Multi-channel rapid detection method and kit for carbapenemase-producing enterobacteriaceae drug-resistant gene based on PfAgo nuclease

Abstract

The invention discloses a PfAgo nuclease-based single-channel rapid detection method and kit for five drug-resistant genes of carbapenemase-producing enterobacteriaceae. The method comprises the following steps: extracting nucleic acid to obtain nucleic acid to be detected; the method comprises the following steps: simultaneously amplifying to-be-detected sites of three drug-resistant genes by using three groups of different PCR (Polymerase Chain Reaction) primers to obtain nucleic acid products, namely a KPC type gene amplification product, an NDM type gene amplification product and a VIM type gene amplification product; preparing a PfAgo reaction mixed solution, adding 20 [mu] L of the nucleic acid amplification product into the PfAgo reaction mixed solution, incubating at 95 DEG C for 30 min, and reading fluorescence to obtain a detection result. According to the invention, the PfAgo derived from the pyrococcus violaceus is used for detection, and the method has the advantages of fast detection speed, high accuracy and low cost.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological detection, and relates to a multi-channel rapid detection method and a kit for detecting carbapenemase-producing Enterobacteriaceae resistance genes based on PfAgo nuclease. Background Art

[0002] Enterobacteriaceae are one of the common pathogens in community and hospital infections, and carbapenem antibiotics are generally considered to be the most effective antibacterial drugs for treating multidrug-resistant bacterial infections. Therefore, the prevalence of carbapenem-resistant Enterobacteriaceae (i.e., CRE) has become a serious threat to public health. There are four resistance mechanisms of CRE, the first of which is the production of carbapenemase, which hydrolyzes antibiotics. This type of resistant bacteria is called carbapenemase-producing Enterobacteriaceae (i.e., CPE), which is the main resistance mechanism of CRE and can account for more than 90% clinically. The resistance genes of CPE are divided into three types: Class A, Class B, and Class D. Class A and Class D belong to serine enzymes, and Class B belongs to metalloenzymes. The most common resistance gene in Class A is KPC type, the most common resistance gene in Class B is NDM type, IMP type, and VIM type, and the most common resistance gene in Class D is OXA-48 type. The resistance genes of CPE are transmitted through plasmids or transposons, so it is very easy to form an epidemic. There are some differences in the genotypes prevalent in different countries. In China, KPC and NDM are the main types, while IMP, VIM and OXA-48 are in the minority, but we still need to be vigilant about their outbreaks. In addition, CPE is not only spread among people, but has also been detected in animals, food and the environment.

[0003] CPE poses a multifaceted threat to human health. Its colonization can lead to abdominal infection, urinary tract infection, bloodstream infection, and ventilator-associated pneumonia. Different CPE colonization sites and resistance genes require different clinical treatment drugs. Therefore, based on the widespread trend of CPE and the need for precision medication, accurate and economical detection methods are currently needed. The clinical detection process of CPE is to determine whether it is carbapenem-resistant Enterobacteriaceae (CRE) through conventional drug sensitivity tests (such as paper diffusion method), and then report the results through phenotypic or genotypic detection methods. Phenotypic detection methods such as modified carbapenemin activation method (mCIM), ethylenediaminetetraacetic acid (EDTA) modified carbapenemin inactivation test (EDTA-carbapenemin activation method, eCIM) and carbapenemase inhibitor enhancement test cannot determine the specific genotype, and when the strain contains both serine enzyme and metalloenzyme resistance genes, mCIM / eCIM cannot distinguish the resistance genes. Genotyping methods include molecular biology and colloidal gold immunochromatography. Molecular biology requires downstream observation methods such as agarose gel electrophoresis or Sanger sequencing. Agarose gel electrophoresis has low sensitivity, while Sanger sequencing is expensive and takes a long time. Colloidal gold immunochromatography is expensive and not suitable for large-scale screening.

[0004] Based on the above-mentioned clinical demand for detection technology and the limitations of existing detection technology, the polymerase chain reaction (PCR) is combined with the PfAgo nuclease cleavage to ensure the accuracy of the detection while making the results easier to read. Argonaute protein was first discovered in eukaryotes and is a key role in the RNA interference pathway. Prokaryotic Ago protein is a homolog of eukaryotic Ago protein, using ssDNA or RNA with a phosphate group at the 5' end as a guide to target and cut the nucleotide sequence that is complementary to it. The PfAgo selected in the present invention is the abbreviation of "Pyrococcusfuriosus Argonaute protein", which is a thermostable nuclease derived from Pyrococcus furiosus. At 95°C, ssDNA modified with a phosphate group at the 5' end is used as a guide to target and cut the ssDNA that is complementary to it. The cutting action of PfAgo nuclease is specific and depends on the principle of base complementary pairing. Its cutting site is located between the 10th and 11th bases from the 5' end of the guide. Therefore, based on the defects of existing clinical detection technologies and the action characteristics of PfAgo nuclease, the present invention constructs a multi-channel detection for carbapenemase-producing Enterobacteriaceae resistance genes, and simultaneously detects three types of resistance genes, KPC type, NDM type and VIM type.

