Sensors and Sensing Systems

Abstract

The present application relates to a sensor and a sensing system. The sensor includes two electrodes and a modulated conductive channel attached to the two electrodes. The modulated conductive channel includes a modified partially double-stranded nucleic acid polymer electrically connected to the two electrodes and bridging the space between the two electrodes. The partially double-stranded nucleic acid polymer of the modification includes two polynucleotide chains partially bonded together, a vacancy in the first polynucleotide chain in which a nucleotide base is missing, and more than one nucleotide base of the second polynucleotide chain exposed at the vacancy in the first polynucleotide chain.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application Serial No. 62 / 692,468, filed on June 29, 2018, and Netherlands Application Serial No. N2021376, filed on July 23, 2018; the contents of each of which are incorporated herein by reference in their entirety.

[0003] Reference to a sequence listing

[0004] The sequence listing submitted herewith is hereby incorporated by reference in its entirety. The file name is IP-1687_sequence_listing_ST25.txt, the file size is 366 bytes, and the file creation date is June 7, 2019. Technical Field

[0005] The present application relates to, but is not limited to, sensors, sensing systems, labeled nucleotides, kits, and methods involving the use of the sensors, the sensing systems, the labeled nucleotides, and / or the kits. background

[0006] Various schemes in biological or chemical research involve a large number of controlled reactions on the surface of a local support or in a predefined reaction chamber. The specified reaction can then be observed or detected, and the subsequent analysis can help identify or reveal the properties of the chemicals involved in the reaction. For example, in some multiplex assays, an unknown analyte with an identifiable marker (e.g., a fluorescent marker) can be exposed to thousands of known probes under controlled conditions. Each known probe can be placed in a corresponding well of a microplate. Any chemical reaction occurring between the known probe and the unknown analyte in the observation well can help identify or reveal the properties of the analyte. Other examples of such schemes include known DNA sequencing methods, such as sequencing-by-synthesis (SBS) or cyclic-array sequencing. Using polynucleotide sequencing technology, analysis can help identify or reveal the properties of the polynucleotides involved in the reaction.

[0007] Brief description

[0008] The first aspect disclosed herein is a sensor. In an example, the sensor includes two electrodes with a space between the two electrodes; and a modulatable electrically conductive channel attached to the two electrodes, the modulatable electrically conductive channel including a modified, partially double stranded nucleic acid polymer electrically connected to the two electrodes and bridging the space between the two electrodes, the modified partially double stranded nucleic acid polymer including: two polynucleotide chains partially bonded together; a vacancy in the first polynucleotide chain in which a nucleotide is deleted; and more than one (a plurality of) nucleotide bases of the second polynucleotide chain exposed at the vacancy in the first polynucleotide chain.

[0009] In examples of sensors, the vacancies have a length ranging from about 10 nm to about 50 nm.

[0010] Examples of sensors also include polymerases attached to modified partially double-stranded nucleic acid polymers.

[0011] In examples of sensors, i) a linker attaches each end of the first polynucleotide chain to a corresponding one of the two electrodes; or ii) a linker attaches each end of the second polynucleotide chain to a corresponding one of the two electrodes; or iii) both i and ii.

[0012] In an example of the sensor, at least one of the more than one nucleotide bases exposed at the vacancy is a guanine base.

[0013] In an example of the sensor, each of the more than one nucleotide bases exposed at the vacancy is a guanine base.

[0014] Examples of the sensor also include a detector that detects a response from the modified partially double-stranded nucleic acid polymer when a switch strand is associated with at least some of the more than one nucleotide bases at the vacancy, wherein the switch strand includes a nucleotide strand comprising bases complementary to the at least some of the more than one nucleotide bases exposed at the vacancy.

[0015] Examples of the sensor also include a substrate supporting two electrodes; and a polymerase attached to the substrate.

[0016] Examples of sensors also include fluid systems that introduce reagents into modified partially double-stranded nucleic acid polymers. In an example, the reagents include labeled nucleotides, at least one of the labeled nucleotides includes: a nucleotide; a linker molecule attached to a phosphate group of the nucleotide; and a switch chain attached to the linker molecule, the switch chain including a nucleotide chain containing bases complementary to at least some of the more than one nucleotide bases exposed at the vacancy.

[0017] Examples of the sensor also include more than one other modulatable conductive channel attached to two electrodes, each of the other modulatable conductive channels comprising a corresponding modified partially double-stranded nucleic acid polymer electrically connected to the two electrodes and bridging the space between the two electrodes.

[0018] In an example of a sensor, the conductive channel can be modulated to exhibit a first conductance when more than one nucleotide base is exposed at a vacancy; and to exhibit a second conductance different from the first conductance when at least some of the more than one nucleotide base at the vacancy are associated with complementary nucleotide bases.

[0019] It should be understood that any features of the sensors disclosed herein may be used in any desired manner and / or configuration, and / or combined with any other examples disclosed herein.

[0020] The second aspect disclosed herein is a labeled nucleotide comprising a nucleotide; a linking molecule attached to a phosphate group of the nucleotide; and a switch chain attached to the linking molecule, the switch chain comprising a nucleotide chain comprising bases complementary to at least some of more than one nucleotide bases exposed at a vacancy of the sensor of the first aspect.

[0021] The third aspect disclosed herein is a kit comprising: an electronic component comprising: a support; and two electrodes operably disposed on the support and separated by a space; and a polymer solution comprising: a liquid carrier; and a modified partially double-stranded nucleic acid polymer in the liquid carrier, the modified partially double-stranded nucleic acid polymer comprising: two polynucleotide chains partially bonded together and having opposed ends; a linker attached to each of the opposed ends, each linker attached to a corresponding one of the two electrodes; a vacancy in the first polynucleotide chain in which a nucleotide is missing; and more than one nucleotide base of the second polynucleotide chain exposed at the vacancy in the first polynucleotide chain; when each linker is attached to a corresponding one of the two electrodes, the modified partially double-stranded nucleic acid polymer forms a modulated conductive channel in the space between the two electrodes.

[0022] In an example, the kit also includes a reagent solution (reagent solution), the reagent solution includes a labeled nucleotide, at least one of the labeled nucleotides includes: a nucleotide; a connecting molecule attached to the phosphate group of the nucleotide; and a switch chain attached to the connecting molecule, the switch chain includes a nucleotide chain containing at least some complementary bases in more than one nucleotide base exposed at a vacancy. In an example of the kit, the base in the switch chain is completely complementary to more than one nucleotide base exposed at a vacancy. In another example of the kit, the switch chain also includes at least one nucleotide with a mismatched base, which is not complementary to the corresponding base in more than one nucleotide base exposed at a vacancy. In still another example of the kit, the nucleotide chain in the switch chain is less than at least one nucleotide in more than one nucleotide base exposed at a vacancy. In another example of the kit, the nucleotide chain in the switch chain has a number of nucleotides higher than more than one nucleotide base exposed at a vacancy, and wherein when associated at a vacancy, a part of the switch chain forms a stem loop (stem loop). In an example of the kit, the nucleotide chain in the switch chain has a higher number of nucleotides than the more than one nucleotide base exposed at the vacant position; a portion of the switch chain forms a stem loop when associated at the vacant position; and another portion of the switch chain is fully complementary to the more than one nucleotide base exposed at the vacant position, or includes at least one nucleotide having a mismatched base that is not complementary to the corresponding base in the more than one nucleotide base exposed at the vacant position.

[0023] It will be appreciated that any features of the kit may be combined in any desired manner. In addition, it will be appreciated that any combination of features of the kit and / or sensor and / or labeled nucleotides may be used together and / or combined with any example disclosed herein.

[0024] In a fourth aspect, a sensing system includes: a flow cell; and an electronic sensor integrated into the flow cell, the electronic sensor including: two electrodes with a space between the two electrodes; a modulatable conductive channel attached to the two electrodes, the modulatable conductive channel including a modified partially double-stranded nucleic acid polymer electrically connected to the two electrodes and bridging the space between the two electrodes, the modified partially double-stranded nucleic acid polymer including: two polynucleotide chains partially bonded together; a vacancy in the first polynucleotide chain in which a nucleotide is missing; and more than one nucleotide base of the second polynucleotide chain exposed at the vacancy in the first polynucleotide chain.

[0025] In an example, the sensing system further comprises a reagent delivery system for selectively introducing a reagent into an input of the flow cell. In an example, the reagent is in a sample container, the reagent comprises a labeled nucleotide, at least one of the labeled nucleotides comprises: a nucleotide; a linker molecule attached to a phosphate group of the nucleotide; and a switch chain attached to the linker molecule, the switch chain comprising a nucleotide chain comprising bases complementary to at least some of the more than one nucleotide bases exposed at the vacancy.

[0026] Examples of sensing systems also include detectors that detect responses from electronic sensors.

[0027] Examples of the sensing system also include a polymerase anchored to a modified partially double-stranded nucleic acid polymer or a support of an electronic sensor; and a template polynucleotide chain to be introduced into the electronic sensor.

[0028] It should be understood that any features of the sensing system can be combined in any desired manner. In addition, it should be understood that any combination of features of the sensing system and / or sensor and / or kit and / or labeled nucleotides can be used together and / or combined with any example disclosed herein.

[0029] The fifth aspect disclosed herein is a method. In an example, the method includes introducing a template polynucleotide chain into an electronic sensor having a polymerase, the polymerase being tethered to i) a modulatable conductive channel that bridges the space between two electrodes and is electrically connected to the two electrodes, or ii) a substrate that supports the two electrodes, the modulatable conductive channel comprising a modified partially double-stranded nucleic acid polymer, the modified partially double-stranded nucleic acid polymer comprising: two polynucleotide chains partially bonded together; a vacancy in the first polynucleotide chain in which a nucleotide is missing; and more than one nucleotide base of the second polynucleotide chain exposed at the vacancy in the first polynucleotide chain; introducing a reagent comprising a labeled nucleotide into the electronic sensor, whereby one of the labeled nucleotides associates with the polymerase, and a nucleotide-specific switch chain of one of the labeled nucleotides associates with at least some of the more than one nucleotide bases exposed at the vacancy; and detecting a response of the electronic sensor in response to the association at the vacancy.

