A urine preservative and use thereof
By adding specific proportions of pH buffer, DNase inhibitor, preservative and cell fixative to the urine preservation solution, the problem that urine preservation agents can only be used at low temperatures has been solved, and stable preservation of cfDNA in urine has been achieved over a wide temperature range, reducing transportation costs.
Patent Information
- Application Number
- CN202010670376.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2020-07-13
- Publication Date
- 2025-11-28
- Estimated Expiration
- 2040-07-13
AI Technical Summary
Existing urine preservation agents can only be used at low temperatures, resulting in high transportation costs and making it impossible to effectively preserve cfDNA in urine at room temperature.
A urine preservation solution is provided, comprising a pH buffer, a DNase inhibitor, a preservative, a cell fixative, and a formaldehyde quencher, in proportions of 6-10 mmol/L, 0.2-0.4 mol/L, 0.1-0.3 mol/L, 5%-15%, and 0.3-1.0 mol/L, for preserving urine in the range of 4℃-40℃, avoiding interference between components and maintaining the stability of cfDNA.
It effectively preserves cfDNA in urine within the range of 4℃-40℃, avoiding nuclease degradation and cell rupture, ensuring stable cfDNA concentration, simplifying the operation process, and reducing transportation costs.
Smart Images

Figure CN111869655B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biological sample preservation, in particular to a urine preservative and use thereof. BACKGROUND
[0002] Urine is a complex metabolic waste product excreted by the human body, mainly produced through the human urinary system (nephron -> renal pelvis -> ureter -> bladder -> urethra). More than 96% of urine is water, and also contains many pathological metabolic products such as free nucleic acids, proteins and sugar substances. Free DNA (Cell-Free Circulating DNA, cfDNA) refers to DNA fragments from cell apoptosis or necrosis, which are free in the extracellular space and widely exist in human serum, plasma, cerebrospinal fluid, urine or saliva. At present, cfDNA has been used as a new biomarker in the fields of clinical prenatal diagnosis of pregnant women, tumor detection, organ transplant rejection and infection detection. Among them, cfDNA in urine mainly comes from the exfoliation of organ epithelial cells in the urinary system and a small amount of white blood cell degradation and pathogenic bacteria fragments. When the urinary system of the human body is diseased, the content of cfDNA in urine also changes. Recent studies have found that urine cfDNA contains rich information of bacteria and viruses in the microbiome, drug sensitivity, bacterial growth dynamics, kidney transplant damage and host response to infection, and is considered to be a general analyte for monitoring urinary tract infections.
[0003] However, compared with peripheral blood, the composition of urine is more complex, especially the content of nucleases is higher, which causes the cfDNA in urine to be more easily degraded, the concentration to be reduced, and the pathological changes of the body to be unable to be truly reflected. In addition, the exfoliated intact epithelial cells or white blood cells in urine are unstable in the complex environment, and the genomic DNA is released into the urine by breaking, which also changes the concentration of the real cfDNA in urine, affects the proportion of the target site, especially for low-frequency variant sites, increases the background noise, and is easy to cause false negatives. As for the existing technologies reported, their compositions are complex, the cost is high, and the preservation effect decreases seriously with time, which needs to be further improved. Therefore, in order to ensure the accuracy of the urine cfDNA detection result, a urine cfDNA preservative and a preservation tube specially used for urine cfDNA are needed. For example, the urine preservative and urine preservation tube disclosed in CN107603970A can prevent the degradation of free DNA in urine, can store urine at 4℃ for up to 7 days, during which time free DNA does not significantly degrade, and gDNA of exfoliated cells in urine does not significantly release into urine, affecting the content of free DNA in urine. However, the urine preservative disclosed in the above document can only be used under low temperature conditions such as 4℃ or lower temperature, which makes the transportation cost high. SUMMARY
[0004] Therefore, the technical problem to be solved by the present application is to overcome the defect that the urine preservative in the prior art can only be used under low temperature conditions, resulting in high transportation cost, and to provide a urine preservative with an expanded temperature range and an application thereof.
[0005] To this end, the present application provides the following technical solutions:
[0006] In a first aspect, the present application provides a urine preservative, comprising: a pH buffer 6-10 mmol / L, a DNA enzyme inhibitor 0.2-0.4 mol / L, a preservative 0.1-0.3 mol / L, a cell fixative 5%-15% by mass fraction, and a formaldehyde quencher 0.3-1.0 mol / L.
