A method for designing primers and probes

Abstract

The present invention discloses a design method for primers and probes for amplifying low-concentration mutant target sequences. First, the mutation position (mutation point, i.e., position 0) of the target sequence to be amplified is determined; then, a 15-25bp nucleic acid fragment including the 0 base is selected in the negative direction of the mutation point as a forward primer, and a 12-25bp nucleic acid sequence is selected from the ‑1 base or the 0 base in the positive direction of the mutation point as the probe sequence of the amplification system; finally, a reverse primer is designed according to a conventional method at a suitable position downstream of the 3' direction of the probe sequence. The primers and probes designed according to the method of the present invention can effectively (high specificity and high efficiency) amplify the target fragment under the background of a higher content of wild-type template, especially for point mutations, deletion mutations, and insertion mutations in gene mutations, etc., combined with fluorescent real-time PCR technology, can effectively solve the difficulty of insufficient sensitivity in current clinical tumor detection and drug sensitivity detection.

Description

[0001] This application is a divisional application of the Chinese invention patent application with application number 201610281016.3, application date 2016-04-29, and invention name “A method for designing primers and probes for amplifying low-concentration mutant target sequences”. Technical Field

[0002] The present invention belongs to the field of molecular biology technology and relates to a novel method for designing nucleic acid primers and probes, and more specifically, relates to a method for designing primers and probes for amplifying low-concentration mutant target sequences. Technical Background

[0003] Many diseases are closely related to gene mutations. In many cases, the type and generation of post-drug reactions are also related to gene mutations. The detection of gene mutations is of great significance in many fields and situations, and the detection technology of gene mutations often uses PCR detection technology. PCR (Polymerase Chain Reaction) is polymerase chain reaction, which refers to the process of in vitro replication of daughter DNA complementary to the parent template DNA through denaturation, annealing, extension and other steps under the catalysis of DNA polymerase, using the parent DNA as a template and specific primers as the extension starting point. PCR is a DNA in vitro synthesis and amplification technology that can quickly and specifically amplify any target DNA in vitro, and can be used in many aspects such as gene isolation and cloning, sequence analysis, gene expression regulation, and gene polymorphism research.

[0004] During semiconservative replication of DNA, double-stranded DNA can be denatured and melted into single strands under the action of multiple enzymes, and with the participation of DNA polymerase and promoter, it can be replicated into two identical copies according to the principle of base complementary pairing. Under experimental conditions, DNA can also denature and melt at high temperatures, and can renature into double strands when the temperature is lowered. Therefore, by controlling the denaturation and renaturation of DNA through temperature changes, designing primers as promoters, and adding DNA polymerase and dNTP, the in vitro replication of specific genes can be completed. PCR is similar to the natural replication process of DNA, and its specificity depends on the oligonucleotide primers that are complementary to both ends of the target sequence. PCR consists of three basic reaction steps: denaturation-annealing (renaturation)-extension: ① Denaturation of template DNA: After the template DNA is heated to about 94°C for a certain period of time, the double-stranded DNA of the template DNA or the double-stranded DNA formed by PCR amplification is dissociated to become a single strand, so that it can bind to the primer and prepare for the next round of reaction; ② Annealing (renaturation) of template DNA and primer: After the template DNA is heated and denatured into a single strand, the temperature drops to about 40-60°C, and the primer and the complementary sequence of the template DNA single strand are paired and combined; ③ Extension of primer: Under the action of DNA polymerase, the DNA template-primer complex is at about 72°C, with dNTP as the reaction raw material and the target sequence as the template, according to the principle of base pairing and semi-conservative replication, a new semi-conservative replication chain complementary to the template DNA chain is synthesized. Repeating the cycle can obtain more semi-conservative replication chains, and this new chain can become the template for the next cycle. It takes 2 to 4 minutes to complete each cycle, and the target gene to be amplified can be amplified several million times in 2 to 3 hours.

[0005] PCR technology is often used in clinical medicine, such as the detection of hepatitis B virus, tumors, pathogens, etc. For example, many common tumor diseases in humans are closely related to certain viral etiologies and genetic changes in tumor-related genes. PCR technology has achieved gratifying results in the study of tumor viral etiologies, tumor-related genes, and tumor-related tumor suppressor genes. It is also used for genetic diseases with multiple mutations. PCR is used in paternity testing, blood typing, and fingerprint identification in law. For example, when it is impossible to use traditional serological methods to test blood types for trace amounts of blood, PCR methods can be used to test ABO and MN blood types. The testing of biological materials at certain crime scenes will provide forensic doctors with reliable and effective basis and direct and efficient data.

[0006] For PCR detection technology, the design of primers and probes is a crucial first condition. When using PCR technology to detect gene mutations, especially when the amount of wild-type DNA accounts for a large proportion (i.e., fewer mutations), the shortcomings of existing PCR technology are mainly reflected in the design of primers and probes, which are specifically manifested as follows: ① Poor specificity. Primers and probes designed according to ordinary methods for gene mutations often produce non-specific amplification bands; ② Poor selectivity. Under the background of a higher wild-type template, the detection ability for lower-content gene mutation DNA is limited. Most of the mutations that cause tumors are somatic mutations, and the mutant cells are doped in wild-type cells. Therefore, the extracted DNA also contains a large amount of wild-type DNA; ③ When the sample size is small or there is complex background interference in the sample, it is difficult to produce effective DNA amplification using the extracted DNA, which may even lead to failure to detect or cause false negative detection. Summary of the invention

[0007] The technical problem to be solved by the present invention is to overcome the defects and shortcomings of the existing methods for designing primers and probes for detecting gene mutations, and to provide a method for designing primers and probes for amplifying low-content mutant DNA in a background of high-content wild-type DNA, as well as its application in the field of nucleic acid detection. The primers and probes designed according to the method of the present invention can effectively amplify the target fragment in the background of a relatively high wild-type template, and are a simple, inexpensive, efficient, and highly specific PCR amplification primer and probe design method for amplifying the target fragment.