[0005] like Figure 1 As shown in the figure, the cleavage of PfAgo nuclease is applied to the multi-channel detection of carbapenemase-producing Enterobacteriaceae resistance genes. The detection process includes two rounds of cleavage. The primary cleavage is the cleavage of the primary template (i.e., the detection object). The guide DNA (gDNA) recognizes the target to be cleaved through base complementary pairing. Under the traction of gDNA, the PfAgo nuclease cleaves the phosphodiester bond between the 10th and 11th bases of the target (the position is calculated from the 5' end of gDNA). The 16nt ssDNA cleavage product obtained by primary cleavage can replace the primary gDNA and bind to the PfAgo nuclease as a secondary gDNA to cleave the molecular beacon that is complementary to it. The cleavage principle is the same as the primary cleavage. After the molecular beacon is cleaved, the quenching group loses its quenching effect on the fluorescent group, and the detection result can be reported. Since the two rounds of cleavage of PfAgo nuclease are both based on the principle of base complementary pairing, it is highly specific and will not cross-react when multiple detections are performed. Summary of the invention

[0006] The object of the present invention is to provide a multi-channel rapid detection method and kit for carbapenemase-producing Enterobacteriaceae resistance genes based on PfAgo nuclease.

[0007] To achieve the above-mentioned purpose and other related purposes, the technical solution provided by the present invention is: a kit for a single-channel rapid detection method of five drug resistance genes of carbapenemase-producing Enterobacteriaceae based on PfAgo nuclease, the kit comprising:

[0008] Three sets of PCR amplification primers:

[0009] KPC-for:5'-GCCGTGCAATACAGTGATAAC-3';

[0010] KPC-rev:5'-TAGAGCGCATGAAGGCCGTCA-3';

[0011] NDM-for:5'-CACGCGCATCAGGACAAGATG-3';

[0012] NDM-rev: 5'-GTCAGGCTGTGTTGCGCCGCA-3';

[0013] VIM-for:5'-TCGCAACGCAGTCGTTTGATG-3';

[0014] VIM-rev:5'-TTCGCACCCCACGCTGTATC-3';

[0015] Three groups of gDNA for PfAgo nuclease specificity detection:

[0016] KPC-gDNA1: 5'-CCGCCGCCAATTTGTT-3';

[0017] KPC-gDNA2: 5'-GCTGAAGGAGTTGGGC-3';

[0018] KPC-gDNA3: 5'-GGCCGCCCAACTCCTT-3';

[0019] NDM-gDNA1: 5'-ATTGCGACTTATGCCA-3';

[0020] NDM-gDNA2: 5'-ATGCGTTGTCGAACCA-3';

[0021] NDM-gDNA3: 5'-AAGCTGGTTCGACAAC-3';

[0022] VIM-gDNA1: 5'-AATGGTCTCATTGTCC-3';

[0023] VIM-gDNA2: 5'-GTGATGGTGATGAGTT-3';

[0024] VIM-gDNA3: 5'-AAGCAACTCATCACCA-3';

[0025] DNA Molecular Beacons:

[0026] KPC-ROX: 5'-ROX-cgcaccTTTGTTGCTGAAGGAGggtgcg-BHQ2 -3';

[0027] NDM-VIC: 5'-VIC-cgcaccATGCCAATGCGTTGTCggtgcg-BHQ1 -3';

[0028] VIM-FAM: 5'-FAM-cgcaccTTGTCCGTGATGGTGAggtgcg-BHQ1-3'.

[0029] The preferred technical solution is: further comprising: 5×OneTaq Standard Reaction Buffer, dNTP Mix, OneTaq DNA Polymerase, and enzyme-free water.

[0030] The preferred technical solution is: it also includes: 10×reaction buffer and MnCl2.

[0031] To achieve the above-mentioned purpose and other related purposes, the technical solution provided by the present invention is: a single-channel rapid detection method for five drug resistance genes of carbapenemase-producing Enterobacteriaceae based on PfAgo nuclease, comprising the following steps:

[0032] Step 1: Immerse the colony to be tested in bacterial lysis solution, centrifuge and take the supernatant after the reaction to obtain the nucleic acid to be tested;

[0033] Step 2: Prepare PCR reaction mixture: mix 10 μL of 5×OneTaq Standard Reaction Buffer, 1 μL of dNTP Mix, 0.25 μL of OneTaq DNA Polymerase, 2 μL of KPC-for, 2 μL of KPC-rev, 2 μL of NDM-for, 2 μL of NDM-rev, 2 μL of VIM-for, 2 μL of VIM-rev, 21.75 μL of enzyme-free water and 5 μL of nucleic acid to be tested, cover the reaction tube with a cap, and then perform amplification reaction to obtain a nucleic acid amplification product;

[0034] KPC-for:5'-GCCGTGCAATACAGTGATAAC-3';

[0035] KPC-rev:5'-TAGAGCGCATGAAGGCCGTCA-3';

[0036] NDM-for:5'-CACGCGCATCAGGACAAGATG-3';

[0037] NDM-rev: 5'-GTCAGGCTGTGTTGCGCCGCA-3';

[0038] VIM-for:5'-TCGCAACGCAGTCGTTTGATG-3';

[0039] VIM-rev:5'-TTCGCACCCCACGCTGTATC-3';

[0040] Step 3: Prepare PfAgo reaction mixture: 3.8 μL of 10× reaction buffer, 1.9 μL of 40 mM MnCl2 solution, 1.71 μL of 100 μM KPC-gDNA1, NDM-gDNA1, VIM-gDNA1, 1.71 μL of 100 μM KPC-gDNA2, NDM-gDNA2, VIM-gDNA2, 1.71 μL of 100 μM KPC-gDNA3, NDM-gDNA3, VIM-gDNA3, 2.97 μL of 64 μM PfAgo nuclease, 0.5 μL of 100 μM KPC-ROX, NDM-VIC and VIM-FAM and 3.7 μL of enzyme-free water;