[0007] Preferably, the urine preservative comprises: a pH buffer 6-8 mmol / L, a DNA enzyme inhibitor 0.2-0.3 mol / L, a preservative 0.1-0.2 mol / L, a cell fixative 5%-10% by mass fraction, and a formaldehyde quencher 0.3-0.6 mol / L.
[0008] More preferably, the urine preservative comprises: a pH buffer 7.5-8 mmol / L, a DNA enzyme inhibitor 0.2 mol / L, a preservative 0.1 mol / L, a cell fixative 5% by mass fraction, and a formaldehyde quencher 0.3 mol / L.
[0009] Further, the pH buffer comprises at least one of Tris-HCl, phosphate (PO4 3- ), acetate (CH3COO - ), bicarbonate (HCO3 - ), and borate (BO3 - ); preferably, the pH buffer is Tris-HCl, and the pH is 7.0-8.0.
[0010] Further, the DNA enzyme inhibitor comprises at least one of EDTA, EDTA sodium salt (including EDTA-Na2 and / or EDTA-Na3), EDTA potassium salt (including EDTA-K2 and / or EDTA-K3), and ammonium sulfate (NH4)2SO4; preferably, the DNA enzyme inhibitor is EDTA.
[0011] Further, the cell fixative comprises at least one of imidazole alkyl urea, diazo alkyl urea, diazole alkyl urea, paraformaldehyde, and formalin; preferably, the cell fixative is paraformaldehyde.
[0012] Further, the preservative comprises at least one of citric acid, sodium citrate, lactic acid, sodium lactate, sorbic acid, and sodium sorbate; preferably, the preservative is citric acid and / or sodium citrate.
[0013] Further, the formaldehyde quencher includes at least one of arginine, glycine, L-lysine and urea; preferably, the preservative is glycine.
[0014] In a second aspect, the present application provides the use of the urine preservative solution in the preservation of urine or body fluid.
[0015] In a third aspect, the present application provides a urine preservation method, comprising: mixing the urine preservative solution with urine uniformly and preserving; preferably, the volume ratio of the urine preservative solution to urine is 2%-4%.
[0016] The technical scheme of the present application has the following advantages:
[0017] 1. The urine preservative solution provided by the present application comprises: a pH buffer 6-10 mmol / L, a DNA enzyme inhibitor 0.2-0.4 mol / L, a preservative 0.1-0.3 mol / L, a cell fixative 5%-15% by mass fraction and a formaldehyde quencher 0.3-1.0 mol / L; in the urine preservative solution, the mutual interference between the components is avoided, the functions of the components are affected, the respective corresponding protective effects are still maintained between 4°C and 40°C, and the nucleic acid in the urine is not directly affected, so that the preservative solution can still maintain the urine unspoiled at 4°C-40°C, and the relative content of cfDNA is ensured.
[0018] In addition, in the urine preservative solution, the pH buffer functions to maintain the pH value and the salt ion concentration of the solution, and avoid the cell rupture or cfDNA degradation in the urine; the DNA enzyme inhibitor is mainly a metal ion chelating agent, and functions to combine with metal ions such as Mg2+, Ca2+ and Fe3+ in the urine, inhibit the activity of nucleases in the urine, maintain the stability of cells in the urine, and also avoid the degradation of cfDNA by DNA enzymes in the urine; the preservative mainly functions to inhibit the activity of microorganisms originally existing in the urine, prevent the further reproduction of microorganisms, and cause the deterioration of the urine; the cell fixative mainly functions to maintain the morphology of cells in the urine, avoid the release of genomic DNA into the urine due to cell rupture, and affect the true concentration of cfDNA; and the formaldehyde quencher mainly eliminates free aldehyde released in the preservative, and avoids the influence on the subsequent PCR process.
[0019] 2. The urine preservation method provided by the present application comprises: mixing the urine preservative solution with urine uniformly, and then preserving, which can be preserved at 4°C-40°C; the method is simple and easy to operate, and does not need to centrifuge to remove cells in the urine before preservation. BRIEF DESCRIPTION OF DRAWINGS
[0020] In order to more clearly illustrate the technical solutions in the specific embodiments of the present application or the prior art, the following will briefly introduce the drawings needed to be used in the specific embodiments or the prior art description. Obviously, the drawings described below are some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without any creative effort on the basis of these drawings.