[0008] Another object of the present invention is to provide a method for designing primers and probes for amplifying low-concentration mutant target sequences.

[0009] Another object of the present invention is to provide an application of the above-mentioned method for designing primers and probes.

[0010] The purpose of the present invention is achieved through the following technical solutions:

[0011] A method for designing primers and probes for amplifying low-concentration mutant target sequences. Preferably, the primers and probes for amplifying low-concentration mutant target sequences are specifically primers and probes for amplifying low-concentration mutant DNA (amplifying low-content mutant DNA in a high wild-type DNA background).

[0012] The design method comprises the following steps:

[0013] S1. To better explain the technical content of the present invention, the following definitions are made: the number of bases at the mutation point on the target sequence to be amplified is defined as 0, the 5' direction of the mutation point base is the negative direction, the 3' direction is the positive direction, the number of bases from the mutation point to the 5' direction is called -1, -2, -3... positions in sequence; the number of bases from the mutation point to the 3' direction is called +1, +2, +3... positions in sequence;

[0014] S2. Determine the position of the mutated base of the target sequence to be amplified and the type of mutation to be determined, that is, determine position 0;

[0015] S3. In the negative direction of the mutation point, a 15-25 bp nucleic acid fragment including the 0 base is selected as the forward primer for amplification; single or multiple base mismatches can be introduced at positions -1 to -4 of the forward primer according to the needs of the assay to adjust the specificity and efficiency of amplification;

[0016] S4. In the positive direction of the mutation point, a 12-25 bp nucleic acid sequence is selected from the -1 base or the 0 base as the probe sequence of the amplification system; since the sequence of the probe starts from the -1 base or the 0 base, the method of the present invention has an obvious structural feature that the 3' end of the forward primer and the 5' end of the probe have a 1 bp or 2 bp overlap;

[0017] S5. Design a reverse primer at an appropriate position in the 3' downstream direction of the probe sequence according to conventional methods.

[0018] Among them, further, the influence of the mismatch base introduced by the forward primer in step S3 on the amplification specificity is in the following order: -1 position > -2 position > -3 position > -4 position; that is, the amplification specificity of the mismatch base introduced at the -1 position is the highest.

[0019] Preferably, the 5' end of the probe sequence in step S4 is labeled with a fluorescent group, and the 3' end is labeled with a corresponding quenching group. The labeling group can be a conventional labeling group such as FAM, VIC, HEX, and a corresponding quenching group.

[0020] More preferably, the fluorescent group and quenching group of the label are FAM and BHQ1. When MGB labeling is selected, the sequence of the probe should be designed to be as short as possible.

[0021] Preferably, the base at position -1 on the probe sequence in step S4 may be the same as that on the primer, or may be different from that on the primer.

[0022] In addition, preferably, in order to make the designed primers have a suitable Tm value, the GC content of the designed primers and probes should be between 40% and 60%. Specifically, the forward primer can be obtained by properly adjusting the length of the primer and the type of mismatched bases introduced, and introducing an unrelated sequence of suitable length at the 5' end; the probe sequence can be obtained by adjusting the length of the probe, labeling different fluorescent groups, or introducing an unrelated sequence at the 3' end, but the overall design requirement of the probe is that it is better to be short rather than long.

[0023] Preferably, step S3 is to select a nucleic acid fragment of 18 to 23 bp including the 0 base in the negative direction of the mutation point as a forward primer for amplification.

[0024] Preferably, step S4 is to select a 15-23 bp nucleic acid sequence from base -1 or base 0 in the positive direction of the mutation point as a probe sequence for the amplification system.

[0025] The application of the above design method in designing primers and probes for amplifying low-content mutant DNA in a high-content wild-type DNA background is also within the protection scope of the present invention.

[0026] In addition, the primers and probes designed by the present invention are used to perform PCR amplification, comprising the following steps:

[0027] (1) Pre-denaturation;

[0028] (2) a first PCR amplification comprising several cycles of denaturation, primer annealing, and primer extension;

[0029] (3) The second part of the PCR amplification includes several cycles of denaturation, primer annealing and primer extension.

