Biomarkers for determining possible incompatibility with metallic implants

Abstract

The present disclosure relates to a method for predicting an increased risk of an increased tendency to incompatibility with metal implants.The object of the present disclosure is to improve the prediction of possible complications when using metal implants. To achieve this objective, the present disclosure provides a method for predicting an increased risk of increased incompatibility tendency to metal implants in a subject, wherein in an isolated sample comprising genetic material of the subject: a) examining the single nucleotide variation rs1143627 AGCCTCCTACTTCTGCTTTTGAAAGC[C / T]ATAAAACAGCGAGGGAGAACTGG (SEQ ID NO: 1) in the gene encoding interleukin 1β, and determining whether there is C at the position of the single nucleotide variation; and / or b) examining the VNTR polymorphism rs2234663 having a repeating unit ATCCTGGGGAAAGTGAGGGAAATATGGACATCACATGGAACAACATC-CAGGAGAC TCAGGCCTCTAGGAGTAACTGGGTAGTGTGC (SEQ ID NO: 2) in the gene encoding the IL1 receptor antagonist IL1‑AN, and determining whether the repeating unit is present five times.

Description

Technical Field

[0001] The present disclosure relates to a method and a kit for predicting an increased risk of increased incompatibility propensity to metal implants. Background Art

[0002] Implants are playing an increasingly important role, for example in the fields of orthopedics and dentistry. Such implants are usually made of metals (e.g. pure titanium) or metal alloys. However, this is accompanied by an increase in the number of implant incompatibility reactions [1-4]. For example, even trace impurities in metals such as nickel or foreign materials can lead to inflammatory or allergic reactions. Wear particles or corrosion processes taken up by macrophages and monocytes can also trigger inflammatory reactions. However, complications have also been identified in endoprostheses that cannot be attributed to known causes such as corrosion products or wear products or infections. Thus, a hitherto puzzling excessive inflammatory reaction has been identified, which can be accompanied, for example, by swelling, recurrent joint effusions, pain, restricted movement, implant loosening or failure.

[0003] According to JACOBI-GRESSER E. et al. (Genetic and immunological markers predict titanium implant failure: a retrospective study; Int. J. Oral Maxillofac. Surg. (2013) 42(4) 537-543), diagnostic markers were evaluated to predict titanium implant failure. Implant outcomes were evaluated in 109 subjects who underwent titanium implant surgery and who underwent IL1A-889C / T (rs1800587), IL1B+3954C / T (rs1143634), IL1RN+2018T / C (rs419598) and TNFA-308G / A (rs1800629) genotyping, in vitro-IL-1β / TNF-α release assay and lymphocyte transformation assay during treatment.

[0004] According to RAMIREZ-PEREZ S. et al. (Association of 86bp variable number of tandem repeat (VNTR) polymorphism of interleukin-1 receptor antagonist (IL1RN) with susceptibility and clinical activity in rheumatoid arthritis; Clin. Rheumatol. (2017) 36 (6) 1247-1252), multiple studies reported that a variable number of tandem repeat units (VNTR) 86bp (rs2234663) in intron 2 of the IL1RN gene included in the risk of rheumatoid arthritis (RA). In the current study, the frequency of this polymorphism was determined in patients with RA and controls (CS) and its association with RA was determined in a western Mexican population. An analytical cross-sectional study was performed, which included 350 patients with RA and 307 CS. IL1RN VNTR polymorphisms were identified by polymerase chain reaction (PCR), and the genotypes were associated with clinical variables (DAS28 and CRP).

[0005] According to JACOBI-GRESSER E. et al. ("Prediction of healing rate of titanium implants based on laboratory parameters - a retrospective study" (Prognose der Einheilquote von Titanimplantaten anhand von Laborparametern-eine retrospektive Studie); Umweltmedizin-gesellschaft 26 (2 / 2013) 98-103), the authors evaluated diagnostic markers for predicting failure of titanium implants in their study. Implant outcomes were retrospectively evaluated in 109 subjects who underwent titanium implant surgery and underwent IL1A-889C / T (rs1800587), IL1B+3954C / T (rs1143634), IL1RNN+2018T / C (rs419598), and TNFA-308G / A (rs1800629) genotyping, in vitro IL-1β / TNF-a release assays, and lymphocyte transformation assays during treatment. Titanium-stimulated TNF-a and in vitro IL-1β release were significantly higher in patients who endured implant loss (TNF-a: 256.89 pg / ml vs 81.4 pg / ml; p<0.0001; IL-1β: 159.96 pg / ml vs 54.01 pg / ml; p<0.0001).

