserin, nomeline, and zicronapine.

[0242] Suitable analgesics include, but are not limited to, acetaminophen / acetaminophen, nonsteroidal anti-inflammatory drugs (e.g., ibuprofen, naproxen, ketoprofen, and nimesulide), COX-2 inhibitors (e.g., rofecoxib, celecoxib, and etoricoxib), opioids (e.g., morphine, codeine, oxycodone, hydrocodone, dihydromorphine, pethidine, buprenorphine), tramadol, norepinephrine, fluoxetine, nefopam, orphenadrine, pregabalin, gabapentin, cyclobenzaprine, scopolamine, methadone, ketobemidone, pirithromide, and aspirin and related salicylates (e.g., choline salicylate, magnesium salicylate, and sodium salicylate).

[0243] Suitable antispasmodics include, but are not limited to, mebeverine, paverine, cyclobenzaprine, carisoprodol, orphenadrine, tizanidine, metaxalone, methocarbamol, chlorzoxazone, baclofen, dantrolene, baclofen, tizanidine, and dantrolene.

[0244] Suitable anti-inflammatory drugs include, but are not limited to, prednisone, non-cholesterol anti-inflammatory drugs (e.g., ibuprofen, naproxen, ketoprofen, and nimesulide), COX-2 inhibitors (e.g., rofecoxib, celecoxib, and etoricoxib), and immunoselective anti-inflammatory derivatives (e.g., submandibular peptide-T and its derivatives).

[0245] Suitable antihistamines include, but are not limited to, H1-receptor antagonists (e.g., acrivastine, azelastine, bilastine, brompheniramine, buclizine, bromazine, carbinoxamine, cetirizine, chlorpromazine, cyclizine, chlorpheniramine, clemastine, cyproheptadine, desloratadine, dexbrompheniramine, dexchlorpheniramine, dimenhydrinate, dimethinidine, diphenhydramine, doxylamine, ebastine, embramine, fexofenadine, hydroxyzine, levocetirizine, levocetirizine, chlorpromazine, cyclizine, chlorpheniramine, clemastine, cyproheptadine, desloratadine, dexbrompheniramine, dexchlorpheniramine, dimenhydrinate, dimethinidine, diphenhydramine, doxylamine, ebastine, embramine, fexofenadine, hydroxyzine, levocetiriz ... tirzine), loratadine, meclizine, mirtazapine, olopatadine, orphenadrine, phenindrine, pheniramine, phenyltoloxamine, promethazine, pyrimidine, quetiapine, rupatadine, tripelenamine and triprolidine), H2-receptor antagonists (e.g., cimetidine, famotidine, lafutidine, nizatidine, rafitidine and roxatidine), triptoquine, catechins, cromoglicate, nedocromil, and beta2-adrenergic agonists.

[0246] Suitable anti-infective agents include, but are not limited to, anti-amoebic agents (e.g., nitazoxanide, paromomycin, metronidazole, tnidazole, chloroquine, and iodoquinol), aminoglycosides (e.g., paromomycin, tobramycin, gentamicin, amikacin, kanamycin, and neomycin), anthelmintics (e.g., pyrantel, mebendazole, ivermectin, praziquantel, albendazole, miltefosine, thiabendazole, olaminoquine), antifungals (e.g., azole antifungals (e.g., itraconazole, fluconazole, posaconazole, ketoconazole, clotrimazole, miconazole, and voriconazole), echinocandins (e.g., caspofungin, anidulafungin, and micafungin), griseofulvin, terbinafine, flucytosine), , and polyenes (e.g., nystatin and amphotericin B), antimalarials (e.g., pyrimethamine / sulfadoxine, artemisinin methyl / lumefantrine, atovaquone / proguanil, quinine, hydroxychloroquine, mefloquine, chloroquine, doxycycline, pyrimethamine, and halofantrine), antituberculosis agents (e.g., aminosalicylates (e.g., aminosalicylic acid), isoniazid / rifampicin, isoniazid / pyrazinamide / rifampicin, bedaquiline, isoniazid, ethambutol, rifampicin, rifabutin, rifapentine, capreomycin, and cycloserine), antivirals (e.g., amantadine, rimantadine, abacavir / lamivudine, emtricitabine / tenofovir, cobicistat / elvitegravir / emtricitabine / tenofovir, efavirenz Abacavir / emtricitabine / tenofovir, abacavir / lamivudine / zidovudine, lamivudine / zidovudine, emtricitabine / tenofovir, emtricitabine / lopinavir / ritonavir / tenofovir, interferon α-2v / ribavirin, peginterferon α-2b, maraviroc, raltegravir, dolutegravir, enfuvirtide, foscarnet, fomivirsen, oseltamivir, zanamivir, nevirapine, efavirenz, etravirine, rilpivirine, delavirdine, nevirapine, entecavir, lamivudine, adefovir, sofosbuvir, didanosine, tenofovir, abacavir (avacivr), zidovudine, stavudine, emtricitabine, zalcitabin, telbivudine, simvastatin ritonavir, fosamprenavir, darunavir, ritonavir, tipranavir, atazanavir, nelfinavir, amprenavir, indinavir, sawuinavir, ribavirin, valcyclovir, acyclovir, famciclovir, ganciclovir, and valganciclovir), carbapenems (e.g., doripenem, meropenem, ertapenem, and cilastatin / imipenem), cephalosporins (e.g., cefadroxil, cefradine, cefazolin, cephalexin, cefepime, ceflaroline, loracarb, cefotetan, cefuroxime, cefuroxime, loracarb, cefoxitin,cefaclor, ceftibuten, ceftriaxone, cefotaxime, cefpodoxime, cefdinir, cefixime, cefditoren, cefazolin, and ceftazidime), glycopeptide antibiotics (e.g., vancomycin, dalbavancin, oritavancin, and telvancin), glycine cyclines (e.g., tigecycline), antileprosy drugs (e.g., clofazimine and thalidomide), lincomycin and its derivatives (e.g., clindamycin and lincomycin), macrolides and their derivatives (e.g., telithromycin, fidaxomicin, erythromycin, azithromycin, clarithromycin, dirithromycin, and troleandomycin), ), linezolid, sulfamethoxazole / trimethoprim, rifaximin, chloramphenicol, fosfomycin, metronidazole, aztreonam, bacitracin, beta-lactam antibiotics (benzathine penicillin (benzacetyl and benzylpenicillin), phenoxymethylpenicillin, cloxacillin, flucoxacillin, methicillin, temocillin, mecillinam, azlocillin, mezlocillin, piperacillin, amoxicillin, ampicillin, bacampicillin, carbenicillin, piperacillin, ticarcillin, amoxicillin / clavulanic acid, ampicillin / sulbactam, piperacillin / tazobactam, clavulanic acid / ticarcillin, penicillin, procaine penicillin, oxacillin, bicyclidine Cloxacillin, nafcillin, cefazolin, cephalexin, cephalosporin C, cephalosporin, cefaclor, cefadroxil, cefuroxime, cefotetan, cefoxitin, cefiximine, cefotaxime, cefpodoxime, ceftazidime, ceftriaxone, cefepime, cefpirome, ceftaroline, biapenem, doripenem, ertapenem, faropenem, imipenem, meropenem, panipenem, azupenem, tebipenem, thanamycin, azrewonam, tigemonam, nocardiamycin A, taboxinine, and beta-lactams), quinolones (e.g., lomefloxacin, norflurazon floxacin, ofloxacin, qatifloxacin, moxifloxacin, ciprofloxacin, levofloxacin, gemifloxacin, moxifloxacin, cinoxacin, nalidixic acid, enoxacin, grefloxacin, gatifloxacin, trovafloxacin, and sparfloxacin), sulfonamides (e.g., sulfamethoxazole / trimethoprim, sulfasalazine, and sulfisoxazole), tetracyclines (e.g., doxycycline, demeclocycline, minocycline, doxycycline / salicylic acid, doxycycline / omega-3 polyunsaturated fatty acids, and tetracycline), and urinary tract anti-infectives (e.g., nitrofurantoin, methenamine, fosfomycin, cinoxacin, nalidixic acid, trimethoprim, and methylene blue).

[0247] Suitable chemotherapeutic agents include, but are not limited to, paclitaxel, brentuximab vedotin, doxorubicin, 5-FU (fluorouracil), everolimus, pemetrexed, melphalan, pamidronate, anastrozole, exemestane, nelarabine, ofatumumab, bevacizumab, belinostat, tositumomab, carmustine, bleomycin, bosutinib, busulfan, alemtuzumab, irinotecan, vancomycin, Detanib, bicalutamide, lomustine, daunomycin, clofarabine, cabozantinib, actinomycin D, ramucirumab, cytarabine, cyclophosphamide, cyclophosphamide mustard, decitabine, dexamethasone, docetaxel, hydroxyurea, dacarbazine, leuprolide, epirubicin, oxaliplatin, asparaginase, estramustine, cetuximab, vilmodegib, Erwinia chrysanthemi asparaginase, amifostine, etoposide, flutamide, toremifene, flu Vestrant, letrozole, degarelix, pralatrexate, methotrexate, floxuridine, atozumab, gemcitabine, afatinib, imatinib mesylate, carmustine, eribulin, trastuzumab, altretinoin, topotecan, ponatinib, idarubicin, ifosfamide, ibrutinib, axitinib, interferon α-2a, gefitinib, romidepsin, ixabepilone, ruxolitinib, cabazitaxel, ado-trastuzumab emtansine Conjugates, carfilzomib, chlorambucil, sargramostim, cladribine, mitotane, vincristine, procarbazine, megestrol acetate, trametinib, mesna, strontium-89 chloride, dichloromethyl diethylamine, mitomycin, busulfan, gemtuzumab ozogamicin, vinorelbine, filgrastim, PEG-filgrastim, sorafenib, nilutamide, pentostatin, tamoxifen, mitoxantrone, pegaspargase, deneukin diftitox), alitretinoin, carboplatin, pertuzumab, cisplatin, pomalidomide, prednisone, aldesleukin, mercaptopurine, zoledronic acid, lenalidomide, rituximab, octreotide, dasatinib, regorafenib, histrelin, sunitinib, sildenafil, homoharringtonine, thioguanine (tioguanine), dabrafenib, erlotinib, bexarotene, temozolomide, thiotepa, thalidomide, BCG, temsirolimus, bendamustine hydrochloride, triptorelin, arsenic trioxide (aresnic trioxide), lapatinib, valrubicin, panitumumab, vinblastine, bortezomib, tretinoin, azacitidine, pazopanib, teniposide, folinic acid, crizotinib, capecitabine, enzalutamide, ipilimumab, goserelin, vorinostat, idelalisib, ceritinib, abiraterone, epothilone, tafluposide, azathioprine, doxifluridine, vindesine, all-trans retinoic acid, and other anticancer agents listed elsewhere herein.

[0248] Methods of using RNA nanostructures and formulations thereof

[0249] RNA nanostructures and preparations thereof can be used to deliver one or more cargo compounds to a subject or cell in need thereof. In some respects, the RNA nanostructures can be used to deliver RNA or DNA molecules for replacement gene / transcript therapy, deliver RNAi or similar RNA (e.g., microRNA) to a subject to specifically inhibit RNA transcripts to reduce the gene expression of a specific gene or multiple genes, deliver imaging agents, deliver small molecule drugs, and / or deliver any other cargo compounds that can be encapsulated in the RNA nanostructures provided herein. Therefore, the RNA nanostructures can be used to deliver treatment, prevention, and / or diagnosis compounds to a subject in need thereof.

[0250] In some aspects, the RNA nanostructures described herein can be contacted with cells or their populations. In some aspects, the cells or their populations are sensitized for treatment or prevention delivered by the RNA nanostructure. In some aspects, the RNA nanostructure is delivering a sensitizer. In some aspects, the cargo compound delivered is not a sensitizer. In one aspect, after the RNA nanostructure is administered, the subject can be sensitized for treatment. In one aspect, the sensitivity of the increase or decrease in the sensitivity for treatment such as therapeutic treatment (such as provided by the cargo compound delivered by the RNA nanostructure) can be measured according to one or more methods known in the art for specific treatment. In one aspect, the method for measuring the sensitivity for treatment includes, but is not limited to, cell proliferation assays and cell death assays. In one aspect, the sensitivity of cells or subjects to treatment can be measured or determined by comparing the sensitivity of cells or subjects after the disclosed therapeutic composition with the sensitivity of cells or subjects to which the disclosed therapeutic composition has not yet been administered.