[0030] In order to improve the amplification efficiency of the product, the number of cycles in the second step is set to 3 to 10 cycles, and the annealing temperature is set to 56°C to 65°C. The results show that when the annealing temperature is set to 56°C to 65°C, the temperature is most conducive to the specific binding of the designed primers and the target sequence template, and the possibility of the designed primers binding to the wild-type template is the lowest, so that the mutant template in the high-content wild-type background can be amplified in large quantities, which is conducive to the subsequent third-part cycle and the amplification efficiency of the entire system. The number of PCR amplification cycles in the third step is set to 30 to 45, preferably 35, which can be determined according to needs. The annealing temperature of this part is 5 to 8°C lower than the annealing temperature of the first part. After the specific amplification of the target sequence in the first part, the ratio of the mutant template to the wild-type template in this part is obviously higher than that in the initial sample, so lowering the annealing temperature is conducive to more effective amplification of the mutant target sequence. After the amplification of the second part, a small amount of mutations are enriched millions of times, while the wild-type template is completely at a disadvantage in binding and fluorescence generation during the entire amplification process, and there is almost no amplification. In this way, a very small amount of mutant DNA in the DNA template to be detected can be well detected. Studies have shown that the primers and probes designed by this method can effectively detect mutations of 0.1% or more.

[0031] When the primers and probes designed according to the present invention are used for PCR amplification, the DNA polymerase, dNTP, Mg 2+ The components such as the system buffer and the like are the same as those of ordinary PCR and can be optimized according to different reactions.

[0032] In addition, the application of the above-mentioned design method in designing primers and probes for detecting gene mutations and / or single nucleotide polymorphisms is also within the protection scope of the present invention. Primers and / or probes designed according to this method can be well applied to detecting gene mutations, single nucleotide polymorphisms and / or SNPs.

[0033] The reasons why the primers and probes designed by this method have high specificity are mainly related to the following two aspects:

[0034] (1) Primer design: First, according to the conventional design method, the mutated chain is used as the target sequence chain for primer design, and the mutation point is placed at the 3' end of the primer; since the matching of the 3' end is crucial for amplification, the amplification efficiency of the primer is extremely low for the unmatched wild-type template, which plays the role of enhancing the amplification specificity in the first level. Then, several mismatched bases are artificially introduced into the primer. After the mismatched bases are introduced, the new chain amplified will completely match the primer. At this time, the original wild-type chain or the mutant chain does not completely match the primer, but the mutant chain is easier to match the primer than the wild-type chain. The higher annealing temperature in the first stage is to ensure that the primer and the wild-type template are avoided as much as possible during the amplification process. This provides a second guarantee for specific amplification, thereby enriching the low-abundance mutant template in the initial few cycles.

[0035] (2) Probe design: The probe design in this method is basically a 15-22 bp sequence downstream of the -1 or -2 position. The probe length can be adjusted according to the actual test situation. Since the 0th position is the mutation point, the probe also contains the 0th position mutation base. Therefore, adjusting a suitable annealing temperature according to the Tm value of the probe can allow the probe to preferentially bind to the target sequence rather than the wild-type sequence, which plays a role in increasing specificity.

[0036] The schematic diagram of the PCR amplification reaction of the primers and probes designed by the present invention is shown in the attached figure. Figure 1 As shown. The amplification process is explained as follows: at the denaturation temperature, the double helix of DNA is unwound to form single strands; in the initial annealing stage, the DNA strands are renatured, and the primers will bind to the DNA template strands. Since the annealing temperature in the first stage is higher, for the mutant template, the end of the primer matches the mutation point on the template, so it is easier to bind to the mutant template strand; while the wild-type template is not easy to bind to the template strand due to the mismatched ends (although it is not easy to bind, some primers will still bind to the wild-type template strand). In the subsequent amplification process, since the newly generated mutant DNA strands and primers are completely matched, the primers are easier to bind to the mutant strands. After several cycles, the mutant template is continuously amplified, while the wild-type template cannot produce effective amplification, resulting in an increasing difference in the amount of the two, and ultimately achieving effective distinction between mutant fluorescent signals and wild-type fluorescent signals.

[0037] The present invention has the following beneficial effects:

[0038] (1) The greatest feature of the primers and probes designed in the present invention is that the 3' end of the primer and the 5' end of the probe overlap by 1 to 2 bp. In this way, not only the primers are specific but also the probes are specific during amplification. The double restriction further ensures the specificity and efficiency of amplification.

[0039] (2) The forward primer designed by the present invention can introduce appropriate mismatched bases according to the amplification results and needs to increase the specificity of amplification or improve the efficiency of amplification. Under the premise of ensuring the specificity of amplification, the Ct value corresponding to the amplification can be optimized according to the introduced mismatches, which is beneficial to the optimization of the process in the multiplex PCR system.

[0040] (3) It is better to introduce the mismatch base in the forward primer at the -3 or -4 position. In most gene amplification systems, better specificity and amplification efficiency can be achieved by introducing the mismatch at this position.

[0041] (4) The labeling group of the probe sequence designed by this method can be selected from conventional labeling groups such as FAM, VIC, HEX and the corresponding quenching group, and the more preferred labeled fluorescent group and quenching group are FAM and BHQ1. When MGB labeling is selected, the probe sequence should be designed to be as short as possible.

[0042] Based on the above, the primer and probe design method of the present invention targets point mutations, deletion mutations and insertion mutations in gene mutations, and combined with fluorescent real-time PCR technology can effectively solve the difficulty of insufficient sensitivity in current clinical tumor detection and drug sensitivity detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 Schematic diagram of PCR amplification reaction using primers and probes designed for the present invention; including Figure a and Figure b.

[0044] Figure 2 The primers and probes designed according to the method of the present invention in Example 1 are used to target the G at codon 12 of the Kras gene. G T>G C Amplification of T mutant and wild type.