[0006] According to LIU YH et al. (Association of interleukin-1beta (IL1B) polymorphisms with Graves' ophthalmopathy in Taiwan Chinese patients; Invest. Ophthalmol. Vis. Sci. (2010) 51 (12) 6238-46), it was investigated whether variants in the IL1B gene could be associated with thyroid eye disease (GO) in patients with Graves' disease (GD). Among the IL1B SNPs studied, the C allele of rs1143634 was associated with GD, while the T / T genotype of SNPs rs1143634 and rs16944 was less associated with the disease. The A / A genotype of SNPs rs3917368 and rs1143643, which had the strongest interaction, increased the risk of GO (P = 0.024 or P = 0.017). Multiple GD-sensitive and -insensitive haplotypes of IL1B were identified, and the Ht4-GCGCCTCC haplotype, which consisted of eight SNPs and was associated with low circulating IL1β values, was protective against the development of GO (P=0.025). The data on IL1B polymorphisms and the association of GD and GO with plasma IL1β suggest that IL1B polymorphisms may be associated with the development of GD and GO. Summary of the invention

[0007] The object of the present disclosure is to improve the prediction of possible complications when using metal implants.

[0008] To achieve this object, the present disclosure provides a method for predicting an increased risk of an increased tendency to incompatibility with metal implants in a subject, wherein in an isolated sample comprising genetic material of the subject:

[0009] a) examining the single nucleotide variation rs1143627AGCCTCCTACTTCTGCTTTTGAAAGC[C / T]ATAAAACAGCGAGGGAGAACTGG (SEQ ID NO: 1) in the gene encoding interleukin 1 beta, and determining whether there is a C at the position of the single nucleotide variation; and / or

[0010] b) The VNTR polymorphism rs2234663 having the repeating unit ATCCTGGGGAAAGTGAGGGAAATATGGACATCACATGGAACAACATCCAGGAGACTCAGGCCTCTAGGAGTAACTGGGTAGTGTGC (SEQ ID NO: 2) in the gene encoding the IL1 receptor antagonist IL1-RN was examined, and it was determined whether the repeating unit was present five times.

[0011] Surprisingly confirmed that polymorphism rs1143627 and rs2234663 are suitable as biomarkers, in order to measure the risk that the people who should accept or have accepted metal implants show the possible improvement of incompatibility with implants.Here, if in single nucleotide variation rs1143627, C rather than T is at the position of single nucleotide variation, and / or if in VNTR polymorphism rs2234663, repeat unit (" repeat ") series formula exists five times successively, then can think that risk improves.Incompatibility can be especially manifested in the inflammatory tendency that improves, and it causes implant loosening (accompanying osteolysis), pain, effusion, functional deterioration (for example the activity of joint prosthesis reduces).

[0012] In order not to be bound by a particular theory, it is assumed that the biomarkers show an imbalance in the regulation of inflammation determined by genetic genes. This leads to incompatibility with "foreign" implants. The human immune system will also react to the same inflammatory stimulus (e.g. bacteria, implant materials) to varying degrees, with the course of the immune response being determined by the ratio between pro-inflammatory and anti-inflammatory messenger substances (e.g. cytokines) that play an important role in the defense mechanism. The cytokine IL-1 is one of the most important pro-inflammatory messenger substances. For example, excessive messenger substance release determined by genetic polymorphisms may lead to an overreaction of the immune system. The pro-inflammatory effect of IL-1 is usually downregulated by the antagonist IL-RN. However, if there is also a polymorphism that reduces the effect, there is a lack of anti-inflammatory effects that offset the inflammatory messenger substance IL-1, resulting in an excessive inflammatory reaction. This can at least partially explain the situation in which a strong inflammatory reaction occurs on an implant without an identifiable cause.

[0013] The method according to the disclosure can be used, for example, to determine before implantation for a person who needs an implant whether a higher probability of complications, in particular excessive inflammatory reactions, must be taken into account when using metal implants. In this case, another implant material, such as ceramic, can be selected, for example. The disclosure is advantageous not only in the field of orthopedics or endoprosthesis, but also in dental implants.

