chiral control

Abstract

The present invention relates to chirality control. The present invention relates to chiral oligonucleotides, chiral oligonucleotide compositions, and methods of making and using the same. The present invention specifically encompasses identifying sources of certain problems with existing methods for making chiral oligonucleotides, including problems that prevent making fully chirally controlled compositions, particularly compositions comprising multiple oligonucleotide types. In some embodiments, the present invention provides chiral oligonucleotide compositions. In some embodiments, the present invention provides methods of making chiral oligonucleotide and chiral oligonucleotide compositions.

Description

[0001] This application is a divisional application of Chinese patent application No. 201380047876.5, which was filed on July 12, 2013 as PCT international application PCT / US2013 / 050407 and entered the Chinese national phase on March 13, 2015.

[0002] Cross-reference to related applications

[0003] This application claims priority to U.S. Provisional Applications No. 61 / 671,655, filed July 13, 2012; U.S. Provisional Applications No. 61 / 671,656, filed July 13, 2012; U.S. Provisional Applications No. 61 / 671,722, filed July 14, 2012; and U.S. Provisional Applications No. 61 / 671,724, filed July 14, 2012, each of which is incorporated herein by reference in its entirety. Technical Field

[0004] This invention relates to chiral control. Background Technology

[0005] Oligonucleotides are suitable for therapeutic, diagnostic, research, and nanomaterial applications. The therapeutic uses of naturally occurring nucleic acids (e.g., unmodified DNA or RNA) can be limited, for example, by their instability against extracellular and intracellular nucleases and / or their poor cellular permeability and distribution. Furthermore, in vitro studies have shown that the properties of antisense oligonucleotides, such as binding affinity, sequence specificity for binding complementary RNA (Cosstick and Eckstein, 1985; LaPlanche et al., 1986; Latimer et al., 1989; Hacia et al., 1994; Mesmaeker et al., 1995), and stability against nucleases can be affected by the absolute stereochemical configuration of the phosphorus atom (Cook et al., US005599797A). Therefore, there is a need for novel and improved oligonucleotide compositions. Summary of the Invention

[0006] This invention encompasses the recognition that there is a need for chiral-controlled oligonucleotide compositions and novel methods for their synthesis. This invention explicitly covers the identification of the sources of certain problems with the preparation of chiral oligonucleotides using prior methods, including problems that prevent the preparation of fully chiral-controlled compositions, particularly those comprising multiple oligonucleotide types.

[0007] In some embodiments, the present invention provides chiral-controlled oligonucleotide compositions.

[0008] In some embodiments, the present invention provides a method for preparing chiral-controlled oligonucleotides and chiral-controlled oligonucleotide compositions.

[0009] In some embodiments, the present invention provides a method using chiral-controlled oligonucleotides and chiral-controlled oligonucleotide compositions.

[0010] All publications and patent documents cited in this application are incorporated herein by reference in their entirety.

[0011] definition

[0012] Aliphatic: As used herein, the term "aliphatic" or "aliphatic group" refers to a straight (i.e., unbranched) or branched, substituted or unsubstituted, fully saturated or containing one or more unsaturated units of a hydrocarbon chain, or a monocyclic, bicyclic, or polycyclic hydrocarbon (also referred to herein as "carbocyclic," "cycloaliphatic," or "cycloalkyl") that is fully saturated or contains one or more unsaturated units of a hydrocarbon chain, but is not aromatic, and has a single connection point with the rest of the molecule. In some embodiments, the aliphatic group contains 1-50 aliphatic carbon atoms. Unless otherwise specified, the aliphatic group contains 1-10 aliphatic carbon atoms. In some embodiments, the aliphatic group contains 1-6 aliphatic carbon atoms. In some embodiments, the aliphatic group contains 1-5 aliphatic carbon atoms. In other embodiments, the aliphatic group contains 1-4 aliphatic carbon atoms. In other embodiments, the aliphatic group contains 1-3 aliphatic carbon atoms, and in other embodiments, the aliphatic group contains 1-2 aliphatic carbon atoms. In some implementations, "cycloaliphatic" (or "carbocyclic" or "cycloalkyl") refers to a monocyclic or bicyclic C3-C ring that is fully saturated or contains one or more unsaturated units, but is not aromatic, and has a single connection point to the rest of the molecule. 10 Hydrocarbons. In some embodiments, "cycloaliphatic" (or "carbocyclic" or "cycloalkyl") refers to a monocyclic C3-C6 hydrocarbon that is fully saturated or contains one or more unsaturated units, but is not aromatic, and has a single connection point to the rest of the molecule. Suitable aliphatic groups include, but are not limited to, straight-chain or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl, and their hybrids, such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl, or (cycloalkyl)alkenyl.

[0013] Alkylene: The term "alkylene" refers to a divalent alkyl group. An "alkylene chain" is a polymethylene group, i.e., -(CH2). n - where n is a positive integer, preferably 1 to 6, 1 to 4, 1 to 3, 1 to 2, or 2 to 3. The substituted alkylene chain is a polymethylene in which one or more methylene hydrogen atoms are replaced by substituents. Suitable substituents include those described below for substituted aliphatic groups.

[0014] Idemenyl: The term "demenyl" refers to a divalent alkenyl group. A substituted demenyl chain is a polymethylene chain containing at least one double bond in which one or more hydrogen atoms are replaced by a substituent. Suitable substituents include those described below for substituted aliphatic groups.

[0015] Animal: As used herein, the term "animal" means any member of the animal kingdom. In some embodiments, "animal" means a human being at any developmental stage. In some embodiments, "animal" means a non-human animal at any developmental stage. In some embodiments, a non-human animal is a mammal (e.g., rodents, mice, rats, rabbits, monkeys, dogs, cats, sheep, cattle, primates, and / or pigs). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and / or worms. In some embodiments, an animal may be a transgenic animal, a genetically engineered animal, and / or a clone.

[0016] Approximate: As used herein, unless otherwise stated or apparent from the context, the term "approximate" or "about" with respect to a numerical value is generally considered to include values ​​that fall within a range of 5%, 10%, 15%, or 20% of the value in either direction (greater than or less than) (the exception being when the value would be less than 0% of a possible value or more than 100% of a possible value). In some embodiments, the term "about" with respect to dosage refers to ±5 mg / kg / day.

[0017] Aryl: The term "aryl" as used alone or as part of a larger portion of "aralkyl," "aralkyloxy," or "aryloxyalkyl" refers to a monocyclic or bicyclic system having a total of 5 to 14 ring members, wherein at least one ring in the system is aromatic, and wherein each ring in the system contains 3 to 7 ring members. The term "aryl" is used interchangeably with the term "aryl ring." In some embodiments of the invention, "aryl" refers to an aromatic ring system that may carry one or more substituents, including but not limited to phenyl, biphenyl, naphthyl, anthracene, etc. The scope of the term "aryl" as used herein also includes groups in which an aromatic ring is fused to one or more non-aromatic rings, such as indanyl, phthalimide, naphthimide, phenanthridine, or tetrahydronaphthyl, etc.

[0018] Characteristic portion: As used herein, the “characteristic portion” of a phrase protein or polypeptide is a portion containing a single continuous amino acid or a collection of multiple continuous amino acid segments that collectively characterize the protein or polypeptide. Each of these continuous segments will typically contain at least two amino acids. Furthermore, those skilled in the art will understand that protein characterization typically requires at least 5, 10, 15, 20, or more amino acids. Generally, a characteristic portion is a portion that, in addition to the sequence identity specified above, shares at least one functional characteristic with the relevant intact protein.

[0019] Characteristic sequence: A "characteristic sequence" is a sequence found in all members of a polypeptide or nucleic acid family, and is therefore available to those skilled in the art for identifying members of the family.

[0020] Characteristic structural element: The term “characteristic structural element” refers to a unique structural element (e.g., core structure, set of side attachments, sequence elements, etc.) found in all members of a family of polypeptides, small molecules, or nucleic acids, and is therefore available to those skilled in the art for identifying members of the family.