[0041] KPC-gDNA1: 5'-CCGCCGCCAATTTGTT-3';

[0042] KPC-gDNA2: 5'-GCTGAAGGAGTTGGGC-3';

[0043] KPC-gDNA3: 5'-GGCCGCCCAACTCCTT-3';

[0044] NDM-gDNA1: 5'-ATTGCGACTTATGCCA-3';

[0045] NDM-gDNA2: 5'-ATGCGTTGTCGAACCA-3';

[0046] NDM-gDNA3: 5'-AAGCTGGTTCGACAAC-3';

[0047] VIM-gDNA1: 5'-AATGGTCTCATTGTCC-3';

[0048] VIM-gDNA2: 5'-GTGATGGTGATGAGTT-3';

[0049] VIM-gDNA3: 5'-AAGCAACTCATCACCA-3';

[0050] KPC-ROX: 5'-ROX-cgcaccTTTGTTGCTGAAGGAGggtgcg-BHQ2 -3';

[0051] NDM-VIC: 5'-VIC-cgcaccATGCCAATGCGTTGTCggtgcg-BHQ1 -3';

[0052] VIM-FAM: 5'-FAM-cgcaccTTGTCCGTGATGGTGAggtgcg-BHQ1 -3';

[0053] Step 4: Take 20 μL of the nucleic acid amplification product obtained in step 2 and add it to the PfAgo reaction mixture prepared in step 3, incubate at 95°C for 30 minutes; judge by the following method:

[0054] At the beginning of the PfAgo reaction incubation, the fluorescence values ​​under the ROX, VIC and FAM channels were read using a qPCR instrument. The cells were incubated at 95°C for 15 cycles, with an interval of 2 minutes between each cycle. The fluorescence signal was recorded once at the end of each cycle, and the detection result of each drug-resistant gene was determined by the final fluorescence signal intensity. For the ROX channel, a fluorescence value greater than 6000 indicates that the corresponding site is positive, and a fluorescence value less than 5000 indicates that the corresponding site is negative. If the fluorescence value is between 5000-6000, the test is repeated. If the fluorescence value is still between 5000-6000, the corresponding site is determined to be positive. For the VIC channel, a fluorescence value greater than 6000 represents a positive detection of the corresponding site, and a fluorescence value less than 5000 represents a negative detection of the corresponding site. If the fluorescence value is between 5000-6000, the test is repeated. If the fluorescence value is still between 5000-6000, the corresponding site is determined to be positive. For the FAM channel, a fluorescence value greater than 4000 represents a positive detection of the corresponding site, and a fluorescence value less than 3500 represents a negative detection of the corresponding site. If the fluorescence value is between 3500-4000, the test is repeated. If the fluorescence value is still between 3500-4000, the corresponding site is determined to be positive.

[0055] The preferred technical solution is: the reaction procedure of step 2 is: initial denaturation at 94°C for 2 minutes, followed by 34 cycles, including denaturation: 94°C, 30s; annealing: 55°C, 30s; and extension: 68°C, 8s, with extension at 68°C for 5 minutes at the end of the cycle.

[0056] Due to the application of the above technical solution, the present invention has the following advantages compared with the prior art:

[0057] The present invention overcomes the shortcomings of traditional detection methods for drug-resistant bacteria, such as the inability to determine the genotype and the long time required. It combines PCR amplification technology with PfAgo cleavage to perform multi-channel detection of three different resistant genotypes of carbapenem-producing Enterobacteriaceae while ensuring sensitivity and specificity. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] Figure 1 This is the process and principle of the PfAgo multi-channel detection method.

[0059] Figure 2 This is a feasibility verification of the PfAgo multi-channel detection method.

[0060] Figure 3 Optimize nuclease concentration in the PfAgo multichannel detection method.

[0061] Figure 4 This is a sensitivity verification of the PfAgo multi-channel detection method.

[0062] Figure 5 For detection of combined plasmid samples.

[0063] Figure 6 Verified with actual samples. DETAILED DESCRIPTION

[0064] The following is a description of the implementation of the present invention by means of specific embodiments. Those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in the embodiments.

[0065] See also Figure 1-6 . It should be noted that the structures, proportions, sizes, etc. illustrated in the drawings of this specification are only used to match the contents disclosed in the specification for people familiar with this technology to understand and read, and are not used to limit the limiting conditions under which the present invention can be implemented. Therefore, they have no substantive technical significance, and any structural modification, change in proportional relationship or adjustment of size. The following examples are provided to better understand the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are all conventional methods unless otherwise specified. The experimental materials used in the following examples are all purchased from conventional biochemical reagent stores unless otherwise specified.

[0066] The technical solution of the present invention is further described in detail below with reference to examples.