[0014] The term "increased propensity to incompatibility with metal implants" is understood to mean an increased likelihood, relative to the average general population, of an incompatible reaction, in particular an inflammatory reaction, with respect to metal implants.

[0015] The term "implant" or "endoprosthesis" is understood to be an artificial material implanted in the body, which should remain there permanently or at least for a long period of time. Examples of implants are hip implants, knee implants, shoulder implants or dental implants. However, the term also includes osteosynthetic materials implanted in the body, such as plates, nails or screws.

[0016] The term “metal implant” is understood here to mean a cobalt-chromium-molybdenum-based implant, a stainless steel-based implant or a titanium implant, in particular a hip / knee prosthesis or a dental implant.

[0017] The term "arthroplasty" (also known as "arthroplasty") is used herein particularly with respect to the use of an intra-articular prosthesis, ie the replacement of one or more joint surfaces with an allogeneic (ie exogenous), non-biological material.

[0018] The term "polymorphism" describes sequence variations in population genes. Due to this sequence variation, different individuals or different individual cells of a population can have different variants of a specific gene at the same locus (Locus), which is also referred to as "allele". The term includes, for example, variations in a single nucleotide (SNV or SNP) or the occurrence of different number of sequence repetitions (e.g., minisatellite sequences, VNTRs).

[0019] The term "single nucleotide variation rs1143627" (also referred to as IL-1B-31 when necessary) describes a variation involving a single nucleotide at position 31 (relative to the start codon) in the promoter region of the gene encoding interleukin 1 beta (IL-1B, IL-1β), where a C or T is produced at this position (e.g. according to the HGVS nomenclature, NG_008851.1:g.4970C>T, see

[11] ). The sequence of the relevant region including the single nucleotide variation (SNV) is reproduced below:

[0020] AGCCTCCTACTTCTGCTTTTGAAAGC[C / T]ATAAAAACAGCGAGGGAGAACTGG(SEQ ID NO:1)

[0021] The nucleotide variant in question (here C or T) is given in square brackets. Instead of the expression "single nucleotide variation" or SNV, the term "single nucleotide polymorphism" or SNP (single nucleotide polymorphism) is also used synonymously, if necessary.

[0022] The term "VNTR polymorphism rs2234663" (also referred to as "intron 2 VNTR rs2234663" or "intron 2 VNTR") is understood to be a polymorphism in which a variable number (2-6) of tandemly occurring repeating units (VNTR, variable number tandem repeat) are present in the gene encoding the IL1 receptor antagonist (IL1-AN or IL1-RN), the sequence of which is

[0023] ATCCTGGGGAAAGTGAGGGAAATATGGACATCACATGGAACAACATCCAGGAGACTCAGGCCTCTAGGAGTAACTGGGTAGTGTGC (SEQ ID NO: 2). For example, a sequence comprising four repeat units is reproduced in the LRG sequence (LRG = Locus Reference Genomic sequence) LRG_188 (see http: / / ftp.ebi.ac.uk / pub / databases / lrgex / LRG_188.xml; see also the NCBI reference sequence with the accession number NG_021240.1). According to the HGVS nomenclature (see

[11] ), the VNTR polymorphism comprising five repeat units is labeled g.17637_17722 [5].

[0024] The term "atopic disease" is understood to be a disease based on a genetically determined predisposition to react to airborne, gastrointestinal or cutaneous contact with natural or artificial environmental substances with an immediate allergic reaction (type I allergy), i.e. with an accelerated IgE formation. Atopic diseases usually involve the interface between the respiratory mucosa and the gastrointestinal mucosa and the skin. Examples of atopic diseases are allergic bronchial asthma, allergic rhinitis (allergic rhinoconjunctivitis) and atopic dermatitis (atopic eczema, neurodermatitis).

[0025] Preferably, in the method according to the present disclosure, the gene encoding the IL1 receptor antagonist IL1-RN is examined for the presence of a repeating unit

[0026] The VNTR polymorphism rs2234663 of ATCCTGGGGAAAGTGAGGGAAATATGGACATCACATGGAACAACATCCAGGAGACTCAGGCCTCTAGGAGTAACTGGGTAGTGTGC (SEQ ID NO: 2) was determined, and whether the repeat unit existed five times.