[0045] Figure 3 The primers and probes designed according to the conventional method in Example 1 were used to target the G at codon 12 of the Kras gene. G T>G C Amplification of T mutant and wild type.

[0046] Figure 4 The primers and probes designed according to the method of the present invention in Example 2 are used to amplify the V600E mutant and wild-type BRAF genes.

[0047] Figure 5 The primers and probes designed according to the common method in Example 2 are used to amplify the V600E mutant and wild-type BRAF genes.

[0048] Figure 6The amplification of the c.3140A>G mutant and wild type of the PIK3CA gene using the primers and probes designed by the method of the present invention in Example 3.

[0049] Figure 7 The primers and probes designed using the common method in Example 3 are used to amplify the c.3140A>G mutant and wild type of the PIK3CA gene.

[0050] Figure 8 The primers and probes designed by the method of the present invention are used to amplify the mutant and wild types of the BRCA1 gene (c.2311T2C; p.L771L).

[0051] Fig. 9 The primers and probes designed using common methods were used to amplify the BRCA1 gene c.2311T2C; p.L771L mutant and wild type.

[0052] Fig.10 The primers and probes designed by the method of the present invention are used to amplify the c.2573T2G; p.L858R mutant and wild-type EGFR genes.

[0053] Fig.11 The primers and probes designed using common methods were used to amplify the c.2573T2G; p.L858R mutant and wild-type EGFR gene.

[0054] Fig.12 The primers and probes designed using the method described in this patent are used to amplify the c.182A>G; p.Q61R mutant and wild type of the NRAS gene.

[0055] Fig.13 The amplification results of the c.182A>G; p.Q61R mutant and wild type of the NRAS gene using primers and probes designed using common methods.

[0056] Fig.14 The primers and probes designed using the method described in this patent are used to amplify the c.524G>A; p.R175H mutant and wild type of the TP53 gene.

[0057] Fig.15 The amplification of the c.524G>A; p.R175H mutant and wild type of the TP53 gene using primers and probes designed using common methods.

[0058] Fig.16 The primers and probes designed using the method described in this patent are used to amplify the c.2753T>C; p.M918T mutant and wild type of the RET gene.

[0059] Fig.17 The amplification of the c.2753T>C; p.M918T mutant and wild type of the RET gene using primers and probes designed using common methods. DETAILED DESCRIPTION

[0060] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents and equipment used in the present invention are conventional reagents and equipment in the art.

[0061] The above method of the present invention has been verified through a large number of studies and experiments, and is described below using mutation detection of 8 genes as an example.

[0062] Example 1

[0063] 1. Use the method of the present invention to design primers and probes to perform PCR amplification of the G G T>G C Fluorescence PCR amplification assay of T mutant and wild-type samples at different gradients.

[0064] According to the wild-type gene sequence of Kras gene codon 12 published by Cosmic data and G G T>G C T mutation gene sequence, a probe was designed as Kras-Pb; the primers were Kras-Fp and Kras-Rp respectively.

[0065] Specifically, the primer and probe sequences designed according to the method of the present invention are as follows:

[0066] Kras-0Fp: CACTCTTGCCTACGCCTG;

[0067] Kras-0Pb:TGCAGCTCCAACTACCAC;

[0068] Kras-0Rp:GGCCTGCTGAAAATGACTG.

[0069] The primers and probes designed according to the conventional primer and probe design method are as follows:

[0070] Kras-1Fp:CACTCTTGCCTACGCCTG;

[0071] Kras-1Pb:GCTCCAACTACCACAAGTT;

[0072] Kras-1Rp:GGCCTGCTGAAAATGACTG.

[0073] 2. Sample preparation:

[0074] Artificial synthesis of a G G T>G C The T mutant sequence and the corresponding Kras wild-type sequence were loaded into plasmids for amplification. The synthesized plasmid was digested and 10 4 The enzyme-cut fragments of different copy numbers were then mixed in different proportions to obtain samples containing different concentrations of mutant and wild types: 100% mutant, 50% mutant, 10% mutant, 5% mutant, 1% mutant, 0.1% mutant and 100% wild-type sample templates.

[0075] 3. Real-time fluorescence PCR amplification

[0076] (1) The system of real-time fluorescence PCR is shown in Table 1.

[0077] Table 1

[0078] Components Addition volume (μl) Forward primer (100 μM) 0.125 Backward primer (100 μM) 0.125 Probe (100 μM) 0.05 <![CDATA[Mg 2+ (25mM)]]> 3 dNTP(10mM) 1 Hot start enzyme (5U / μl) 0.3 5*buffer 5 water 14.4 DNA 1 Total volume 25

[0079] (2) The real-time fluorescence PCR reaction procedure is:

[0080] Pre-denaturation: 95℃5min;

[0081] The first part was 10 cycles: 95°C for 20 s, 62°C for 30 s, and 72°C for 20 s;

[0082] The second part was 40 cycles: 95°C for 20 s, 58°C for 30 s, and 72°C for 20 s and the fluorescence signals were collected.

[0083] 4. Test results are as attached Figure 2 , Attachment Figure 3 And as shown in Table 2.

[0084] Figure 2 The results show that the amplification effect of the primers and probes designed according to the method of the present invention is very low in amplification of the wild-type template and can effectively distinguish 0.1% of the mutation type.