[0021] Figure 1 is a graph of cfDNA content in urine at different temperatures for 5 days in the experimental example of the present application;
[0022] Figure 2 is a column chart of cfDNA content in urine at different storage times at 25°C in the experimental example of the present application. DETAILED DESCRIPTION
[0023] The following examples are provided to better further understand the present application and are not limited to the best mode, and do not limit the content and protection scope of the present application. Any person under the inspiration of the present application or the combination of the present application with other prior art features can obtain any product same or similar to the present application, which falls within the protection scope of the present application.
[0024] The specific experimental steps or conditions are not specified in the examples, which can be operated according to the conventional experimental steps described in the literature in the art or the conditions. The reagents or instruments used are not specified by the manufacturer, which are conventional reagent products that can be obtained by market purchase.
[0025] Example 1
[0026] The present embodiment provides a urine preservation solution, which is an aqueous solution composed of the following components with the following concentrations: Tris-Hcl 7 mmol / L, EDTA 0.2 mol / L, citric acid 0.1 mol / L, paraformaldehyde mass fraction 5%, imidazole alkyl urea mass fraction 5%, diazalkyl urea mass fraction 5%, and glycine 0.3 mol / L; the pH of the urine preservation solution is 7.0-8.0.
[0027] The above urine preservation solution is prepared according to the conventional method, and the preparation method can be as follows: 1M Tris-Hcl (pH=7-8) solution is added to water to prepare a buffer reagent A with a certain concentration; the corresponding amount of DNA enzyme inhibitor EDTA solid is weighed and dissolved in the above A solution; the corresponding mass of paraformaldehyde, imidazole alkyl urea, and diazalkyl urea is weighed and added to the A solution in turn, and heating at 65°C can promote dissolution; the corresponding amount of citric acid is weighed and dissolved in the A solution; the corresponding amount of glycine is weighed and dissolved in the A solution; finally, the pH of the solution is adjusted to 7.0-8.0, and the volume is adjusted with water to obtain the urine preservation solution with the corresponding concentration, which is filtered and stored at 4°C.
[0028] In the urine preservation, the urine preservation solution is mixed with urine uniformly, and the volume ratio of the urine preservation solution to urine is 2%-4%, and in this embodiment, 2% can be selected.
[0029] Embodiment 2
[0030] The embodiment provides a urine preservation solution, which is an aqueous solution composed of the following components with the following concentrations: a pH buffer 6 mmol / L, a DNA enzyme inhibitor 0.4 mol / L, a preservative 0.3 mol / L, a cell fixative 5% by mass, and a formaldehyde quencher 1.0 mol / L; and the pH of the urine preservation solution is 7.0-8.0.
[0031] The pH buffer is a phosphate salt; the DNA enzyme inhibitor is sodium EDTA and potassium EDTA; the preservative is sodium citrate; the cell fixative is formalin; and the formaldehyde quencher is arginine.
[0032] The urine preservation solution is prepared according to a conventional method or the preparation method in Embodiment 1.
[0033] In the urine preservation, the urine preservation solution is mixed with urine uniformly, and the volume ratio of the urine preservation solution to urine is 2%-4%, and in this embodiment, 4% can be selected.
[0034] Embodiment 3
[0035] The embodiment provides a urine preservation solution, which is an aqueous solution composed of the following components with the following concentrations: a pH buffer 8 mmol / L, a DNA enzyme inhibitor 0.3 mol / L, a preservative 0.2 mol / L, a cell fixative 10% by mass, and a formaldehyde quencher 0.6 mol / L; and the pH of the urine preservation solution is 7.0-8.0.
[0036] The pH buffer is a bicarbonate salt; the DNA enzyme inhibitor is ammonium sulfate; the preservative is lactic acid and sodium lactate; the cell fixative is diazolidinyl urea and polyformaldehyde; and the formaldehyde quencher is urea and L-lysine.
[0037] The urine preservation solution is prepared according to a conventional method or the preparation method in Embodiment 1.