[0030] Examples of the method also include correlating a response of the electronic sensor to an associated nucleotide-specific switch strand; and identifying a nucleotide that is one of the labeled nucleotides based on the associated nucleotide-specific switch strand.

[0031] Examples of the method further include applying heat to dissociate the nucleotide-specific switch strand from the vacancy.

[0032] The sixth aspect disclosed herein is a sensor device. In an example, the sensor device includes two electrodes with a space between the two electrodes; a modulatable conductive channel attached to the two electrodes, the modulatable conductive channel including a modified partially double-stranded nucleic acid polymer electrically connected to the two electrodes and bridging the space between the two electrodes, the modified partially double-stranded nucleic acid polymer including: two polynucleotide chains partially bonded together; a vacancy in the first polynucleotide chain where a nucleotide is missing; and more than one nucleotide base of the second polynucleotide chain exposed at the vacancy in the first polynucleotide chain; and a labeled nucleotide, wherein the labeled nucleotide includes a nucleotide; a linker molecule attached to a phosphate group of the nucleotide; and a switch chain attached to the linker molecule, the switch chain including a nucleotide chain containing bases complementary to at least some of the more than one nucleotide bases exposed at the vacancy.

[0033] Should be understood that any feature of method can be combined in any desired manner.In addition, should be understood that any combination of the feature of method and / or sensing system and / or sensor and / or any kit and / or labeled nucleotide can be used together and / or combined with any example disclosed herein. Sequence Listing <110> Illumina Co., Ltd. <120> Sensors and Sensing Systems <130> IP-1687-PRV <160> 1 <170> PatentIn version 3.5 <210> 1 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> Conductivity Sensors <400> 1 tgggccccat cccccctagg c 21 BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Features of examples of the present disclosure will become apparent by reference to the following detailed description and accompanying drawings, in which like reference numerals correspond to similar (although perhaps not identical) parts. For the sake of brevity, reference numerals or features having a previously described function may or may not be described in conjunction with other drawings in which they appear.

[0035] Figure 1A is a schematic diagram of an example of a sensor disclosed herein;

[0036] Figure 1B is a schematic diagram of an example of a sensor and an example of a fluidic system for introducing an agent into a modified partially double-stranded nucleic acid polymer of the sensor;

[0037] Figure 2 is a schematic diagram of an example of a labeled nucleotide disclosed herein;

[0038] Figures 3A to 3D are schematic cross-sectional views of different examples of labeled nucleotides, the labeled nucleotides of the different examples comprising different switch chains associated with nucleotide bases exposed at vacancies in a modified partially double-stranded nucleic acid polymer;

[0039] Figure 4 is a schematic perspective view of an example of a sensing system including a flow cell and an example of a sensor disclosed herein;

[0040] Figure 5 is a schematic diagram of an example of a sensing system; and

[0041] Figure 6 is a flow diagram of an example of a method disclosed herein. Detailed Description

[0042] Disclosed herein is an electronic / electrical sensor, which can be used for single molecule detection in nucleic acid sequencing procedures. The sensor includes a modulated conductive channel electrically attached to two electrodes. The modulated conductive channel includes a partially double-stranded nucleic acid polymer (referred to herein as modified "dsNA"), and therefore can be referred to as a conductive molecular nanowire. A polynucleotide chain (chain) or strand (strand) of the modified dsNA has a vacancy in which a nucleotide base is exposed. Another one of the polynucleotide chains (chains) or chains (strands) extends from one electrode to another electrode, and therefore, even when the nucleotide base at the vacancy is exposed (and single molecule detection is not performed), the modulated conductive channel also provides a conduction path (conduction path) between the two electrodes. The nucleotide base at the vacancy can be associated with a switch chain, and the switch chain has at least some nucleotide bases complementary to the nucleotide base at the vacancy. When the switch chain associates at the vacancy, the conductive path increases, and the conductance of the conductive channel is modulated. Thus, when more than one nucleotide base is exposed at a vacancy, the modulatable conductive channel exhibits a first conductance; and when at least some of the more than one nucleotide bases at the vacancy are associated with complementary nucleotide bases, the modulatable conductive channel exhibits a second conductance different from the first conductance. In an example, when the nucleotide bases at the vacancy are exposed, the conductivity of the modulatable conductive channel is relatively low. In contrast, when the switch chain is associated at the vacancy, the conductivity of the modulatable conductive channel changes (e.g., increases or decreases), and in some examples, the change is by orders of magnitude.

[0043] The switch chain can be a part of a labeled nucleotide, and the labeled nucleotide includes a specific nucleotide connected to the switch chain. When a specific nucleotide is incorporated into a nascent chain during a nucleic acid sequencing program, the switch associates at a vacancy, which causes a change in the conductivity of the modulatable conductive channel. Because nucleotides and the switch chain are specific to each other, the change in conductivity associated with the switch is also related to nucleotides. In this way, the change in conductivity can be used to identify the nucleotide bases being incorporated into the nascent chain.

[0044] Reference now Figure 1A, depicting an example of a sensor 10. The example sensor 10 is an electrical / electronic sensor. The sensor 10 includes two electrodes 12, 14 with a space therebetween, and a modulatable conductive channel 16 attached to the two electrodes 12, 14. The modulatable conductive channel includes a modified partially double-stranded nucleic acid polymer (i.e., modified dsNA) 16' electrically connected to the two electrodes 12, 14 and bridging the space between the two electrodes 12, 14, the modified dsNA 16' including two polynucleotide chains 18, 20 partially bonded together; a vacancy 22 in the first polynucleotide chain 18 in which a nucleotide is deleted; and more than one nucleotide base 24 of the second polynucleotide chain 20 exposed at the vacancy 22 in the first polynucleotide chain 18.

[0045] The electrodes 12, 14 are in electrical communication with the modified dsNA 16' / modulatable conductive channel 16, and therefore when the sensor 10 is in operation, there is a constant conductive path between the electrodes 12, 14. As mentioned, this conductive path is modulatable by the association of the switch chain at the vacancy 22.

[0046] Any suitable electrode material that can be chemically and electrically attached to the modified dsNA 16' may be used. Examples of suitable electrode materials include gold, platinum, carbon, indium tin oxide, and the like.

[0047] The modified dsNA 16' is a nucleic acid polymer that includes two polynucleotide chains 18, 20 that are partially bonded together. "Partially bonded together" means that some of the nucleotide bases of the two chains 18, 20 are hydrogen bonded to each other to form a double helix, but one of the chains 18 has a vacancy 22 without any nucleotides. At the vacancy 22 in one chain 18, the nucleotide bases of the other chain 20 are exposed. "Exposed" means that the bases of these nucleotides are not bonded to another nucleotide and are therefore available to bind, hybridize or otherwise associate with a complementary nucleotide.

[0048] The nucleotides of the two polynucleotide chains 18, 20 can be natural nucleotides. Natural nucleotides include a nitrogenous heterocyclic base, a sugar and one or more phosphate groups. Examples of natural nucleotides of the two polynucleotide chains 18, 20 include ribonucleotides or deoxyribonucleotides. In ribonucleotides, the sugar is ribose, and in deoxyribonucleotides, the sugar is deoxyribose, i.e., a sugar lacking the hydroxyl group at the 2' position present in ribose. In an example, the nucleotide is in the form of a polyphosphate because it includes several phosphate groups (e.g., tri-phosphate (i.e., gamma phosphate), tetra-phosphate, penta-phosphate, hexa-phosphate (i.e., Figure 5 ) etc.). The heterocyclic base (i.e., nucleobase) can be a purine base or a pyrimidine base or any other nucleobase analog. Purine bases include adenine (A) and guanine (G) and modified derivatives or analogs thereof. Pyrimidine bases include cytosine (C), thymine (T) and uracil (U) and modified derivatives or analogs thereof. The C-1 atom of deoxyribose is bonded to the N-1 of pyrimidine or the N-9 of purine. Polynucleotide chains 18, 20 can also include any nucleic acid analogs. Nucleic acid analogs can have any of a modified phosphate backbone, sugar or nucleobase. Examples of nucleic acid analogs include, for example, universal bases or phosphate-sugar backbone analogs, such as peptide nucleic acids (PNA).

[0049] As mentioned herein, the first polynucleotide chain 18 has a vacancy 22 in which there are no nucleotides. The vacancy 22 can be located anywhere along the chain 18, for example, at the center of the chain 18 or near the center of the chain 18, at either end of the chain 18, between the center and one end of the chain 18, etc. Thus, in some examples, the first polynucleotide chain 18 includes two shorter chains separated by the vacancy 22. In other examples (for example, when the vacancy 22 is at either end of the chain 18), the first polynucleotide chain 18 is a single continuous chain. In still other examples, the first polynucleotide chain 18 can have more than one (multiple) vacancy 22 along the polymer backbone. The vacancy 22 can have any length shorter than the total length of the dsNA 16'. In an example, the length of each vacancy 22 is in the range of from about 5nm to about 60nm. In another example, the length of each vacancy 22 is in the range of from about 10nm to about 50nm. In still another example, the length of each vacancy 22 is in the range of from about 20 nm to about 40 nm. Although the length of the vacancy 22 is listed as a metric unit, it is understood that the vacancy length can also be defined based on the number of nucleotides that can fit into the vacancy 22 or the number of nucleotide bases of the second polymer chain 20 exposed at the vacancy 22. The vacancy 22 in the first polynucleotide chain 18 reduces the conductivity of the modified dsNA 16'.