[0027] Particularly preferably, in the method according to the present disclosure, it is additionally determined whether the subject suffers from atopic disease. Examples of atopic diseases are bronchial asthma, allergic rhinoconjunctivitis and atopic dermatitis. In particular, in the presence of a combination of the VNTR polymorphism rs2234663 comprising five repeating units and atopic diseases, it can be inferred that the risk of complications (particularly enhanced inflammatory reactions) occurring in the associated personnel when metal implants are implanted increases.

[0028] In another aspect, the present disclosure also relates to a kit for performing the method according to the present disclosure. The kit according to the present disclosure comprises the primer sequences given in Table 1:

[0029] Table 1

[0030] DETAILED DESCRIPTION

[0031] Hereinafter, the present disclosure is described in detail according to embodiments purely for illustrative purposes.

[0032] A study was conducted in which 195 patients with complete endoprosthesis participated with informed consent. The study was approved by the local ethics committee and registered on ClinicalTrials.gov as study number 230-12.

[0033] 102 patients (72 females, 30 males, 41-81 years old) underwent arthroplasty with complications. The control group consisted of 93 patients (70 females, 23 males, 18-96 years old) with normal functioning arthroplasty.

[0034] Questionnaire

[0035] A questionnaire-supported medical history was initiated, which included information on smoking, medication use, implant type, history of metal allergies, and history of atopic diseases (such as allergic rhinitis, atopic eczema, or asthma). Additionally, the Western Ontario and McMaster Universities Osteoarthritis Index (WOMAC) questionnaire was used to quantify the patient's self-assessment of the performance of the artificial joint in terms of pain, stiffness, and functional limitations [5].

[0036] Allergens and patch testing

[0037] All patients were tested allergically in the patch test. For this reason, Almirall Hermal patch test reagents and Finn-Chambers on Scanpor (Almirall Hermal, Reinbeck, Germany) were used. On day 0, the substance was applied to the upper back. A standard series of 29 allergens, a conventional supplementary series and a bone cement series (if the corresponding patient had a carburized endoprosthesis) [6] that met the guidelines of the German Contact Dermatitis Research Group (DKG) were tested. Measurements were performed by an allergist on the 2nd, 3rd and 6th days. The reactions described as positive here are the reactions that are classified as +, ++ and +++.

[0038] Lymphocyte transformation test (LTT)

[0039] The lymphocyte transformation test (LTT) was performed according to Summer et al. [7]. Briefly, peripheral blood mononuclear cells (PBMCs) were isolated by density centrifugation and stimulated for four days with different concentrations of NiSO4, CoCl2, or CrCl3 in four parallel formulations. Control stimuli were 2.4 μg / ml of T cell mitogenic phytohemagglutinin (PHA, Biochrom, Berlin, Germany), 5 μg / ml of tetanus toxoid (TT, Chiron Behring, Berlin, Germany) as a control recall antigen. After 5 days, cells were treated with 3 H thymidine makes PBMC flow, and after overnight incubation, proliferation is determined by measuring the absorbed radioactivity. The results are given as stimulation index (SI), which is equivalent to the ratio of the radioactivity absorbed by the stimulated control culture and the unstimulated control culture, respectively. SI ≥ 3 is considered a positive reaction.

[0040] Polymorphism analysis

[0041] According to the manufacturer's protocol, DNA was isolated from the patient's peripheral blood using the "peqGOLD Blood DNA Mini Kit" (Peqlab, Erlangen, Germany). The DNA obtained was diluted to a final concentration of 40 ng / μl with distilled water. By PCR, digestion with restriction enzymes Taql, Alu1 or Ava1 was performed, followed by gel electrophoresis to analyze three polymorphisms IL-1B-3954 (rs1143634), IL-1B-31 (rs1143627), IL1-B-511 (rs16944) and the small satellite sequence IL-1RN intron 2VNTR (rs2234663). The DNA sequences of the polymorphisms are provided in Table 1.

[0042] Table 2: Polymorphisms examined and corresponding DNA sequences

[0043]

[0044] The polymorphisms including their corresponding restriction enzymes and the resulting fragments are given in Table 2.

[0045] Table 2: Polymorphisms analyzed, including corresponding restriction enzymes and resulting DNA fragment lengths

[0046]

[0047]

[0048] Statistical evaluation was performed according to cross-tabulations including exact Fisher test and risk analysis (odds ratio) with allelic modeling according to several authors [8-10] in collaboration with the Institute of Statistics of the Ludwig-Maximilians-University of Munich.