[0038] Embodiment 4
[0039] The embodiment provides a urine preservation solution, which is an aqueous solution composed of the following components with the following concentrations: a pH buffer 7.5 mmol / L, a DNA enzyme inhibitor 0.2 mol / L, a preservative 0.1 mol / L, a cell fixative 5% by mass, and a formaldehyde quencher 0.3 mol / L; and the pH of the urine preservation solution is 7.0-8.0.
[0040] The pH buffer is Tris-HCl, and the pH is 7.0-8.0; the DNA enzyme inhibitor is EDTA; the preservative is citric acid; the cell fixative is polyformaldehyde; and the formaldehyde quencher is glycine.
[0041] The urine preservative solution is prepared according to a conventional method or the preparation method in Embodiment 1.
[0042] Comparative Example 1
[0043] The urine preservative solution is an aqueous solution composed of the following components at the following concentrations: a pH buffer of 7.5 mmol / L, a DNA enzyme inhibitor of 0.5 mol / L, a preservative of 0.4 mol / L, a cell fixative of 18% by mass, and a formaldehyde quencher of 0.8 mol / L; and the pH of the urine preservative solution is 7.0-8.0.
[0044] The pH buffer is Tris-HCl, and the pH is 7.0-8.0; the DNA enzyme inhibitor is EDTA; the preservative is citric acid; the cell fixative is polyformaldehyde; and the formaldehyde quencher is glycine.
[0045] The urine preservative solution is prepared according to a conventional method or the preparation method in Embodiment 1.
[0046] Comparative Example 2
[0047] The urine preservative solution is an aqueous solution composed of the following components at the following concentrations: a pH buffer of 2 mmol / L, a DNA enzyme inhibitor of 10 mmol / L, a preservative of 5 mmol / L, a cell fixative of 0.1% by mass, and a formaldehyde quencher of 40 mmol / L; and the pH of the urine preservative solution is 7.0-8.0.
[0048] The pH buffer is Tris-HCl, and the pH is 7.0-8.0; the DNA enzyme inhibitor is EDTA; the preservative is 1.25 mmol / L citric acid and 3.75 mmol / L sodium citrate; the cell fixative is composed of equal amounts of polyformaldehyde, diazobisalkylurea, and imidazolidinyl urea; and the formaldehyde quencher is composed of equal amounts of glycine, lysine, and ethylenediamine.
[0049] The urine preservative solution is prepared according to a conventional method.
[0050] Experimental Example
[0051] 1. Sample Collection
[0052] Urine samples were collected from five patients who had received kidney transplants at a hospital. The urine was midstream morning urine.
[0053] 2. Experimental Method
[0054] Each urine sample of each patient was treated as follows: (1) extraction after 2h of gentle shaking after adding the preservative solution, the volume ratio of urine preservative solution to urine was 3%; (2) extraction after 3 days of gentle shaking after adding the preservative solution, the volume ratio of urine preservative solution to urine was 3%; (3) extraction after 5 days of gentle shaking after adding the preservative solution, the volume ratio of urine preservative solution to urine was 3%; (4) extraction after 7 days of gentle shaking after adding the preservative solution, the volume ratio of urine preservative solution to urine was 3%. The urine samples treated as above were stored under different temperature conditions, including 4℃, 25℃ and 40℃.
[0055] The urine preservative solution used for the urine samples of the patients was selected as the urine preservative solution of Example 1, Example 3, Example 4, Comparative Example 1 and Comparative Example 2, respectively.
[0056] 3. Detection method
[0057] 3.1 Detection of cfDNA concentration: The treated urine sample was centrifuged at 3000g, 4℃ for 10min, and the supernatant was separated into a new centrifuge tube. The supernatant was further centrifuged at 16000g, 4℃ for 10min, and the centrifuged supernatant was transferred to a new centrifuge tube to obtain the pre-processed urine, which could be stored at -20℃. The cfDNA in the urine was extracted using a cfDNA extraction kit (Qiagen free DNA extraction kit, 55114), and the cfDNA concentration was quantified using Qubit 3.0.