[0021] Comparable: The term "comparable" is used herein to describe two (or more) sets of conditions or situations that are sufficiently similar to each other to allow for comparison of the results obtained or the phenomena observed. In some embodiments, multiple sets of comparable conditions or situations are characterized by a number of substantially identical features and one or a few different features. Those skilled in the art will understand that multiple sets of conditions are comparable to each other when they possess a sufficient number and type of substantially identical features to ensure that reasonable conclusions can be drawn that differences in results obtained or observed in different sets of conditions or situations are caused by or indicate changes in those different features.

[0022] Dosing regimen: As used herein, a “dosing regimen” or “treatment regimen” refers to a set of unit doses (typically more than one) administered individually to a subject at intervals of time. In some embodiments, a given therapeutic agent has a recommended dosing regimen that may involve one or more doses. In some embodiments, a dosing regimen includes multiple doses, each at equal intervals from the other; in some embodiments, a dosing regimen includes multiple doses and at least two distinct time intervals separating the individual doses. In some embodiments, all doses within a dosing regimen have the same unit dosage. In some embodiments, the different doses within a dosing regimen have different amounts. In some embodiments, a dosing regimen includes a first dose of a first dosage, followed by one or more other doses of a second dosage different from the first dosage. In some embodiments, a dosing regimen includes a first dose of a first dosage, followed by one or more other doses of a second dosage identical to the first dosage.

[0023] Equivalent Agents: Those skilled in the art will understand upon reading this disclosure that, in the context of this invention, the scope of applicable agents is not limited to those explicitly mentioned or exemplified herein. Specifically, those skilled will recognize that active agents generally have a structure consisting of a core portion and connected side portions, and will further understand that simple variations of the core and / or side portions may not significantly alter the activity of the agent. For example, in some embodiments, substituting one or more side portions with groups having comparable three-dimensional structural and / or chemical reactivity characteristics can produce substituted compounds or portions equivalent to the parent reference compound or portion. In some embodiments, adding or removing one or more side portions can produce substituted compounds equivalent to the parent reference compound. In some embodiments, altering the core structure, for example, by adding or removing a few bonds (typically no more than 5, 4, 3, 2, or 1 bond, and often only a single bond), can produce substituted compounds equivalent to the parent reference compound. In many embodiments, equivalent compounds can be prepared using readily available starting materials, reagents, and conventional or provided synthetic procedures, by methods described, for example, in the general reaction schemes described below, or by modifications thereof. These reactions may also utilize known variants that are not mentioned in this paper.

[0024] Equivalent dose: The term "equivalent dose" is used herein to compare doses of different pharmaceutically active agents that achieve the same biological outcome. If doses of two different agents achieve comparable levels or extents of biological outcome, then according to the invention, the doses are considered "equivalent" to each other. In some embodiments, the equivalent doses of different pharmaceutical formulations for use according to the invention are determined using in vitro and / or in vivo assays as described herein. In some embodiments, one or more lysosomal activators for use according to the invention are utilized at a dose equivalent to that of a reference lysosomal activator; in some of these embodiments, the reference lysosomal activator for said purpose is selected from the group consisting of: small molecule allosteric activators (e.g., pyrazolpyrimidine), iminosaccharides (e.g., isofagomine), antioxidants (e.g., N-acetylcysteine), and cell transport regulators (e.g., Rab1a peptide).

[0025] Heteroaliphatic: The term "heteroaliphatic" refers to an aliphatic group in which one or more units selected from C, CH, CH2, or CH3 are independently replaced by heteroatoms. In some embodiments, the heteroaliphatic group is a heteroalkyl group. In some embodiments, the heteroaliphatic group is a heteroalkenyl group.

[0026] Heteroaryl: The terms "heteroaryl" and "heteroaryl-" used alone or as part of a larger portion of, for example, "heteroarylalkyl" or "heteroarylalkoxy," refer to a group having 5 to 10 ring atoms, preferably 5, 6, or 9 ring atoms; having 6, 10, or 14 electrons common in the cyclic array; and having 1 to 5 heteroatoms in addition to carbon atoms. The term "heteroatom" refers to nitrogen, oxygen, or sulfur, and includes any oxidized form of nitrogen or sulfur and any quaternized form of basic nitrogen. Heteroaryl groups include, but are not limited to, thiophene, furanyl, pyrrole, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridinyl, pyrimidinyl, pyrazinyl, indoleazinyl, purine, naphridinyl, and pteridinyl. As used herein, the terms “heteroaryl” and “heteroary-” also include groups in which a heteroaryl ring is fused to one or more aryl, cycloaliphatic, or heterocyclic rings, wherein the linking group or point is on the heteroaryl ring. Non-limiting examples include indolyl, isoindolyl, benzothiopheneyl, benzofuranyl, dibenzofuranyl, indazoleyl, benzimidazolyl, benzothiazolyl, quinolinyl, isoquinolinyl, terpineyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H-quinazinyl, carbazolyl, acridineyl, phenazinyl, phenthiazolyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3-b]-1,4-oxazin-3(4H)-one. Heteroaryl groups can be monocyclic or bicyclic. The term "heteroaryl" may be used interchangeably with the terms "heteroaryl ring," "heteroaryl group," or "heteroarylene," any of which includes an optionally substituted ring. The term "heteroarylalkyl" refers to an alkyl group substituted with a heteroaryl group, wherein the alkyl and heteroaryl portions are optionally substituted independently.

[0027] Heteroatom: The term "heteroatom" refers to one or more of oxygen, sulfur, nitrogen, phosphorus, or silicon (including any oxidized form of nitrogen, sulfur, phosphorus, or silicon; any quaternized form of basic nitrogen; or a substituted nitrogen of a heterocycle, such as N (as in 3,4-dihydro-2H-pyrrole), NH (as in pyrrolealkyl), or NR). + (e.g., in N-substituted pyrroleyl groups).

[0028] Heterocycle: As used herein, the terms “heterocycle,” “heterocyclic group,” “heterocyclic ring,” and “heterocyclic ring” are used interchangeably and refer to a stable 3- to 7-membered monocyclic or 7- to 10-membered bicyclic heterocyclic moiety that is saturated or partially unsaturated and has one or more, preferably one to four, heteroatoms as defined above, in addition to a carbon atom. When referring to the ring atom of the heterocycle, the term “nitrogen” includes substituted nitrogen. For example, in a saturated or partially unsaturated ring having 0 to 3 heteroatoms selected from oxygen, sulfur, or nitrogen, nitrogen may be N (as in 3,4-dihydro-2H-pyrrole), NH (as in pyrrolealkyl), or... + NR (e.g., in N-substituted pyrroleyl groups).

[0029] The heterocycle may be attached to its side group at any heteroatom or carbon atom that produces a stable structure, and any ring atom may optionally be substituted. Examples of the saturated or partially unsaturated heterocyclic groups include, but are not limited to, tetrahydrofuranyl, tetrahydrophenylthio, pyrrolyl, piperidinyl, pyrrololinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolyl, piperazine, dioxyl, dioxapentylyl, diazapyr, oxonitrilepyr, thiopyr, morpholinyl, and quininecycloyl. The terms “heterocyclic,” “heterocyclic group,” “heterocyclic ring,” “heterocyclic group,” “heterocyclic moiety,” and “heterocyclic radical” are used interchangeably herein and also include groups in which the heterocyclic ring is fused to one or more aryl, heteroaryl, or cycloaliphatic rings, such as indololinyl, 3H-indolyl, benzodihydropyranyl, phenanthridineyl, or tetrahydroquinolinyl, wherein the linking group or dot is located on the heterocyclic ring. The heterocyclic group can be monocyclic or bicyclic. The term “heterocyclic alkyl” refers to an alkyl group substituted with a heterocyclic group, wherein the alkyl and heterocyclic moiety are optionally substituted independently.

[0030] Intraperitoneal: As used herein, the phrases “intraperitoneal administration” and “administered intraperitoneal” have the meaning as understood in the art and refer to the administration of a compound or composition into the peritoneum of a subject.