[0050] At the vacancy 22 in the first polynucleotide chain 18, more than one nucleotide of the second polymer chain 20 is exposed. In particular, the bases 24 of these nucleotides are exposed. The exposed bases 24 can all be the same bases, or can be a combination of different bases. In an example, at least one of the exposed bases 24 is guanine (G). In this example, other exposed bases 24 can be any one of adenine (A), cytosine (C), thymine (T) and / or uracil (U) or any combination thereof. In another example, each of the exposed bases 24 is guanine (G). It is desirable to include several guanine (G) bases exposed in a row at the vacancy 22, because guanine (G) bases are better at conducting electricity than other bases.

[0051] The two partially bonded polynucleotide chains have opposite ends, and a connector can be attached to each of the opposite ends. In the examples disclosed herein, i) the connector attaches each end of the first polynucleotide chain 18 to a corresponding one of the two electrodes 12, 14, respectively; or ii) the connector attaches each end of the second polynucleotide chain to a corresponding one of the two electrodes, respectively; or iii) both i and ii. Although FIG. 1 shows that the second polynucleotide chain 20 is bonded to the electrodes 12, 14 via a connector 26, it should be understood that the first polynucleotide chain 18 or both chains 18, 20 can be bonded to the electrodes 12, 14 via corresponding connectors 26. In this way, the respective 5' and 3' ends of the first and / or second polynucleotide chains 18, 20 can have connectors 26 attached thereto. The connector 26 electrically connects the modified dsNA 16' to the electrodes 12, 14. The connector 26 can also be capable of chemically bonding to the corresponding electrodes 12, 14, thereby bridging the modified dsNA 16' between the electrodes 12, 14. Thus, the linker 26 can depend on the electrode material. As an example, a thiolate or amine linker can be attached to a gold electrode, a thiol linker can be attached to a platinum electrode, and a silane linker (e.g., azidosilane) can be attached to an ITO electrode. Depending on the linker and electrode materials, the attachment of the corresponding linker 26 to one of the electrodes 12, 14 can be performed by covalent bonding, coordination bonding, or another chemical or physical bond. The linker 26 is also conductive so that when the modified dsNA 16' is attached to each of the electrodes 12, 14, a conductive path is established between the electrodes 12, 14.

[0052] Any example of the sensor 10 disclosed herein may include more than one other modulatable conductive channel 16 attached to two electrodes 12, 14, each of the other modulatable conductive channels 16 including a corresponding modified partially double-stranded nucleic acid polymer 16' electrically connected to the two electrodes 12, 14 and bridging the space between the two electrodes 12, 14. In other words, the sensor 10 may include two or more partially double-stranded nucleic acid polymers 16', wherein each modified dsNA 16' is electrically connected to the two electrodes 12, 14. More than one channel 16 is relatively easy to manufacture (by allowing more than one modified dsNA 16' chain to be attached), and provides several vacancies 22 with which the switch chain can be associated. With more than one channel 16, the base signal (e.g., when no switch chain is associated with the vacancy 22) is higher, and when the corresponding switch chain is associated with more than one modulatable conductive channel 16, the detected signal can be enhanced.

[0053] Although in Figure 1A Although not shown in the figure, the sensor 10 may also include a substrate or support on which the electrodes 12, 14 are placed. An example of a support / substrate 13 is shown in Figure 1B. The support / substrate 13 can be any solid surface on which the electrodes 12, 14 can be located. Any non-conductive or semi-conductive solid surface can be used. The solid surface can also be impermeable to and inert to liquids, reagents, etc. used in single molecule sequencing operations. Some examples of suitable supports / substrates 13 include epoxysilicone, glass and modified or functionalized glass, plastics (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane, polytetrafluoroethylene (such as from Chemours) ), cyclic olefins / cyclo-olefin polymers (COP) (such as from Zeon ), polyimide, etc.), nylon, ceramic / ceramic oxide, silica, fused silica or silica-based materials, aluminum silicate, silicon and modified silicon (e.g., boron-doped p+ silicon), silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (TaO5) or other tantalum oxides (TaO x ), hafnium oxide (HaO2), inorganic glass or the like. The support or substrate 13 may also be glass or silicon having a coating of silicon dioxide or tantalum oxide or another ceramic oxide at the surface.

[0054] Similarly, although in Figure 1A Although not shown, the sensor 10 may also include a detector that can detect the electrical response of the sensor 10. An example of the detector 15 is shown in Figure 1B , Figure 4 and Figure 5 In the example, the detector 15 is an ammeter. Figure 5 More specifically, when the switch chain 28 (in Figure 2 The conductivity of the modified dsNA 16′ (and therefore the modulatable conductive channel 16) can be improved when the switch chain 28 (shown in FIG. 1 ) is associated with at least some of the more than one nucleotide bases 24 at the vacancy 22, wherein the switch chain 28 includes a nucleotide chain including bases complementary to the at least some of the more than one nucleotide bases 24 exposed at the vacancy 22.

[0055] like Figure 1BAs shown, the sensor 10 may also include a fluid system 17 for introducing a reagent into the modulated conductive channel 16. The fluid system 17 may be any fluid device that can deliver a reagent to the dsNA 16' or that can contain a reagent within proximity of the dsNA 16'. Figure 1B As shown, the fluid system 17 can be a flow cell lid that can be attached to the support / substrate 13 and can be removed from the support / substrate 13. This example of the fluid system 17 includes an inlet 19 through which a reagent can be introduced. The walls of the fluid system maintain the reagent adjacent to the dsNA 16'. As another example (not shown), the fluid system 17 can be a pipette (or other delivery device) that can be used to deliver the reagent to the modulated conductive channel 16 / dsNA 16'. In this example, the support / substrate 13 can have a groove adjacent to the modulated conductive channel 16 / dsNA 16' that can receive the reagent and enable the reagent to contact the modulated conductive channel 16 / dsNA 16'. Although some example fluid systems have been provided, it should be understood that the sensor 10 may include any fluid system 17 that can deliver a reagent to the modulatable electrically conductive channel 16 / dsNA 16' and / or enable a reagent to be contained within proximity of the modulatable electrically conductive channel 16 / dsNA 16'.

[0056] The sensors 10 disclosed herein may be capable of achieving single molecule sensitivity. In addition, when arranged in an array (i.e., several sensors 10 placed on a substrate / support 13), very small inter-sensor distances may be used, so that the density (i.e., sensors / area) may be very high.

[0057] To form the sensor 10 , any suitable method may be used. In an example, a modified dsNA 16 ′ may be synthesized and then attached to electrodes 12 , 14 to form a modulatable conductive channel 16 in the space between the two electrodes 12 , 14 .

[0058] The modified dsNA 16' can be prepared by synthesizing the second polynucleotide chain 20, and then mixing the second polynucleotide chain 20 with a complementary chain that will be attached to the second polynucleotide chain 20 at an appropriate position. The mixture can then be annealed to initiate attachment. In an example, two complementary chains can be attached to corresponding portions of the second polynucleotide chain 20 so that a vacancy 22 is formed somewhere between the two ends of the resulting modified dsNA 16'. In another example, a complementary chain shorter than the second polynucleotide chain 20 can be attached to a portion of the second polynucleotide chain 20 so that a vacancy 22 is formed at one end of the resulting modified dsNA 16'. It should be understood that the second polynucleotide chain 20 and the complementary chain attached to form the first polynucleotide chain 18 can be selected to control the length of the vacancy 22 and the nucleotide base 24 exposed at the vacancy 22.

[0059] The modified dsNA 16' can then be attached to the electrodes 12, 14. The linker 26 can be attached to the modified dsNA 16' using any suitable technique, and the linker 26 can then be attached to the electrodes 12, 14. In an example, thiol-modified DNA bases can be conjugated at the 3' and 5' ends of the strands 18, 20. In an example, the modified dsNA 16' can be immobilized on the electrodes 12, 14 by exposing the electrodes 12, 14 to a solution of the modified dsNA 16' for a suitable time, followed by rinsing with a suitable buffer to remove unbound modified dsNA 16'.

[0060] In the method of manufacturing the sensor 10 , the electrodes 12 , 14 may also be electrically connected to the detector 15 .

[0061] In some examples, sensor 10 may be pre-assembled.

[0062] In other examples, the sensor components can be part of a test kit, and the test kit components can be used to assemble the sensor 10. Examples of test kits include electronic components and polymer solutions. The electronic components include a support 13 and two electrodes 12, 14 that are operably arranged on the support and separated by a space. "Operably arranged" means that the electrodes 12, 14 can be connected to an electronic circuit that enables their operation (for example, once connected to a detector 15 and a power supply). The electronic circuit can be electrically connectable to the detector 15 and a power supply. The polymer solution includes a liquid carrier and a modified dsNA 16' in the liquid carrier, wherein the modified dsNA 16' is any example described herein. As described herein, the modified dsNA 16' includes two polynucleotide chains 18, 20 that are partially bonded together and have opposite ends. The modified dsNA 16' can have a joint 26 attached to one or two chains 18 and / or 20 at each of the opposite ends. In an example, the modified dsNA16' is in millimolar to molar concentrations in an ionic salt buffer solution such as saline citrate.

[0063] When using the kit, the user may place the polymer solution on the electronic component, allow the polymer solution to remain on the electronic component for a suitable time for the linker 26 to attach to the corresponding electrode 12, 14, and then the electronic component may be rinsed with a suitable buffer to remove unbound modified dsNA 16'.