[0251] For example, in one aspect, after administration of a sensitizer and / or an RNA nanostructure (such as an RNA nanostructure carrying a sensitizer), the cell can be 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, 20-fold or more sensitive to treatment than a cell that has not been administered the sensitizer. In one aspect, after applying the disclosed therapeutic composition, the resistance of the cell to treatment can be lower by 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, 20-fold or more than the cell to which the sensitizer (such as the sensitizer delivered by the RNA nanostructure as described herein) is not applied. Determining the sensitivity or resistance of a cell or subject can be conventional in the art and within the skill range of an ordinary clinician and / or researcher.

[0252] In one aspect, determine that cell or subject is sensitive or resistance to treatment and can be monitored.For example, in one aspect, data about sensitivity and resistance can be acquired periodically, such as for subject (for example, human subject or patient with cancer and / or abnormal cell growth) life span weekly, every other week, monthly, every other month, every 3 months, 6 months, 9 months, or every year, every other year, every 5 years, every 10 years.In one aspect, data about sensitivity and resistance can be acquired at different times rather than at periodic time.In one aspect, can change subject's treatment based on data about cell or subject's sensitivity or resistance to treatment.For example, in one aspect, can change treatment by changing the dosage of disclosed composition, the administration route of disclosed composition, the administration frequency of disclosed composition etc.

[0253] In some respects, when the RNA nanostructure includes a photodegradable joint connecting a targeting moiety and / or a cargo compound, the RNA nanostructure can be applied to a subject or a cell colony. After application, light can be applied to a cell region and / or colony in a subject in need thereof that needs treatment or prevention, to cause the release of the RNA nanostructure and / or cargo molecules.

[0254] RNA nanostructures as provided herein can be administered to subjects, cells or their colonies in need thereof. The subjects in need thereof may suffer from cancer, genetic diseases or disorders, viruses, bacteria, parasites and / or fungal infections, or any other diseases or disorders that will benefit from the effective agents (such as cargo compounds described herein) delivered. The amount delivered can be the effective amount of the RNA nanostructures provided herein. The subjects in need thereof can be symptomatic or asymptomatic. In some aspects, the RNA nanostructures provided herein can be co-administered with another active agent. It will be understood that co-administration can refer to additional compounds contained in a formulation or provided in a dosage form separated from the RNA nanostructure or its formulation. The effective amount of the RNA nanostructure or its formulation (such as those disclosed herein) can be in the range of about 0.1 mg / kg to about 500 mg / kg. In some aspects, the effective amount is in the range of about 0.1 mg / kg to 10 mg / kg. In other aspects, the effective amount is in the range of about 0.1 mg / kg to 100 mg / kg. If in further aspects, the effective amount is in the range of about 0.1 mg to about 1000 mg. In some aspects, the effective amount can be from about 500 mg to about 1000 mg.

[0255] The administration of the RNA nanostructure and its preparation can be systemic or local. The compounds and preparations described herein can be administered to subjects in need thereof once or more daily. In one aspect, the compound and / or its preparation can be administered once a day. In some aspects, the compound and / or its preparation can be administered once a day. In another aspect, the compound and / or its preparation can be administered twice a day. In some aspects, when administered, an effective amount of the compound and / or preparation is administered to a subject in need thereof. The compound and / or its preparation can be administered once or more weekly. In some aspects, the compound and / or its preparation can be administered 1 day per week. In other aspects, the compound and / or its preparation can be administered 2 to 7 days per week.

[0256] In some aspects, the RNA nanostructure and / or its preparation can be administered in a dosage form. The amount or effective amount of the compound and / or its preparation can be divided into a variety of dosage forms. For example, the effective amount can be divided into two dosage forms, and the first dosage form can be, for example, administered in the morning, and the second dosage form can be administered in the evening. Although the effective amount is given by two doses in one day, the subject has received an effective amount. In some aspects, the effective amount is about 0.1 to about 1000 mg per day. The effective amount in the dosage form can be in the range of about 0.1 mg / kg to about 1000 mg / kg. The dosage form can be formulated for oral, vaginal, intravenous, transdermal, subcutaneous, intraperitoneal, or intramuscular administration. The preparation of dosage forms for various routes of administration is described elsewhere herein.

[0257] The modular RNA motifs described herein and the RNA nanostructures described herein can be used to prepare drugs for treating diseases or cancer.

[0258] Many aspects of the invention have been described. However, it will be appreciated that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other aspects are within the scope of the following claims.

[0259] Example

[0260] Example 1: RNA-based micelles: a platform for chemotherapeutic drug loading and delivery.

[0261] RNA can be used as a powerful building block for bottom-up manufacturing of nanostructures for biotechnology and biomedical applications. In addition to the current self-assembly strategies using base pairing, motif stacking and tertiary interactions, we report for the first time the construction of RNA-based micelle nanostructures, which have cholesterol molecules conjugated to a helical end of a branched pRNA 3-to-joining (3WJ) motif. The obtained amphiphilic RNA micelles are composed of hydrophilic RNA heads and covalently attached hydrophobic lipid tails, which can be spontaneously assembled in aqueous solution by hydrophobic interactions. Utilizing the characteristics of pRNA 3WJ branched structures, assembled RNA micelles can escort a variety of functional modules. As a proof of concept for therapeutic delivery, paclitaxel is loaded onto the RNA micelles with significantly improved water solubility. The successful construction of drug-loaded RNA micelles is confirmed and characterized by agarose gel electrophoresis, atomic force microscopy (AFM), dynamic light scattering (DLS) and Nile red fluorescence encapsulation assays. The critical micelle formation concentration is as low as about 100nM. The RNA micelles loaded with paclitaxel can be internalized into cancer cells and inhibit their proliferation. Further studies show that the RNA micelles loaded with paclitaxel induce apoptosis of cancer cells in a Caspase-3 dependent manner, but the RNA micelles alone show low cytotoxicity. Finally, the RNA micelles loaded with paclitaxel target tumors in vivo, and do not accumulate in healthy tissues and organs. There is also no or very low pro-inflammatory reaction induction. Therefore, multivalence, cancer cell permeability, combined with controlled assembly, low toxicity or non-toxicity, and tumor targeting, are all promising features that make our pRNA micelles become suitable platforms for potential drug delivery.

[0262] Introduction

[0263] Functional nanoparticles prepared by molecular self-assembly have great application prospects in biotechnology and biomedicine[1-4]. Among these, RNA has been used as a unique biomaterial to construct a variety of nanoparticles through self-assembly [Li, H. et al. Adv. Mater. 28 (2016) 7501-7507; Guo, P. Nature Nanotechnology 5 (2010) 833-842; Shu, D. et al. Nature Nanotechnology 6 (2011) 658-667; Shu, Y. et al. Methods 54 (2011) 204-214; Haque, F. et al. Nano Today 7 (2012) 245-257; Afonin, KA et al. Nano. Lett. 12 (2012) 5192-5195; Shu, Y. et al. Nat. Protoc. 8 (2013) 1635-1659; Khisamutdinov, E. et al. Nucleic Acids Res.42(2014)9996-10004; Jasinski, D. et al. ACS Nano 8 (2014) 7620-7629; Khisamutdinov, EF et al. Advanced Materials 28 (2016) 100079-100087; Afonin, KA et al. Nano Lett. 14 (2014) 5662-5671; Dibrov, SM et al. Proc. Natl. Acad. Sci. USA 108 (2011) 6405-6408; Afonin, KA et al. Nat. Nanotechnol. 5 (2010) 676-682].It has been demonstrated that these RNA nanoparticles can be further functionalized for biomedical applications [Lee, JB et al. Nat. Mater. 11 (2012) 316-322; Lee, TJ et al. Oncotarget 6 (2015) 14766-14776; Cui, D. et al. Scientific reports 5 (2015) 10726; Shu, D. et al. ACS Nano 9 (2015) 9731-9740; Rychahou, P. et al. ACS Nano 9 (2015) 1108-1116; Binzel, D. et al. Molecular Therapy 24 (2016) 1267-1277; Afonin, KA et al. Nat. Protoc. 6 (2011) 2022-2034]. Strategies for self-assembly of RNA nanoparticles have been previously reported. The use of RNA base pairing and tertiary interactions provides precise control of the composition, structure and function of multifunctional RNA assemblies at the nanoscale [Shu, Y. et al. Nat. Protoc. 8 (2013) 1635-1659; Khisamutdinov, EF et al. Methods Mol Biol 1316 (2015) 181-193]. In this study, the strategy of making RNA self-assemblies with micelle properties through intermolecular hydrophobic interactions was examined.

[0264] Described herein is the design and fabrication of a stable phi29pRNA 3-way junction (3WJ) motif that can be used as a backbone for constructing multivalent RNA nanoparticles with high chemical and thermodynamic stability [Guo, P. Nature Nanotechnology 5 (2010) 833-842; Haque, F. et al. Nano Today 7 (2012) 245-257]. The size and shape of the branched RNA nanoparticles obtained are uniform. They can exert different functions while maintaining their tertiary folding and independent functions both in vitro and in vivo [Haque, F. et al. Nano Today 7 (2012) 245-257; Jasinski, D. et al. ACS Nano 8 (2014) 7620-7629; Shu, D. et al. ACS Nano 9 (2015) 9731-9740; Binzel, D. et al. Molecular Therapy 24 (2016) 1267-1277; Shu, Y. et al. RNA 19 (2013) 766-777; Khisamutdinov, E. F. et al. ACS Nano. 8 (2014) 4771-4781; Li, H. et al. Nucleic Acid Ther. (2015) 25 (4): 188-97; Lee, T. J. et al. Mol. Ther. (2017) 25 (7): 1544-1555; Shu, D. et al. Nucleic Acids Res. (2014) 42 (2): e10].It has also been shown that fluorescent dye molecules [Shu, D. et al. EMBO J. 26 (2007) 527-537] and specific cell targeting ligands [Shu, D. et al. ACS Nano 9 (2015) 9731-9740; Rychahou, P. et al. ACS Nano 9 (2015) 1108-1116; Binzel, D. et al. Molecular Therapy 24 (2016) 1267-1277; Lee, T. J. et al. Mol Ther. (2017) 25 (7): 1544-1555; Pi, F. et al. Nat Nanotechnol. (2018) 13 (1): 82-89] can be covalently linked to RNA chains by RNA solid phase synthesis or by post-transcriptional chemical conjugation [Shu, Y. et al. Methods 54 (2011) 204-214; Shu, Y. et al. Nat. Protoc. 8 (2013) 1635-1659; Raouane, M. et al. Bioconjug. Chem 23 (2012) 1091-1104]. The feasibility of RNA molecules modified by different chemical and functional moieties demonstrates the potential of RNA nanoparticles as a versatile drug delivery platform.