[0049] result

[0050] Patients with complications of arthroplasty showed various symptoms such as pain (84.1%), followed by reduced freedom of movement (78.4%), swelling (71.6%), etc. This was also reflected in the WOMAC values, where 100 points indicate perfect functionality. Here, the good performance of the endoprosthesis was confirmed by the arthroplasty control patients with a high mean value of 82.13±18.11. On the other hand, patients with complications of arthroplasty showed a low mean WOMAC value of 42.06±10.12. In the group with complications of arthroplasty, the rate of atopic diseases was higher (24.5% vs. 16.1%), of which hay fever accounted for the largest proportion (18.7% vs. 11.8%). In the group with complications of arthroplasty, there were also more patients with a history of metal allergy (24.05% vs. 9.7%). The results of the positive metal patch test were as follows: nickel 19.6% vs. 9.7%, cobalt 6.9% vs. 3.2%, and chromium 2.0% vs. 1.1%. More patients were positive in LTT. Here, 28.4% of patients with arthroplasty complications showed positive LTT for nickel, 2.9% showed positive LTT for cobalt, and 2.9% showed positive LTT for chromium. A small number of patients in the control group showed positive LTT, of which 19.4% were positive for nickel, 1.1% were positive for cobalt, and none were positive for chromium. The results of the questionnaire, patch test, and LTT are listed in Table 3.

[0051] Table 3: Results of questionnaire, patch test and LTT in the patient group. MW = mean, SD = standard deviation

[0052]

[0053] Smoking:

[0054]

[0055] Atopy:

[0056]

[0057] Patch test:

[0058]

[0059] LTT:

[0060]

[0061] There was no difference in the allele frequency of the two different alleles of IL-1B-polymorphism 3954, C or T. Subgroup analysis in patients with or without atopy, positive or negative patch test or LTT also did not show any major differences. In the control group, especially in patients without atopy, without positive patch test or positive LTT reaction, there was a slight trend towards a higher frequency of the C allele. The results for IL1B polymorphism 3954 are listed in Table 4.

[0062] Table 4: Allele frequencies of the IL-1B-3954 polymorphism, also including subgroup analysis. Results of Fisher's exact test and Fisher's odds ratio (+95% confidence interval, KI (Konfidenzintervall)) are given.

[0063]

[0064]

[0065] The IL-1B-31 polymorphism including the T allele had a higher frequency in the control group (84.3% vs. 48%). This may reflect a "protective" genotype that may reduce the immune response to the implant. This difference in T allele frequency was also present in the subgroup analysis. The results of IL-1B-31 allele frequency are listed in Table 5.

[0066] Table 5: Allele frequencies of IL-1B-31 polymorphisms including subgroup analysis. Results of Fisher's exact test and odds ratios (+95% confidence interval, KI) are presented.

[0067]

[0068]

[0069] There were no significant differences in the allele frequencies of the IL-1B-511 polymorphism. In the control group, there was a trend towards a higher frequency of the C allele of this polymorphism, however, this was not statistically significant enough. The results for the IL-1B-511 polymorphism are listed in Table 6.

[0070] Table 6: Allele frequencies of IL-1B-511 polymorphisms including subgroup analysis. Results of Fisher's exact test and odds ratios (+95% confidence interval, KI) are presented.

[0071]

[0072]

[0073] In the IL-1B-RN-intron-2-VNTR, there is a much higher risk of arthroplasty discomfort, which is associated with allele 3 (498 bp, 5 repeat units). Interestingly, if the patient also suffers from atopic disease, the risk increases. This risk is not related to patch test reaction or LTT reactivity. The results of IL-1B-RN intron 2 VNTR are listed in Table 7.

[0074] Table 7: Allele frequencies of IL-1B-RN-VNTR polymorphisms including subgroup analysis. Results of Fisher's exact test and odds ratios (+95% confidence interval, KI) are presented.