[0064] In addition to containing the components that form the sensor 10, some examples of the kit may also include a reagent solution to be used with the sensor 10. The reagent solution includes labeled nucleotides that are referenced to Figure 2 Give a description.

[0065] Reference now Figure 2 , depicts an example of a labeled nucleotide 30 that includes the switch chain 28 mentioned above. The labeled nucleotide 30 includes a nucleotide 32, a linker molecule 34 attached to a phosphate group of the nucleotide 32, and a switch chain 28 attached to the linker molecule 34, the switch chain 28 including a nucleotide chain including bases 36 that are complementary to at least some of the more than one nucleotide bases 24 exposed at the vacancy 22 of the sensor 10. The labeled nucleotide 30 can be considered a non-natural or synthetic nucleotide because it is structurally or chemically different from a natural nucleotide.

[0066] The nucleotide 32 of the nucleotide 30 of labeling can be natural nucleotide.Natural nucleotide includes nitrogenous heterocyclic base, sugar and three or more phosphate groups.The example of natural nucleotide includes, for example, ribonucleotide or deoxyribonucleotide.As mentioned above, in ribonucleotide, sugar is ribose, and in deoxyribonucleotide, sugar is deoxyribose.In an example, nucleotide 32 is in the form of polyphosphate, because it includes several phosphate groups (for example, triphosphate, tetraphosphate, pentaphosphate, hexaphosphate etc.).Heterocyclic base (that is, core base) can be purine base (for example, adenine (A) or guanine (G)) or pyrimidine base (for example, cytosine (C), thymine (T) and uracil (U)).

[0067] The labeled nucleotide 30 also includes a linker molecule 34. The linker molecule 34 can be any long chain molecule that can be chemically bonded to the phosphate group of the nucleotide 32 at one end and can be chemically bonded to the switch chain 28 at the other end. The linker molecule 34 can also be selected so that it will not interact with the system 40, 40' disclosed herein (see Figure 4 and 5 ) is used in the present invention to interact with a polymerase 38 used in the present invention. The linker molecule 34 is selected so that it is long enough to allow the switch chain 28 to associate with the nucleotide base 24 exposed at the vacancy 22 of the electrical sensor 10, while, for example, the nucleotide 32 is retained by the polymerase 38.

[0068] As an example, the linking molecule 34 may include an alkyl chain, a poly(ethylene glycol) chain, an amido group, a phosphate group, a heterocycle such as a triazole, a nucleotide, or a combination thereof. An example of an alkyl chain may include at least 6 carbon atoms, and an example of a poly(ethylene glycol) chain may include at least 3 ethylene glycol units.

[0069] The following examples illustrate examples of labeled nucleotides 30, wherein the linker molecule 34 includes an alkyl chain, an amide group, a poly(ethylene glycol) chain, and a triazole:

[0070]

[0071] The following example illustrates another example of a labeled nucleotide 30, wherein the linking molecule 34 includes an alkyl chain, an amide group, a poly(ethylene glycol) chain, a triazole, and a phosphate group:

[0072]

[0073] The following example illustrates yet another example of a labeled nucleotide 30, wherein the linking molecule 34 includes an alkyl chain, an amide group, a poly(ethylene glycol) chain, a triazole, and a phosphate group:

[0074]

[0075] The following examples illustrate still further examples of labeled nucleotides 30, wherein the linking molecule 34 comprises an alkyl chain, an amide group, a poly(ethylene glycol) chain, a triazole, a phosphate group, and a polynucleotide chain:

[0076]

[0077] While several example linking molecules 34 have been described, it should be understood that other linking molecules 34 may be used.

[0078] The switch chain 28 is a chain of nucleotides. The nucleotides in the switch chain 28 are similar to the nucleotides 32, that is, they include a nitrogenous heterocyclic base, a sugar, and three or more phosphate groups. At least some of the nucleotides in the switch chain 28 include a base 36 that is complementary to the base 24 exposed at the vacancy 22 of the sensor 10. As such, the sequence of the nucleotides in the switch chain 28 depends at least in part on the sequence of the exposed base 24.

[0079] In one example, the bases 36 in the switch strand 28 are fully complementary to more than one nucleotide base 24 exposed at the vacancy 22. As an example, the nucleotide base 24 exposed at the vacancy 22 may be GGGGGGG, and the switch strand 28A may be CCCCCCC. As another example, the nucleotide base 24 exposed at the vacancy 22 may be GAGTGCGG, and the switch strand 28A may be CTCACGCC. Figure 3A In the example shown in FIG. 1 , any suitable sequence can be used for the switch strand 28A, as long as the sequence has the same number of bases as the base 24 exposed at the gap 22 and is completely complementary to the base 24 exposed at the gap 22. An example of a labeled nucleotide 30A including a completely complementary switch strand 28A is shown in FIG. Figure 3AAs shown in . As depicted, the switch strand 28A of the nucleotide 30A of the label itself associates with the nucleotide base 24 exposed at the vacancy 22. More specifically, in this example, each of the nucleotide bases 36 in the switch strand 28A temporarily and at least partially hybridizes with the complementary base 24 (of the polynucleotide chain 20) exposed at the vacancy 22 in the polynucleotide chain 18. In some examples, hybridization is incomplete, and in other examples, hybridization is complete. In order to achieve partial or complete hybridization, the melting temperature of the interaction between the complementary bases can be adjusted. The different degrees of hybridization between different switch strands 28A and the nucleotide base 24 make it possible to obtain different time characteristics (timesignature) with different switch strands 28A. When incorporated, the switch strand 28A closes the switch of the modified dsNA 16', which significantly changes (e.g., improves) the conductivity of the dsNA 16', modulates the channel 16, and causes detectable changes.

[0080] In another example, base 36 in switch strand 28 is not completely complementary to one or more nucleotide bases 24 exposed at vacancy 22; instead, switch strand 28B includes at least one nucleotide having a mismatched base 42 that is not complementary to a corresponding base (shown as 24') in one or more nucleotide bases 24 exposed at vacancy 22, as shown in FIG. Figure 3B As shown. In other words, the mismatched base 42 is not complementary to the corresponding nucleotide base 24' exposed at the vacancy 22. As an example, the nucleotide base 24 exposed at the vacancy 22 may be GGGGGGG, and the switch strand 28B may be CCCACCC. In this example, the adenine of the switch strand 28B is the mismatched base 42 because it is not complementary to the corresponding guanine exposed at the vacancy 22 of the polynucleotide strand 20. As another example, the nucleotide base 24 exposed at the vacancy 22 may be GAGTGCGG, and the switch strand 28B may be CCCACGCC. In this example, the second cytosine of the switch strand 28B is the mismatched base 42 because it is not complementary to the corresponding adenine exposed at the vacancy 22 of the polynucleotide strand 20. Figure 3BIn the example shown in , any suitable sequence can be used for the switch strand 28B, as long as the sequence has the same number of bases as the base 24 exposed at the gap 22, is partially complementary to the base 24 exposed at the gap 22, and includes at least one base that is mismatched with the base 24 exposed at the gap 22. As depicted, the switch strand 28B of the labeled nucleotide 30B associates itself with the nucleotide base 24 exposed at the gap 22. More specifically, in this example, while some of the nucleotide bases 36 in the switch strand 28B are temporarily hybridized with the corresponding complementary base 24, the mismatched base 42 and the corresponding nucleotide base 24' in the polynucleotide strand 20 remain unbound. When incorporated, switch strand 28B substantially closes the switch of modified dsNA 16' (but does not completely close the switch due to mismatched base 42), which significantly changes (e.g., increases) the conductivity of dsNA 16', modulates channel 16, and results in a detectable change. It should be understood that in some instances, the increase in conductivity with switch strand 28B due to mismatched base 42 may not be as great as the increase observed with switch strand 28A.

[0081] In yet another example, the nucleotide chain in the switch chain 28 has at least one less nucleotide than the more than one nucleotide base 24 exposed at the vacancy 22. Figure 3C . The nucleotides in switch strand 28C are complementary to some of the nucleotide bases 24 exposed at vacancy 22; however, after switch strand 28C associates at vacancy 22, at least one of the nucleotide bases 24" remains unbound because of the shorter switch strand length (due to the missing base). As an example, the nucleotide base 24 exposed at vacancy 22 may be GGGGGGG, and switch strand 28C may be CCCCC. In this example, switch strand 28C is missing two bases, or is two nucleotides shorter than the total number of nucleotide bases 24 (including 24") exposed at vacancy 22. As another example, the nucleotide base 24 exposed at vacancy 22 may be GAGTGCGG, and switch strand 28C may be TCACGCC. In this example, switch strand 28C is missing one base, or is one nucleotide shorter than the total number of nucleotide bases 24 (including 24") exposed at vacancy 22. Figure 3C In the example shown in , any suitable sequence can be used for switch strand 28C as long as the sequence has less than the total number of bases 24 exposed at vacancies 22 and is complementary to some of the bases 24 exposed at vacancies 22. Figure 3C, when switch strand 28C of labeled nucleotide 30C associates itself at vacancy 22, i) nucleotide base 36 in switch strand 28C temporarily and at least partially hybridizes with corresponding complementary base 24, and ii) because switch strand 28C is missing a base, some of the nucleotide bases 24″ in polynucleotide strand 20 remain unbound. When incorporated, switch strand 28C substantially closes the switch of modified dsNA 16′ (but does not completely close the switch due to the missing base), which significantly changes (e.g., increases) the conductivity of modified dsNA 16′ (and channel 16) and results in a detectable change. It should be understood that in some instances, the increase in conductivity with switch strand 28C may not be as great as the increase observed with switch strand 28A due to the missing base.