[0031] In vitro: As used herein, the term “in vitro” refers to an event that occurs in an artificial environment, such as in a test tube or reaction vessel, in a cell culture, etc., rather than in an organism (e.g., an animal, plant, and / or microorganism).

[0032] In vivo: As used in this article, the term “in vivo” refers to an event that occurs within an organism (e.g., an animal, plant, and / or microorganism).

[0033] Lower alkyl groups: The term "lower alkyl group" refers to C14-C ... 1-4 Straight-chain or branched alkyl groups. Exemplary lower alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, and tert-butyl.

[0034] Lower haloalkyl: The term "lower haloalkyl" refers to a C-aryl group that has been substituted with one or more halogen atoms. 1-4 Straight-chain or branched alkyl groups.

[0035] Optional Substitution: As described herein, the compounds of the present invention may contain an “optionally substituted” portion. Generally, the term “substitution,” whether preceding the term “optionally”, refers to the replacement of one or more hydrogen atoms of a specified portion with a suitable substituent. Unless otherwise indicated, the “optionally substituted” group may have suitable substituents at each substituted position of the group, and the substituents at each position may be the same or different when more than one position in any given structure may be substituted by more than one substituent selected from the specified group. Combinations of substituents contemplated by the present invention are preferably those that result in the formation of stable or chemically viable compounds. The term “stable” as used herein means that the compound is not substantially altered when subjected to conditions that allow it to be generated, detected, and, in some embodiments, recovered, purified, and used for one or more purposes disclosed herein.

[0036] The suitable monovalent substituent on the substituted carbon atom of the "optionally substituted" group is independently a halogen; -(CH2) 0-4 R ○ ;-(CH2) 0-4 OR ○ ;-O(CH2) 0-4 R ○ -O-(CH2) 0-4 C(O)OR ○ ;-(CH2) 0-4 CH(OR ○ )2;-(CH2) 0-4 SR ○ ;-(CH2) 0-4 Ph, which can be R ○ Substitution; -(CH2) 0-4 O(CH2) 0-1 Ph, which can be R ○ Substitution; -CH=CHPh, which can be replaced by R ○ Substitution; -(CH2) 0-4 O(CH2) 0-1 -pyridyl, which can be R ○ Substitution; -NO2; -CN; -N3; ​​-(CH2) 0-4 N(R ○ )2;-(CH2) 0-4 N(R ○ )C(O)R ○ ;-N(R ○ )C(S)R ○ ;-(CH2) 0-4 N(R ○ )C(O)NR ○ 2; -N(R) ○ )C(S)NR ○ 2;-(CH2)0-4 N(R ○ )C(O)OR ○ ;-N(R ○ )N(R ○ )C(O)R ○ ;-N(R ○ )N(R ○ )C(O)NR ○ 2;-N(R ○ )N(R ○ )C(O)OR ○ ;-(CH2) 0-4 C(O)R ○ ;-C(S)R ○ ;-(CH2) 0-4 C(O)OR ○ ;-(CH2) 0-4 C(O)SR ○ ;-(CH2) 0-4 C(O)OSiR ○ 3;-(CH2) 0-4 OC(O)R ○ ;-OC(O)(CH2) 0-4 SR-,SC(S)SR ○ ;-(CH2) 0-4 SC(O)R ○ ;-(CH2) 0-4 C(O)NR ○ 2;-C(S)NR ○ 2;-C(S)SR ○ ;-SC(S)SR ○ ,-(CH2) 0-4 OC(O)NR ○ 2;-C(O)N(OR ○ )R ○ ;-C(O)C(O)R ○ ;-C(O)CH2C(O)R ○ ;-C(NOR ○ )R ○ ;-(CH2) 0-4 SSR ○ ;-(CH2) 0-4 S(O)2R ○ ;-(CH2) 0-4 S(O)2OR ○ ;-(CH2) 0-4 OS(O)2R ○ ;-S(O)2NR ○ 2;-(CH2) 0-4 S(O)R ○;-N(R ○ )S(O)2NR ○ 2; -N(R) ○ )S(O)2R ○ ;-N(OR) ○ )R ○ ;-C(NH)NR ○ 2; -P(O)2R ○ ;-P(O)R ○ 2; -OP(O)R ○ 2; -OP(O)(OR ○ )2;-SiR ○ 3; -(C 1-4 (linear or branched alkylene)ON(R) ○ )2; or -(C 1-4 (linear or branched alkylene)C(O)ON(R) ○ )2, where each R ○ It can be replaced as defined below, and is independently hydrogen, C 1-6 Aliphatic, -CH2Ph, -O(CH2) 0-1 Ph, -CH2- (5-6 membered heteroaryl ring), or a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 independent heteroatoms selected from nitrogen, oxygen, or sulfur, or, despite the above definitions, two independently occurring R atoms. ○ Together with one or more intercalated atoms, they form 3-12 substituted heteroatoms having 0-4 independent heteroatoms selected from nitrogen, oxygen or sulfur, which can be substituted as defined below.

[0037] R ○ (or two independent Rs) ○ Suitable monovalent substituents on the ring (formed together with their intercalated atoms) are independently halogens, -(CH2). 0-2 R ● -(halogenated R) ● -(CH2) 0-2 OH, -(CH2) 0-2 OR ● -(CH2) 0-2 CH(OR ● )2;-O(halogenated R ● -CN, -N3, -(CH2) 0-2 C(O)R ● -(CH2) 0-2 C(O)OH, -(CH2) 0-2 C(O)OR ● -(CH2) 0-2 SR ● -(CH2)0-2 SH, -(CH2) 0-2 NH2、-(CH2) 0-2 NHR ● -(CH2) 0-2 NR ● 2, -NO2, -SiR ● 3. -OSiR ● 3. -C(O)SR ● -(C 1-4 (linear or branched alkylene)C(O)OR ● or -SSR ● , where each R ● It is either unsubstituted or, when previously a "halogen group", substituted by only one or more halogens, and independently selected from C. 1-4 Aliphatic, -CH2Ph, -O(CH2) 0-1 Ph, or a 5-6 member saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. R ○ Suitable divalent substituents on saturated carbon atoms include =O and =S.

[0038] Suitable divalent substituents on the saturated carbon atom of the "optionally substituted" group include the following: =O, =S, =NNR. * 2、=NNHC(O)R * =NNHC(O)OR * =NNHS(O)2R * =NR * =NOR * -O(C(R) * 2)) 2-3 O- or -S(C(R) * 2)) 2-3 S-, where each R appears independently * Selected from hydrogen, and C that can be substituted as defined below. 1-6 Aliphatic, or having 0-4 unsubstituted 5-6 membered saturated, partially unsaturated, or aryl rings independently selected from nitrogen, oxygen, or sulfur. Suitable divalent substituents attached to the adjacent substituted carbon of the "optionally substituted" group include: -O(CR * 2) 2-3 O-, where each R appears independently * Selected from hydrogen, and C that can be substituted as defined below. 1-6 Aliphatic, or having 0-4 unsubstituted 5-6 saturated, partially unsaturated or aryl rings independently selected from nitrogen, oxygen or sulfur.

[0039] R * Suitable substituents on the aliphatic group include halogens, -R● -(halogenated R) ● -OH, -OR ● -O (halogenated R) ● -CN, -C(O)OH, -C(O)OR ● -NH2, -NHR ● -NR ● 2 or -NO2, where each R ● It is either unsubstituted or, when previously a "halogen group", substituted by only one or more halogens, and is independently C. 1-4 Aliphatic, -CH2Ph, -O(CH2) 0-1 Ph or a 5-6 member saturated, partially unsaturated or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen or sulfur.

[0040] Suitable substituents on the substituted nitrogen of the "optionally substituted" group include or Among them each Independently, it is hydrogen, and C can be substituted as defined below. 1-6 Aliphatic, unsubstituted -OPh, or unsubstituted 5-6 member saturated, partially unsaturated, or aryl rings having 0-4 independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur, or, despite the above definitions, two independently occurring... Together with their intercalated atoms, they form unsubstituted 3-12 saturated, partially unsaturated, or aryl monocyclic or bicyclic rings with 0-4 independent heteroatoms selected from nitrogen, oxygen, or sulfur.