[0265] DNA micelle constructs have been described [Gosse, C. et al. J Phys Chem B 108 (2004) 6485-6497; Wu, Y. et al. Proc Natl Acad Sci USA 107 (2010) 5-10; Liu, H. et al. Chemistry 16 (2010) 3791-3797; Chen, T. et al. Angew. Chem Int. Ed Engl. 52 (2013) 2012-2016; Jeong, J Het al. Bioconjug. Chem 12 (2001) 917-923; Dentinger, PM et al. Langmuir 22 (2006) 2935-2937; Alemdaroglu, FE et al. Angew. Chem Int. Ed Engl. 52 (2013) 2012-2016; Jeong, J Het al. Bioconjug. Chem 12 (2001) 917-923; Dentinger, PM et al. Langmuir 22 (2006) 2935-2937; Alemdaroglu, FE et al. Angew. Chem Int. Ed Engl. Engl.45(2006)4206-4210;Trinh,T.et al.Chem Commun.(Camb.)52(2016)10914-10917;Li,Z.et al.NanoLetters 4(2004)1055-1058;Alemdaroglu,FEet al.Adv.Mater.20(2008)899-902]. By fusing the lipophilic part to one of the helical ends of the pRNA-3WJ branch, the hydrophilic RNA molecule can be converted into an amphiphilic construct. This amphiphilic construct behaves like a phospholipid, and at the same time it spontaneously self-assembles into a monodisperse three-dimensional micelle nanostructure having a lipid core and a branched RNA outer crown as a result of intermolecular hydrophobic interactions in aqueous solution. Unlike current DNA micelle systems, whose applications are limited by their single functionality [Wu, Y. et al. Proc Natl Acad Sci USA 107 (2010) 5-10; Jeong, J Het al. Bioconjug. Chem 12 (2001) 917-923], pRNA micelles are able to covalently link different types of functional moieties to a single particle, including chemotherapeutics for cancer treatment, imaging moieties for nanoparticle tracking, and co-delivered RNAi components for combination therapy.

[0266] Paclitaxel (PTX) isolated from the bark of Taxus brevifolia [Wani, MC et al. J Am. Chem Soc 93 (1971) 2325-2327] is one of the most effective chemotherapeutic drugs for a variety of cancer types [Spencer, CM et al. Drugs 48 (1994) 794-847; Rowinsky, EK et al. N. Engl. J Med. 332 (1995) 1004-1014; Jordan, MA et al. Nat Rev. Cancer 4 (2004) 253-265]. The mechanism of paclitaxel for cancer treatment is to promote and stabilize microtubules and further inhibit the G2 or M phase of the cell cycle, followed by cell death [Horwitz, SB et al. Trends Pharmacol. Sci 13 (1992) 134-136]. However, according to the Biopharmaceutical Classification System (BCS), paclitaxel has been classified as a type IV chemical drug because of its low water solubility (~0.4 μg / mL) and low permeability. The first formulation of paclitaxel used was in a 1:1 (v:v) mixture of Cremophor EL (polyoxyethylene castor oil) and dehydrated ethanol, diluted 5-20 times with 0.9% sodium chloride or 5% dextrose solution for intravenous administration [Singla, AK et al. Int. J Pharm 235 (2002) 179-192]. However, it has been observed that formulations containing Cremophor oil lead to severe side effects [Gelderblom, H. et al. Eur. J Cancer 37 (2001) 1590-1598] and unexpected nonlinear plasma pharmacokinetics [Sparreboom, A. et al. Cancer Res 56 (1996) 2112-2115]. Therefore, alternative formulations of paclitaxel have been extensively explored, particularly with nanoparticle-based delivery systems [Kim, SC et al. J Control Release 72 (2001) 191-202]. Encapsulation of paclitaxel in nanodelivery systems can increase drug circulation half-life, reduce its systemic toxicity, reduce side effects, improve pharmacokinetic and pharmacodynamic properties, and demonstrate better patient compliance, taking advantage of nanoscale size, tumor-targeted delivery, and biocompatibility. Paclitaxel albumin-bound nanoparticles Approved by the FDA in 2005. Liposomal paclitaxel Polymer micelles (Genexol ) and polymer conjugates with polyglutamate It is the currently commercially available formulation of paclitaxel. In addition, there are various types of paclitaxel nanoparticle formulations that are either under development or in clinical trials, such as polymer-based nanoparticles [Hamaguchi, T. et al. Br. J Cancer 97 (2007) 170-176; Dong, Y. et al. Biomaterials 25 (2004) 2843-2849; Kim, K. et al. J Control Release 146 (2010) 219-227], lipid-based nanoparticles [Yoshizawa, Y. et al. Int. J Pharm 412 (2011) 132-141; Yuan, H. et al. Int. J Pharm 348 (2008) 137-145], polymer-drug conjugates [Khandare, JJ et al. Bioconjug. Chem 17 (2006) 1464-1472; Bedikian, AY et al. Melanoma Res 14 (2004) 63-66], inorganic nanoparticles [Hwu, J. R et al. J Am. Chem Soc 131 (2009) 66-68], carbon nanotubes [Lay, CL et al. nanotechnology 21 (2010) 065101], nanocrystals [Deng, J. et al. Int. J Pharm 390 (2010) 242-249], etc. However, the formulation of paclitaxel into RNA-based nanodelivery platforms has never been reported.

[0267] This embodiment particularly describes the design and construction of a well-defined RNA-micelle system for encapsulating paclitaxel by conjugating with pRNA-3WJ-lipid. This is also the first report of RNA-paclitaxel micelles with significantly enhanced water solubility and tumor permeability of paclitaxel. The RNA micelles obtained show low critical micelle formation concentration (CMC), excellent cell binding and permeability, and effective inhibition of cancer cell proliferation by inducing Caspase-3 dependent cell apoptosis in vitro. Finally, it is demonstrated that these drug-loaded RNA micelles can be delivered to tumors with favorable tumor targeting systemically, thereby minimizing the retention of drugs in healthy tissues and key organs. There is also no or very low induction of proinflammatory reactions. All these findings show the powerful potential of RNA-micelle systems as suitable drug delivery platforms for cancer treatment. These RNA micelles can be used for tumor-specific targeting, reducing drug effective doses and further reducing the side effects of chemotherapy. The RNA micelles described herein can be a solid and safe nano delivery system to carry anticancer drugs for specific tumor targeting and treatment with minimal side effects to combat cancer and improve the quality of life of patients.

[0268] Materials and methods

[0269] Synthesis of RNA strands conjugated to paclitaxel via “click chemistry”

[0270] To synthesize PTX-azide, 1:2:2:1 equivalents of paclitaxel (Alfa Aesar), 6-azidohexanoic acid (azido-HA) (Chem-IMPEX International), N,N'-dicyclohexylcarbodiimide (DCC) (AcrosOrganics) and 4-(dimethylamino)pyridine (DMAP) (Sigma Aldrich) were weighed into a two-necked round bottom flask. The reaction mixture was dissolved in about 20 mL of dry dichloromethane (DCM) and reacted at room temperature while stirring under a nitrogen atmosphere for 24 hours. The reaction solution was filtered and concentrated on a rotary vaporizer. The concentrated reaction solution was further purified by silica gel chromatography with a series of solvent washes of n-hexane:ethyl acetate. The fractions containing the purified product were combined and dried. The purified final product, PTX-azide, was characterized by nuclear magnetic resonance (NMR) spectroscopy.

[0271] 5'-Alkyne-RNA was synthesized by standard RNA solid phase chemical synthesis using 5'-hexynyl phosphoramidite (Glen Research Inc.) The theoretical yield of labeled RNA strands was approximately 68% (0.9819=0.68) with an average coupling efficiency of 98%.

[0272] To 5 μL of 2 mM RNA-alkyne aqueous solution, 2 μL of PTX-azide (50 mM, 5 equivalents, in 3:1 (v / v) DMSO (dimethyl sulfoxide, hard dry, Acros Organics) / tBuOH (tert-butyl alcohol, anhydrous, Sigma Aldrich)) and 3 μL of freshly prepared "click solution" containing 1:2 molar ratio of 0.1 M CuBr (copper (I) bromide, Sigma Aldrich) and 0.1 M TBTA (tris [(1-benzyl-1H-1,2,3-triazol-4-yl) methyl] amine, Sigma Aldrich) were added. The reaction mixture was mixed thoroughly and reacted at room temperature for 3 hours. The success of the reaction was determined by 20% 8M urea PAGE in TBE (89 mM Tris base-borate, 2 mM EDTA) buffer. The reaction solution was then diluted with 100 μL 0.3 M NaOAc (sodium acetate) and 1 mL 100% ethanol for RNA precipitation. The precipitate was dissolved in water and used for RNA precipitation in an Agilent PLRP-S 4.6 x 250 mm Ion pair reverse phase HPLC purification was used on the column. PTX-labeled RNA was separated from unreacted RNA-alkyne in an acetonitrile gradient (ramp). The flow rate of 1.5 mL / min was balanced in 95% solvent A (0.1 MTEAA, HPLC grade H2O) and 5% solvent B (0.1 M TEAA, 75% acetonitrile, 25% HPLC grade H2O). The sample was filtered through a 0.2 μm spin filter, loaded onto the column, and then eluted by a gradient from 5% to 100% B over a 30-minute period. Fractions were collected, merged, and buffer exchanged. The final RNA-PTX conjugate was characterized by mass spectrometry.

[0273] Design and construction of 2'-F modified pRNA-3WJ-PTX micelles

[0274] RNA micelles were constructed using a bottom-up approach [Shu, D. et al. Nature Nanotechnology 6 (2011) 658-667]. The pRNA-3WJ-PTX micelle, consisting of three fragments, a3WJ, b3WJ, and c3WJ, was functionalized with: paclitaxel (Alfa Aesar) (a3WJ-5'PTX) at the 5'-end of a3WJ as a therapeutic module; cholesterol at the 3'-end of b3WJ (b3WJ-3'chol) as a lipophilic module; and Alexa647 (Alexa 647) at the 3'-end of c3WJ. 647, Invitrogen) (c3WJ-3'Alexa647), as a near infrared (NIR) imaging module. The control RNA nanoparticles were particles without a therapeutic module called pRNA-3WJ micelle, without a lipophilic module called pRNA-3WJ-PTX, and without both a lipophilic module and a therapeutic module called pRNA-3WJ.

[0275] The following pRNA-3WJ scaffold [Shu, D. et al. Nature Nanotechnology 6 (2011) 658-667] sequences were used: a3WJ 5'-UUgCCaUgUgUaUgUggg-3' (SEQ ID NO: 16); b3WJ 5'-CCCaCaUaCUUUgUUgaUCC-3' (SEQ ID NO: 17); c3WJ 5'-ggaUCaaUCaUggCaa-3' (SEQ ID NO: 18) (capital letters indicate 2' fluoro (2'-F) modified nucleotides). RNA fragments were synthesized by standard solid phase chemical synthesis [Lay, CL et al. nanotechnology 21 (2010) 065101] using commercially available phosphoramidite monomers of 2'-TBDMS adenosine (n-bz) CED, 2'-TBDMS guanosine (n-ibu) CED, 2'-fluorocytidine (n-ac) CED and 2'-fluorouridine CED, followed by deprotection according to the protocol provided by the manufacturer (Azco Biotech). Paclitaxel (PTX) was conjugated to the 5'-end of a3WJ by a chemoselective Cu(I)-catalyzed Huisgen 1,3-dipolar cycloaddition reaction ("click chemistry") and purified by reverse phase HPLC as described above. Cholesterol was attached to the 3'-end of the b3WJ chain by using a 3'-cholesteryl-TEG CPG carrier (Glen Research) following the manufacturer's instructions. The theoretical yield of b3WJ-3'chol was ∼68% (0.9819=0.68), with an average coupling efficiency of 98%. Synthesized RNA was purified from terminated chains using an ion-pair reverse phase column, which typically results in complete labeling of cholesterol during solid phase synthesis. Alexa647 labeled RNA chains were purchased from Trilink Bio Technologies, LLC.

[0276] pRNA-3WJ-PTX micelles were assembled by mixing 3WJ chains (a3WJ, b3WJ and c3WJ) at equimolar concentrations in TMS buffer (50 mM Tris pH 8.0, 100 mM NaCl, 10 mM MgCl2) or PBS buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and 2 mM KH2PO4, pH 7.4), followed by heating to 80°C for 5 min and slowly cooling to 37°C over the course of 40 min, followed by incubation at 37°C for 1 h.

[0277] Characterization of assembled pRNA-3WJ micelles

[0278] The assembly of functionalized 3WJ nanoparticles was characterized by 1% (w / v) agarose gel shift assay in TAE (40 mM Tris-acetate, 1 mM EDTA) buffer. After electrophoresis, the gel was stained with ethidium bromide and visualized by Typhoon FLA 7000 (GE healthcare).