[0067] Example 1: A multi-channel rapid detection method and kit for carbapenemase-producing Enterobacteriaceae resistance genes based on PfAgo nuclease

[0068] Kit includes:

[0069] Three sets of PCR amplification primers:

[0070] KPC-for:5'-GCCGTGCAATACAGTGATAAC-3';

[0071] KPC-rev:5'-TAGAGCGCATGAAGGCCGTCA-3';

[0072] NDM-for:5'-CACGCGCATCAGGACAAGATG-3';

[0073] NDM-rev: 5'-GTCAGGCTGTGTTGCGCCGCA-3';

[0074] VIM-for:5'-TCGCAACGCAGTCGTTTGATG-3';

[0075] VIM-rev:5'-TTCGCACCCCACGCTGTATC-3';

[0076] Three groups of gDNA for PfAgo nuclease specificity detection:

[0077] KPC-gDNA1: 5'-CCGCCGCCAATTTGTT-3';

[0078] KPC-gDNA2: 5'-GCTGAAGGAGTTGGGC-3';

[0079] KPC-gDNA3: 5'-GGCCGCCCAACTCCTT-3';

[0080] NDM-gDNA1: 5'-ATTGCGACTTATGCCA-3';

[0081] NDM-gDNA2: 5'-ATGCGTTGTCGAACCA-3';

[0082] NDM-gDNA3: 5'-AAGCTGGTTCGACAAC-3';

[0083] VIM-gDNA1: 5'-AATGGTCTCATTGTCC-3';

[0084] VIM-gDNA2: 5'-GTGATGGTGATGAGTT-3';

[0085] VIM-gDNA3: 5'-AAGCAACTCATCACCA-3';

[0086] DNA Molecular Beacons:

[0087] KPC-ROX: 5'-ROX-cgcaccTTTGTTGCTGAAGGAGggtgcg-BHQ2 -3';

[0088] NDM-VIC: 5'-VIC-cgcaccATGCCAATGCGTTGTCggtgcg-BHQ1 -3';

[0089] VIM-FAM: 5'-FAM-cgcaccTTGTCCGTGATGGTGAggtgcg-BHQ1 -3';

[0090] The preferred technical solution is: further comprising 5×OneTaq Standard Reaction Buffer, dNTPs; 5×OneTaq Standard Reaction Buffer: 5mM Mg 2+ ; Deoxynucleotide (dNTP) Solution Mix: 2.5mM each of dATP, dGTP, dCTP, and dTTP.

[0091] The preferred technical solution is: it also includes 10×reaction buffer (1M NaCl, 150mM Tris-HCl, pH8.0) and 2mM MnCl2.

[0092] like Figure 1As shown in the figure, the principle of the multi-channel rapid detection method of carbapenemase-producing Enterobacteriaceae resistance genes based on PfAgo nuclease is demonstrated. First, the clinical sample is cultured, and then the cultured colony is amplified by PCR to amplify the signal to be detected. The obtained amplified product is added to the configured PfAgo detection system. Under the guidance of gDNA, the PfAgo nuclease recognizes the respective target nucleic acid and plays a cutting role. gDNA is a 16nt ssDNA with a phosphate group at the 5' end. As shown in the figure, the PfAgo nuclease first cuts the target complementary to it under the guidance of gDNA to obtain a 16nt cleavage product, which can be used as its secondary gDNA, and then cuts the molecular beacon complementary to it. The quenching group loses its quenching effect on the fluorescent group, and is collected by a fluorescence collection instrument.

[0093] A multi-channel rapid detection method and kit for carbapenemase-producing Enterobacteriaceae resistance genes based on PfAgo nuclease, comprising the following technical steps:

[0094] (1) Clinical sample culture

[0095] The collected clinical samples were spread on blood agar plate culture medium and cultured at 37℃ for 12h to obtain single colonies. A single colony was picked and placed in 50μL Lysis Buffer, heat denatured at 80℃ for 15 minutes, centrifuged at 6000g for 3 minutes, and the supernatant was stored at -20℃ for subsequent amplification template.

[0096] (2) PCR primer design

[0097] PCR (Polymerase chain reaction) is a nucleic acid synthesis technology that uses the principle of DNA double-strand replication to replicate specific DNA fragments in vitro. PCR is based on the principle of DNA semi-conservative replication and the principle of base complementary pairing, that is, during the replication process, double-stranded DNA will unwind and turn from double-stranded to single-stranded, and the temperature is generally 95°C; then the temperature drops, the primer will bind to the single-stranded DNA, and under the action of DNA polymerase, the free dNTP will bind to the single-stranded DNA according to the principle of base complementary pairing, forming a new double-stranded DNA hybridized by the old chain and the new chain. This process can be summarized as the three basic steps of "denaturation-annealing-extension". The PCR reaction is the first step in the PfAgo detection method, which plays a role in amplifying the signal and thus improving the detection sensitivity.

[0098] The design of PCR primers follows the following principles: 1. The primer length is 20-30 bases; 2. The GC content of the primer is 40%<GC<60%; 3. The length of the amplified product ranges from 70bp to 150bp; upstream and downstream primers are designed around the detection site.

[0099] Three sets of PCR amplification primers:

[0100] KPC-for:5'-GCCGTGCAATACAGTGATAAC-3';

[0101] KPC-rev:5'-TAGAGCGCATGAAGGCCGTCA-3';

[0102] NDM-for:5'-CACGCGCATCAGGACAAGATG-3';

[0103] NDM-rev: 5'-GTCAGGCTGTGTTGCGCCGCA-3';

[0104] VIM-for:5'-TCGCAACGCAGTCGTTTGATG-3';

[0105] VIM-rev:5'-TTCGCACCCCACGCTGTATC-3';

[0106] (3) PCR nucleic acid amplification

[0107] Use NEB's OneTaq DNA Polymerase Kit and corresponding PCR primers to amplify the extracted colony nucleic acid. The specific steps are as follows:

[0108] Prepare 50 μL of PCR reaction mixture: mix 10 μL of 5×OneTaq Standard Reaction Buffer, 1 μL of dNTP Mix, 0.25 μL of OneTaq DNA Polymerase, 6 μL of Primer-for (i.e., 2 μL each of KPC-for, NDM-for, and VIM-for), 6 μL of Primer-rev (i.e., 2 μL each of KPC-rev, NDM-rev, and VIM-rev), 21.75 μL of enzyme-free water, and 5 μL of the nucleic acid to be tested, cover the reaction tube with a cap, and then perform an amplification reaction to obtain a nucleic acid amplification product.