[0085] Figure 3 The amplification effect of the primers and probes designed according to the common method is shown in Table 2. The wild-type template is amplified more obviously, and only 1% of the mutant types can be distinguished.

[0086] Table 2

[0087]

[0088] Comprehensive comparison Figure 2 , Figure 3As well as the amplification effects in Table 2, it can be clearly seen that the primers and probes designed using the method of the present invention have better detection specificity for low-concentration mutant templates. Figure 2 The Ct value difference between the 0.1% mutant (about 10 copies) ratio template and the wild-type template is 12.27, while the Ct value difference between the same template and the wild-type template in the ordinary design system is only 0.92. A difference of 1 Ct is almost unusable in actual detection. Therefore, the detection limit of most primers designed according to ordinary methods is generally 1%, while the detection limit of the method described in the present invention is far less than 1‰, which is a thousand times different. Therefore, the primers and probes described in the method of the present invention are more sensitive and specific, and have lower requirements for samples.

[0089] Example 2

[0090] 1. Use the primers and probes designed by the patent of this invention to detect BRAF V600E mutation.

[0091] The following primers and probes were designed based on the wild-type and mutant sequences of the BRAF gene obtained from the cosmic data:

[0092] BRAFV600E primers and probes designed according to the invention method:

[0093] BRAF-0Fp:CCCACTCCATCGAGATGTCT;

[0094] BRAF-0Rp: TGAAGACCTCACAGTAAAA;

[0095] BRAF-0Pb: CTCTGTAGCTAGACCA.

[0096] BRAFV600E primer and probe sequences designed according to common methods:

[0097] BRAF-1Fp:CCCACTCCATCGAGATTTCT;

[0098] BRAF-1Rp: TGAAGACCTCACAGTAAAA;

[0099] BRAF-1Pb: CTGTAGCTAGACCAA.

[0100] 2. Sample preparation:

[0101] A sequence with BRAFV600E mutation and the corresponding BRAF wild-type sequence were artificially synthesized, and the two sequences were loaded into plasmids for amplification. The synthesized plasmid was digested using an enzyme digestion system to obtain 10^4 copy-order enzyme fragments, and then the two were mixed in different proportions to obtain samples containing different concentrations of mutant and wild-type: 100% mutant, 50% mutant, 10% mutant, 5% mutant, 1% mutant, 0.1% mutant and 100% wild-type sample templates.

[0102] 3. Real-time fluorescence PCR amplification

[0103] (1) The real-time fluorescence PCR system is shown in Table 3.

[0104] Table 3

[0105] Components Addition volume (μl) Forward primer (100 μM) 0.125 Backward primer (100 μM) 0.125 Probe (100 μM) 0.05 Mg2+(25mM) 3 dNTP(10mM) 1 Hot start enzyme (5U / μl) 0.3 5*buffer 5 water 14.4 DNA 1 Total volume 25

[0106] (2) The real-time PCR reaction procedure is:

[0107] 95℃5min;

[0108] The first part was 10 cycles: 95°C for 20 s, 62°C for 30 s, and 72°C for 20 s;

[0109] The second part was 40 cycles: 95°C for 20 s, 55°C for 30 s, and 72°C for 20 s and the fluorescence signals were collected.

[0110] 4. Test results are as attached Figure 4 , Attachment Figure 5 And as shown in Table 4.

[0111] Figure 4 It shows the detection effect of BRAF V600E mutation by designing primers and probes according to the method of the present invention.

[0112] Figure 5 It indicates the detection effect of BRAFV600E mutation by designing primers and probes according to the common method.

[0113] Table 4

[0114]

[0115] Comprehensive comparison Figure 4 and Figure 5 As well as the amplification effects in Table 4, it can be clearly seen that the primers and probes designed using the method of the present invention have better detection specificity for low-concentration mutant templates. Figure 4The difference in Ct value between the 0.1% mutant (about 10 copies) ratio template and the wild-type template is 4, while the difference in Ct value between the same template and the wild-type template in the common design system is only 1.2, and a difference of 1 Ct is almost unusable in actual detection. Therefore, the detection limit of most primers designed according to common methods is generally 1%, while the detection limit of primers and probes designed using the method of the present invention is much lower than 1‰, which is more than 10 times different. Therefore, the primers and probes designed by the method of the present invention are more sensitive and specific, and have lower requirements on samples.

[0116] Example 3

[0117] 1. The primers and probes designed by the method of the present invention and the primers and probes designed by the conventional method were used to detect the c.3140A>G mutation of the PIK3CA gene and the results were compared.

[0118] The following primers and probes were designed based on the wild-type and mutant sequences of the PIK3CA gene obtained from the cosmic data:

[0119] PIK3CAc.3140A>G primers and probes designed according to the method of the present invention:

[0120] PIK-0Fp: AACAAATGAATGATGCGCG

[0121] PIK-0Rp:TGCATGCTGTTTAATTGTGTGG

[0122] PIK-0Pb:CGTCATGGTGGCTGGACAACA

[0123] PIK3CAc.3140A>G primer and probe sequences designed according to common methods:

[0124] PIK-1Fp: CAAATGAATGATGCACG

[0125] PIK-1Rp:TGCATGCTGTTTAATTGTGTGG

[0126] PIK-1Pb: ATGGTGGCTGGACAACA

[0127] 2. Sample preparation:

[0128] A sequence with the PIK3CA c.3140A>G mutation and the corresponding PIK3CA wild sequence were artificially synthesized, and the two sequences were loaded into plasmids for amplification. The synthesized plasmid was digested using an enzyme digestion system to obtain 10 4The enzyme-cut fragments of different copy numbers were then mixed in different proportions to obtain samples containing different concentrations of mutant and wild types: 100% mutant, 50% mutant, 10% mutant, 5% mutant, 1% mutant, 0.1% mutant and 100% wild-type sample templates.