[0279] The apparent hydrodynamic diameters of preassembled pRNA-3WJ-PTX (20 μM in PBS buffer) and pRNA-3WJ-PTX micelles (10 μM in PBS buffer) were measured by Zetasizer nano-ZS (Malvern Instrument, Ltd) at 25°C. The data are from three independent measurements. The zeta potential of pRNA-3WJ-PTX micelles (1 μM in PBS buffer) was also measured by Zetasizer nano-ZS (Malvern Instrument, Ltd) at 25°C.

[0280] The size and shape of RNA micelles were also determined by atomic force microscopy (AFM). For AFM, 10 μM pRNA-3WJ-PTX micelle solutions dissolved in TMS buffer were deposited onto freshly cut mica and dried overnight. After two consecutive rinse steps with HPLC-grade water, the mica was mounted on a Bruker Multimode IV AFM and imaged in tapping mode.

[0281] The successful formation of RNA micelles was also determined by Nile Red encapsulation assay as previously reported [Edwardson, TG Wet al. Nature Chemistry 5 (2013) 868-875; Zhang, A. et al. Soft Matter 9 (2013) 2224-2233]. A 5 mM Nile Red stock solution in acetone was used for all experiments. Briefly, 0 μM, 1 μM, 5 μM and 10 μM assembled pRNA-3WJ micelles were incubated with 100 μM Nile Red in TMS buffer, respectively. The mixture was heated to 80°C for 5 minutes and slowly cooled to 37°C over 40 minutes, followed by incubation at 37°C for 1 hour. The Nile Red fluorescence intensity relative to the RNA micelle concentration was measured on a Fluorolog spectrofluorometer (Horiba Jobin Yvon) with an excitation wavelength of 535 nm and an emission spectrum of 560 nm to 760 nm. pRNA-3WJ was used as a control.

[0282] Determine the critical micelle formation concentration (CMC)

[0283] The CMC of pRNA-3WJ micelles was determined by fluorescent Nile red encapsulation assay [Zhang, A. et al. Soft Matter 9 (2013) 2224-2233] and agarose gel electrophoresis as previously reported. In brief, 2-fold serial dilutions of RNA micelle samples (in the range of 5 μM to 0.005 μM) were incubated with 100 μM Nile red in a final volume of 50 μL. The samples were heated to 80 ° C for 5 minutes and slowly cooled to 37 ° C within 40 minutes, followed by incubation at 37 ° C for 1 hour. The Nile red fluorescence intensity relative to the RNA micelle concentration was measured using a Fluorolog spectrofluorometer (Horiba Jobin Yvon) with an excitation wavelength of 535 nm and an emission spectrum of 560 nm to 760 nm. Two-fold serial dilutions of RNA micelle samples (ranging from 2.5 nM to 0.0390625 μM) were directly loaded onto 1% (w / v) agarose gel for electrophoresis in TAE buffer at 120 V. The gel was stained with ethidium bromide and visualized by Typhoon FLA 7000.

[0284] Formulation stability test

[0285] 2 μM solutions of pRNA-3WJ micelles were incubated at 37°C for 1 hour in acidic (pH = 4), neutral (pH = 7.4) and alkaline (pH = 12) buffers. The final 2 μM pRNA-3WJ micelles were also incubated at different temperatures (4°C, 37°C and 65°C) for 1 hour. All samples after incubation were loaded onto 1% (w / v) agarose gels for electrophoresis in TAE buffer at 120V. The gels were stained with ethidium bromide and visualized by Typhoon FLA 7000.

[0286] Cell culture

[0287] Human KB cells (American Type Culture Collection, ATCC) were grown and cultured in RPMI-1640 (Thermo Scientific) containing 10% FBS in a 37° C. incubator with 5% CO2 and a humidified atmosphere. Mouse macrophage-like RAW 264.7 cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum, 100 units / mL penicillin, and 100 mg / mL streptomycin at 37° C. in a humidified atmosphere containing 5% CO2.

[0288] In vitro binding assay using flow cytometry

[0289] 250 nM, 500 nM and 1 μM Alexa647-labeled pRNA-3WJ-PTX micelles and control pRNA-3WJ-PTX nanoparticles without lipophilic modules were each incubated with 2×10 5 KB cells were incubated at 37°C for 1 hour. After washing twice with PBS, the cells were resuspended in PBS. Flow cytometry was performed by the UK Flow Cytometry & Cell Sorting Core Facility to observe the cell binding efficacy of Alexa647-labeled pRNA-3WJ-PTX micelles. Data were analyzed by FlowJo 7.6.1 software.

[0290] In vitro binding and internalization assays using confocal microscopy

[0291] KB cells were grown on slides overnight. 1 μM Alexa647-labeled pRNA-3WJ-PTX micelles and control pRNA-3WJ-PTX nanoparticles without a lipophilic module were each incubated with cells at 37°C for 1 hour. After washing with PBS, cells were fixed with 4% paraformaldehyde (PFA) and washed three times with PBS. The cytoskeleton of the fixed cells was treated with 0.1% Triton-X100 in PBS for 5 minutes to increase the permeability of the cell membrane, and then stained with Alexa Fluor 488 phalloidin (Life Technologies) for 30 minutes at room temperature, followed by 3 × 10 minute washes with PBS. The cells were encapsulated with ELISA Gold antifade reagent, and DAPI was used for nucleus staining. Cell binding and cellular internalization were then measured by FluoView FV1000 filter confocal microscope system (Olympus Corp.).

[0292] In vitro drug release assay of pRNA-3WJ-PTX

[0293] 10 μM pRNA-3WJ-PTX conjugates were incubated with 50% FBS at 37°C and samples were collected at different time points (1 hour, 4 hours, 8 hours, 12 hours, 15 hours, 22 hours, 28 hours, and 36 hours) and immediately frozen at -80°C. After completing sample collection over the entire time course, all samples were electrophoresed on 15% non-denaturing PAGE in TBM buffer (89mMTris alkali-borate, 5mM MgCl2). Gel bands were quantified by ImageJ, and the percentage of complete particles was calculated with complete particle %=[(intensity of the upper band) / (intensity of the upper band+intensity of the lower band)]×100%. The upper band represents the complete RNA-drug conjugate, while the lower band represents the RNA oligonucleotide after drug release.

[0294] MTT assay

[0295] To determine the cytotoxic effects from pRNA-3WJ-PTX micelle treatment, the CellTiter 96 non-radioactive cell proliferation assay (Promega) was used to determine changes in cell viability following the manufacturer's instructions. Briefly, 1×10 4KB cells were seeded into 96-well plates. On the second day, 1 μM, 800nM, 600nM, 400nM and 200nM pRNA-3WJ-PTX micelles were added to the wells and repeated three times. Paclitaxel, pRNA-3WJ micelles, pRNA-3WJ-PTX and pRNA-3WJ were used as controls with the same test concentration. The plate was incubated for 48 hours at 37°C in a humidified 5% CO2 atmosphere. After incubation, 15 μl of dye solution was added to each well and the plate was incubated up to 4 hours at 37°C in a humidified 5% CO2 atmosphere. Then, 100 μL of solubilization solution / termination mixture was added to each well and incubated for 1 hour. Finally, the contents in the wells were mixed to obtain a uniformly colored solution and their absorbance at 570nm was recorded on a Synergy 4 microplate detector (Bio-Tek).

[0296] Study of apoptosis in in vitro cell models

[0297] As previously reported, FITC Annexin V apoptosis detection kit (BD Pharmingen) and Caspase-3 assay kit (BD Pharmingen) were used to study apoptosis induced by pRNA-3WJ-PTX micelle treatment. For FITC Annexin V staining assay, KB cells were seeded in 12-well plates overnight. Then, cells (~30% confluence) were treated with 1 μM pRNA-3WJ-PTX micelles. Controls included paclitaxel, pRNA-3WJ micelles, and pRNA-3WJ. According to the manufacturer's instructions, after incubation with RNA micelles for 48 hours, KB cells were trypsinized into single cell suspensions. After two PBS washes, cells were resuspended in 100 μL 1× Annexin V-FITC binding buffer. Then 5 μL Annexin V-FITC and 5 μL propidium iodide (PI) were added to each sample and incubated at room temperature for 25 minutes. The samples were finally added to flow tubes containing 200 μL of 1× binding buffer and used for FACS analysis within 1 hour.

[0298] For Caspase-3 assay, KB cells were seeded on 24-well plates overnight. Cells (about 30% confluence) were then treated with 1 μM pRNA-3WJ-PTX micelles. Controls included paclitaxel, pRNA-3WJ micelles, and pRNA-3WJ. Following the manufacturer's instructions, the Caspase-3 activity of the cells was measured and compared using a Caspase-3 assay kit (BD Pharmingen). Briefly, cell lysates (1-10 × 10 6Cells / mL) and incubated on ice for 30 minutes. For each sample, 2 μL of reconstituted Ac-DEVD-AMC in 80 μL 1× HEPES buffer was added to 25 μL of cell lysate and incubated at 37°C for 1 hour. The amount of AMC released from Ac-DEVD-AMC was measured on a Fluorolog fluorescence spectrometer (Horiba Jobin Yvon) with an excitation wavelength of 380 nm in the range of 400-500 nm emission wavelength.

[0299] Animal models

[0300] All experimental protocols involving animals were performed under the supervision of the University of Kentucky Institutional Animal Care and Use Committee (IACUC). To generate the xenograft model, female athymic nu / nu mice aged 4–8 weeks were purchased from Taconic. KB cells were cultured at 2 × 10 6 The cells / site were injected into the left shoulder of nude mice to establish subcutaneous tumor xenografts. When the tumor nodules reached 50 mm approximately 5 days after injection, the 3 The mice were used for tumor targeting studies when the volume of

[0301] NIR fluorescence imaging to detect RNA microclusters targeting cancer xenografts in vivo

[0302] To study the delivery of pRNA-3WJ-PTX micelles in vivo, fluorescence imaging studies were performed after tail vein injection of 100 μL 20 μM Alexa 647-labeled pRNA-3WJ-PTX micelles and pRNA-3WJ-PTX (estimated final concentration in blood was about 1 μM) in mice bearing KB tumors. Mice injected with PBS were used as negative fluorescence controls. Whole-body images were taken at 30 minutes, 1 hour, 2 hours, 4 hours, 8 hours, and 24 hours. Mice were killed by CO2 inhalation and subsequent cervical dislocation 24 hours after injection, and major visceral organs including heart, lungs, liver, spleen, and kidneys from the killed mice were collected together with the tumors, and fluorescence imaging was performed using an IVIS spectral workstation (Caliper Life Science) with 640 nm excitation and 680 nm emission to evaluate the biodistribution profile.

[0303] Evaluation of pro-inflammatory induction of pRNA-3WJ micelles

[0304] For in vitro evaluation of pro-inflammatory cytokine induction, 2.5 × 10 cells / well were seeded in 24-well plates. 5RAW 264.7 cells were cultured overnight. pRNA-3WJ micelles (1 μM or 200 nM) and lipopolysaccharide (LPS, 3.6 μg / mL, equivalent to 200 nM pRNA-3WJ micelles) were diluted in DMEM (Life Technologies) and added to the cells for incubation, repeated three times. After incubation for 16 hours, the cell culture supernatant was collected and immediately stored at -80 ° C for further analysis. Following the manufacturer's instructions, TNF-α and IL6 in the collected supernatant were detected using mouse ELISA MAX Deluxe kits (BioLegend, San Diego, California, USA), while IFN-α was detected using mouse IFNα ELISA kits (PBLAssay Science, Piscataway, New Jersey, USA).

[0305] To evaluate proinflammatory cytokines and chemokine induction in vivo, pRNA-3WJ micelles (1 μM), LPS (10 μg per mouse) and DPBS controls were injected into male C57BL / 6 mice aged 4 to 6 weeks via the tail vein. Blood samples were collected from mice by cardiac puncture 3 hours after injection and centrifuged at 12,800 × g for 10 minutes to collect serum. Following the manufacturer's instructions, the concentrations of TNF-α, IL6 and IFN-α in serum were detected by ELISA as described above. Chemokine induction was determined using a mouse chemokine chip kit (R&D Systems, Minneapolis, Minnesota, USA) following the manufacturer's instructions. LiCor was used to quantify the imprinted spots.