[0058] 3.2 cfDNA fragment size quantification: Based on the leptin gene, primers and probes with amplification fragment lengths of 80 bp, 145 bp, 280 bp, and 576 bp were designed, respectively. The corresponding primers and probes were designed based on the Primer Express software (Table 1 below). The urine cfDNA fragment size was quantified by the method of fluorescent quantitative PCR. TaqMan PCR Core Reagent Kit (Applied Biosystems) kit was used, and the reaction system was 50 uL, including 5 uL 10 x buffer A, 4 mM MgCl2, 200 uM dATP, 200 uM dCTP, and 400 uM dGTP, 400 uM dUTP, 1 uM forward primer and reverse primer, 500 nM TaqMan probe, 2 U AmpliTaq Gold polymerase, 0.5 U AmpErase uracil N-glycosylase, 50 nL dimethylsulfoxide (DMSO), and 5 uL cfDNA template. The reaction conditions were 50 °C for 2 min; 95 °C for 10 min, 50 cycles (95 °C for 30 s, 58 °C for 1 min), and 72 °C for 1 min. Based on the 80 bp amplification ct value as the reference, the proportion of different fragments was calculated, and the proportion of cfDNA fragments of different lengths under different storage time conditions at 25 °C was observed. The 80 bp amplification ct value was ct0, and the amplification ct value of other length fragments was ct1. The calculation formula was: other length fragment proportion change % = ct1 value / ct0 value.
[0059] Table 1 Primers and probes
[0060] Primer Name Sequence F 5 ′ -3'CAGTCTCCTCCAAACAGAAAGTCA-5'(SEQ ID NO: 1) ′ ]] 80R 5 ′ - GTCCATCTTGGATAAGGTCAGGA -3 ′ ]]> 145R 5 ′ - GATATTTGGATCACGTTTCTGG -3 ′ ]]> 280R 5 ′ -CTCTGTGGAGTAGCCTGAAGCTT-3 ′ ]]> 576R 5 ′ - CCTTCCTGGTGAGAATAGGATCC -3 ′ ]]> Probe 5'-(FAM) GAC TCC ATTCCTGG(MGBNFQ)-3' 2 GACTTCCATTCCTGG(MGBNFQ)-3'
[0061] 3.3 cfDNA proportion change from donors:
[0062] Donor-derived cell-free DNA (ddcfDNA) is a kind of free extracellular DNA derived from cells of transplanted organs. After organ transplantation, ddcfDNA can be detected in urine. In this experiment, the urine cfDNA of 5 kidney transplant patients at different storage times was extracted, and 30 ng cfDNA was used for library construction (KAPA LTP library preparation kit). Based on the designed RNA probe (6200 SNPs) (which can be the probe designed based on Primer Express software for the SNP molecular marker disclosed in CN107254514B), liquid hybridization capture was carried out, and second-generation sequencing technology (illumina, 10M data per sample) was used for sequencing. The off-machine data was analyzed by bioinformatics to obtain the concentration of ddcfDNA. The changes of ddcfDNA concentration under different treatment conditions were observed.
[0063] 4. Detection results
[0064] 4.1 Changes of cfDNA concentration under different treatment conditions
[0065] Table 2 is the Qubit 3.0 quantification result of Example 1. There is no significant difference in cfDNA content in urine between 0, 3, 5, and 7 days at 4℃, and the p value is greater than 0.05. When at 25℃ and 40℃, with the increase of storage time, a small amount of nucleic acid degradation phenomenon appeared, but to the 5th day, 7th day, the degradation of nucleic acid slowed down and tended to be stable. At 0 days (2h) of storage time, there was no significant difference in cfDNA content between 4℃, 25℃ and 40℃, and the p value was greater than 0.05. At 3 days of storage time, there was no significant difference in cfDNA content between 4℃ and 25℃, but a small amount of nucleic acid degradation phenomenon appeared at 40℃. At 5 days and 7 days of storage time, with the increase of storage temperature, a small amount of nucleic acid degradation phenomenon appeared, but the degradation of nucleic acid between 25℃ and 40℃ slowed down and tended to be stable.
[0066] Table 2 is the cfDNA content (ng / uL) in urine samples under different storage time and storage temperature of urine preservation solution of Example 1.