[0129] 3. Real-time fluorescence PCR amplification

[0130] (1) The system of real-time fluorescence PCR is shown in Table 5.

[0131] Table 5

[0132]

[0133]

[0134] (2) The real-time PCR reaction procedure is:

[0135] 95℃5min;

[0136] The first part was 10 cycles: 95°C for 20 s, 62°C for 30 s, and 72°C for 20 s;

[0137] The second part was 40 cycles: 95°C for 20 s, 55°C for 30 s, and 72°C for 20 s and the fluorescence signals were collected.

[0138] 4. Test results are as attached Figure 6 , Attachment Figure 7 And as shown in Table 6.

[0139] Figure 6 The present invention is used to amplify the PIK3CAc.3140A>G gene using the primers and probes designed by the method of the present invention. Figure 7 This is the amplification of the PIK3CAc.3140A>G gene using primers and probes designed using common methods.

[0140] Table 6

[0141]

[0142] Comprehensive comparison Figure 6 and Figure 7 From the amplification effects shown in Table 6, it can be clearly seen that the primers and probes designed using the method of the present invention have better detection specificity for low-concentration mutant templates. Figure 6The Ct value difference between the 0.1% mutant (about 10 copies) ratio template and the wild-type template is 5.1, while the Ct value difference between the same template and the wild-type template in the ordinary design system is only 1.2. A difference of 1 Ct is almost unusable in actual detection. Therefore, the detection limit of most primers designed according to ordinary methods is generally 1%, while the detection limit of the method described in the present invention is far less than 1‰, which is more than 30 times different. Therefore, the primers and probes described in the method of the present invention are more sensitive and specific, and have lower requirements for samples.

[0143] Example 4

[0144] 1. The primers and probes designed by the method of the present invention and the primers and probes designed by the conventional method were used to detect the mutation of the (c.2311T2C; p.L771L) SNP site of the BRCA1 gene and the results were compared.

[0145] The following primers and probes were designed based on the wild-type and mutant sequences of the BRCA1 gene obtained from the cosmic data:

[0146] (1) Primers and probes for the (c.2311T2C; p.L771L) SNP site of the BRCA1 gene designed according to the method of this patent:

[0147] BRC-0Fp:AATCAGTACCAGGTAGCAG

[0148] BRC-0Rp:GTGGAGAAAGGGTTTTGCAA

[0149] BRC-0Pb:GTGAAATACTGCTACTCTC

[0150] (2) Primer and probe sequences of the BRCA1 gene (c.2311T2C; p.L771L) SNP site designed according to conventional methods:

[0151] BRC-1Fp:AATCAGTACCAGGTAGCAG

[0152] BRC-1Rp:GTGGAGAAAGGGTTTTGCAA

[0153] BRC-1Pb:GAAATACTGCTACTCTCTAC

[0154] 2. Sample preparation:

[0155] A sequence containing the BRCA1 gene (c.2311T2C; p.L771L) SNP site and the corresponding BRCA1 wild-type sequence were artificially synthesized and loaded into plasmids for amplification. The synthesized plasmid was digested using an enzyme digestion system to obtain 10 4 The copy-level restriction fragments are used as templates for fluorescent PCR amplification.

[0156] 3. Fluorescence PCR amplification, the system is shown in Table 7:

[0157] Table 7

[0158]

[0159]

[0160] The real-time PCR reaction program was: 95°C for 5 min; 50 cycles: 95°C for 20 s, 51°C for 30 s, 72°C for 30 s and collecting the fluorescence signal.

[0161] 4. The results are as attached Figure 8 and 9 , and as shown in Table 8.

[0162] Table 8

[0163]

[0164] Comprehensive comparison Figure 8 , Fig. 9 From the amplification results shown in Table 4, it can be clearly seen that the primers and probes designed using the method described in this patent have better detection specificity for mutant templates.

[0165] Example 5

[0166] 1. The primers and probes designed by the method described in the present invention and the primers and probes designed by the common method were used to detect the c.2573T2G and p.L858R mutants of the EGFR gene and the results were compared.

[0167] The following primers and probes were designed based on the wild-type and mutant sequences of the EGFR gene queried from the cosmic data:

[0168] (1) Primers and probes for c.2573T2G; p.L858R mutations of EGFR gene designed according to the method of this patent:

[0169] EGFR-0Fp:CAAGATCACAGATTTTGCCGG

[0170] EGFR-0Rp:CTTACTTTGCCTCCTTCTGC

[0171] EGFR-0Pb:GGGCCAAACTGCTGGGT

[0172] (2) The c.2573T2G; p.L858R mutant primer and probe sequences of the EGFR gene designed according to the conventional method:

[0173] EGFR-1Fp:CAAGATCACAGATTTTGCCGG

[0174] EGFR-1Rp:CTTACTTTGCCTCCTTCTGC

[0175] EGFR-1Pb:GCCAAACTGCTGGGTGCGGA

[0176] 2. Sample preparation:

[0177] A sequence with EGFR gene c.2573T2G; p.L858R mutation site and the corresponding EGFR wild sequence were artificially synthesized and loaded into plasmids for amplification. The synthesized plasmid was digested using an enzyme digestion system to obtain 10 4 The copy-level restriction fragments are used as templates for fluorescent PCR amplification.