[0075]

[0076]

[0077] References

[0078] 1.Sharkey PF et al; Why are total knee arthroplasties failing today; JArthroplasty 2017;29:1774-1778

[0079] 2.Thomsen M et al;Adverse Reaktionen gegenüber Metallimplantaten nach Kniegelenkersatz; Hautarzt2016;67:347-351

[0080] 3.Granchi D et al; Sensitivity to implant materials in patients undergoing total hip replacement; J Biomed Mater Res B Appl Biomater 2006;77(2):257-64

[0081] 4. Thomas P, Summer B; Diagnosis and management of patients with allergyto metal implants; Exp Rev Clin Immunol. 2015; 11(4):501-509

[0082] 5. Stucki G et al.; Evaluation of a German version of the WOMAC (Western Ontario and McMaster Universities) osteoarthritis index; Z Rheumatol 1996; 55(1):40-49

[0083] 6. Schnuch A et al.; Conducting the patch test with contact allergens; Guideline of the German Dermatological Society and the German Society for Allergy and Clinical Immunology; JDDG 2008; 6(9):770-775

[0084] 7.Summer B et al;Nickel(Ni)allergic patients with complications to Nicontaining joint replacement show preferential IL-17type reactivity to Ni;Contact Dermatitis 2010;63:15-22

[0085] 8.Colhoun HM et al;Problems of reporting genetic associations with complex outcomes;Lancet.2003;361(9360):865-72

[0086] 9.Yang H et al;Association of interleukin gene polymorphisms with the risk of coronary artery disease;Genetics and molecular research:GMR.2015;14(4):12489-96.

[0087] 10. Lopez-Mejias R et al; Interleukin 1 beta(IL1ss)rs16944 genetic variant as a genetic marker of severe renal manifestations and renal sequelae in Henoch-Schonlein purpura; Clinical and experimentalrheumatology.20l6;34(3 Suppl 97):S84-8.

[0088] 11. den Dunnen et al; HGVS Recommendations for the Description of Sequence Variants: 2016 Update; HUMAN MUTATION; Vol.37; No.6; 564-569, 2016, doi10.1002 / humu.22981. Sequence Listing <110> University Hospital Munich <120> Biomarkers for determining possible incompatibility with metallic implants <130> PPI20024012DE <160> 13 <170> BiSSAP 1.3.6 <210> 1 <211> 51 <212> DNA <213> Homo sapiens <220> <223> rs1143627 <400> 1 agcctcctac ttctgctttt gaaagcyata aaaacagcga gggagaactg g 51 <210> 2 <211> 86 <212> DNA <213> Homo sapiens <220> <223> rs2234663 repeat <400> 2 atcctgggga aagtgaggga aatatggaca tcacatggaa caacatccag gagactcagg 60 cctctaggag taactgggta gtgtgc 86 <210> 3 <211> 52 <212> DNA <213> Homo sapiens <220> <223> rs1143634 <400> 3 ctccacattt cagaacctat cttcttygac acatgggata acgaggctta tg 52 <210> 4 <211> 52 <212> DNA <213> Homo sapiens <220> <223> rs16944 <400> 4 ctaccttggg tgctgttctc tgcctcrgga gctctctgtc aattgcagga gc 52 <210> 5 <211> 205 <212> DNA <213> Homo sapiens <220> <223> rs2234663 two repeats <400> 5 actcctattg acctggagca caggtatcct ggggaaagtg agggaaatat ggacatcaca 60 tggaacaaca tccaggagac tcaggcctct aggagtaact gggtagtgtg catcctgggg 120 aaagtgaggg aaatatggac atcacatgga acaacatcca ggagactcag gcctctagga 180 gtaactgggt agtgtgcttg gttta 205 <210> 6 <211> 291 <212> DNA <213> Homo sapiens <220> <223> rs2234663 three repeats <400> 6 actcctattg acctggagca caggtatcct ggggaaagtg agggaaatat ggacatcaca 60 tggaacaaca tccaggagac tcaggcctct aggagtaact gggtagtgtg catcctgggg 120 aaagtgaggg aaatatggac atcacatgga acaacatcca ggagactcag gcctctagga 180 gtaactgggt agtgtgcatc ctggggaaag tgagggaaat atggacatca catggaacaa 240 catccaggag actcaggcct ctaggagtaa ctgggtagtg tgcttggttt a 291 <210> 7 <211> 377 <212> DNA <213> Homo sapiens <220> <223> rs2234663 four repeats <400> 7 actcctattg acctggagca caggtatcct ggggaaagtg agggaaatat ggacatcaca 60 tggaacaaca tccaggagac tcaggcctct aggagtaact gggtagtgtg catcctgggg 120 aaagtgaggg aaatatggac atcacatgga acaacatcca ggagactcag gcctctagga 180 gtaactgggt agtgtgcatc ctggggaaag tgagggaaat atggacatca catggaacaa 240 catccaggag actcaggcct ctaggagtaa ctgggtagtg tgcatcctgg ggaaagtgag 300 ggaaatatgg acatcacatg gaacaacatc caggagactc aggcctctag gagtaactgg 360 gtagtgtgct tggttta 377 <210> 8 <211> 463 <212> DNA <213> Homo sapiens <220> <223> rs2234663 five repeats <400> 8 actcctattg acctggagca caggtatcct ggggaaagtg agggaaatat ggacatcaca 60 tggaacaaca tccaggagac tcaggcctct aggagtaact gggtagtgtg catcctgggg 120 aaagtgaggg aaatatggac atcacatgga acaacatcca ggagactcag gcctctagga 180 gtaactgggt agtgtgcatc ctggggaaag tgagggaaat atggacatca catggaacaa 240 catccaggag actcaggcct ctaggagtaa ctgggtagtg tgcatcctgg ggaaagtgag 300 ggaaatatgg acatcacatg gaacaacatc caggagactc aggcctctag gagtaactgg 360 gtagtgtgca tcctggggaa agtgagggaa atatggacat cacatggaac aacatccagg 420 agactcaggc ctctaggagt aactgggtag tgtgcttggt tta 463 <210> 9 <211> 549 <212> DNA <213> Homo sapiens <220> <223> rs2234663 six repeats <400> 9 actcctattg acctggagca caggtatcct ggggaaagtg agggaaatat ggacatcaca 60 tggaacaaca tccaggagac tcaggcctct aggagtaact gggtagtgtg catcctgggg 120 aaagtgaggg aaatatggac atcacatgga acaacatcca ggagactcag gcctctagga 180 gtaactgggt agtgtgcatc ctggggaaag tgagggaaat atggacatca catggaacaa 240 catccaggag actcaggcct ctaggagtaa ctgggtagtg tgcatcctgg ggaaagtgag 300 ggaaatatgg acatcacatg gaacaacatc caggagactc aggcctctag gagtaactgg 360 gtagtgtgca tcctggggaa agtgagggaa atatggacat cacatggaac aacatccagg 420 agactcaggc ctctaggagt aactgggtag tgtgcatcct ggggaaagtg agggaaatat 480 ggacatcaca tggaacaaca tccaggagac tcaggcctct aggagtaact gggtagtgtg 540 cttggttta 549 <210> 10 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Primers <400> 10 tcttttcccc tttcctttaa ct 22 <210> 11 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Primers <400> 11 gagagactcc cttagcacct agt 23 <210> 12 <211> 17 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 12 cccctcagca acactcc 17 <210> 13 <211> 17 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 13 ggtcagaagg gcagaga 17