[0306] Statistical analysis

[0307] For each sample tested,

[0308] Each experiment was repeated 3 times. Unless otherwise stated, the results are presented as mean ± SD. Statistical differences were assessed using Student's T-test, and p < 0.05 was considered significant.

[0309] Results and discussion

[0310] Construction and characterization of pRNA-3WJ micelles

[0311] pRNA-3WJ-PTX micelles utilize a modular design consisting of three short RNA segments derived from the pRNA 3WJ motif [Shu, D. et al. Nature Nanotechnology 6 (2011) 658-667] ( Figure 1A). By considering the global folding structure of the pRNA 3WJ motif, the lipophilic module cholesterol was conjugated to the 3'-end of b3WJ. The crystal structure of the pRNA3WJ motif shows that the angles across the three helices (H1, H2 and H3) of pRNA3WJ are about 60° (H1-H2), about 120° (H2-H3) and about 180° (H1-H3) [Zhang, H. et al. RNA 19 (2013) 1226-1237] ( Figure 1B ). To avoid steric interference with micelle formation due to the branched 3WJ structure, the cholesterol molecule was placed on H3, which is farthest from the other two helices H1 and H2. Our current design involves functionalizing H1 with a therapeutic module (paclitaxel) and an imaging module (Alexa 647 dye) without interfering with micelle formation ( Figure 1C , Figure 1D ). As shown in the following studies, the functions of the conjugated chemotherapeutic drugs and detection dyes are also fully retained. The unoccupied helix H2 can be further activated with RNAi modules (such as siRNA or microRNA) for combined therapy to produce enhanced or synergistic therapeutic effects.

[0312] After mixing the chains in equimolar ratios in PBS or TMS buffer, the complex assembled with high efficiency as shown in a 1% agarose gel shift assay ( Figure 1E ). Alexa 647-labeled RNA microclusters also showed fluorescent bands, which corresponded to the bands indicating successful microclusters formation ( Figure 1E ). The assembly of RNA microclusters was further demonstrated by AFM, which showed a uniform spherical structure ( Figure 2A DLS analysis showed that the average hydrodynamic diameter of pRNA-3WJ-PTX micelles was 118.7±14.50nm, compared with 7.466±1.215nm of the pRNA-3WJ core skeleton ( Figure 2B ). The constructed pRNA-3WJ-PTX micelles also carry a negative charge. Figure 2C As shown, the zeta potential is -26.1 ± 10.4 mV. Finally, RNA micelle formation was analyzed by Nile red encapsulation assay. Nile red is a hydrophobic dye and is almost non-luminescent in bulk aqueous solution, but its inclusion in a non-polar microenvironment (such as the lipid core of the micelle structure) leads to a strong fluorescence enhancement [Greenspan, P. et al. J Cell Biol 100 (1985) 965-973]. Therefore, the increase in fluorescence intensity associated with incubation of different concentrations of RNA micelles with a fixed amount of Nile red dye indicates that RNA micelles are formed in buffer solutions ( Figure 2D In contrast, no significant increase in fluorescence intensity was observed in the control pRNA-3WJ without a lipid core ( Figure 2D ).

[0313] In order to chemically stabilize pRNA-3WJ micelles in vivo, 2'-F modified U and C nucleotides were used during RNA chain synthesis [Behlke, MA Oligonucleotides. 18 (2008) 305-319; Vestweber, H. et al. Synthetic Metals 68 (1995) 263-268]. The 2'-F modified RNA nanoparticles were shown to be chemically stable and showed a longer circulation half-life compared to their unmodified RNA counterparts [Shu, D. et al. Nature Nanotechnology 6 (2011) 658-667; Behlke, MA Oligonucleotides. 18 (2008) 305-319]. The presence of 2'-F nucleotides not only renders RNA nanoparticles resistant to RNase degradation, but also enhances the melting temperature of pRNA-3WJ [Binzel, D. et al. Biochemistry 53 (2014) 2221-2231] without compromising the true folding and functionality of the core and incorporated modules [Shu, D. et al. Nature Nanotechnology 6 (2011) 658-667; Liu, J. et al. ACS Nano 5 (2011) 237-246].

[0314] The stability of the pRNA-3WJ formulations was further determined with respect to pH (acidic pH 4, neutral pH 7.4, and alkaline pH 12) and temperature (4°C, 37°C, and 65°C). The results showed that the pRNA-3WJ micelles were stable over a wide range of temperatures and acidic and neutral conditions. Figure 8 As reported, pRNA-micelles showed dissociation under alkaline conditions, but the pRNA-3WJ micelle formulation was apparently chemically and thermodynamically stable under physiological conditions (pH 7.4, 37°C).

[0315] Synthesis of RNA strands conjugated to paclitaxel via “click chemistry”

[0316] To load the pRNA micelle with a therapeutic moiety, PTX was first functionalized with -azido (-N3) for further reaction with alkyne-modified RNA. The azido group on the 2'-OH of PTX was introduced by esterification using a 6-azidohexanoic acid linker in the presence of N,N'-dicyclohexylcarbodiimide (DCC) and 4-(dimethylamino)pyridine (DMAP) in anhydrous dichloromethane to provide azide-functionalized PTX (PTX-N3) as the major product ( Fig. 9A). Although both hydroxyl groups at the 7' and 2' positions of PTX are chemically reactive, the 2'-OH generally shows higher reactivity than the 7'-OH because the 7'-OH acetylation is very unstable in aqueous media and loses the C-7 substituent rapidly [Skwarczynski, M. et al. J Med. Chem 49 (2006) 7253-7269]. After purification, PTX-N3 with functionality at the 2' position was obtained in 73% yield. 1 H NMR mass spectroscopy was used to confirm the chemical structure of PTX-N3 in CDCl3. 1 In the H NMR mass spectrum, 7'-CH resonates at 4.40 ppm, and no significant chemical shift change of the 7-CH-OH signal (at 4.4 ppm) was observed before and after esterification ( Fig. 9B ), while the resonance of the 2'-CH proton shifts from 4.78 ppm (before esterification) to 5.46 ppm (after esterification) ( Fig. 9C ).

[0317] like Figure 3A As shown, PTX-N3 reacted with -alkyne-modified RNA (a3WJ) with an efficiency of more than 90% through copper I-mediated click reaction. Figure 3B ) and mass spectrometry confirmed successful conjugation. The experimental mass of a3WJ-PTX determined by mass spectrometry was 6939.2 (m / z), which is consistent with the results based on the chemical structure ( Figure 3C ) is close to the theoretical mass (6936.82 (m / z)) calculated by paclitaxel. The ester bond formed between paclitaxel and RNA can be hydrolyzed in the presence of esterase or in aqueous solution, which allows the loaded drug to be slowly released in a controlled manner as indicated by in vitro drug release assays ( Figure 3A , 3D). This is the first report of “clicking” RNA molecules with the chemotherapy drug paclitaxel. PTX conjugation does not interfere with the stepwise assembly of pRNA-3WJ ( Fig. 10A This is also the first demonstration that the water insolubility of paclitaxel is enhanced by fusion to RNA oligonucleotides. 1 mM RNA-paclitaxel conjugate dissolved in DEPC H2O showed a clear solution ( Fig. 10B). The significantly improved water solubility of paclitaxel after conjugation to RNA and assembly into micellar nanostructures allows the use of saline solutions for in vivo administration instead of Cremophor EL formulations. In addition to click chemistry, the use of other chemical coupling reactive groups, such as -NH2 / -NHS-NH2 / -COOH, or -SH / -maleimide to functionalize RNA oligonucleotides and drug candidates is also a feasible RNA-drug conjugation method, which can be applied to drug candidates that are not suitable for click chemistry.

[0318] Determination of critical micelle formation concentration

[0319] To determine the critical micelle formation concentration (CMC) of pRNA-3WJ-PTX micelles, the Nile red assay as previously reported was used [Zhang, A. et al. Soft Matter 9 (2013) 2224-2233]. Nile red is a hydrophobic dye that has low fluorescence in water and other polar solvents, but emits strong fluorescence in non-polar environments (such as the lipid core of micelles). Therefore, the Nile red fluorescence emission intensity is used as an indicator of micelle formation. To determine the CMC, the fluorescence intensity of Nile red is plotted as a function of sample concentration. As Fig.11A As shown in the figure, Nile Red exhibits low fluorescence intensity at concentrations below 0.078 μM, indicating that Nile Red is in water and there are few micelles. As the concentration increases, the fluorescence intensity increases significantly, indicating that Nile Red is encapsulated in the lipid core of the RNA micelle. The CMC can be estimated as the intersection of the tangent line of the horizontal line with a relatively constant value of the intensity ratio and the diagonal line with a rapidly increasing intensity ratio ( Fig. 11B ). The CMC was about 100 nM and 1% TAE agarose gel further confirmed that the CMC was about 150 nM due to sensitivity limitations ( Fig. 11C ). All pRNA micelle concentrations used in in vitro and in vivo experiments were above the CMC to ensure micelle formation.

[0320] pRNA-3WJ-PTX microassembly and internalization into KB cells

[0321] To determine tumor cell targeting in vitro, pRNA-3WJ-PTX micelles and control pRNA-3WJ-PTX without the lipophilic module were incubated with KB cells, trypsinized, washed, and then analyzed by fluorescence activated cell sorting (FACS) assay. Strong binding (almost 100%) was observed for pRNA-3WJ-PTX micelles compared to pRNA-3WJ-PTX backbone control (0% binding) ( Figure 4A Confocal microscopy imaging further confirmed that pRNA-3WJ-PTX micelles were effectively bound and internalized into cancer cells, as were fluorescent RNA nanoparticles ( Figure 4B) and cytoplasm ( Figure 4B ) is proved by the excellent overlap of . For the control pRNA-3WJ-PTX without lipophilic module, very low signal is observed. These results show that RNA micelles have high affinity for cancer cell binding. Although the current RNA micelle design does not include tumor-specific targeting modules, highly charged RNA micelles (because RNA is negatively charged, it is also shown in zeta potential studies) can be similar to DNA micelles as previously reported, self-disintegrate and insert into the cell membrane when interacting with cells [Liu, H. et al. Chemistry 16 (2010) 3791-3797]. Without being bound by theory, it is believed that the internalization of RNA micelles may be mediated by subsequent endocytosis after insertion into the cell membrane.

[0322] Effects of pRNA-3WJ-PTX micelles on cancer cell growth and apoptosis in vitro

[0323] To determine the cellular effects of RNA microclusters treatment, MTT assay was performed to analyze the cell viability after treatment. Compared with RNA microclusters alone and 3WJ controls without paclitaxel conjugates, RNA microclusters containing PTX can successfully inhibit tumor cell growth at 250 nM or above ( Figure 5A ). Concentrations below 125 nM were not evaluated to remain above CMC. The cell growth inhibition caused by pRNA-3WJ-PTX micelles indicated that paclitaxel was released from the RNA strand due to the hydrolysis of the linker ester in aqueous solution. Since all RNA-PTX conjugates undergo HPLC purification, the possibility of free paclitaxel contaminating the test construct is very small. In addition, pRNA-3WJ micelles without paclitaxel loading had no effect on cell viability and proliferation, which indicates the low cytotoxicity of the RNA micelle skeleton and its potential as a safe drug delivery platform.

[0324] like Figure 5B As shown, FITC-labeled Annexin V staining confirmed that most cancer cell death was due to apoptosis. Loss of the plasma membrane is one of the earliest features in apoptotic cells. The externalization of membrane phospholipid phosphatidylserine (PS) from the inner layer of the plasma membrane to the outer layer allows FITC-labeled Annexin V to bind to PS to detect cells undergoing apoptosis. FITC Annexin V staining is used in conjunction with PI to identify cells in early apoptosis (Q3: PI negative, FITC Annexin V positive) and cells in late apoptosis or already dead (Q2: FITC Annexin V and PI positive). In our study, more than 30% of cells underwent apoptosis after 48 hours of treatment with pRNA-3WJ-PTX micelles, compared with control micelles without PTX (4.52%) or pRNA-3WJ without PTX (3.7%), indicating that changes in cancer viability are due to the induction of apoptosis.