[0041] Suitable substituents on the aliphatic group are independently halogens, -R ● -(halogenated R) ● -OH, -OR ● -O (halogenated R) ● -CN, -C(O)OH, -C(O)OR ● -NH2, -NHR ● -NR ● 2 or -NO2, where each R ● It is either unsubstituted or, when previously a "halogen group", substituted by only one or more halogens, and is independently C. 1-4 Aliphatic, -CH2Ph, -O(CH2) 0-1 Ph, or a 5-6 member saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0042] Oral: As used herein, the phrases “oral administration” and “administered orally” have their meanings as understood in the art, referring to the administration of a compound or composition through the oral cavity.

[0043] Parenteral administration: As used herein, the phrases “parenteral administration” and “administered parenterally” have their meanings as understood in the art, referring to a mode of administration other than enteral and topical administration, usually by injection, and including but not limited to intravenous, intramuscular, intra-arterial, intrathecal, intracapsular, intra-bursal, intraorbital, intracardiac, intradermal, intraperitoneal, tracheal, subcutaneous, subepidermal, intra-articular, subcapsular, arachnoid, intravertebral, and intrasternal injections and infusions.

[0044] Partially unsaturated: As used herein, the term “partially unsaturated” refers to a ring portion that includes at least one double or triple bond. The term “partially unsaturated” is intended to cover rings having multiple unsaturated sites, but is not intended to include aryl or heteroaryl portions as defined herein.

[0045] Pharmaceutical composition: As used herein, the term "pharmaceutical composition" refers to an active agent formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in a unit dose suitable for administration in a treatment regimen that demonstrates a statistically significant probability of achieving a predetermined therapeutic effect when administered to the relevant population. In some embodiments, the pharmaceutical composition may be specifically formulated for administration in solid or liquid form, including those suitable for: oral administration, such as enemas (aqueous or non-aqueous solutions or suspensions), tablets (e.g., those targeted for buccal, sublingual, and systemic absorption), pills, powders, granules, or pastes for tongue administration; parenteral administration, such as by subcutaneous, intramuscular, intravenous, or epidural injection in the form of, for example, sterile solutions or suspensions, or sustained-release formulations; topical administration, such as in the form of creams, ointments, controlled-release patches, or sprays for administration to the skin, lungs, or mouth; intravaginal or rectal administration, such as in the form of pessaries, creams, or foams; sublingual; ocular; transdermal; or nasal, pulmonary, and other mucosal surfaces.

[0046] Pharmaceutically acceptable: As used herein, the phrase “pharmaceutically acceptable” means compounds, materials, compositions, and / or dosage forms that, to the extent of reasonable medical judgment, are suitable for contact with human and animal tissues without excessive toxicity, irritation, allergic reactions, or other problems or complications, in proportion to a reasonable benefit / risk ratio.

[0047] Pharmaceutically acceptable carriers: As used herein, the term "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, composition, or medium, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, used to carry or transport the subject compound from one organ or part of the body to another organ or part of the body. Each carrier must be "acceptable" in the sense that it is compatible with other components of the formulation and does not harm the patient. Examples of materials that can serve as pharmaceutically acceptable carriers include: sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; powdered tragacanth; maltose; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; polyols such as glycerol, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethanol; pH buffer solutions; polyesters, polycarbonates, and / or polyanhydrides; and other non-toxic and compatible materials used in pharmaceutical formulations.

[0048] Pharmaceutically acceptable salts: As used herein, the term "pharmaceutically acceptable salt" means a salt of the compound in the context of a pharmaceutical, i.e., a salt suitable for contact with tissues of humans and lower animals without excessive toxicity, irritation, anaphylactic reactions, etc., to the extent of reasonable medical judgment, and in proportion to a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, SMBerge et al. described pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66: 1-19 (1977). In some embodiments, pharmaceutically acceptable salts include, but are not limited to: non-toxic acid addition salts, which are salts formed by reacting an amino group with an inorganic acid (such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid) or an organic acid (such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid) or by using other methods used in the art (such as ion exchange). In some embodiments, pharmaceutically acceptable salts include, but are not limited to, adipic acid salts, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, hydrogen sulfate, borate, butyrate, camphorate, camphor sulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, gluconate, glycerophosphate, gluconate, hemisulfate, heptaate, hexanoate, hydroiodate, 2-hydroxyethanesulfonate, and lactobionic acid. Salts, lactates, laurates, lauryl sulfates, malates, maleates, malonates, methanesulfonates, 2-naphthalenesulfonates, nicotinates, nitrates, oleates, oxalates, palmitates, papoates, pectinates, persulfates, 3-phenylpropionates, phosphates, picrates, pivalates, propions, stearates, succinates, sulfates, tartrates, thiocyanates, p-toluenesulfonates, undecanoates, valerates, etc. Representative alkali metal or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, etc. In some embodiments, where appropriate, pharmaceutically acceptable salts include those using balancing ions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, alkyl groups having 1 to 6 carbon atoms, sulfonates, and arylsulfonates forming non-toxic ammonium, quaternary ammonium, and amine cations.

[0049] Prodrug: Generally, as used herein and as understood in the art, the term "prodrug" is an entity that, upon administration to an organism, is metabolized in the body to deliver a target active agent (e.g., a therapeutic or diagnostic agent). Typically, this metabolism involves the removal of at least one "prodrug moiety" to form the active agent. Various forms of "prodrugs" are known in the art. For examples of such prodrug moiety, see:

[0050] a) Design of Prodrugs, H. Bundgaard, ed. (Elsevier, 1985) and Methods in Enzymology, 42: 309-396, K. Widder et al., eds. (Academic Press, 1985);

[0051] b) Prodrugs and Targeted Delivery, edited by J.Rautio (Wiley, 2011);

[0052] c) Prodrugs and Targeted Delivery, edited by J.Rautio (Wiley, 2011);

[0053] d)A Textbook of Drug Design and Development, edited by Krogsgaard-Larsen;

[0054] e) Bundgaard, Chapter 5 "Design and Application of Prodrugs", H. Bundgaard, pages 113-191 (1991);

[0055] f) Bundgaard, Advanced Drug Delivery Reviews, 8: 1-38 (1992);

[0056] g) Bundgaard et al., Journal of Pharmaceutical Sciences, 77: 285 (1988); and

[0057] h) Kakeya et al., Chem. Pharm. Bull., 32: 692 (1984).

[0058] Like the other compounds described herein, the prodrug can be provided in any of a variety of forms, such as crystalline form, salt form, etc. In some embodiments, the prodrug is provided in its pharmaceutically acceptable salt form.