[0082] In still another example, the nucleotide chain in the switch chain 28 has a higher number of nucleotides than the more than one nucleotide base 24 exposed at the vacancy 22, and a portion of the switch chain 28 forms a stem loop when associated at the vacancy 22. Figure 3D . Some of the nucleotides in the switch strand 28D are complementary to the nucleotide base 24 exposed at the vacancy 22; however, after the switch strand 28D associates at the vacancy 22, the non-complementary nucleotides 36' of the switch strand 28D remain unbound and form a stem-loop 44. As an example, the nucleotide base 24 exposed at the vacancy 22 may be GGGGGGGGG, and the switch strand 28D may be CCCC. In this example, the switch strand 28D includes nine additional bases 36' that form the stem-loop 44. As another example, the nucleotide base 24 exposed at the vacancy 22 may be AGTTTTTTG, and the switch strand 28D may be TCC. In this example, the switch strand 28D includes six additional bases 36' that form the stem-loop 44. Figure 3D In the example shown in , any suitable sequence can be used for switch strand 28D, as long as the sequence has more than the total number of bases 24 exposed at vacancies 22 and includes at least some nucleotide bases complementary to the bases 24 exposed at vacancies 22. The nucleotide bases at either end of stem loop 44 can be completely complementary to the nucleotide bases 24 exposed at vacancies 22, can include one or more non-complementary bases, can have missing bases, or can include a combination of complementary bases, non-complementary bases, and missing bases. Figure 3DAs depicted in FIG, when the switch strand 28D of the labeled nucleotide 30D associates itself at the vacancy 22, i) some of the nucleotide bases 36 in the switch strand 28D temporarily and at least partially hybridize with the corresponding complementary base 24, and ii) some of the non-complementary nucleotide bases 36' in the switch strand 28D remain unbound and form a stem loop 44. When incorporated, the switch strand 28D closes the switch of the modified dsNA 16', which significantly changes (e.g., increases) the conductivity of the modified dsNA 16', modulates the channel 16, and causes a detectable change. Some of the electron flow will be transmitted on either strand 18, 20 (e.g., when both strands 18, 20 are bound to the electrodes 12, 14), so adding the stem loop 44 is equivalent to adding a larger parallel resistor.

[0083] Any example of a labeled nucleotide 30 disclosed herein (e.g., 30A, 30B, 30C, 30D) can be used in a reagent solution of an example of a kit and / or in a sensor system 40, 40', an example of a sensor system 40, 40' in Figure 4 and Figure 5 Each of the systems 40, 40' also includes an example of the sensor 10 disclosed herein.

[0084] Figure 4 The example of the sensing system 40 shown in FIG. 4 includes a flow cell 41 and an electronic sensor 10 integrated into the flow cell 41. The electronic sensor 10 includes two electrodes 12, 14; a modified partially double-stranded nucleic acid polymer 16 bridging the two electrodes 12, 14, the modified partially double-stranded nucleic acid polymer 16 including two polynucleotide chains 18, 20 partially bonded together (via hydrogen bonding), a vacancy 22 in the first polynucleotide chain 18 where a nucleotide is deleted; and more than one nucleotide base 24 of the second polynucleotide chain 20 exposed at the vacancy 22. The flow cell 41 is a vessel containing the sensor 10. It should be understood that other containers, such as wells, tubes, channels, cuvettes, Petri plates, bottles, or the like, can alternatively contain the sensor 10. Cyclic processes, such as nucleic acid sequencing reactions, are particularly suitable for the flow cell 41.

[0085] The example flow cell 41 includes a substrate / support 13 and a cover directly or indirectly bonded thereto or formed integrally therewith. The flow cell 41 may include a fluid inlet 45 and a fluid outlet 47 that can deliver bulk reagents to one sensor 10 or an array of sensors 10 contained within the flow cell 41.

[0086] The sensing system 40 may also include a reagent delivery system 49, which selectively introduces reagents into the input end (input) (e.g., fluid inlet 45) of the flow cell 41, passes through the sensor 10, and then leads to a fluid outlet 47. The reagent delivery system 49 may include a tube or other fluidics that may be permanently or removably attached to the fluid inlet 45. The reagent delivery system 49 may include a sample container 51. Reagents (including the nucleotides 30 of the label to be introduced into the electronic sensor 10) may be stored in the sample container, or prepared and introduced into the sample container before use. The reagent delivery system 49 may also include a pump or other suitable equipment to retrieve reagents from the sample container 51 and deliver them to the fluid inlet 45. In other examples, the sample container 51 is placed so that reagents can flow to the fluid inlet 45 by gravity, pass through the sensor 10, and flow out of the fluid outlet 47.

[0087] The sensor 10 in the flow cell 41 may also be operably connected to a detector 15 that detects changes in conductivity of the sensor 10 when the sensing system 40 is used.

[0088] Another example of the system 40' is Figure 5 , and includes an electronic sensor 10, which includes two electrodes 12, 14; a modified partially double-stranded nucleic acid polymer 16 bridging the two electrodes 12, 14, the modified partially double-stranded nucleic acid polymer 16 including two polynucleotide chains 18, 20 partially bonded together (via hydrogen bonding), a vacancy 22 in the first polynucleotide chain 18 where a nucleotide is missing; and more than one nucleotide base 24 of the second polynucleotide chain 20 exposed at the vacancy 22; and a separate reagent to be introduced into the electronic sensor 10, the reagent including labeled nucleotides 30, at least one of the labeled nucleotides 30 including the nucleotide 32, a linker molecule 34 attached to the phosphate group of the nucleotide, a switch chain 28 attached to the linker molecule 34, the switch chain 28 including a nucleotide chain including bases 36 complementary to at least some of the more than one nucleotide bases 24 exposed at the vacancy 22. Figure 5 In the example shown in , polynucleotide strand 18 is ACCCGGGGTA-gap-ATCCG, and polynucleotide strand 20 is TGGGCCCCATCCCCCCTAGGC (SEQ. ID No. 1). In polynucleotide strand 20, nucleotide base "CCCCCC" is exposed at gap 22 (at least until switch strand 28 associates with it).

[0089] Although not shown, it is understood that the sensor 10 may be placed within or be part of a container, such as a flow cell 41 ( Figure 4 ), tubes, channels, cuvettes, petri dishes, bottles or the like. Another example of a suitable container is a flow cell.

[0090] Although Figure 5 , one sensor 10 is shown, but it should be understood that the sensing system 40' may include an array of sensors 10 placed on a substrate. In addition, the sensors 10 of the sensing system 40' may each be electrically connected to a corresponding detector 15 that detects a response from the electrical sensor 10 when the switch chain 28 is associated at the empty position 22.

[0091] Some examples of the sensing system 40 ′ further include a polymerase 38 anchored to the modified dsNA 16 ′ and a template polynucleotide chain 48 to be introduced into the sensor 10 .

[0092] like Figure 5 As shown, the sensor 10 includes a polymerase 38. Any DNA polymerase that can catalyze the addition of one nucleotide to a nascent chain at a time can be used. The DNA polymerase can be from any of the following families: A, B, C, D, X, Y, and RT. Specific examples from family A include T7 DNA polymerase, Pol I, Polγ, Polθ, or Pol v; or specific examples from family B include Pol II, Pol B, Polζ, Polα, Polδ, and Polε; or specific examples from family C include Pol III; or specific examples from family D include Pol D (DP1 / DP2 heterodimer); or specific examples from family X include Polβ, Polσ, Polλ, Polμ, and terminal deoxynucleotidyl transferase; or specific examples from family Y include Polι, Polκ, Polη, Pol IV, and Pol V; or specific examples from family RT include telomerase.

[0093] like Figure 5As shown, polymerase 38 is immobilized to modified dsNA 16' with tether 46. In another example, polymerase 38 is immobilized to a substrate with tether 46. Tether 46 is used as an anchor for polymerase 38, and it may be desirable that tether 46 is non-conductive. A non-conductive tether may be particularly desirable when polymerase 38 is attached to modified dsNA 16'. Examples of suitable tethers 46 include polyethylene glycol (PEG) having a cleavable link at a point along the PEG chain; or may include nickel NTA / His tag chemistry, streptavidin / biotin chemistry (e.g., streptavidin attached to modified dsNA 16' and biotin attached to polymerase 38), DNA-DNA hybridization, DNA-PNA hybridization, carboxyl silane 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC), or any other suitable linker that can attach the polymerase to the modified dsNA 16' or to the substrate surface. In some examples, the tether 46 holds the polymerase 38 at least 10 nm away from the modified dsNA 16'. This may be desirable, for example, so that conformal changes in polymerase 38, the charge of polymerase 38, and / or the charge of target / template polynucleotide strand 48 held by polymerase 38 do not interfere with the sensing operation of modified dsNA 16'.

[0094] In an example, the modified dsNA 16' can be initially attached to the polymerase 38 via a tether 46 that includes a cleavable connection. This combination can be introduced into the electrodes 12, 14 to attach the opposite ends of the modified dsNA 16' to the electrodes 12, 14, and the polymerase 38 is attached to the substrate surface via, for example, nickel NTA / His tag chemistry. In this example, the cleavable connection can be cleaved to detach the polymerase 38 from the modified dsNA 16'. In this example, the polymerase 38 is adjacent to the modified dsNA 16', but does not actually contact the modified dsNA 16'. It should be understood that the tether 46 can be cleaved when a chemical process is provided to keep the polymerase 38, for example, on the substrate surface and adjacent to the sensor 10 (within proximity to the sensor 10).

[0095] As mentioned herein, examples of the systems 40 , 40 ′ may also include a template polynucleotide strand 48 to be introduced to the sensor 10 .