[0067] Storage time 4°C (Mean ± SD) 25°C (Mean ± SD) 40°C (Mean ± SD) 0 days (2h) 0.91±0.14 1.01±0.21 0.97±0.24 3 days 0.98±0.43 0.90±0.14 0.79±0.31 5 days 1.04±0.21 0.79±0.20 0.69±0.29 7 days 0.99±0.13 0.71±0.14 0.61±0.21
[0068] Table 3 shows the quantitative results using Qubit 3.0 in Example 3. At 4°C, there was no significant difference in cfDNA content in urine at 0, 3, 5, and 7 days (p values were all greater than 0.05). However, at 25°C and 40°C, a small amount of nucleic acid degradation occurred with increasing storage time, but the degradation slowed down and stabilized at 3, 5, and 7 days. Under storage time of 0 days (2 hours), there was no significant difference in cfDNA content at 4°C, 25°C, and 40°C (p values were all greater than 0.05). Under storage time of 3, 5, and 7 days, a small amount of nucleic acid degradation occurred with increasing storage temperature, but the degradation slowed down and stabilized at 25°C and 40°C.
[0069] Table 3 shows the cfDNA content (ng / uL) in urine samples from different storage times and temperatures using the urine preservation solution from Example 3.
[0070] Storage time 4°C (Mean ± SD) 25°C (Mean ± SD) 40°C (Mean ± SD) 0 days (2h) 0.89±0.10 0.90±0.11 0.93±0.14 3 days 0.92±0.21 0.82±0.12 0.78±0.21 5 days 0.94±0.19 0.79±0.21 0.70±0.19 7 days 0.92±0.13 0.73±0.15 0.63±0.22
[0071] Table 4 shows the quantitative results using Qubit 3.0 in Example 4. It indicates that there were no significant differences in cfDNA levels in urine at different temperatures on days 0, 3, 5, and 7, with p-values all greater than 0.05 (e.g., ...). Figure 1 The graph shows the cfDNA content in urine at different temperatures after 5 days of storage, indicating no nucleic acid degradation. Furthermore, under different storage conditions, there were no significant differences in cfDNA content at 4℃, 25℃, and 40℃, with p-values greater than 0.05 for all values. Figure 2 The graph shows the cfDNA content in urine at different storage times when the storage temperature is 25℃, indicating that there is no nucleic acid degradation.
[0072] Table 4 shows the cfDNA content (ng / uL) in urine samples from different storage times and temperatures using the urine preservation solution from Example 4.
[0073] Storage time 4°C (Mean ± SD) 25°C (Mean ± SD) 40°C (Mean ± SD) 0 days (2h) 0.98±0.12 1.02±0.14 0.97±0.24 3 days 1.05±0.53 0.94±0.11 1.19±0.33 5 days 1.14±0.15 1.03±0.13 1.17±0.31 7 days 0.93±0.12 1.07±0.17 1.16±0.07
[0074] Table 5 shows the quantification results using Qubit 3.0 with Comparative Example 1. At 4℃, the cfDNA content in urine decreased slowly between 0, 3, 5, and 7 days. However, at 25℃ and 40℃, a small amount of nucleic acid degradation occurred with increasing storage time. Under storage conditions of 0 days (2 hours) and 3 days, there was no significant difference in cfDNA content between 4℃, 25℃, and 40℃, with p values greater than 0.05. Under storage conditions of 5 days and 7 days, a small amount of nucleic acid degradation occurred with increasing storage temperature.
[0075] Table 5 cfDNA content (ng / uL) in urine samples using urine storage solution of Comparative Example 1 at different storage time and storage temperature
[0076] Storage time 4°C (Mean ± SD) 25°C (Mean ± SD) 40°C (Mean ± SD) 0 days (2h) 0.89±0.09 0.91±0.11 0.91±0.09 3 days 0.79±0.11 0.81±0.11 0.81±0.17 5 days 0.80±0.20 0.70±0.21 0.67±0.16 7 days 0.69±0.11 0.71±0.16 0.59±0.12
[0077] Table 6 cfDNA content (ng / uL) in urine samples using Qubit 3.0 quantification results of Comparative Example 2, at 4℃, there is no significant difference in cfDNA content between 0, 3, 5, 7 days, p value is greater than 0.05, while at 25℃, with the increase of storage time, a large amount of nucleic acid degradation phenomenon occurs, at 40℃, with the increase of storage time, a small amount of nucleic acid degradation phenomenon occurs; at storage time 0 day (2h), there is no significant difference in cfDNA content between 4℃, 25℃ and 40℃, p value is greater than 0.05; at storage time 3 days, 5 days, 7 days, with the increase of storage temperature, a large amount of nucleic acid degradation phenomenon occurs first, and then the nucleic acid content increases significantly.