[0059] Protecting groups: The term “protecting group” as used herein is well known in the art and includes those detailed in Protecting Groups in Organic Synthesis, TW Greene and PGM Watts, 3rd edition, John Wiley & Sons, 1999, which are incorporated herein by reference in their entirety. It also includes those protecting groups described in Current Protocols in Nucleic Acid Chemistry, Serge L. Beaucage et al., eds. 06 / 2012, which are particularly suitable for nucleoside and nucleotide chemistry, Chapter 2, which are incorporated herein by reference in their entirety. Suitable amino protecting groups include methyl carbamate, ethyl carbamate, 9-fluorenyl methyl carbamate (Fmoc), 9-(2-sulfonyl)fluorenyl methyl carbamate, 9-(2,7-dibromo)fluorenyl methyl carbamate, 2,7-di-tert-butyl-[9-(10,10-dioxo-10,10,10,10-tetrahydrothiopheneyl)]methyl carbamate (DBD-Tmoc), 4-methoxybenzoyl methyl carbamate (Phenoc), and amino... 2,2,2-Trichloroethyl formate (Troc), 2-trimethylsilyl ethyl carbamate (Teoc), 2-phenylethyl carbamate (hZ), 1-(1-adamantyl)-1-methylethyl carbamate (Adpoc), 1,1-dimethyl-2-haloethyl carbamate, 1,1-dimethyl-2,2-dibromoethyl carbamate (DB-t-BOC), 1,1-dimethyl-2,2,2-trichloroethyl carbamate (TCBOC) 1-Methyl-1-(4-biphenyl)ethyl carbamate (Bpoc), 1-(3,5-di-tert-butylphenyl)-1-methylethyl carbamate (t-Bumeoc), 2-(2'-pyridyl and 4'-pyridyl)ethyl carbamate (Pyoc), 2-(N,N-dicyclohexylformamido)ethyl carbamate, tert-butyl carbamate (BOC), 1-adamantane carbamate (Adoc), vinyl carbamate (Voc), ammonia Allyl carbamate (Alloc), 1-isopropylallyl carbamate (Ipaoc), cinnamonyl carbamate (Coc), 4-nitrocinnamonyl carbamate (Noc), 8-quinoline carbamate, N-hydroxypiperidinyl carbamate, alkyl dithiocarbamate, benzyl carbamate (Cbz), p-methoxybenzyl carbamate (Moz), p-nitrobenzyl carbamate, p-bromobenzyl carbamate, p-chlorobenzyl carbamate, 2-carbamate4-Dichlorobenzoate, 4-methylsulfinylbenzene carbamate (Msz), 9-anthraylmethyl carbamate, diphenyl methyl carbamate, 2-methylthioethyl carbamate, 2-methylsulfonylethyl carbamate, 2-(p-toluenesulfonyl)ethyl carbamate, [2-(1,3-dithionecyclohexyl)]methyl carbamate (Dmoc), 4-methylthiophenyl carbamate (Mtpc), 2,4-dimethylthiophenyl carbamate (Bmpc), 2-phosphonium ethyl carbamate (Peoc), 2-triphenylphosphonium isopropyl carbamate (Ppoc), 1,1-dimethyl-2-carbamate - Cyanoethyl ester, m-chloro-p-acyloxybenzyl ester of carbamate, p-(dihydroxyboryl)benzyl ester of carbamate, 5-benzisoxazolyl methyl ester of carbamate, 2-(trifluoromethyl)-6-chromone methyl ester of carbamate (Tcroc), m-nitrophenyl ester of carbamate, 3,5-dimethoxybenzyl ester of carbamate, o-nitrophenyl ester of carbamate, 3,4-dimethoxy-6-nitrophenyl ester of carbamate, phenyl(o-nitrophenyl) methyl ester of carbamate, phenothiazinyl-(10)-carbonyl derivative, N'-p-toluenesulfonylaminocarbonyl derivative, N'-phenylaminothiocarbonyl derivative, tert-amyl ester of carbamate, thioamino S-benzoic acid, p-cyanobenzoic acid, cyclobutyl carbamate, cyclohexyl carbamate, cyclopentyl carbamate, cyclopropyl carbamate, p-decyloxybenzoic acid, 2,2-dimethoxycarbonyl vinyl carbamate, o-(N,N-dimethylformamide)benzoic acid, 1,1-dimethyl-3-(N,N-dimethylformamide)propyl carbamate, 1,1-dimethylpropynyl carbamate, di(2-pyridyl)methyl carbamate, 2-furanylmethyl carbamate, 2-iodoethyl carbamate, isobornyl carbamate, isobutyl carbamate, isonicotinic acid ester p-(p-methoxyphenylazo)benzyl carbamate, 1-methylcyclobutyl carbamate, 1-methylcyclohexyl carbamate, 1-methyl-1-cyclopropylmethyl carbamate, 1-methyl-1-(3,5-dimethoxyphenyl)ethyl carbamate, 1-methyl-1-(p-phenylazophenyl)ethyl carbamate, 1-methyl-1-phenylethyl carbamate, 1-methyl-1-(4-pyridyl)ethyl carbamate, phenyl carbamate, p-(phenylazo)benzyl carbamate, 2,4,6-tri-tert-butylphenyl carbamate, 4-(trimethylammonium)benzyl carbamate, 2,4,6-carbamate6-Trimethylbenzyl ester, formamide, acetamide, chloroacetamide, trichloroacetamide, trifluoroacetamide, phenylacetamide, 3-phenylpropionamide, pyridinecarboxamide, 3-pyridylcarboxamide, N-benzoylphenylalanyl derivative, benzamide, p-phenylbenzamide, o-nitrophenylacetamide, o-nitrophenoxyacetamide, acetylacetamide, (N'-dithiobenzylmethyloxycarbonylamino)acetamide, 3-(p-hydroxyphenyl)propionamide, 3-(o-nitrophenyl)propionamide, 2-methyl-2-(o-nitrophenoxy)propionamide, 2-methyl-2-(o-phenylazophenoxy)propionamide, 4 - Chloropreneamide, 3-methyl-3-nitrobutamide, o-nitrocinnamamide, N-acetylmethionine derivatives, o-nitrobenzamide, o-(benzoyloxymethyl)benzamide, 4,5-diphenyl-3-oxazoline-2-one, N-benzodicarboximide, N-dithiosuccinimide (Dts), N-2,3-diphenylcis-butene diimide, N-2,5-dimethylpyrrole, N-1,1,4,4-tetramethyldisilazylazine adduct (STABASE), 5-substituted 1,3-dimethyl-1,3,5-triazacyclohexane-2-one, 5-substituted 1 3-Diphenylmethyl-1,3,5-triazacyclohexane-2-one, 1-substituted 3,5-dinitro-4-pyridinone, N-methylamine, N-allylamine, N-[2-(trimethylsilyl)ethoxy]methylamine (SEM), N-3-acetoxypropylamine, N-(1-isopropyl-4-nitro-2-oxo-3-pyrrololin-3-yl)amine, quaternary ammonium salts, N-benzylamine, N-di(4-methoxyphenyl)methylamine, N-5-dibenzocycloheptanamine, N-triphenylmethylamine (Tr), N-[(4-methoxyphenyl)diphenylmethyl]amine (MMTr), N-9-phenylfluorenylamine (P hF), N-2,7-dichloro-9-fluorenylmethyleneamine, N-ferroceneylmethylamino (Fcm), N-2-pyridinemethylamino N'-oxide, N-1,1-dimethylthiomethyleneamine, N-phenylmethyleneamine, N-p-methoxyphenylmethyleneamine, N-diphenylmethyleneamine, N-[(2-pyridyl)trimethylmethyl]methyleneamine, N-(N',N'-dimethylaminomethylene)amine, N,N'-isopropylenediamine, N-p-nitrophenylmethyleneamine, N-salicylamine, N-5-chlorosalicylamine, N-(5-chloro-2-hydroxyphenyl)phenylmethyleneamine, N-cyclohexylamine, N-(5,5-Dimethyl-3-oxo-1-cyclohexenyl)amine, N-borane derivatives, N-diphenylalkylboronic acid derivatives, N-[phenyl(pentacarbonylchromium- or tungsten)carbonyl]amine, N-copper chelate, N-zinc chelate, N-nitroamine, N-nitrosoamine, amine N-oxide, diphenylphosphamide (Dpp), dimethylthiophosphamide (Mpt), diphenylthiophosphamide (Ppt), dialkyl aminophosphate, diphenylaminophosphate, diphenylaminophosphate, benzenesulfinamide, o-nitrobenzenesulfinamide (Nps), 2,4-dinitrobenzenesulfinamide, pentachlorobenzenesulfinamide, 2-nitro-4-methoxybenzenesulfinamide, triphenylmethylsulfinamide, 3-nitropyridinesulfinamide (Npys), p-toluenesulfonamide (Ts), benzenesulfonamide, 2,3,6,- Trimethyl-4-methoxybenzenesulfonamide (Mtr), 2,4,6-trimethoxybenzenesulfonamide (Mtb), 2,6-dimethyl-4-methoxybenzenesulfonamide (Pme), 2,3,5,6-tetramethyl-4-methoxybenzenesulfonamide (Mte), 4-methoxybenzenesulfonamide (Mbs), 2,4,6-trimethylbenzenesulfonamide (Mts), 2,6-dimethoxy-4-methylbenzenesulfonamide (iMds), 2,2,5,7,8-pentamethylsomn-6-sulfonamide (Pmc), methanesulfonamide (Ms), β-trimethylsilylethanesulfonamide (SES), 9-anthracitesulfonamide, 4-(4',8'-dimethoxynaphthylmethyl)benzenesulfonamide (DNMBS), benzylmethylsulfonamide, trifluoromethylsulfonamide, and benzoylmethylsulfonamide.