[0096] Template polynucleotide chain 48 can be any sample to be sequenced, and can include DNA, RNA or its analog (for example, peptide nucleic acid). The source of template (or target) polynucleotide chain 48 can be genomic DNA, messenger RNA or other nucleic acids from natural sources. In some cases, the template polynucleotide chain 48 derived from such a source can be amplified before being used in the method or system 40, 40' herein. Any of a variety of known amplification techniques can be used, including but not limited to polymerase chain reaction (PCR), rolling circle amplification (RCA), multiple displacement amplification (MDA) or random primer amplification (RPA). It should be understood that the amplification of the template polynucleotide chain 48 before using in the method or system 40, 40' listed herein is optional. So, before using in some examples, template polynucleotide chain 48 will not be amplified. Template / target polynucleotide chain 48 can optionally be derived from a synthetic library. Synthetic nucleic acid can have natural DNA or RNA composition or can be its analog.

[0097] Biological samples from which the template polynucleotide chain 48 can be derived include, for example, those from mammals such as rodents, mice, rats, rabbits, guinea pigs, ungulates, horses, sheep, pigs, goats, cows, cats, dogs, primates, humans, or non-human primates; plants such as Arabidopsis thaliana, corn, sorghum, oats, wheat, rice, rapeseed, or soybeans; algae such as Chlamydomonas reinhardtii; nematodes such as Caenorhabditis elegans; insects such as Drosophila melanogaster, mosquitoes, fruit flies, bees, or spiders; fish such as zebrafish; reptiles; amphibians such as frogs or Xenopus laevis; dictyostelium discoideum); fungi such as pneumocystis carinii, Takifugu rubripes, yeast, Saccharamoyces cerevisiae or Schizosaccharomyces pombe; or Plasmodium falciparum. The template polynucleotide chain 48 may also be derived from prokaryotes such as bacteria, Escherichia coli, staphylococci or mycoplasma pneumoniae; archaea; viruses such as hepatitis C virus, Ebola virus or human immunodeficiency virus; or viroids. The template polynucleotide chain 48 may be derived from a homogeneous culture or population of the above organisms, or alternatively from a collection of several different organisms (e.g., several different organisms in a community or ecosystem).

[0098] In addition, the template polynucleotide chain 48 may not be derived from a natural source, but may be synthesized using known techniques. For example, gene expression probes or genotyping probes may be synthesized and used in the examples listed herein.

[0099] In some instances, template polynucleotide chain 48 can be obtained as a fragment of one or more larger nucleic acids. Fragmentation can be carried out using any of a variety of techniques as known in the art, including, for example, atomization, sonication, chemical cleavage, enzymatic cleavage or physical shearing. Fragmentation can also be produced owing to the use of a specific amplification technique, which produces an amplicon by only copying a part of a larger nucleic acid chain. For example, pcr amplification produces such a fragment, and the fragment has a size defined by the length of the nucleotide sequence between the sites of flanking primer hybridization during amplification on the original template. The length of template polynucleotide chain 48 can be measured according to nucleotide quantity or according to metric length (for example, nanometer).

[0100] The colony of template / target polynucleotide chain 48 or its amplicon can have the average chain length that is desired or suitable for the particular application of method or system 40,40' listed herein.For example, the average chain length can be less than about 100,000 nucleotides, about 50,000 nucleotides, about 10,000 nucleotides, about 5,000 nucleotides, about 1,000 nucleotides, about 500 nucleotides, about 100 nucleotides or about 50 nucleotides.Alternatively or additionally, the average chain length can be greater than about 10 nucleotides, about 50 nucleotides, about 100 nucleotides, about 500 nucleotides, about 1,000 nucleotides, about 5,000 nucleotides, about 10,000 nucleotides, about 50,000 nucleotides or about 100,000 nucleotides.The average chain length of the colony of target polynucleotide chain 48 or its amplicon can be in the range between the maximum value and the minimum value listed above.

[0101] In some cases, the colony of template / target polynucleotide chain 48 can be produced under the condition that its member has maximum length or can be configured in other ways so that its member has maximum length.For example, the maximum length of a member can be less than about 100,000 nucleotides, about 50,000 nucleotides, about 10,000 nucleotides, about 5,000 nucleotides, about 1,000 nucleotides, about 500 nucleotides, about 100 nucleotides or about 50 nucleotides.Alternatively or additionally, the colony of template polynucleotide chain 48 or its amplicon can be produced under the condition that its member has minimum length or can be configured in other ways so that its member has minimum length.For example, the minimum length of a member can be greater than about 10 nucleotides, about 50 nucleotides, about 100 nucleotides, about 500 nucleotides, about 1,000 nucleotides, about 5,000 nucleotides, about 10,000 nucleotides, about 50,000 nucleotides or about 100,000 nucleotides. The maximum chain length and the minimum chain length of the template polynucleotide chains 48 in the population can be within the range between the maximum and minimum values ​​listed above.

[0102] like Figure 5 As shown, a template polynucleotide strand 48 to be sequenced (eg, a single-stranded DNA strand) is bound to a polymerase 38 after having been introduced in solution along with reagents such as labeled nucleotides 30 .

[0103] In some examples, several different labeled nucleotides 30 (e.g., labeled with dA, dC, dG, and dT, respectively, as nucleotides 32) can be used together in a system 40, 40' comprising an array of sensors 10. In one example, four different labeled nucleotides 30 are used, each comprising a different nucleotide 32 and a different nucleotide-specific switch chain 28. As an example, the labeled nucleotide 30 includes: a first labeled nucleotide and a first nucleotide-specific switch chain, the first labeled nucleotide includes deoxyadenosine polyphosphate as a nucleotide; a second labeled nucleotide and a second nucleotide-specific switch chain, the second labeled nucleotide includes deoxyguanosine polyphosphate as a nucleotide, and the second nucleotide-specific switch chain has a sequence different from the first switch chain; a third labeled nucleotide and a third nucleotide-specific switch chain, the third labeled nucleotide includes deoxycytidine polyphosphate as a nucleotide, and the third nucleotide-specific switch chain has a sequence different from each of the first switch chain and the second switch chain; and a fourth labeled nucleotide and a fourth nucleotide-specific switch chain, the fourth labeled nucleotide includes deoxythymidine polyphosphate as a nucleotide, and the fourth nucleotide-specific switch chain has a sequence different from each of the first switch chain, the second switch chain, and the third switch chain. Thus, in this example, the first nucleotide-specific switch chain, the second nucleotide-specific switch chain, the third nucleotide-specific switch chain, and the fourth nucleotide-specific switch chain are different from each other. Different switch strands will produce different conductivity changes (when associated at complementary vacancies 22), which can be used to identify specific nucleotides attached to different switch strands.

[0104] Reference now Figure 6, depicting an example of a method. The method 100 includes introducing a template polynucleotide chain 48 into an electronic sensor 10 having a polymerase 38 tethered to i) a modulatable conductive channel 16 that bridges the space between two electrodes 12, 14 and is electrically connected to the two electrodes 12, 14, or ii) a substrate 13 that supports the two electrodes 12, 14, the modulatable conductive channel 16 comprising a modified partially double-stranded nucleic acid polymer 16', the modified partially double-stranded nucleic acid polymer 16' comprising: two polynucleotide chains 18, 20 partially bonded together; a first polynucleotide chain 18, 20 in which a nucleotide is deleted; The method 100 includes: introducing a reagent comprising labeled nucleotides 30 to the electronic sensor 10, whereby a nucleotide 32 of one of the labeled nucleotides associates with a polymerase 38, and a nucleotide-specific switch strand 28 of one of the labeled nucleotides 30 associates with at least some of the more than one nucleotide bases 24 exposed at the vacancy 22 (reference numeral 104); and detecting a response of the electronic sensor 10 in response to the association at the vacancy 22. Reference will also be made throughout the discussion of the method 100 to Figure 5 .

[0105] like Figure 5 As shown, a template polynucleotide strand 48 introduced into the sensor 10 may be held in place by a polymerase 38 that is tethered to the sensor 10 or to a substrate surface supporting the sensor 10 . Figure 5 The template polynucleotide chain 48 shown in the figure is a template chain of DNA. The template polynucleotide chain 48 can be introduced in a biologically stable solution together with reagents such as labeled nucleotides 30. The biologically stable solution can be any buffer suitable for polymerase-based incorporation reactions, such as polymerase chain reaction (PCR) or linear amplification. As an example, the biologically stable solution can include a pH of nearly 7, a salt concentration of more than several millimolar, and a millimolar concentration of Mg. 2+ Ionic buffer.

[0106] Likewise Figure 5 As shown, labeled nucleotides 30 may include bases that are complementary to the target nucleic acid of template polynucleotide strand 48. Labeled nucleotides 30 will be held in place in part by polymerase 38, which is also bound to template polynucleotide strand 48.

[0107] The interaction between the labeled nucleotide 30 and the polymerase 38 and the length of the linker molecule 34 enable the switch strand 28 to associate with the vacancy 22 of the sensor 10. In an example, the association of the switch strand 28 with the vacancy 22 involves hybridization of at least a portion of the switch strand 28 with the nucleotide base 24 exposed at the vacancy 22. The hybridization that occurs will depend in part on the switch strand 28 (e.g., 28A, 28B, 28C, 28D) used. The temperature and / or ion concentration of the solution can be adjusted to initiate or promote complete or partial hybridization or annealing of the switch strand 28 with at least some of the nucleotide bases 24 exposed at the vacancy 22. As an example, the switch strand 28 can be designed to partially or completely hybridize at the vacancy 22 at room temperature (e.g., from about 18° C. to about 22° C.) and in a solution with a salt concentration of 50 mM.