[0325] Caspase-3 is an early apoptosis marker. Increased Caspase-3 activity is closely related to apoptosis. As reflected by increased fluorescence intensity, the increase in Caspase-3 activity appeared 12 hours after treatment with pRNA-3WJ-PTX micelles ( Figures 12A-12F ). It was found that compared with control nanoparticles (pRNA-3WJ micelles and pRNA-3WJ), cell lysates treated with pRNA-3WJ-PTX micelles showed the highest fluorescence emission similar to that of paclitaxel alone, which indicated that the induction of apoptosis was in a Caspase-3-dependent manner ( Figure 5C ).

[0326] Specific targeting of tumors in xenograft animal models by using NIR fluorescent pRNA-3WJ-PTX micromass imaging

[0327] The tumor targeting efficiency of pRNA-3WJ-PTX micelles was investigated by collecting in situ fluorescent images of tumor xenografts in nude mice at different time points after injection. Images of the tumor area became readily identifiable 4 hours after injection ( Figures 6A-6D and Fig.13 Ex vivo images of normal tissues, organs, and tumors obtained from mice injected with RNA microclusters show that the tumors taken 24 hours after injection show the strongest signal ( Figure 6E-6G ). Figures 6H-6I RNA micelles are shown to bind and internalize to cancer cells in vitro. Flow cytometry compares binding affinity to KB cells after 1 hour of treatment. Confocal microscopy shows internalization distribution. Blue: nucleus; green: cytoskeleton; red: RNA nanoparticles. Figure 6J-6L In vitro studies showing RNA micelles carrying anti-miR21. Dual-luciferase assay demonstrating anti-miR21 delivery to KB cells. qRT-PCR showing the effect of miR21 knockdown on target gene PTEN expression. Caspase-3 assay showing induction of apoptosis after treatment. Figure 6M-6N Shown is an in vivo biodistribution study in mice with xenografts. Whole body imaging. Ex vivo organ imaging 8 hours after injection. Figure 6O-6RThe in vivo therapeutic effect of RNA micelles in mice with xenografts is shown. Tumor regression curves during 5 injections (red arrows show injection days). Mouse weight curves during treatment. qRT-PCR and Western blots show that PTEN is upregulated after anti-miR21 is delivered in vivo. In terms of tumor accumulation dynamics, RNA nanoparticles reach their highest accumulation 4 hours after injection, and remain longer in tumors than in healthy organs and tissues, which shows the high tumor targeting efficiency and tumor retention ability of the constructed RNA micelles. This unique tumor retention behavior of RNA micelles shows that the delivery system takes advantage of the EPR (enhanced permeability and retention) effect in view of its nanoscale size and particle shape. In addition, the RNA micelle construct shows the extended tumor retention that may be due to its larger particle size. By including proteins such as folic acid [Shu, D. et al. Nature Nanotechnology 6 (2011) 658-667; Lee, T. J. et al. Mol Ther. (2017) 25 (7): 1544-1555; Zhang, H. et al. RNA 19 (2013) 1226-1237; Rychahou, P. et al. Methods Mol Biol 1297 (2015) 121-135; Guo, S. et al. Gene Ther 13 (2006) 814-820] and RNA aptamers [Shu, D. et al. ACS Nano 9 (2015) 9731-9740; Binzel, D. et al. Molecular Therapy 24 (2016) 1267-1277; Pi, F. et al. Nanomedicine 13(2016)1183-1193] can further ensure the specificity of in vivo tumor targeting of RNA micelle nanoparticles.

[0328] pRNA-3WJ micelles did not or only induced low pro-inflammatory responses

[0329] Proinflammatory responses may potentially be induced by both the RNA component [Guo, S. et al. Mol Ther Nucleic Acids. 2017 9: 399-408] and the cholesterol component [Tall, AR et al. Nat Rev. Immunol. 15 (2015) 104-116] in the pRNA-3WJ micelle formulation. To address this concern, the production of proinflammatory cytokines and chemokines after pRNA-3WJ micelle treatment was evaluated in both in vitro and in vivo. Tumor necrosis factor-α (TNF-α) is a cytokine involved in systemic inflammation and is one of the cytokines that causes acute phase reactions [Jaffer, U. et al. HSR Proc Intensive Care Cardiovasc. Anesth. 2 (2010) 161-175]. Interleukin 6 (IL6) is an interleukin that is both a proinflammatory cytokine and an anti-inflammatory myokine. IL6 is secreted during infection to stimulate immune responses [Scheller, J. et al. Biochim. Biophys Acta 1813 (2011) 878-888]. IFN-α interferon, which belongs to type I interferons, is also a cytokine involved in the proinflammatory response released in response to the presence of viral pathogens. Fig. 7A The results in showed that when incubated with mouse macrophage-like cells in vitro, high-dose (1 μM) and low-dose (200 nM) pRNA-3WJ micelles induced neither IL6 nor IFN-α production compared with the LPS positive control. The induction of TNF-α was undetectable under low-dose pRNA-3WJ-micells treatment, but was slightly increased under high-dose RNA-micells treatment. Figure 7B As shown, all three cytokines were not induced after intravenous injection of pRNA-3WJ-microgroups into immunocompetent C57BL / 6 mice compared to LPS control.

[0330] Chemokines are major pro-inflammatory mediators [Wang, ZM et al. J Biol Chem 275 (2000) 20260-20267; Turner, MD et al. Biochim. Biophys Acta 1843 (2014) 2563-2582]. After in vivo treatment with pRNA-microgroups, 25 chemokines were detected to have increased production. Figure 7C As shown, it can be demonstrated that pRNA-3WJ micelles did not induce new chemokines compared with the PBS group. Fig.14As highlighted by red boxes in the Figure, there are three chemokines (macrophage inflammatory protein-1γ (MIP-1γ), chemokine 10 (C10), and monocyte chemoattractant protein 2 (MCP2)) that show elevated induction compared to the PBS control. In conclusion, the pRNA-3WJ micelle formulation did not induce or only induced a very low pro-inflammatory response.

[0331] In summary, in this embodiment, the design and construction of micelles based on well-defined pRNA are particularly described, and the micelles are composed of a hydrophobic lipid core and a hydrophilic pRNA-3WJ corona. The chemotherapeutic drug paclitaxel has been loaded into the RNA micelles, and has significantly improved water solubility. It is also proved that the pRNA micelles loaded with paclitaxel show excellent tumor cell binding and internalization, and effectively induce the cytotoxic effect on tumors in vitro. After the injection of pRNA-micelles, there is also no or very low pro-inflammatory response induction. Tumor targeting is achieved by systemic injection of pRNA micelles into xenograft mouse models without accumulation in normal organs and tissues. Fig.13 The time course of tumor targeting in pRNA-3WJ-PTX microclusters is shown. P: PBS; M-PTX: pRNA-3WJ-PTX microclusters.

[0332] The branched pRNA-3WJ outer crown confers unparalleled versatility, which can be designed and constructed in any desired combination. For example, multifunctional pRNA-3WJ micelles can be constructed by combining targeting, imaging, and therapeutic modules in one nanoparticle. pRNA-3WJ micelles can also simultaneously deliver siRNA or microRNA to multiple genes or different locations of a gene to produce a synergistic effect. In addition, different types of anticancer drugs can be loaded onto one pRNA-3WJ micelle to enhance the therapeutic effect or overcome drug resistance through combination therapy. Therefore, this innovative RNA-based micelle nanodelivery platform has great potential for clinical applications.

[0333] Example 2: RNA nanoparticles, three-way junctions, multi-branched or multi-armed RNA nanostructures carrying multiple copies of paclitaxel and its derivatives are used to treat cancer and other diseases.

[0334] FIG. 15A to FIG. 19 RNA nanoparticles, three-way junctions, multi-branched or multi-armed RNA nanostructures are shown to carry multiple copies of paclitaxel and its derivatives for the treatment of cancer and other diseases.

[0335] Example 3: RNA-drug conjugation

[0336] FIG. 20A to FIG. 24B Display RNA-Taxol sequence design and drug conjugation ( Fig. 20A to Figure 20C), in vitro characterization ( Figures 21A to 21C), thermal stability (TGGE&qPCR, Fig.22A and 22B ), in vitro toxicity ( Fig.23 ) and results of therapeutic studies in animal experiments ( Fig.24A and 24B ).

[0337] FIG. 25A to FIG. 28 RNA-CPT design and drug conjugation ( FIG. 25A to FIG. 25C ), in vitro characterization (assembly gel and TGGE, FIG. 26A to FIG. 26C ), in vitro toxicity ( Fig. 27 ), and results of therapeutic studies in animal experiments ( Fig.28 ).

[0338] Example 4: Computational design of thermodynamically stable multilayered branched RNA nanostructures.

[0339] FIG. 29A to FIG. 31B Designs of branched 3WJs with different cores and helices are shown ( Fig.29A and 29B ), thermal stability (qPCR&TGGE, FIG. 30A to FIG. 30C ) and enzyme stability (serum stability assay, Fig.31A and 31B ).

[0340] Figures 32A to 36B Design of 3WJ showing branches ( FIG. 32A to FIG. 32C ), in vitro characterization (gel electrophoresis and DLS, FIG. 33A to FIG. 33C ), thermal stability (qPCR and TGGE, Fig.34A and Fig.34B ), enzyme stability (serum stability assay, Figures 35A to 35C ), and shielding properties (cell binding assay, Fig.36A and Fig.36B ).

[0341] design

[0342] Natural RNA structural elements, such as the phi29 3WJ motif, have evolved over centuries to serve specific purposes, which can be structural frameworks or structurally dynamic elements for biological functions. For drug delivery, nanoscale particles with adjustable size and shape, high structural / thermodynamic stability, and the ability to carry high density cargo to specific targets in the body without inducing immune responses or toxicity are desired.

[0343] To achieve this purpose, a platform allowing the formation of a highly stable three-dimensional RNA nanostructure has been designed, which is assembled from 3-9 sections of independent synthetic oligonucleotides of 16-120nt in length. Solid phase synthesis can be used to synthesize the oligomer, which allows site-specific modification and therefore incorporates modified nucleotides to 1) increase enzyme stability, 2) improve thermodynamic stability, or 3) increase the site for high-density cargo connections. Each oligomer is synthesized according to its specific functional requirements, and self-assembly is used to assemble all component chains of equimolar concentrations into the desired nanostructure.

[0344] To achieve efficient self-assembly from a large number of individual chains (3-9), oligomer sequence design needs to take into account several concepts: i) the interlocking domains need to be highly thermodynamically stable, ii) the sequence needs to be specific, iii) the oligomers should not have a strong internal structure, and iv) the cargo molecules should be sufficiently spaced from the core and from each other.

[0345] The stability of the interlocking domains determines the stability of the final 3D structure. Since each chain can contain different modules of the particle (treatment, targeting, imaging), it is necessary for the nanostructure to remain intact to deliver all modules. Although this can be achieved on linear double-stranded oligomers, the use of more ordered structures provides benefits, such as controlling particle size and shape, which affects biodistribution and EPR effect; protecting cargo from exposure during delivery, which allows delivery of hydrophobic molecules; and reducing enzyme activity due to steric hindrance. In order to achieve a more ordered structure, the oligomer is divided into at least two interlocking domains that may or may not be separated by structural connections. In our branched nanostructures, by example, each oligomer is divided into three domains: 5'DA, core protrusions, and 3'DA ( Fig.47C ). The number of chains that make up the nanostructure is equal to the number of DA domains in the structure. Furthermore, the number of DA domains is equal to the number of independent sequences in the nanostructure. Therefore, the sequence of any 3'DA is the reverse complementary sequence of a specific 5'DA and vice versa. The 8-branched nanostructure is then defined by 8 independent DA domains that are interlocked with their reverse complements by the specific design of the synthesized oligomers. The oligomers are then designed into two types: extension oligomers and termination oligomers. The oligomers can be fully identified by defining the DA number (1, 2, ..., 9) and whether the sequence is normal or its reverse complement (rev). Extension oligomers typically connect consecutive DA domains, such as 12rev, 23rev, 34rev, while termination oligomers close the loop by connecting the last DA with the reverse complement of the first DA (such as 41rev), in this case forming a tetrahedral arranged 4-DA nanostructure ( Fig.47A-B). Similarly, 12rev, 23rev, 34rev, 45rev, 56rev plus 61rev can form a 6-DA nanostructure, with DA domains with equal spacing being assembled into an octahedral arrangement around the nanoparticle core ( Fig.47A ).