[0109] The reaction procedure is:

[0110] The initial denaturation was at 94°C for 2 min, followed by 34 cycles of denaturation (94°C, 30 s), annealing (55°C, 30 s), and extension (68°C, 8 s), ending with an extension at 68°C for 5 min.

[0111] (4) Design of PfAgo detection method sites

[0112] Design of gDNA for detection: The gDNA that guides the PfAgo nuclease to perform cleavage must contain a phosphate group at the 5' end, and there are no special requirements for the sequence. Therefore, the sequence of the CPE resistance gene was aligned by Multiple Alignment using Fast Fourier Transform (MAFFT) to obtain the conserved regions of the three genotypes of KPC, NDM and VIM, and gDNA was designed within the conserved regions.

[0113] The detection sites finally designed by the present invention are as follows:

[0114] Three groups of gDNA for PfAgo nuclease specificity detection:

[0115] KPC-gDNA1: 5'-CCGCCGCCAATTTGTT-3';

[0116] KPC-gDNA2: 5'-GCTGAAGGAGTTGGGC-3';

[0117] KPC-gDNA3: 5'-GGCCGCCCAACTCCTT-3';

[0118] NDM-gDNA1: 5'-ATTGCGACTTATGCCA-3';

[0119] NDM-gDNA2: 5'-ATGCGTTGTCGAACCA-3';

[0120] NDM-gDNA3: 5'-AAGCTGGTTCGACAAC-3';

[0121] VIM-gDNA1: 5'-AATGGTCTCATTGTCC-3';

[0122] VIM-gDNA2: 5'-GTGATGGTGATGAGTT-3';

[0123] VIM-gDNA3: 5'-AAGCAACTCATCACCA-3';

[0124] (5) Configure the PfAgo reaction system

[0125] Prepare the PfAgo detection system using the following ingredients, volumes, and concentrations:

[0126] The PfAgo reaction mixture configuration system is as follows:

[0127] Components concentration volume source RNase-free water - 3.7μL Thermo Fisher Reaction buffer 10× 3.8μL - <![CDATA[Mn 2+ ]]> 40mM 1.9μL Merck KPC-gDNA1 100μM 0.57μL Shanghai Bioengineering KPC-gDNA2 100μM 0.57μL Shanghai Bioengineering KPC-gDNA3 100μM 0.57μL Shanghai Bioengineering NDM-gDNA1 100μM 0.57μL Shanghai Bioengineering NDM-gDNA2 100μM 0.57μL Shanghai Bioengineering NDM-gDNA3 100μM 0.57μL Shanghai Bioengineering VIM-gDNA1 100μM 0.57μL Shanghai Bioengineering VIM-gDNA2 100μM 0.57μL Shanghai Bioengineering VIM-gDNA3 100μM 0.57μL Shanghai Bioengineering PfAgo 64μM 2.97μL - KPC-ROX 100μM 0.1μL Nanjing Qingke NDM-VIC 100μM 0.2μL Nanjing Qingke VIM-FAM 100μM 0.2μL Nanjing Qingke total - 18μL -

[0128] KPC-ROX: 5'-ROX-cgcaccTTTGTTGCTGAAGGAGggtgcg-BHQ2 -3';

[0129] NDM-VIC: 5'-VIC-cgcaccATGCCAATGCGTTGTCggtgcg-BHQ1 -3';

[0130] VIM-FAM: 5'-FAM-cgcaccTTGTCCGTGATGGTGAggtgcg-BHQ1 -3';

[0131] Take 18 μL of the detection system, add 20 μL of the amplification product thereto, and react at 95°C.

[0132] (6) Fluorescence detection and result reading of PfAgo detection method

[0133] At the beginning of the PfAgo reaction incubation, a qPCR instrument (Bio-Rad CFX96) was used to read the fluorescence values ​​under the ROX, VIC and FAM channels, and incubated at 95°C for 15 cycles, with an interval of 2 minutes between each cycle. The fluorescence signal was recorded once at the end of each cycle, and the final fluorescence signal intensity was used to determine the detection results of each drug-resistant gene. For the ROX channel, a fluorescence value greater than 6000 represents a positive detection of the corresponding site, and a fluorescence value less than 5000 represents a negative detection of the corresponding site. If the fluorescence value is between 5000-6000, it is re-tested. If the fluorescence value is still between 5000-6000, the corresponding site is determined to be positive. For the VIC channel, a fluorescence value greater than 6000 represents a positive detection of the corresponding site, and a fluorescence value less than 5000 represents a negative detection of the corresponding site. If the fluorescence value is between 5000-6000, it is re-tested. If the fluorescence value is still between 5000-6000, the corresponding site is determined to be positive. For the FAM channel, a fluorescence value greater than 4000 indicates that the corresponding site is positive, and a fluorescence value less than 3500 indicates that the corresponding site is negative. If the fluorescence value is between 3500-4000, the test is repeated. If the fluorescence value is still between 3500-4000, the corresponding site is judged to be positive.