[0060] Suitable protected carboxylic acids further include, but are not limited to, silyl, alkyl, alkenyl, aryl, and arylalkyl-protected carboxylic acids. Examples of suitable silyl groups include trimethylsilyl, triethylsilyl, tert-butyldimethylsilyl, tert-butyldiphenylsilyl, triisopropylsilyl, etc. Examples of suitable alkyl groups include methyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, triphenylmethyl, tert-butyl, tetrahydropyran-2-yl. Examples of suitable alkenyl groups include allyl. Examples of suitable aryl groups include optionally substituted phenyl, biphenyl, or naphthyl groups. Examples of suitable arylalkyl groups include optionally substituted benzyl groups (e.g., p-methoxybenzyl (MPM), 3,4-dimethoxybenzyl, O-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl) and 2-pyridylmethyl and 4-pyridylmethyl groups.

[0061] Suitable hydroxyl protecting groups include methyl, methoxymethyl (MOM), methylthiomethyl (MTM), tert-butylthiomethyl, (phenyldimethylsilyl)methoxymethyl (SMOM), benzyloxymethyl (BOM), p-methoxybenzyloxymethyl (PMBM), (4-methoxyphenoxy)methyl (p-AOM), guaiacol methyl (GUM), tert-butoxymethyl, 4-pentenyloxymethyl (POM), silanoxymethyl, 2-methoxyethoxymethyl (MEM), 2,2,2-trichloroethoxymethyl, bis(2-chloroethoxy)methyl, 2-(trimethylsilyl)ethoxymethyl (SEMOR), and tetrahydropyranyl (THP). ), 3-bromotetrahydropyranyl, tetrahydrothiaranyl, 1-methoxycyclohexyl, 4-methoxytetrahydropyranyl (MTHP), 4-methoxytetrahydrothiaranyl, 4-methoxytetrahydrothiaranyl S,S-dioxide, 1-[(2-chloro-4-methyl)phenyl]-4-methoxypiperidin-4-yl (CTMP), 1,4-dioxane-2-yl, tetrahydrofuranyl, tetrahydrothiofuranyl, 2,3,3a,4,5,6,7,7a-octahydro-7,8,8-trimethyl-4,7-methylbridged benzofuran-2-yl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 1-methyl-1-methoxyethyl, 1-methyl-1-benzylmethyloxyethyl, 1-methyl -1-Benzyloxy-2-fluoroethyl, 2,2,2-trichloroethyl, 2-trimethylsilylethyl, 2-(phenylhydroselenoyl)ethyl, tert-butyl, allyl, p-chlorophenyl, p-methoxyphenyl, 2,4-dinitrophenyl, benzyl, p-methoxyphenyl, 3,4-dimethoxyphenyl, o-nitrophenyl, p-nitrophenyl, p-halophenylmethyl, 2,6-dichlorophenylmethyl, p-cyanophenylmethyl, p-phenylphenylmethyl, 2-pyridinemethyl, 4-pyridinemethyl, 3-methyl-2-pyridinemethyl N-oxobridge, diphenylmethyl, P,P'-dinitrodiphenylmethyl, 5-dibenzocycloheptyl, triphenylmethyl, α-naphthyldiphenylmethyl, p-methoxyphenyldiphenylmethyl , di(p-methoxyphenyl)phenylmethyl, tri(p-methoxyphenyl)methyl, 4-(4'-bromobenzoylmethyloxyphenyl)diphenylmethyl, 4,4',4”-tris(4,5-dichlorobenzoiminophenyl)methyl, 4,4',4”-tris(acetylpropionyloxyphenyl)methyl, 4,4',4”-tris(benzoyloxyphenyl)methyl, 3-(imidazol-1-yl)bis(4',4”-dimethoxyphenyl)methyl, 1,1-bis(4-methoxyphenyl)-1'-pyrenemethyl, 9-anthrayl, 9-(9-phenyl)oxanthracene, 9-(9-phenyl-10-oxo)anthrayl, 1,3-benzodithiopentane-2-yl, benzisothiazolyl S,S-dioxane bridge, trimethylsilyl (TMS), triethylsilyl (TES), triisopropylsilyl (TIPS), dimethylisopropylsilyl (IPDMS), diethylisopropylsilyl (DEIPS), dimethylhexylsilyl, tert-butyldimethylsilyl (TBDMS), tert-butyldiphenylsilyl (TBDPS), triphenylmethylsilyl, tri-p-xylylsilyl, triphenylsilyl, diphenylmethylsilyl (DPMS), tert-butylmethoxyphenylsilyl (TBMPS), formate, benzoylformate, acetate, chloroacetate, dichloroacetate, trichloroacetate, trifluoroacetate, methoxyacetate, triphenylmethoxy Phthalate, phenoxyacetate, p-chlorophenoxyacetate, 3-phenylpropionate, 4-oxovalerate (acetylpropionate), 4,4-(ethylidene dithio)valerate (acetylpropionyl dithioacetal), neovalerate, adamantane, crotonate, 4-methoxycrotonate, benzoate, p-phenylbenzoate, 2,4,6-trimethylbenzoate (trimethylbenzoate), methyl carbonate, 9-fluorenylmethyl carbonate (Fmoc), ethyl carbonate, 2,2,2-trichloroethyl carbonate (Troc), 2-(trimethylsilyl)ethyl carbonate (TMSEC), 2-(phenylsulfonyl)ethyl carbonate (Psec), 2-( Triphenylphosphonium (PP) ethyl carbonate (Peoc), isobutyl carbonate, vinyl carbonate, allyl carbonate, p-nitrophenyl carbonate, benzyl carbonate, p-methoxybenzenemethyl carbonate, 3,4-dimethoxybenzenemethyl carbonate, o-nitrobenzenemethyl carbonate, p-nitrobenzenemethyl carbonate, S-benzenemethylthiocarbonate, 4-ethoxy-1-naphthyl carbonate, methyl dithiocarbonate, 2-iodobenzoate, 4-azidobutyrate, 4-nitro-4-methylvalerate, o-(dibromomethyl)benzoate, 2-formylbenzenesulfonate, 2-(methylthiomethoxy)ethyl, 4-(methylthiomethoxy)butyrate, 2-(methylthio) Methoxymethyl)benzoate, 2,6-dichloro-4-methylphenoxyacetic acid, 2,6-dichloro-4-(1,1,3,3-tetramethylbutyl)phenoxyacetic acid, 2,4-bis(1,1-dimethylpropyl)phenoxyacetic acid, dichlorophenylacetic acid, isobutyrate, monosuccinate, (E)-2-methyl-2-butenoate, o-(methoxycarbonyl)benzoate, α-naphthyl ester, nitrate, alkyl N,N,N',N'-tetramethylphosphonic acid diamine, N-phenylcarbamate, borate, dimethylphosphinosulfonyl, 2,4-dinitrophenyl sulfenic acid alkyl ester, sulfate, methanesulfonate (methanesulfonate), benzyl methylsulfonate, and toluenesulfonate (Ts). For the protection of 1,2-diol or 1,3-diol,Protecting groups include methylene acetal, ethylene acetal, 1-tert-butyl ethylene ketal, 1-phenyl ethylene ketal, (4-methoxyphenyl) ethylene acetal, 2,2,2-trichloroethylene acetal, acetone compounds, cyclopentyl ketal, cyclohexyl ketal, cycloheptyl ketal, benzene methylene acetal, p-methoxybenzene methylene acetal, 2,4-dimethoxybenzene methylene ketal, 3,4-dimethoxybenzene methylene acetal, 2-nitrobenzene methylene acetal, methoxymethylene acetal, ethoxymethylene acetal, dimethoxymethylene orthoester, 1-methoxyethylene orthoester, 1 -Ethoxyethylene orthoester, 1,2-dimethoxyethylene orthoester, α-methoxybenzyl orthoester, 1-(N,N-dimethylamino)ethylene derivative, α-(N,N'-dimethylamino)benzyl derivative, 2-oxacyclopentyl orthoester, di-tert-butylsilane (DTBS), 1,3-(1,1,3,3-tetraisopropyldisilane) derivative (TIPDS), tetra-tert-butoxydisiloxane-1,3-diendyl derivative (TBDS), cyclic carbonates, cyclic borates, ethyl borates, and phenyl borates.