[0346] Computation-guided design of spherical sequences:

[0347] According to the above examples, the 6-DA structure will use certain sequences (12rev, 23rev, 34rev) that are the same as the 4-DA structure. Therefore, in order to make a series of 3-9DA nanostructures, 8 extension chains and 7 termination chains are required. Computationally, this requires identifying the thermodynamically stable sequence for the 9DA domain of a predefined length (number of nucleotides), determining the desired core protrusion connecting nucleotides, and optimizing the sequence to achieve minimum self-complementarity and cross-complementarity to achieve efficient self-assembly of thermodynamically stable nanostructures.

[0348] exist Fig.48 The algorithm flow is outlined in In the first step, the user defines the following input parameters: 1) the number of DA domains, 2) the length of the DA domain, 3) the identity of the nucleotides in the linker domain, 4) the range of melting temperatures (Tm) of the DA domains, 5) the range of GC content allowed, 6) the percentage of self-complementarity allowed, 7) the percentage of cross-complementarity allowed.

[0349] The algorithm then generates a DA sequence using random number generation and tests whether the sequence falls within the expected GC content and TM range. If the sequence falls within the range, it is saved and the process is repeated until 25×# DA sequences have been determined. Once enough # sequences have been identified, they are tested for self-complementarity. Sequences that show low self-complementarity are then sorted based on their degree of cross-complementarity with other saved DA sequences. The sequence with the lowest overall complementarity is then used to target the extension oligonucleotide according to (seq1+UG 连接 +seq2 反向互补 ) and for the termination oligonucleotide according to (seq2+UG 连接 +seq1 反向互补 ) to calculate the sequence of the nanostructure chain. The self-complementarity and cross-complementarity of the full-length oligomer chain are retested to ensure that reverse complementation does not adversely affect the overall specificity of the sequence. If the nanostructure sequences pass the QC test, they are converted into RNA letter codes and saved to a file, otherwise the procedure is repeated until a suitable oligomer set is found.

[0350] Figures 37A-37C Shown are the design and construction of a branched 3WJ-based modular RNA motif and variants with different numbers of arms. Fig.37A Different highly ordered junctions (cores) are used as building blocks of modular RNA motifs. Fig.37B .Nucleotide sequences of modular RNA motifs for synthesis. Fig.37C .3D structure of one of the modular RNA motifs using 6WJ as the core and 4WJ as the arms (or branches).

[0351] FIG. 38A to FIG. 38G Show 3WJ( Fig.38A )、4WJ( Fig.38B )、5WJ( Fig.38C )、6WJ( Fig.38D )、7WJ( Fig.38E )、8WJ( Fig.38F ) and 9WJ( Figure 38G ) 2D structure of a modular RNA motif, showing an example of a synthetic RNA oligonucleotide sequence.

[0352] FIG. 39A to FIG. 39C Showing the thermal stability of various modular RNA motifs. Fig.39A .qPCR shows annealing curve. Fig.39B .TGGE shows the melting curve. Fig.39C . Comparison of Tm of annealing and melting of modular RNA motifs.

[0353] Fig.40A and Fig.40B In vitro characterization of modular RNA motifs based on branch 3WJ is shown. Fig.40A Size comparison gel: 2% agarose gel showing the assembly of 4-6WJ (from left to right: molecular weight standard, phi29-3WJ, monomer, dimer, trimer, 4WJ, 5WJ, 6WJ). Fig.40B . Size distribution of 4-6WJ measured by dynamic light scattering (DLS).

[0354] Exemplary sequences generated using the methods described in this Example.

[0355] 12REV

[0356] GACUAUAUGUUAGGCCUGGGUGAGUCCUUGCGUCUUCUACCG (SEQ ID NO: 1).

[0357] 23REV

[0358] CGGUAGAAGACGCAAGGACUUGCUAGUUGUGGUACUGUUCCC (SEQ ID NO: 2).

[0359] 31REV

[0360] GGGAACAGUACCACAACUAGUGCCCAGGCCUAACAUAUACUC(SEQ ID NO:3).

[0361] 34REV

[0362] GGGAACAGUAACCACAACUAGUGUCCCGGGAUAGGGACAUACA(SEQ ID NO:4).

[0363] 41REV

[0364] UGUAUGUCCCUAUCCCGGGAUGCCCAGCCUACAUAUCUC(SEQ ID NO:5).

[0365] 45REV

[0366] UGUAUGUCCCUAUCCCGGGAUGCUCCGCAUGAUGAAUACAGC (SEQ ID NO:6).

[0367] 51REV

[0368] GCUGUAUUCAUCAUGCGGAGUGCCCAGGCCUAACAUAUACUC(SEQ ID NO:7).

[0369] 56REV

[0370] GCUGUAUUCAUCAUGCGGAGUGGGCAUUGGGAUCGUAUGAGC (SEQ ID NO:8).

[0371] 61REV

[0372] GCUCAUACGAAUCCCAAUGCCUGCCCAGGCCUAACAUAUACUC(SEQ ID NO:9).

[0373] 67REV

[0374] GCUCAUACGAAUCCCAAUGCCUGAACAAACAGAGCAAGCCUCC(SEQ ID NO:10).

[0375] 71REV

[0376] GGAGGCUUGCUCUGUUUGUUUGCCCAGGCCUAACAUAUACUC(SEQ ID NO:11).

[0377] 78REV

[0378] GGAGGCUUGCUCUGUUUGUUUGCGCGAUUUCCGCGUUACACA(SEQ ID NO:12).

[0379] 81REV

[0380] UGUGUAACGCGGAAAUCGCGUGCCCAGGCCUAACAUAUACUC(SEQ ID NO:13).

[0381] 89REV

[0382] UGUGUAACGCGGAAAUCGCGUGCCUGCUCGCGUACGUCUUAC (SEQ ID NO:14).

[0383] 91REV

[0384] GUAAGACGUACGCGACGAGGUGCCCAGGCCUAACAUAUACUC(SEQ ID NO:15).

[0385] wxya

[0386] UUGCCAUGUGUAUUGUGGG (SEQ ID NO:16).

[0387] wxya

[0388] CCCACAUACUUUGUUGAUCC (SEQ ID NO:17).

[0389] wxya

[0390] GGAUCAAUCAUGGCAA (SEQ ID NO:18).

[0391] aPhi29-Mod

[0392] AUUCGCUGUGUGGUAGUG(SEQ ID NO:19)

[0393] bPhi29-Mod

[0394] CACUACCACUUUGUCCUACG(SEQ ID NO:20).

[0395] cPhi29-Mod

[0396] CGUAGGACCAGCGAAU(SEQ ID NO:21).

[0397] aPhi29-30

[0398] GCGUGCUGUGUGCUACCG(SEQ ID NO:22).

[0399] bPhi29-30

[0400] CGGUAGCACUUUGCUGUGCG(SEQ ID NO:23).

[0401] cPhi29-30

[0402] CGCACAGCCAGCACGC(SEQ ID NO:24).

[0403] aSF5-30

[0404] GCGUGCUGGUGCUACCG(SEQ ID NO:25).

[0405] bSF5-30

[0406] CGGUAGCACGGGCUGUGCG(SEQ ID NO:26).

[0407] cSF5-30

[0408] CGCACAGCCAGCACGC(SEQ ID NO:27)

[0409] aM2-30

[0410] GCGUGCUGGUGCUACCG(SEQ ID NO:28).

[0411] bM2-30

[0412] CGGUAGCACCGCUGUGCG(SEQ ID NO:29).

[0413] cM2-30

[0414] CGCACAGCCUCAGCACGC(SEQ ID NO:30).

[0415] aPhi29-32

[0416] ACGCGACGUGUGCAUGCC(SEQ ID NO:31).

[0417] bPhi29-32

[0418] GGCAUGCACUUUGCGUUGCG(SEQ ID NO:32).

[0419] cPhi29-32

[0420] CGCAACGCCGUCGCGU(SEQ ID NO:33).

[0421] aSF5-32

[0422] ACGCGACGGUGCAUGCC(SEQ ID NO:34)

[0423] bSF5-32

[0424] GGCAUGCACGGGCGUUGCG(SEQ ID NO:35)

[0425] cSF5-32

[0426] CGCAACGCCGUCGCGU(SEQ ID NO:36).

[0427] aM2-32

[0428] ACGCGACGGUGCAUGCC(SEQ ID NO:37)

[0429] bM2-32

[0430] GGCAUGCACCGCGUUGCG(SEQ ID NO:38)

[0431] cM2-32

[0432] CGCAACGCCUCGUCGCGU(SEQ ID NO:39)

[0433] Mod-a / WT-b

[0434] AUUCCCAUGRADUATECAUGHT(SEQ ID NO:40)

[0435] Mod-b / WT-b

[0436] CHACUACCOUGRAWACGCCCACCACUACCOUCH(SEQ ID NO:41)

[0437] Mod-c / WT-b

[0438] CGUAGGACCAGCAUCCCACAUACUUUGUUGAUCC(SEQ ID NO:42)

[0439] 30a / Mod-b

[0440] GCGUGCUGUGCUACCGCACUACCACUUCUACG(SEQ ID NO:43)

[0441] 30b / Mod-b

[0442] CGGUAGCACUUGCUGUGGCCACUACCACUUUGCUACG(SEQ ID NO:44)

[0443] 30c / Mod-b

[0444] CGCACAGCCAGCACGCCACUACCACUUUGUCCUACG(SEQ ID NO:45)

[0445] Ext30-a / Mod-b

[0446] CCUAUUCAGGUGCGUGGUGUGUAGGUACCACUACCACUUGUCCUACG(SEQ IDNO:46)

[0447] Ext30-b / Mod-b

[0448] UUGAAUUACAUCGGUAGCACUUUGCUGUGCGAGGGUAGCACUACCACUUUGUCCUACG(SEQ IDNO:47)

[0449] Ext30-c / Mod-b

[0450] CUGUUCAGCCUCGCACAGCCAGCACGCACCUGAAUAGGCACUACCACUUUGUCCUACG(SEQ ID NO:48)

[0451] WT-b / Mod-a

[0452] CCCACAUACUUUGUUGAUCCAUUCGCUGUGUGGUAGUG(SEQ ID NO:49)

[0453] WT-b / Mod-c

[0454] CCCACAUACUUUGUUGAUCCCGUAGGACCAGCGAAU(SEQ ID NO:50)

[0455] SF5-4WJ-a

[0456] UUAGGUAAAGCCACCUGCAGGUGCUACCGAUGUAAUUCAA(SEQ ID NO:51)

[0457] SF5-4WJ-b

[0458] UUGAAUUACAUCGGUAGCACGGGCUGUGCGAGGCUGAACAG(SEQ ID NO:52)

[0459] SF5-4WJ-c

[0460] CUGUUCAGCCUCGCACAGCCAGCACGCACCUGAAUAAG(SEQ ID NO:53)

[0461] SF5-4WJ-d

[0462] CCUAUUCAGGUGCGUGCUGGGCUGCAGGUGGCUUUACCUAA(SEQ ID NO:54)

[0463] Example 5 Nanostructures for Imaging

[0464] Figures 49A-49C Fluorophores conjugated to nucleic acid nanostructures (also referred to herein as nanoparticles) for in vivo cancer imaging. Fig.49A .PAGE analysis demonstrated that RNA oligomers and nanoparticles can carry multicolor fluorescent materials. Fig.49B .Assembly gels show that oligomers can be efficiently assembled after modification with fluorophores. Fig.49C.Biodistribution of Phi29 3WJ nanoparticles conjugated with ICG fluorophore.