[0108] Polymerase 38 keeps switch strand 28 at adjacent vacancy 22, thereby allowing several times of hybridization and dehybridization events to occur. In contrast, the random strand of drift will likely hybridize once, and then drift away. Switch strand 28 can be kept at adjacent vacancy 22, until, for example, it is dissociated using melting (melting) or another suitable technology. In some instances, the association of the switch strand in vacancy 22 can be up to tens of milliseconds (tens of milliseconds) or longer. This relatively long interaction makes the switch become "ON" (for example, by improving conductance from a lower state to modulate channel 16), and the change of conductivity can be detected. This relatively long interaction is different from the nucleotide 30 (that is, random drift strand) of other labels present in the solution, and the nucleotide 30 of these other labels can diffuse and short-term contact, but does not experience several times of at least partial hybridization and dehybridization events at the sensor 10. Transient interactions of these other labeled nucleotides 30 may cause transient and / or sporadic conductivity changes and thus be distinguishable from conductivity changes caused by the switch strand 28 held adjacent to the vacancy 22 .

[0109] When the switch strand 28 is at least partially hybridized and dehybridized several times with the exposed nucleotide base 24, the response of the sensor 10 can indicate the base of the labeled nucleotide 30 because the switch strand 28 is nucleotide-specific (i.e., a specific switch strand 28 is selected for a specific base). As such, the method 100 can also include correlating the response of the sensor 10 with the associated nucleotide-specific switch strand 28 (i.e., the labeled nucleotide 30 that has been associated with the polymerase 38 and the vacancy 22), and based on the nucleotide-specific switch strand 28, identifying the nucleotide (e.g., base) of the associated labeled nucleotide 30 (i.e., the labeled nucleotide 30 that has been associated with the polymerase 38 and the vacancy 22).

[0110] The base of the associated labeled nucleotide 30 will be incorporated into the nascent strand 50 hybridized to the template polynucleotide strand 48. This will in turn break the bond between the phosphate group of the labeled nucleotide 30 and the newly incorporated nucleotide base. This causes the remaining portion of the labeled nucleotide 30 to cleave from the newly incorporated nucleotide base.

[0111] Since the switch strand 28 can preferably be at least partially hybridized and remain connected in the double helical configuration of the modified dsNA 16', the method 100 can also include heating to dissociate the nucleotide-specific switch strand 28 from the vacancy 22. When synthesizing the labeled nucleotide 30, the melting temperature of the switch strand 28 can be adjusted to make the "on" time shorter or longer, and the "on" time depends in part on how long the polymerase 38 retains the nucleotide 32 of the labeled nucleotide 30. In an example, the melting temperature can be adjusted to match the temperature at which the sensing system 40, 40' is operated when the bond between the phosphate group of the labeled nucleotide 30 and the newly incorporated nucleotide base is destroyed. This will cause the dissociation of the switch strand 28 to be within the same time range in which the labeled nucleotide 30 is cleaved. In another example, it can be expected that the "off" time of the switch strand 28 is much shorter than the time when the labeled nucleotide 30 is retained by the polymerase 38 during the incorporation of the nascent chain 50. This can minimize background events from the switch strand 28 that is not associated with the polymerase 38.

[0112] As a result of the cleavage and dissociation, the remaining portion of the labeled nucleotide 30 is free to dissociate from the nucleotide base and diffuse away from the sensor 10. The cleavage and dissociation again modulates the channel 16 by returning the conductivity of the sensor 10 to the initial (e.g., lower) conductivity state that it was in before the labeled nucleotide 30 associated with the polymerase 38 and the vacancy 22. The appearance and disappearance of the signal due to the change in conductivity of the sensor 10 (e.g., increase and return to the lower state) can be associated with the incorporation of the nucleotide base into the nascent strand 50 of the template nucleotide strand 48 and the subsequent dissociation of the labeled nucleotide 30, respectively.

[0113] In example method 100, the association of one of the labeled nucleotides 30 (with polymerase 38 and gap 22), detection, correlation, and identification of the response can be used together for single molecule detection of polymerase incorporation events (ie, which nucleotide has been incorporated into the nascent strand 50).

[0114] It should be recognized that all combinations of the foregoing concepts and additional concepts discussed in more detail below (as long as these concepts are not inconsistent with each other) are contemplated as part of the inventive subject matter disclosed herein. In particular, all combinations of the claimed subject matter appearing at the end of this disclosure are contemplated as part of the inventive subject matter disclosed herein. It should also be recognized that the terms explicitly adopted herein (which may also appear in any disclosure incorporated by reference) should conform to the meaning most consistent with the specific concepts disclosed herein.

[0115] References throughout the specification to "one example," "another example," "an example," etc., mean that a particular element (e.g., feature, structure, and / or characteristic) described in conjunction with the example is included in at least one example described herein, and may or may not be present in other examples. Furthermore, it should be understood that the elements described for any example may be combined in any suitable manner in the various examples unless the context clearly indicates otherwise.

[0116] The terms "substantially" and "about" used throughout this disclosure, including the claims, are used to describe and account for small fluctuations, such as due to variations in processing. For example, they may refer to less than or equal to ±5%, such as less than or equal to ±2%, such as less than or equal to ±1%, such as less than or equal to ±0.5%, such as less than or equal to ±0.2%, such as less than or equal to ±0.1%, such as less than or equal to ±0.05%.

[0117] In addition, it should be understood that the ranges provided herein include the stated ranges and any values ​​or sub-ranges within the stated ranges as if they were explicitly listed. For example, a range represented by from about 10 nm to about 50 nm should be interpreted as including not only the explicitly listed limits from about 10 nm to about 50 nm, but also individual values, such as about 15 nm, 22.5 nm, 45 nm, etc., and sub-ranges, such as from about 20 nm to about 48 nm, etc.

[0118] While several examples have been described in detail, it will be appreciated that the disclosed examples may be modified. Therefore, the foregoing description is to be considered non-limiting.

Claims

1. A sensor, comprising: two electrodes with a space between them; a modulatable conductive pathway attached to the two electrodes, the modulatable conductive pathway comprising a modified partially double-stranded nucleic acid polymer electrically connected to the two electrodes and bridging the space between the two electrodes, the modified partially double-stranded nucleic acid polymer comprising: A first polynucleotide chain and a second polynucleotide chain partially bonded together; A gap in the first polynucleotide strand wherein nucleotides are missing; and more than one nucleotide base of the second polynucleotide strand exposed at a vacancy in the first polynucleotide strand, wherein the more than one nucleotide base exposed at the vacancy is capable of associating with a switch strand; and A polymerase is attached to the modified partially double-stranded nucleic acid polymer or to a substrate supporting the two electrodes via a tether. 2 . The sensor of claim 1 , wherein the vacancies have a length ranging from 10 nm to 50 nm.

3. The sensor according to any one of claims 1 to 2, wherein: i) a linker attaches each end of the first polynucleotide chain to a corresponding one of the two electrodes; or ii) a linker attaches each end of the second polynucleotide chain to a corresponding one of the two electrodes; or iii) Both i and ii.

4. The sensor of any one of claims 1 to 2, wherein at least one of the more than one nucleotide bases exposed at the vacancy is a guanine base.

5. The sensor of claim 3, wherein at least one of the more than one nucleotide bases exposed at the vacancy is a guanine base.

6. The sensor of any one of claims 1 to 2, wherein each of the more than one nucleotide bases exposed at the vacancy is a guanine base.

7. The sensor of claim 3, wherein each of the more than one nucleotide bases exposed at the vacancy is a guanine base.

8. The sensor of any one of claims 1 to 2, 5 and 7, further comprising a detector that detects a response from the modified partially double-stranded nucleic acid polymer when a switch chain associates with at least some of the more than one nucleotide bases at the vacancy, the switch chain comprising a nucleotide chain comprising bases complementary to the at least some of the more than one nucleotide bases exposed at the vacancy.

9. The sensor of claim 3, further comprising a detector that detects a response from the modified partially double-stranded nucleic acid polymer when a switch chain associates with at least some of the more than one nucleotide bases at the vacancy, the switch chain comprising a nucleotide chain comprising bases complementary to the at least some of the more than one nucleotide bases exposed at the vacancy.

10. The sensor of claim 4, further comprising a detector that detects a response from the modified partially double-stranded nucleic acid polymer when a switch chain associates with at least some of the more than one nucleotide bases at the vacancy, the switch chain comprising a nucleotide chain comprising bases complementary to the at least some of the more than one nucleotide bases exposed at the vacancy.

11. The sensor of claim 6, further comprising a detector that detects a response from the modified partially double-stranded nucleic acid polymer when a switch chain associates with at least some of the more than one nucleotide bases at the vacancy, the switch chain comprising a nucleotide chain comprising bases complementary to the at least some of the more than one nucleotide bases exposed at the vacancy.

12. The sensor of any one of claims 1 to 2, 5, 7, and 9 to 11, further comprising a fluidic system for introducing a reagent to the modified partially double-stranded nucleic acid polymer.

13. The sensor of claim 3, further comprising a fluidic system for introducing a reagent to the modified partially double-stranded nucleic acid polymer.

14. The sensor of claim 4, further comprising a fluidic system for introducing a reagent to the modified partially double-stranded nucleic acid polymer.

15. The sensor of claim 6, further comprising a fluidic system for introducing a reagent to the modified partially double-stranded nucleic acid polymer.

16. The sensor of claim 8, further comprising a fluidic system for introducing a reagent to the modified partially double-stranded nucleic acid polymer.

17. The sensor of claim 12, wherein the reagents include labeled nucleotides, at least one of the labeled nucleotides comprising: Nucleotides; a linker molecule attached to the phosphate group of the nucleotide; as well as A switch strand is attached to the linker molecule, the switch strand comprising a nucleotide strand comprising bases complementary to at least some of the more than one nucleotide bases exposed at the vacancy.