[0062] In some embodiments, the hydroxyl protecting group is acetyl, tert-butyl, tert-butoxymethyl, methoxymethyl, tetrahydropyranyl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 2-trimethylsilylethyl, p-chlorophenyl, 2,4-dinitrophenyl, benzyl, benzoyl, p-phenylbenzoyl, 2,6-dichlorobenzyl, diphenylmethyl, p-nitrobenzyl, triphenylmethyl (triphenylmethyl), 4,4′-dimethoxytriphenylmethyl, trimethylsilyl, triethylsilyl, tert-butyldimethylsilyl, tert-butyldiphenylsilyl, triphenylsilyl, triisopropylsilyl, benzoylcarbamate, chloroacetyl, trichloroacetyl, trifluoroacetyl, neopentanoyl, 9-fluorenylmethyl carbonate, methanesulfonate, toluenesulfonate, trifluoromethanesulfonate, triphenylmethyl, monomethoxytriphenylmethyl (MMTr), 4,4′-dimethoxytriphenylmethyl (DMTr) and 4,4′,4″-Trimethoxytriphenylmethyl (TMTr), 2-cyanoethyl (CE or Cne), 2-(trimethylsilyl)ethyl (TSE), 2-(2-nitrophenyl)ethyl, 2-(4-cyanophenyl)ethyl, 2-(4-nitrophenyl)ethyl (NPE), 2-(4-nitrophenylsulfonyl)ethyl, 3,5-dichlorophenyl, 2,4-dimethylphenyl, 2-nitrophenyl, 4-nitrophenyl, 2, 4,6-Trimethylphenyl, 2-(2-nitrophenyl)ethyl, butylthiocarbonyl, 4,4′,4″-tris(benzoyloxy)triphenylmethyl, diphenylcarbamoyl, acetylpropionyl, 2-(dibromomethyl)benzoyl (Dbmb), 2-(isopropylthiomethoxymethyl)benzoyl (Ptmt), 9-phenyloxanthracene-9-yl (pixyl), or 9-(p-methoxyphenyl)xanthine-9-yl (MOX). In some embodiments, each hydroxyl protecting group is independently selected from acetyl, benzyl, tert-butyldimethylsilyl, tert-butyldiphenylsilyl, and 4,4′-dimethoxytriphenylmethyl. In some embodiments, the hydroxyl protecting group is selected from the group consisting of triphenylmethyl, monomethoxytriphenylmethyl, and 4,4′-dimethoxytriphenylmethyl.

[0063] In some embodiments, the phosphorus protecting group is a group attached to the phosphorus bond between nucleotides throughout the oligonucleotide synthesis. In some embodiments, the phosphorus protecting group is attached to the sulfur atom of the phosphate thioester bond between nucleotides. In some embodiments, the phosphorus protecting group is attached to the oxygen atom of the phosphate thioester bond between nucleotides. In some embodiments, the phosphorus protecting group is attached to the oxygen atom of the phosphate ester bond between nucleotides. In some embodiments, the phosphorus protecting group is 2-cyanoethyl (CE or Cne), 2-trimethylsilylethyl, 2-nitroethyl, 2-sulfonylethyl, methyl, benzyl, o-nitrobenzyl, 2-(p-nitrophenyl)ethyl (NPE or Npe), 2-phenylethyl, 3-(N-tert-butylformamido)-1-propyl, 4-oxopentyl, 4-methylthio-1-butyl, 2-cyano-1,1-dimethylethyl, 4-N-methylaminobutyl, 3-(2-pyridyl)-1-propyl, 2-[N-methyl-N-(2-pyridyl)]aminoethyl, 2-(N-formyl,N-methyl)aminoethyl, 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl.

[0064] Protein: As used herein, the term "protein" refers to a polypeptide (i.e., a chain of at least two amino acids linked together by peptide bonds). In some embodiments, a protein comprises only naturally occurring amino acids. In some embodiments, a protein comprises one or more non-naturally occurring amino acids (e.g., portions that form one or more peptide bonds with neighboring amino acids). In some embodiments, one or more residues in the protein chain contain non-amino acid portions (e.g., glycans, etc.). In some embodiments, a protein comprises more than one polypeptide chain linked by one or more disulfide bonds or otherwise associated. In some embodiments, a protein contains L-amino acids, D-amino acids, or both; in some embodiments, a protein contains one or more amino acid modifications or analogs known in the art. Applicable modifications include, for example, terminal acetylation, amidation, methylation, etc. The term "peptide" is generally used to refer to polypeptides less than about 100 amino acids, less than about 50 amino acids, less than 20 amino acids, or less than 10 amino acids in length. In some embodiments, a protein is an antibody, an antibody fragment, its biologically active portion, and / or its characteristic portion.

[0065] Sample: As used herein, the term "sample" refers to a biological sample obtained from or derived from the target source as described herein. In some embodiments, the target source includes an organism, such as an animal or a human. In some embodiments, the biological sample includes biological tissue or fluid. In some embodiments, the biological sample is or includes bone marrow; blood; blood cells; ascites; tissue or fine-needle biopsy samples; body fluids containing cells; free-floating nucleic acids; sputum; saliva; urine; cerebrospinal fluid; peritoneal fluid; pleural fluid; feces; lymph; gynecological fluids; skin swabs; vaginal swabs; oral swabs; nasal swabs; washes or lavages, such as catheter lavages or bronchoalveolar lavages; aspirates; scrapings; bone marrow specimens; tissue biopsy specimens; surgical specimens; feces; other body fluids, secretions and / or excretions; and / or their cells, etc. In some embodiments, the biological sample is or includes cells obtained from an individual. In some embodiments, the sample is a "primary sample" obtained directly from the target source by any appropriate means. For example, in some embodiments, primary biological samples are obtained by methods selected from the group consisting of biopsy (e.g., fine-needle aspiration or tissue biopsy), surgery, and collection of bodily fluids (e.g., blood, lymph, feces, etc.). In some embodiments, as will be clear from the context, the term "sample" refers to a preparation obtained by processing (e.g., by removing one or more components and / or by adding one or more reagents) a primary sample. For example, filtration using a semi-permeable membrane. The "processed sample" may include, for example, nucleic acids or proteins obtained by means of techniques such as self-extraction or by subjecting the primary sample to processes such as amplification or reverse transcription of mRNA, isolation and / or purification of certain components.

[0066] Stereochemical isomers: As used herein, "stereochemical isomers" refers to different compounds composed of identical atoms bonded in the same bond sequence but having different three-dimensional structures that are not interchangeable. In some embodiments of the invention, the provided chemical composition may be a pure formulation comprising individual stereochemical isomers of the compound; in some embodiments, the provided chemical composition may be a mixture comprising two or more stereochemical isomers of the compound. In some embodiments, the mixture contains equal amounts of different stereochemical isomers; in some embodiments, the mixture contains different amounts of at least two different stereochemical isomers. In some embodiments, the chemical composition may contain all diastereomers and / or enantiomers of the compound. In some embodiments, the chemical composition may contain less than all diastereomers and / or enantiomers of the compound. In some embodiments, if a specific enantiomer of the compound of the invention is desired, it may be prepared, for example, by asymmetric synthesis or by chiral auxiliary derivatization, wherein the resulting diastereochemical mixture is isolated and the auxiliary group is cleaved to provide a pure desired enantiomer. Alternatively, when the molecule contains a basic functional group such as an amino group, diastereomeric salts are formed with a suitable optically active acid and resolved, for example, by fractional crystallization.