[0465] Figures 50A-50C .DOTA chelators are conjugated to RNA oligomers and nanoparticles at high density. Fig.50A -50B. Assembly of amine-modified and DOTA-conjugated oligomers into RNA nanoparticles. Figures 50B-50C. Gd with and without chelation 3+ Comparison of RNA nanoparticles with different densities of DOTA conjugates.

[0466] Figures 51A-51C .NOTA chelators are conjugated to oligomers and nanoparticles at high density. Fig.51A .Schematic diagram of NOTA chelating Cu64 to RNA nanoparticles for PET imaging. Figures 51B-51C .Assembly gel and reverse-phase HPLC purification of NOTA-conjugated RNA nanoparticles.

[0467] Figures 52A-52E Shown is the design and synthesis of a pRNA strand with multiple aldehyde groups to conjugate drugs for pH-responsive drug release. Fig.52A . Schematic diagram of conjugation of multiple drugs on the 3WJ core. Fig.52B Examples of drugs carrying free amine groups for imine linkage. Fig.52C .Examples of drugs carrying hydroxyl groups for acetal linkage. Fig.52D .Example of pH-sensitive linker design using hydrazine bonds. Fig.52E . Examples of acid-labile linkers for conjugating PI103 prodrugs to nucleic acid oligomers.

[0468] FIG. 53A to FIG. 53H Shown is the design and preparation of RNA-based thermostable micelles for the delivery of erlotinib for cancer treatment. Fig.53A .Amphiphilic RNA chains with tunable hydrophobic modifications for forming RNA micelles. Fig.53B . Schematic representation of RNA-tocopherol micelles conjugated with functional moieties. Figures 53C-53H .Determination of critical micelle concentration of five amphipathic RNA chains with tunable hydrophobic modifications.

[0469] Fig.54A -54Q shows the design and preparation of CPT-RNA conjugates for inhibiting the growth of KB tumor xenografts. Figures 54A-54C .CPT-RNA conjugation.

[0470] Figures 54B-54D .Solubilization of drugs by conjugation to RNA. Figures 54C-54H .Assembly, thermodynamic stability and size distribution of RNA nanoparticles carrying CPT. Figures 54D-54I . Release profile of CPT from RNA nanoparticles. Figures 54J-54K .Cellular binding and internalization of CPT-RNA nanoparticles. Figure 54L-54M .Cytotoxic and apoptotic effects of CPT RNA nanoparticles. Figure 54N-54P .Tumor suppression by CPT RNANP in a KB tumor xenograft mouse model. Sequence Listing <110> Ohio State Innovation Foundation <120> RNA nanostructures, preparation methods and uses thereof <130> 321501-2160 <150> US 62 / 628591 <151> 2018-02-09 <150> US 62 / 755696 <151> 2018-11-05 <160> 54 <170> PatentIn Version 3.5 <210> 1 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide 12rev <400> 1 gacuauaugu uaggccuggg ugaguccuug cgucuucuac cg 42 <210> 2 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide 23rev <400> 2 cgguagaaga cgcaaggacu ugcuaguugu gguacuguuc cc 42 <210> 3 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide 31rev <400> 3 gggaacagua ccacaacuag ugcccaggcc uaacauauac uc 42 <210> 4 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide 34rev <400> 4 gggaacagua ccacaacuag ugucccggga uagggacaua ca 42 <210> 5 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide 41rev <400> 5 uguauguccc uaucccggga ugcccaggcc uaacauauac uc 42 <210> 6 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide 45rev <400> 6 uguauguccc uaucccggga ugcuccgcau gaugaauaca gc 42 <210> 7 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide 51rev <400> 7 gcuguauuca ucaugcggag ugcccaggcc uaacauauac uc 42 <210> 8 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide 56rev <400> 8 gcuguauuca ucaugcggag ugggcauugg gaucguauga gc 42 <210> 9 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide 61rev <400> 9 gcucauacga ucccaaugcc ugcccaggcc uaacauauac uc 42 <210> 10 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide 67rev <400> 10 gcucauacga ucccaaugcc ugaacaaaca gagcaagccu cc 42 <210> 11 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide 71rev <400> 11 ggaggcuugc ucuguuuguu ugcccaggcc uaacauauac uc 42 <210> 12 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide 78rev <400> 12 ggaggcuugc ucuguuuguu ugcgcgauuu ccgcguuaca ca 42 <210> 13 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide 81rev <400> 13 uguguaacgc ggaaaucgcg ugcccaggcc uaacauauac uc 42 <210> 14 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide 89rev <400> 14 uguguaacgc ggaaaucgcg ugccugcucg cguacgucuu ac 42 <210> 15 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide 91rev <400> 15 guaagacgua cgcgacgagg ugcccaggcc uaacauauac uc 42 <210> 16 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide a3WJ <400> 16 uugccaugug uauguggg 18 <210> 17 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide b3WJ <400> 17 cccacauacu uuguugaucc 20 <210> 18 <211> 16 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide c3WJ <400> 18 ggaucaauca uggcaa 16 <210> 19 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide aPhi29-Mod <400> 19 auucgcugug ugguagug 18 <210> 20 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide bPhi29-Mod <400> 20 cacuaccacu uuguccuacg 20 <210> twenty one <211> 16 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide cPhi29-Mod <400> twenty one cguaggacca gcgaau 16 <210> twenty two <211> 18 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide aPhi29-30 <400> twenty two gcgugcugug ugcuaccg 18 <210> twenty three <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide bPhi29-30 <400> twenty three cgguagcacu uugcugugcg 20 <210> twenty four <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide cPhi29-30 <400> twenty four cgguagcacu uugcugugcg 20 <210> 25 <211> 17 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide aSF5-30 <400> 25 gcgugcuggu gcuaccg 17 <210> 26 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide bSF5-30 <400> 26 cgguagcacg ggcugugcg 19 <210> 27 <211> 16 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide cSF5-30 <400> 27 cgcacagcca gcacgc 16 <210> 28 <211> 17 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide aM2-30 <400> 28 gcgugcuggu gcuaccg 17 <210> 29 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide bM2-30 <400> 29 cgguagcacc gcugugcg 18 <210> 30 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide cM2-30 <400> 30 cgcacagccu cagcacgc 18 <210> 31 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide aPhi29-32 <400> 31 acgcgacgug ugcaugcc 18 <210> 32 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide bPhi29-32 <400> 32 ggcaugcacu uugcguugcg 20 <210> 33 <211> 16 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide cPhi29-32 <400> 33 cgcaacgccg ucgcgu 16 <210> 34 <211> 17 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide aSF5-32 <400> 34 acgcgacggu gcaugcc 17 <210> 35 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide bSF5-32 <400> 35 ggcaugcacg ggcguugcg 19 <210> 36 <211> 16 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide cSF5-32 <400> 36 cgcaacgccg ucgcgu 16 <210> 37 <211> 17 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide aM2-32 <400> 37 acgcgacggu gcaugcc 17 <210> 38 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide bM2-32 <400> 38 ggcaugcacc gcguugcg 18 <210> 39 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide cM2-32 <400> 39 cgcaacgccu cgucgcgu 18 <210> 40 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide Mod-a / WT-b <400> 40 auucgcugug ugguagugcc cacauacuuu guugaucc 38 <210> 41 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide Mod-b / WT-b <400> 41 cacuaccacu uuguccuacg cccacauacu uuguugaucc 40 <210> 42 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide Mod-c / WT-b <400> 42 cguaggacca gcgaauccca cauacuuugu ugaucc 36 <210> 43 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide 30a / Mod-b <400> 43 gcgugcugug ugcuaccgca cuaccacuuu guccuacg 38 <210> 44 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide 30b / Mod-b <400> 44 cgguagcacu uugcugugcg cacuaccacu uugccuacg 40 <210> 45 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide 30c / Mod-b <400> 45 cgcacagcca gcacgccacu accacuuugu ccuacg 36 <210> 46 <211> 60 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide Ext30-a / Mod-b <400> 46 ccuauucagg ugcgugcugu gugcuaccga uguaauucaa cacuaccacu uuguccuacg 60 <210> 47 <211> 62 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide Ext30-b / Mod-b <400> 47 uugaauuaca ucgguagcac uuugcugugc gaggcugaac agcacuacca cuuuguccua 60 cg 62 <210> 48 <211> 58 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide Ext30-c / Mod-b <400> 48 cuguucagcc ucgcacagcc agcacgcacc ugaauaggca cuaccacuuu guccuacg 58 <210> 49 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide WT-b / Mod-a <400> 49 cccacauacu uuguugaucc auucgcugug ugguagug 38 <210> 50 <211> 36 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide WT-b / Mod-c <400> 50 cccacauacu uuguugaucc cguaggacca gcgaau 36 <210> 51 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide SF5-4WJ-a <400> 51 uuagguaaag ccaccugcag gugcuaccga uuaauucaa 40 <210> 52 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide SF5-4WJ-b <400> 52 uugaauuaca ucgguagcac gggcugugcg aggcugaaca g 41 <210> 53 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide SF5-4WJ-c <400> 53 cuguucagcc ucgcacagcc agcacgcacc ugaauagg 38 <210> 54 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Synthetic RNA oligonucleotide SF5-4WJ-d <400> 54 ccuauucagg ugcgugcugg gcugcaggug gcuuuaccua a 41

Claims

1. An RNA nanostructure comprising one or more modular RNA motifs, wherein the modular RNA motif comprises synthetic RNA oligonucleotides, wherein the synthetic RNA oligonucleotides are four segments of synthetic RNA oligonucleotides, The four synthetic RNA oligonucleotides are coupled to each other. wherein at least three cargo compound molecules are linked to each of the four synthetic RNA oligonucleotides, wherein the four synthetic RNA oligonucleotides form a central core domain, and four double-stranded arms arranged around the core domain and extending away from the central core domain, wherein the melting temperature of the RNA nanostructure with the conjugated compound molecule is greater than 65°C, wherein the four segments of synthetic RNA oligonucleotides are configured to self-assemble to form the RNA nanostructure, and The oligonucleotide sequences of the four synthetic RNA oligonucleotides are SEQ ID NOs: 51-54.

2. The RNA nanostructure according to claim 1, wherein one or more of the four synthetic RNA oligonucleotides comprises one or more modified nucleotides.

3. The RNA nanostructure of claim 2, wherein the one or more modified nucleotides are terminal nucleotides or non-terminal nucleotides.

4. The RNA nanostructure of claim 2, wherein the modification is an alkyne attached to the one or more modified nucleotides.

5. The RNA nanostructure of claim 2, wherein the modification is a linker attached to the one or more modified nucleotides.

6. The RNA nanostructure according to any one of claims 1 to 5, further comprising a functional group connected to one or more nucleotides of the four synthetic RNA oligonucleotides, wherein the RNA nanostructure further comprises a cargo compound connected to the functional group.

7. The RNA nanostructure of claim 1, wherein the cargo compound is an anticancer compound, a chelator, a radioisotope, a fluorophore, a miRNA, an anti-miRNA, a siRNA, a pH-responsive prodrug, an enzyme-cleavable prodrug, or any combination thereof.

8. The RNA nanostructure according to claim 1, wherein the RNA nanostructure is conjugated to 24 paclitaxel molecules.

9. A pharmaceutical composition comprising the RNA nanostructure according to any one of claims 1-8.

10. Use of the pharmaceutical composition according to claim 9 in the preparation of a medicament for treating cancer in a subject.

11. Use of the pharmaceutical composition according to claim 9 in the preparation of a drug for cancer chemotherapy, wherein the RNA motif or RNA nanostructure renders a hydrophobic or low-soluble drug soluble, thereby reducing the drug dosage to reduce drug toxicity or side effects, or avoiding the use of oil or organic solvents to dissolve the drug.

Images