[0078] Table 6 cfDNA content (ng / uL) in urine samples using urine storage solution of Comparative Example 2 at different storage time and storage temperature
[0079] Storage time 4°C (Mean ± SD) 25°C (Mean ± SD) 40°C (Mean ± SD) 0 days (2h) 0.88±0.19 0.89±0.17 0.91±0.17 3 days 0.81±0.10 0.68±0.13 0.79±0.15 5 days 0.83±0.10 0.59±0.11 0.77±0.12 7 days 0.76±0.13 0.51±0.14 0.69±0.11
[0080] 4.2 Changes in the proportion of cfDNA fragments of different lengths at different storage times
[0081] Table 7 Changes in the proportion of cfDNA fragments of different lengths in urine samples at different storage times
[0082]
[0083] From the above Table 7, it can be seen that using Example 1, Example 3, Example 4 and Comparative Example 1, with the increase of storage time, the proportion of 145bp and 280bp is basically stable, while the proportion of 576bp increases at 7 days of storage time, which may be due to a small amount of cell rupture, which releases genomic DNA to affect the original content of 576bp cfDNA fragments. Using Comparative Example 2, with the increase of storage time, the proportion of large fragments increases, especially 280bp and 576bp at 7 days, which indicates that genomic DNA is released from cells, which cannot inhibit cell rupture, and releases genomic DNA to affect the original content of cfDNA.
[0084] 4.3 Changes in the proportion of donor-derived cfDNA at different storage times
[0085] Based on the results of the second-generation sequencing, the ddcfDNA was analyzed and quantified. The results showed that the proportion of donor-derived cfDNA in urine using the urine preservative of Example 4 did not have significant differences (p>0.05) at different storage times (0 days (2h), 3 days, 5 days and 7 days) (the storage temperature was 25°C). The average values of Example 1 at 0 days (2h), 3 days, 5 days and 7 days were 13.1%, 12.3%, 10% and 8.7% respectively, the average values of Example 3 at 0 days (2h), 3 days, 5 days and 7 days were 16.1%, 14.3%, 10% and 10.3% respectively, the average values of Example 4 at 0 days (2h), 3 days, 5 days and 7 days were 14.04%, 15.24%, 15.26% and 13.64% respectively, the average values of Comparative Example 1 at 0 days (2h), 3 days, 5 days and 7 days were 15.8%, 14.2%, 9.8% and 9.9% respectively, and the average values of Comparative Example 2 at 0 days (2h), 3 days, 5 days and 7 days were 13.9%, 13.5%, 11.3% and 10.2% respectively. The results showed that the urine preservative of Example 4 could stably preserve ddcfDNA in urine for 7 days, and the proportion of donor-derived cfDNA in urine of Example 1, Example 3, Comparative Example 1 and Comparative Example 2 gradually decreased with the increase of storage time.
[0086] Obviously, the above examples are only examples for clearly illustrating, but not limitation to the embodiments. For those skilled in the art, other different forms of changes or variations can be made on the basis of the above description. Here, all the embodiments need not and cannot be exhausted. The obvious changes or variations derived therefrom are still within the protection scope of the present application.
Claims
1. A urine preservation solution, characterized in that, include: The composition includes a pH buffer of 7.5 mmol / L, a DNase inhibitor of 0.2 mol / L, a preservative of 0.1 mol / L, a cell fixative of 5% (w / w), and a formaldehyde quencher of 0.3 mol / L; the pH buffer is Tris-HCl with a pH of 7.0-8.0; the DNase inhibitor is EDTA; the cell fixative is paraformaldehyde; the preservative is citric acid and / or sodium citrate; and the formaldehyde quencher is glycine.
2. The use of the urine preservation solution according to claim 1 in the preservation of urine or body fluids.
3. A method for preserving urine, characterized in that, include: Mix the urine preservation solution described in claim 1 with urine until homogeneous, and then preserve.
4. The urine preservation method according to claim 3, characterized in that, The volume ratio of the urine preservation solution to urine is 2%-4%.
Citation Information
Patent Citations
SNP molecular markers for detecting heterologous cfDNA, detection methods, and applications
CN107254514B
Method for preservation of cells and nucleic acid targets
US20030113705A1
Urine preservative for preventing free DNAs in urine from being degraded and urine preserving tube
CN107603970A
Urine preservation reagent and application thereof
CN107881213A