[0178] 3. Fluorescence PCR amplification, the system is shown in Table 9.

[0179] Table 9:

[0180] Components Addition volume (μl) Forward primer (100 μM) 0.125 Backward primer (100 μM) 0.125 Probe (100 μM) 0.05 Mg2+(25mM) 3 dNTP(10mM) 1 Hot start enzyme (5U / μl) 0.3 5*buffer 5 Water 14.4 DNA 1 Total 25

[0181] The real-time PCR reaction program was: 95°C for 5 min; 50 cycles: 95°C for 20 s, 48°C for 30 s, 72°C for 30 s and collecting the fluorescence signal.

[0182] 4. The results are as attached Fig.10 , Fig.11 As shown in Table 10.

[0183] Table 10

[0184]

[0185]

[0186] Comprehensive comparison Fig.10 and Fig.11 From the amplification results shown in Table 10, it can be clearly seen that the primers and probes designed using the method described in this patent have better detection specificity for mutant templates.

[0187] Example 6

[0188] 1. The primers and probes designed by the method of the present invention and the primers and probes designed according to the conventional method were used to detect the c.182A>G and p.Q61R mutants of the NRAS gene and the results were compared.

[0189] The following primers and probes were designed based on the wild-type and mutant sequences of the NRAS gene found in the cosmic data:

[0190] (1) Primers and probes for the c.182A>G; p.Q61R mutant type of the NRAS gene designed according to the method of this patent:

[0191] NRAS-0Fp:CATGGCACTGTACTCTGCTC

[0192] NRAS-0Rp:ACCCCCAGGATTCTTACAGA

[0193] NRAS-0Pb:CGTCCAGCTGTATCCAGTATG

[0194] (2) The c.182A>G; p.Q61R mutant primer and probe sequences of the NRAS gene designed according to the conventional method:

[0195] NRAS-1Fp:CATGGCACTGTACTCTGCTC

[0196] NRAS-1Rp:ACCCCCAGGATTCTTACAGA

[0197] NRAS-1Pb:CCAGCTTGTATCCAGTATGTCC

[0198] 2. Sample preparation:

[0199] A sequence with the NRAS gene c.182A>G; p.Q61R mutation site and the corresponding NRAS wild sequence were artificially synthesized and loaded into plasmids for amplification. The synthesized plasmid was digested using an enzyme digestion system to obtain 10 4 The copy-level restriction fragments are used as templates for fluorescent PCR amplification.

[0200] 3. Fluorescence PCR amplification, the system is shown in Table 11.

[0201] Table 11

[0202]

[0203]

[0204] The real-time PCR reaction program was: 95°C for 5 min; 50 cycles: 95°C for 20 s, 48°C for 30 s, 72°C for 30 s and collecting the fluorescence signal.

[0205] 4. The results are as attached Fig.12 , Fig.13 and as shown in Table 12.

[0206] Table 12

[0207]

[0208] Comprehensive comparison Fig.12 and Fig.13 From the amplification results shown in Table 12, it can be clearly seen that the primers and probes designed using the method described in this patent have better detection specificity for mutant templates.

[0209] Example 7

[0210] 1. Primers and probes designed by the method described in the present invention and primers and probes designed by the conventional method were used to detect c.524G>A and p.R175H mutants of the TP53 gene and the results were compared.

[0211] The following primers and probes were designed based on the wild-type and mutant sequences of the TP53 gene queried from the cosmic data:

[0212] (1) Primers and probes for the c.524G>A; p.R175H mutant type of the TP53 gene designed according to the method of this patent:

[0213] TP53-0Fp:GCTCATGGTGGGGGTAGT

[0214] TP53-0Rp:TTGATTCCACACCCCCGCC

[0215] TP53-0Pb:TGCCTCACAACCTCCGTC

[0216] (2) Primer and probe sequences for the c.524G>A; p.R175H mutant of the TP53 gene designed according to conventional methods:

[0217] TP53-1Fp:GCTCATGGTGGGGGTAGT

[0218] TP53-1Rp:TTGATTCCACACCCCCGCC

[0219] TP53-1Pb:ACAACCTCCGTCATGTGCTG

[0220] 2. Sample preparation:

[0221] A sequence with the TP53 gene c.524G>A; p.R175H mutation site and the corresponding TP53 wild-type sequence were artificially synthesized and loaded into plasmids for amplification. The synthesized plasmid was digested using an enzyme digestion system to obtain 10 4 The copy-level restriction fragments are used as templates for fluorescent PCR amplification.

[0222] 3. Fluorescence PCR amplification, the system is shown in Table 13.