Claims

1. Use of PCR primers in the preparation of a kit for predicting the risk of increased incompatibility tendency to metal implants in a subject, the PCR primers being: a)TCTTTTCCCCTTTCTTTAACT and GAGAGACTCCCTTAGCACCTAGT, and / or b)CCCTCAGCAACACTCC and GGTCAGAAGGGCAGAGA; Wherein in the isolated sample comprising the genetic material of the subject: i) using the PCR primers a) to examine the single nucleotide variation rs1143627 in the gene encoding interleukin 1β AGCCTCCTACTTCTGCTTTTGAAAGC[C / T]ATAAAAACAGCGAGGGAGAACTGG (SEQ ID NO: 1), and determining whether there is a C at the position of the single nucleotide variation; and / or ii) using the PCR primers b) checking whether the gene encoding the IL1 receptor antagonist IL1-RN has a repeating unit ATCCTGGGGAAAGTGAGGGAAATATGGACATCACATGGAACAAC ATCCAGGAGACTCAGGCCTCTAGGAGTAACTGGGTAGTGTGC (SEQ ID NO: 2) and determined whether the repeat unit existed five times.

2. The use according to claim 1, wherein the increased incompatibility tendency refers to an increased inflammatory tendency.

3. The use according to claim 1 or 2, wherein the possible presence of an atopic disease is additionally determined.

4. Use according to claim 3, wherein the possible presence of an atopic disease is determined, the atopic disease being selected from the group consisting of allergic bronchial asthma, allergic rhinitis and atopic dermatitis.

Images