[0134] Example 2: Example 2 uses the same detection method and process as Example 1, except that the detection sample in Example 2 is sewage, and the sample processing steps before PCR amplification are different.

[0135] (1) Sample culture, taking sewage as an example

[0136] Store the sample in a sterile tube, take 100 μL of the sample and culture it in the culture medium at 37°C for 12 hours to obtain a single colony. Pick a single colony and place it in 50 μL Lysis Buffer, heat denature at 80°C for 15 minutes, centrifuge at 6000g for 3 minutes, take the supernatant and store it at -20°C for subsequent amplification template.

[0137] Example 3: Example 3 uses the same detection method and process as Example 1, except that the detection sample in Example 3 is meat, and the sample processing steps before PCR amplification are different.

[0138] (1) Sample culture, taking meat as an example

[0139] 25g of each meat sample was mixed with 225mL of buffered peptone water (BO1332S, Thermo Fisher), and then incubated at 37°C for 18-22 hours. The enriched sample was placed on a solid culture medium and cultured at 37°C for 12 hours to obtain a single colony. A single colony was picked and placed in 50μL Lysis Buffer, heat denatured at 80°C for 15 minutes, centrifuged at 6000g for 3 minutes, and the supernatant was stored at -20°C for subsequent amplification template.

[0140] A multi-channel rapid detection method for carbapenemase-producing Enterobacteriaceae resistance genes based on PfAgo nuclease was established

[0141] 1. Materials

[0142] PCR amplification primers and single-stranded probes were synthesized by Nanjing Qingke Biotechnology Co., Ltd.; gDNA was synthesized by Shanghai Sangon Biotechnology Co., Ltd.; OneTaq DNA Polymerase Kit (NEB, M0480L) was purchased from NEB; MnCl2 (Sigma-merck, M1787) was purchased from Merck; Lysis buffer (Takara, Code No. 9164) was purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.; PfAgo nuclease was purified in the laboratory and 10× reaction buffer was prepared in the laboratory.

[0143] 2. Methods and Results

[0144] 2.1 Design of PCR primers

[0145] According to the sequences of different CPE resistance genes published in NCBI, the sequences were aligned by Multiple Alignment using Fast Fourier Transform (MAFFT) to obtain the conserved regions of each resistance gene, and PCR primers were designed in the conserved regions. The specific sequences are shown in the following table:

[0146] PCR primer name Sequence (5'-3') KPC-for GCCGTGCAATACAGTGATAAC KPC-rev TAGAGCGCATGAAGGCCGTCA NDM-for CACGCGCATCAGGACAAGATG NDM-rev GTCAGGCTGTGTTGCGCCGCA VIM-for TCGCAACGCAGTCGTTTGATG VIM-rev TTCGCACCCCACGCTGTATC

[0147] 2.2gDNA Design

[0148] In order to ensure the universality of the selected sites and avoid false negatives caused by mutations in the same drug-resistant gene, the gDNA is also designed within the conserved sequence region of each gene. In addition, the gDNA of the PfAgo nuclease must contain a phosphate group at the 5' end, and there are no special requirements for the sequence.

[0149] The gDNA detection sites finally designed by the present invention are as follows:

[0150] KPC-gDNA1: 5'-CCGCCGCCAATTTGTT-3';

[0151] KPC-gDNA2: 5'-GCTGAAGGAGTTGGGC-3';

[0152] KPC-gDNA3: 5'-GGCCGCCCAACTCCTT-3';

[0153] NDM-gDNA1: 5'-ATTGCGACTTATGCCA-3';

[0154] NDM-gDNA2: 5'-ATGCGTTGTCGAACCA-3';

[0155] NDM-gDNA3: 5'-AAGCTGGTTCGACAAC-3';

[0156] VIM-gDNA1: 5'-AATGGTCTCATTGTCC-3';

[0157] VIM-gDNA2: 5'-GTGATGGTGATGAGTT-3';

[0158] VIM-gDNA3: 5'-AAGCAACTCATCACCA-3';

[0159] 2.3 Feasibility verification of PfAgo detection method

[0160] In order to successfully construct a multi-channel rapid detection method for carbapenemase-producing Enterobacteriaceae resistance genes based on PfAgo nuclease, it is first necessary to verify whether the detection system is feasible, that is, whether there is cross-reaction when detecting three resistance genes. Therefore, the three genotypes of KPC, NDM and VIM were tested separately to observe the test results. The experimental results of feasibility verification are shown in Figure 2 .

[0161] 2.4 Optimization of nuclease concentration in PfAgo detection method

[0162] After verifying the feasibility of the multi-channel rapid detection method, the reaction system was optimized. The most important part of the system is the PfAgo nuclease that plays a cutting role. Therefore, when the final concentration of PfAgo nuclease is set to 5μM, 6μM, 8μM, 10μM, and 12μM, the detection fluorescence value is compared with the background fluorescence value to select the best nuclease concentration. The results of the PfAgo nuclease concentration optimization are shown in Figure 3 .

[0163] 2.5 Sensitivity verification of PfAgo detection method

[0164] In order to explore the sensitivity of the multi-channel detection method for detecting three drug-resistant genes at the same time, the plasmid standards containing three drug-resistant genes were first diluted 10 times, 10 5 , 10 4 , 10 3 , 10 2 , 50, and 10 copies / μL. The results showed that the detection limit of the multi-channel detection method for the simultaneous detection of three drug-resistant gene plasmid standards was: all of which could reach 10 2 copies / μL.