[0223] Table 13

[0224] Components Addition volume (μl) Forward primer (100 μM) 0.125 Backward primer (100 μM) 0.125 Probe (100 μM) 0.05 Mg2+(25mM) 3 dNTP(10mM) 1 Hot start enzyme (5U / μl) 0.3 5*buffer 5 Water 14.4 DNA 1 Total 25

[0225] The real-time PCR reaction program was: 95°C for 5 min; 50 cycles: 95°C for 20 s, 48°C for 30 s, 72°C for 30 s and collecting the fluorescence signal.

[0226] 4. The results are as attached Fig.14 , Fig.15 As shown in Table 14.

[0227] Table 14

[0228]

[0229]

[0230] Comprehensive comparison Fig.13 and Fig.14 From the amplification results shown in Table 7, it can be clearly seen that the primers and probes designed using the method described in this patent have better detection specificity for mutant templates.

[0231] Example 8

[0232] 1. The primers and probes designed by the method described in the present invention and the primers and probes designed by the common method were used to detect the c.2753T>C and p.M918T mutants of the RET gene and the results were compared.

[0233] The following primers and probes were designed based on the wild-type and mutant sequences of the RET gene queried from the cosmic data:

[0234] (1) Primers and probes for the c.2753T>C; p.M918T mutation of the RET gene designed according to the method of this patent:

[0235] RET-0Fp:CGGATTCCAGTTAAATCGAC

[0236] RET-0Rp:TCACTTTGCGTGGTGTAGAT

[0237] RET-0Pb:ACGGCAATTGAATCCCT

[0238] (2) Primers and probe sequences for the RET gene c.2753T>C; p.M918T mutation designed according to conventional methods:

[0239] RET-1Fp:CGGATTCCAGTTAAATCGAC

[0240] RET-1Rp:TCACTTTGCGTGGTGTAGAT

[0241] RET-1Pb:GCAATTGAATCCCTTCTTG

[0242] 2. Sample preparation:

[0243] A sequence with RET gene c.2753T>C; p.M918T mutation site and the corresponding RET wild sequence were artificially synthesized, and the two sequences were loaded into plasmids for amplification. The synthesized plasmid was digested using an enzyme digestion system to obtain 10 4 The copy-level restriction fragments are used as templates for fluorescent PCR amplification.

[0244] 3. Fluorescence PCR amplification, the system is shown in Table 15.

[0245] Table 15

[0246]

[0247]

[0248] The real-time PCR reaction program was: 95°C for 5 min; 50 cycles: 95°C for 20 s, 48°C for 30 s, 72°C for 30 s and collecting the fluorescence signal.

[0249] 4. The results are as attached Fig.16 , Fig.17 and as shown in Table 16.

[0250] Table 16

[0251]

[0252] Comprehensive comparison Fig.15 and Fig.16 From the amplification results shown in Table 16, it can be clearly seen that the primers and probes designed using the method described in this patent have better detection specificity for mutant templates.

Claims

1. A method for designing primers and probes, characterized in that: The steps include: S1. The number of bases at the mutation point on the target sequence to be amplified is 0, the 5' direction of the mutation point base is negative, the 3' direction is positive, the number of bases from the mutation point to the 5' direction is called -1, -2, -3... positions; the number of bases from the mutation point to the 3' direction is called +1, +2, +3... positions; S2. Determine the 0 position of the mutant target sequence to be amplified; S3. In the negative direction of the mutation point, a 15-25 bp nucleic acid fragment including the 0 base is selected as a forward primer for amplification; S4. In the positive direction of the mutation point, a 12-25 bp nucleic acid sequence is selected from the -1 base or the 0 base as the probe sequence of the amplification system; S5. Design a reverse primer at an appropriate position downstream of the probe sequence in the 3' direction according to conventional primer design methods.

2. The design method according to claim 1, characterized in that: In step S4, the 5' end of the probe sequence is labeled with a fluorescent group, and the 3' end is labeled with a corresponding quenching group.

3. The design method according to claim 1, characterized in that: In step S4, the base at position -1 on the probe sequence is the same as or different from that on the primer.

4. The design method according to claim 1, characterized in that: Step S4 is to select a 15-23 bp nucleic acid sequence from the -1 base or the 0 base in the positive direction of the mutation point as the probe sequence of the amplification system.

5. The design method according to claim 1, characterized in that: Step S3 is to select a nucleic acid fragment of 18 to 23 bp including the 0 base in the negative direction of the mutation point as a forward primer for amplification.

6. The design method according to claim 1, characterized in that: The primers are specifically primers for amplifying low-concentration mutant DNA.

7. The design method according to claim 1, characterized in that: The probe is specifically a probe for amplifying low-concentration mutant DNA.

8. Use of the design method according to claim 1 in designing primers and / or probes for amplifying mutant DNA in a wild-type DNA background.

9. The use according to claim 8, characterized in that: The wild-type DNA background is a high-content wild-type DNA background.

10. The use according to claim 8, characterized in that: The mutant DNA is a low-content mutant DNA.

11. The use according to claim 8, characterized in that: The design method is used in designing primers and / or probes for detecting gene mutations and / or single nucleotide polymorphisms.

12. The use according to claim 8, characterized in that: The method for PCR amplification using the designed primers and / or probes comprises the following steps: (1) Pre-denaturation; (2) a first PCR amplification comprising several cycles of denaturation, primer annealing, and primer extension; (3) The second part of PCR amplification includes several cycles of denaturation, primer annealing and primer extension.

Images