18. The sensor of any one of claims 13 to 16, wherein the reagents include labeled nucleotides, at least one of the labeled nucleotides comprising: Nucleotides; a linker molecule attached to the phosphate group of the nucleotide; as well as A switch strand is attached to the linker molecule, the switch strand comprising a nucleotide strand comprising bases complementary to at least some of the more than one nucleotide bases exposed at the vacancy.

19. The sensor of any one of claims 1 to 2, 5, 7, 9 to 11 and 13 to 17, further comprising more than one other modulatable conductive channel attached to the two electrodes, each of the other modulatable conductive channels comprising a corresponding modified partially double-stranded nucleic acid polymer electrically connected to the two electrodes and bridging the space between the two electrodes.

20. The sensor of claim 3, further comprising more than one other modulatable conductive channel attached to the two electrodes, each of the other modulatable conductive channels comprising a corresponding modified partially double-stranded nucleic acid polymer electrically connected to the two electrodes and bridging the space between the two electrodes.

21. The sensor as described in claim 4 further includes more than one other modulatable conductive channels attached to the two electrodes, each of the other modulatable conductive channels comprising a corresponding modified partially double-stranded nucleic acid polymer that is electrically connected to the two electrodes and bridges the space between the two electrodes.

22. The sensor of claim 6, further comprising more than one other modulatable conductive channel attached to the two electrodes, each of the other modulatable conductive channels comprising a corresponding modified partially double-stranded nucleic acid polymer electrically connected to the two electrodes and bridging the space between the two electrodes.

23. The sensor of claim 8, further comprising more than one other modulatable conductive channel attached to the two electrodes, each of the other modulatable conductive channels comprising a corresponding modified partially double-stranded nucleic acid polymer electrically connected to the two electrodes and bridging the space between the two electrodes.

24. The sensor of claim 12, further comprising more than one other modulatable conductive channel attached to the two electrodes, each of the other modulatable conductive channels comprising a corresponding modified partially double-stranded nucleic acid polymer electrically connected to the two electrodes and bridging the space between the two electrodes.

25. The sensor of claim 18, further comprising more than one other modulatable conductive channel attached to the two electrodes, each of the other modulatable conductive channels comprising a corresponding modified partially double-stranded nucleic acid polymer electrically connected to the two electrodes and bridging the space between the two electrodes.

26. The sensor of any one of claims 1 to 2, 5, 7, 9 to 11 and 13 to 17, wherein The modulatable conductive channel: The more than one nucleotide bases exhibit a first conductance when exposed at the vacancy; and At least some of the more than one nucleotide bases at the vacancy exhibit a second conductance different from the first conductance when associated with a complementary nucleotide base.

27. The sensor of claim 3, wherein: The modulatable conductive channel: The more than one nucleotide bases exhibit a first conductance when exposed at the vacancy; and At least some of the more than one nucleotide bases at the vacancy exhibit a second conductance different from the first conductance when associated with a complementary nucleotide base.

28. The sensor of claim 4, wherein: The modulatable conductive channel: The more than one nucleotide bases exhibit a first conductance when exposed at the vacancy; and At least some of the more than one nucleotide bases at the vacancy exhibit a second conductance different from the first conductance when associated with a complementary nucleotide base.

29. The sensor of claim 6, wherein: The modulatable conductive channel: The more than one nucleotide bases exhibit a first conductance when exposed at the vacancy; and At least some of the more than one nucleotide bases at the vacancy exhibit a second conductance different from the first conductance when associated with a complementary nucleotide base.

30. The sensor of claim 8, wherein: The modulatable conductive channel: The more than one nucleotide bases exhibit a first conductance when exposed at the vacancy; and At least some of the more than one nucleotide bases at the vacancy exhibit a second conductance different from the first conductance when associated with a complementary nucleotide base.

31. The sensor of claim 12, wherein: The modulatable conductive channel: The more than one nucleotide bases exhibit a first conductance when exposed at the vacancy; and At least some of the more than one nucleotide bases at the vacancy exhibit a second conductance different from the first conductance when associated with a complementary nucleotide base.

32. The sensor of claim 18, wherein: The modulatable conductive channel: The more than one nucleotide bases exhibit a first conductance when exposed at the vacancy; and At least some of the more than one nucleotide bases at the vacancy exhibit a second conductance different from the first conductance when associated with a complementary nucleotide base.

33. A labeled nucleotide comprising: Nucleotides; a linker molecule attached to the phosphate group of the nucleotide; as well as A switch chain attached to the linker molecule, the switch chain comprising a nucleotide chain comprising bases complementary to at least some of the more than one nucleotide bases exposed at vacancies in the sensor according to any one of claims 1 to 32.

34. A kit comprising: An electronic component, comprising: a support; and two electrodes operably disposed on the support and separated by a space; and A polymer solution, comprising: a liquid carrier; and The modified partially double-stranded nucleic acid polymer in the liquid carrier comprises: a first polynucleotide chain and a second polynucleotide chain that are partially bonded together and have opposite termini; a connector attached to each of the opposing ends, each connector attached to a respective one of the two electrodes; A gap in the first polynucleotide strand wherein nucleotides are missing; and more than one nucleotide base of the second polynucleotide strand exposed at a vacancy in the first polynucleotide strand, wherein the more than one nucleotide base exposed at the vacancy is capable of associating with a switch strand; and a polymerase attached to the modified partially double-stranded nucleic acid polymer or to the support via a tether; When each linker is attached to a corresponding one of the two electrodes, the modified partially double-stranded nucleic acid polymer forms a modulatable conductive channel in the space between the two electrodes.

35. The kit of claim 34, further comprising a reagent solution comprising labeled nucleotides, at least one of the labeled nucleotides comprising: Nucleotides; a linker molecule attached to the phosphate group of the nucleotide; as well as A switch strand is attached to the linker molecule, the switch strand comprising a nucleotide strand comprising bases complementary to at least some of the more than one nucleotide bases exposed at the vacancy.

36. The kit of claim 35, wherein the bases in the switch strand are fully complementary to the more than one nucleotide bases exposed at the gap.

37. The kit of claim 35, wherein the switch strand further comprises at least one nucleotide having a mismatched base that is not complementary to a corresponding base among the more than one nucleotide bases exposed at the gap.

38. The kit of claim 35, wherein the nucleotide chain in the switch chain has at least one less nucleotide than the more than one nucleotide base exposed at the vacancy.

39. The kit of claim 35, wherein the nucleotide strand in the switch strand has a higher number of nucleotides than the more than one nucleotide base exposed at the vacancy, and wherein a portion of the switch strand forms a stem-loop when associated at the vacancy.

40. The kit of claim 35, wherein: The nucleotide chain in the switch chain has a higher number of nucleotides than the more than one nucleotide base exposed at the vacancy; When associated at the vacancy, a portion of the switch chain forms a stem loop; and The other portion of the switch strand is fully complementary to the more than one nucleotide bases exposed at the gap, or includes at least one nucleotide having a mismatched base that is not complementary to a corresponding base in the more than one nucleotide bases exposed at the gap.

41. A sensing system comprising: Flow cell; as well as An electronic sensor integrated into the flow cell, the electronic sensor comprising: two electrodes with a space between them; a modulatable conductive pathway attached to the two electrodes, the modulatable conductive pathway comprising a modified partially double-stranded nucleic acid polymer electrically connected to the two electrodes and bridging the space between the two electrodes, the modified partially double-stranded nucleic acid polymer comprising: A first polynucleotide chain and a second polynucleotide chain partially bonded together; A gap in the first polynucleotide strand wherein nucleotides are missing; and more than one nucleotide base of the second polynucleotide strand exposed at a vacancy in the first polynucleotide strand, wherein the more than one nucleotide base exposed at the vacancy is capable of associating with a switch strand; and A polymerase is anchored to the modified partially double-stranded nucleic acid polymer or the support of the electronic sensor via a tether.

42. The sensing system of claim 41, further comprising a reagent delivery system for selectively introducing a reagent to an input end of the flow cell.

43. The sensing system of claim 42, wherein the reagents are in a sample container and the reagents include labeled nucleotides, at least one of the labeled nucleotides comprising: Nucleotides; a linker molecule attached to the phosphate group of the nucleotide; as well as A switch strand is attached to the linker molecule, the switch strand comprising a nucleotide strand comprising bases complementary to at least some of the more than one nucleotide bases exposed at the vacancy.

44. The sensing system of any one of claims 41 to 43, further comprising a detector for detecting a response from the electronic sensor.

45. A method comprising: The template polynucleotide chain is introduced into an electronic sensor having a polymerase tethered to i) a modulatable conductive channel bridging the space between two electrodes and electrically connected to the two electrodes, or ii) a substrate supporting the two electrodes, the modulatable conductive channel comprising a modified partially double-stranded nucleic acid polymer comprising: A first polynucleotide chain and a second polynucleotide chain partially bonded together; A gap in the first polynucleotide strand wherein nucleotides are missing; and more than one nucleotide base of the second polynucleotide strand exposed at a vacancy in the first polynucleotide strand; introducing a reagent comprising a labeled nucleotide to the electronic sensor, whereby a nucleotide of one of the labeled nucleotides associates with the polymerase and a nucleotide-specific switch strand of one of the labeled nucleotides associates with at least some of the more than one nucleotide bases exposed at the vacancy; and In response to the association at the vacancy, a response of the electronic sensor is detected.

46. ​​The method of claim 45, further comprising: correlating a response of the electronic sensor to an associated nucleotide-specific switch strand; as well as Based on the associated nucleotide-specific switch strand, a nucleotide that is one of the labeled nucleotides is identified.

47. The method of claim 45 or 46, further comprising applying heat to dissociate the nucleotide-specific switch strand from the vacancy.

Images