[0165] The results of sensitivity verification are shown in Figure 4 .

[0166] 2.6 Detection of combined plasmid samples

[0167] In order to further verify the performance of the detection method, the plasmid standards of the three drug resistance genes were combined and diluted to 10 3 copies / μL, in order to explore the detection performance of this method. The detection results of the combined plasmid samples are shown in Figure 5 .

[0168] 2.7 Actual Sample Verification

[0169] The PfAgo multi-channel detection method was used to detect 29 CPE clinical samples. The 29 collected CPE clinical samples were cultured, and the PCR primers mentioned in the present invention were used to amplify the nucleic acid after colony treatment. A 20 μL volume of the amplified PCR product was added to the prepared 18 μL PfAgo detection system. At the beginning of the PfAgo reaction incubation, a qPCR instrument was used to read the fluorescence values ​​under the ROX, VIC and FAM channels. The reaction was incubated at 95°C for 15 cycles, with an interval of 2 minutes between each cycle. The fluorescence signal was recorded once at the end of each cycle, and the final fluorescence signal intensity was used to determine the detection results of each drug-resistant gene. The results of the 29 clinical samples detected using the PfAgo detection method were consistent with the clinical verification results. Figure 6 shown.

[0170] Figure 1 :Process and principle of PfAgo detection method

[0171] That is, the colonies after sample culture are first processed to obtain nucleic acid, and then PCR primers are used to perform PCR amplification on the detection site. Finally, the obtained PCR product is added to the prepared PfAgo reaction system, incubated at 95°C for 30 minutes, and at the beginning of incubation, the fluorescence values ​​under the ROX, VIC and FAM channels are read by the qPCR instrument to obtain the test results.

[0172] Figure 2 :Feasibility verification of PfAgo detection method

[0173] In order to verify the feasibility of this detection method, the amplified products of KPC, NDM and VIM type resistance genes were added using the multi-channel PfAgo detection system. Figure 2 This demonstrates that the detection method is feasible.

[0174] Figure 3 : Optimization of nuclease concentration in PfAgo detection method

[0175] In this example, the final concentration of PfAgo nuclease was set to 5 μM, 6 μM, 8 μM, 10 μM, and 12 μM, and the concentration was optimized. The results after optimization are as follows: Figure 3 shown.

[0176] Figure 4 :Sensitivity validation of PfAgo detection method

[0177] After determining the nucleic acid concentration in the PfAgo detection method, the plasmid standard containing three drug resistance genes was diluted 10 times, respectively, 5 , 10 4 , 10 3 , 10 2 , 50, and 10 copies / μL. The PfAgo detection method was used to detect the diluted templates of different concentrations to verify the sensitivity of the detection method. As can be seen from the figure, the sensitivity of the multi-channel detection method based on PfAgo nuclease can reach 10 2 copies / μL.

[0178] Figure 5 :Detection of combined plasmid samples

[0179] The performance of the PfAgo multi-channel detection method was further demonstrated by different combinations of three CPE resistance gene plasmid samples.

[0180] Figure 6 :Actual sample verification

[0181] The PfAgo multi-channel detection method was used to detect 29 CPE clinical samples, and the test results were consistent with the clinical verification results.

[0182] The above description is only used to explain the preferred embodiments of the present invention, and is not intended to limit the present invention in any form. Therefore, any modifications or changes made to the present invention under the same inventive spirit should still be included in the scope of protection intended by the present invention.

Claims

1. A multi-channel rapid detection method and kit for carbapenemase-producing Enterobacteriaceae resistance genes based on PfAgo nuclease, characterized in that: The kit comprises: Three sets of PCR amplification primers: KPC-for:5'-GCCGTGCAATACAGTGATAAC-3'; KPC-rev:5'-TAGAGCGCATGAAGGCCGTCA-3'; NDM-for:5'-CACGCGCATCAGGACAAGATG-3'; NDM-rev: 5'-GTCAGGCTGTGTTGCGCCGCA-3'; VIM-for:5'-TCGCAACGCAGTCGTTTGATG-3'; VIM-rev:5'-TTCGCACCCCACGCTGTATC-3'; Three groups of gDNA for PfAgo nuclease specificity detection: KPC-gDNA1: 5'-CCGCCGCCAATTTGTT-3'; KPC-gDNA2: 5'-GCTGAAGGAGTTGGGC-3'; KPC-gDNA3: 5'-GGCCGCCCAACTCCTT-3'; NDM-gDNA1: 5'-ATTGCGACTTATGCCA-3'; NDM-gDNA2: 5'-ATGCGTTGTCGAACCA-3'; NDM-gDNA3: 5'-AAGCTGGTTCGACAAC-3'; VIM-gDNA1: 5'-AATGGTCTCATTGTCC-3'; VIM-gDNA2: 5'-GTGATGGTGATGAGTT-3'; VIM-gDNA3: 5'-AAGCAACTCATCACCA-3'; DNA Molecular Beacons: KPC-ROX: 5'-ROX-cgcaccTTTGTTGCTGAAGGAGggtgcg-BHQ2-3'; NDM-VIC: 5'-VIC-cgcaccATGCCAATGCGTTGTCggtgcg-BHQ1-3'; VIM-FAM: 5'-FAM-cgcaccTTGTCCGTGATGGTGAggtgcg-BHQ1-3'.

2. The kit for the multi-channel rapid detection of carbapenemase-producing Enterobacteriaceae resistance genes based on PfAgo nuclease according to claim 1, characterized in that: Also includes: 5×OneTaq Standard Reaction Buffer, dNTP Mix, OneTaq DNA Polymerase, enzyme-free water.

3. The kit for the multi-channel rapid detection of carbapenemase-producing Enterobacteriaceae resistance genes based on PfAgo nuclease according to claim 1, characterized in that: Also includes: 10×reaction buffer, MnCl2.

4. A single-channel rapid detection method for five drug resistance genes of carbapenemase-producing Enterobacteriaceae based on PfAgo nuclease, characterized by: The following steps are involved: Step 1: Immerse the colony to be tested in bacterial lysis solution, centrifuge after reaction and take the supernatant to obtain the nucleic acid to be tested; Step 2: Prepare PCR reaction mixture: mix 10 μL of 5×OneTaq Standard Reaction Buffer, 1 μL of dNTP Mix, 0.25 μL of OneTaq DNA Polymerase, 2 μL of KPC-for, 2 μL of KPC-rev, 2 μL of NDM-for, 2 μL of NDM-rev, 2 μL of VIM-for, 2 μL of VIM-rev, 21.75 μL of enzyme-free water and 5 μL of nucleic acid to be tested, cover the reaction tube with a cap, and then perform amplification reaction to obtain a nucleic acid amplification product; KPC-for:5'-GCCGTGCAATACAGTGATAAC-3'; KPC-rev:5'-TAGAGCGCATGAAGGCCGTCA-3'; NDM-for:5'-CACGCGCATCAGGACAAGATG-3'; NDM-rev: 5'-GTCAGGCTGTGTTGCGCCGCA-3'; VIM-for:5'-TCGCAACGCAGTCGTTTGATG-3'; VIM-rev:5'-TTCGCACCCCACGCTGTATC-3'; Step 3: Prepare PfAgo reaction mixture: 3.8 μL of 10× reaction buffer, 1.9 μL of 40 mM MnCl2 solution, 1.71 μL of 100 μM KPC-gDNA1, NDM-gDNA1, VIM-gDNA1, 1.71 μL of 100 μM KPC-gDNA2, NDM-gDNA2, VIM-gDNA2, 1.71 μL of 100 μM KPC-gDNA3, NDM-gDNA3, VIM-gDNA3, 2.97 μL of 64 μM PfAgo nuclease, 0.5 μL of 100 μM KPC-ROX, NDM-VIC and VIM-FAM and 3.7 μL of enzyme-free water; KPC-gDNA1: 5'-CCGCCGCCAATTTGTT-3'; KPC-gDNA2: 5'-GCTGAAGGAGTTGGGC-3'; KPC-gDNA3: 5'-GGCCGCCCAACTCCTT-3'; NDM-gDNA1: 5'-ATTGCGACTTATGCCA-3'; NDM-gDNA2: 5'-ATGCGTTGTCGAACCA-3'; NDM-gDNA3: 5'-AAGCTGGTTCGACAAC-3'; VIM-gDNA1: 5'-AATGGTCTCATTGTCC-3'; VIM-gDNA2: 5'-GTGATGGTGATGAGTT-3'; VIM-gDNA3: 5'-AAGCAACTCATCACCA-3'; KPC-ROX: 5'-ROX-cgcaccTTTGTTGCTGAAGGAGggtgcg-BHQ2-3'; NDM-VIC: 5'-VIC-cgcaccATGCCAATGCGTTGTCggtgcg-BHQ1-3'; VIM-FAM: 5'-FAM-cgcaccTTGTCCGTGATGGTGAggtgcg-BHQ1-3'; Step 4: Take 20 μL of the nucleic acid amplification product obtained in step 2 and add it to the PfAgo reaction mixture prepared in step 3, incubate at 95°C for 30 minutes; judge by the following method: At the beginning of the PfAgo reaction incubation, the fluorescence values ​​under the ROX, VIC and FAM channels were read using a qPCR instrument. The cells were incubated at 95°C for 15 cycles with an interval of 2 minutes between each cycle. The fluorescence signal was recorded once at the end of each cycle. The final fluorescence signal intensity was used to determine the detection result of each drug-resistant gene. For the ROX channel, a fluorescence value greater than 6000 represents a positive detection of the corresponding site, and a fluorescence value less than 5000 represents a negative detection of the corresponding site. If the fluorescence value is between 5000-6000, it is re-tested. If the fluorescence value is still between 5000-6000, it is determined that the corresponding site is positive. For the VIC channel, a fluorescence value greater than 6000 represents a positive detection of the corresponding site, and a fluorescence value less than 5000 represents a negative detection of the corresponding site. If the fluorescence value is between 5000-6000, it is re-tested. If the fluorescence value is still between 5000-6000, it is determined that the corresponding site is positive. For the FAM channel, a fluorescence value greater than 4000 represents a positive detection of the corresponding site, and a fluorescence value less than 3500 represents a negative detection of the corresponding site. If the fluorescence value is between 3500-4000, it is re-tested. If the fluorescence value is still between 3500-4000, it is determined that the corresponding site is positive.

5. The single-channel rapid detection method for five drug resistance genes of carbapenemase-producing Enterobacteriaceae based on PfAgo nuclease according to claim 3, characterized in that: The reaction program of step 2 was: initial denaturation at 94°C for 2 minutes, followed by 34 cycles including denaturation: 94°C for 30 seconds; annealing: 55°C for 30 seconds; and extension: 68°C for 8 seconds, with extension at 68°C for 5 minutes at the end of the cycle.

Images