[0067] Subject: As used herein, the term "subject" or "test subject" refers to any organism to which a compound or composition provided according to the present invention is administered, for example, for experimental, diagnostic, preventive, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms; etc.) and plants. In some embodiments, the subject may have and / or be susceptible to diseases, conditions, and / or symptoms.

[0068] Generally speaking: As used herein, the term "generally speaking" refers to a qualitative situation that shows the extent or degree of a target characteristic or property, either overall or close to that of the whole. Those skilled in the art of biology will understand that biological and chemical phenomena rarely reach completeness and / or proceed to completeness, or achieve or avoid absolute results, if they have ever occurred. Therefore, the term "generally speaking" is used herein to capture the inherent lack of completeness in many biological and / or chemical phenomena.

[0069] Suffering from: An individual who has been diagnosed with and / or exhibits one or more symptoms of a disease, condition and / or illness.

[0070] Susceptible: An individual "susceptible" to a disease, condition, and / or symptom is an individual at higher risk of developing said disease, condition, and / or symptom than the general population. In some embodiments, an individual susceptible to a disease, condition, and / or symptom may not have been diagnosed with said disease, condition, and / or symptom. In some embodiments, an individual susceptible to a disease, condition, and / or symptom may exhibit symptoms of said disease, condition, and / or symptom. In some embodiments, an individual susceptible to a disease, condition, and / or symptom may not exhibit symptoms of said disease, condition, and / or symptom. In some embodiments, an individual susceptible to a disease, condition, and / or symptom will develop said disease, condition, and / or symptom. In some embodiments, an individual susceptible to a disease, condition, and / or symptom will not develop said disease, condition, and / or symptom.

[0071] Systemic: As used herein, the phrases “systemic administration,” “administered systemically,” “peripheral administration,” and “administered peripherally” have their meanings as understood in the art and refer to the administration of a compound or composition to bring it into the recipient’s system.

[0072] Tautomerism: As used herein, the phrase “tautomerism” describes different isomers of an organic compound that can readily interconvert. Tautomers are characterized by form migration of hydrogen atoms or protons, accompanied by the conversion of single bonds and adjacent double bonds. In some embodiments, tautomers may be generated by proton shift tautomerism (i.e., proton repositioning). In some embodiments, tautomers may be generated by valence tautomerism (i.e., rapid reconfiguration of bond electrons). All described tautomerisms are intended to be included within the scope of this invention. In some embodiments, the tautomerisms of the compound exist in dynamic equilibrium with each other, thus attempts to prepare individual materials result in the formation of mixtures. In some embodiments, the tautomerisms of the compound are separable and separable compounds. In some embodiments of the invention, chemical compositions may be provided as pure formulations comprising or including a single tautomerism of the compound. In some embodiments of the invention, chemical compositions may be provided as mixtures of two or more tautomerisms of the compound. In some embodiments, the mixture contains equal amounts of different tautomerisms; in some embodiments, the mixture contains different amounts of at least two different tautomerisms of the compound. In some embodiments of the invention, the chemical composition may contain all tautomeric forms of the compound. In some embodiments of the invention, the chemical composition may contain fewer than all tautomeric forms of the compound. In some embodiments of the invention, the chemical composition may contain one or more tautomeric forms of the compound, the amount of which varies over time due to interconversion. In some embodiments of the invention, the tautomer is a keto-enol tautomer. Those skilled in the art will recognize that keto-enol tautomers can be “trapped” (i.e., chemically modified to retain their “enol” form) using any suitable reagent known in the chemical field to provide an enol derivative that can subsequently be isolated using one or more suitable techniques known in the art. Unless otherwise indicated, the invention covers all tautomeric forms of the relevant compounds, whether in pure form or in mixtures thereof.

[0073] Therapeutic agent: As used herein, the phrase “therapeutic agent” means any agent that, when administered to a subject, has a therapeutic effect and / or induces the desired biological and / or pharmacological action. In some embodiments, a therapeutic agent is any substance that can be used to reduce, improve, alleviate, inhibit, prevent, delay the onset of a disease, condition and / or symptom, reduce its severity, and / or decrease the occurrence of one or more of its symptoms or features.

[0074] Therapeutic Effective Amount: As used herein, the term "therapeutic effective amount" refers to the amount of a substance (e.g., a therapeutic agent, composition, and / or formulation) that, when administered as part of a treatment regimen, elicits a desired biological response. In some embodiments, a therapeutically effective amount of a substance is an amount sufficient to treat, diagnose, prevent, and / or delay the onset of a disease, condition, and / or symptom when administered to a subject suffering from or susceptible to such a disease, condition, and / or symptom. As will be appreciated by those skilled in the art, the effective amount of a substance can vary depending on factors such as the desired biological endpoint, the material to be delivered, the target cells or tissues, etc. For example, an effective amount of a compound in a formulation for treating a disease, condition, and / or symptom is an amount that reduces, improves, alleviates, inhibits, prevents, delays the onset of, reduces the severity of, and / or reduces the occurrence of one or more of its symptoms or features. In some embodiments, the therapeutically effective amount is administered in a single dose; in some embodiments, delivery of the therapeutically effective amount requires multiple unit doses.

[0075] Treatment: As used herein, the term "treatment" means any method used to partially or completely alleviate, improve, mitigate, suppress, prevent, delay the onset of a disease, symptom, and / or condition, reduce its severity, and / or decrease the occurrence of one or more of its symptoms or features. Treatment may be administered to a subject who does not exhibit signs of a disease, symptom, and / or condition. In some embodiments, treatment may be administered to a subject who exhibits only early signs of a disease, symptom, and / or condition, for example, to achieve the purpose of reducing the risk of developing lesions associated with said disease, symptom, and / or condition.

[0076] Unsaturated: As used in this article, “unsaturated” means that a part has one or more unsaturated units.

[0077] Unit dose: As used herein, “unit dose” means the amount administered in the form of a single dose and / or in the form of a pharmaceutical composition in physically discontinuous units. In many embodiments, a unit dose contains a predetermined amount of active agent. In some embodiments, a unit dose contains the entire single dose of the agent. In some embodiments, more than one unit dose is administered to achieve the overall single dose. In some embodiments, multiple unit doses are required or anticipated to achieve the intended effect. A unit dose may be, for example, a volume of liquid (e.g., an acceptable carrier) containing a predetermined amount of one or more therapeutic agents, a predetermined amount of one or more therapeutic agents in solid form, a sustained-release formulation containing a predetermined amount of one or more therapeutic agents, or a drug delivery device, etc. It should be understood that a unit dose may be present in a formulation that includes any of a plurality of components in addition to one or more therapeutic agents. For example, acceptable carriers (e.g., pharmaceutically acceptable carriers), diluents, stabilizers, buffers, preservatives, etc., may be included as described below. Those skilled in the art will understand that in many embodiments, the overall appropriate daily dose of a particular therapeutic agent may include a portion of a unit dose or multiple unit doses, and may be determined, for example, by an attending physician within the bounds of reasonable medical judgment. In some implementations, the specific effective dose level for any particular subject or organism may depend on a variety of factors, including the condition being treated and its severity; the activity of the specific active compound used; the specific composition used; the subject's age, weight, general health status, sex, and diet; the timing of administration and excretion rate of the specific active compound used; the duration of treatment; drugs and / or other therapies used in combination with or concurrently with one or more specific compounds used; and similar factors well known in the medical field.

[0078] Wild-type: As used herein, the term "wild-type" has its meaning as understood in the art, referring to an entity having the structure and / or activity found in nature in a "normal" state or background (as opposed to mutation, disease, alteration, etc.). Those skilled in the art will understand that wild-type genes and polypeptides often exist in many different forms (e.g., alleles).

[0079] Nucleic Acids: The term “nucleic acid” includes any nucleotide, its analogues, and its polymers. As used herein, the term “polynucleotide” refers to a polymeric form of nucleotide (ribonucleotide (RNA) or deoxyribonucleotide (DNA)) of any length. These terms refer to the primary structure of a molecule and therefore include double-stranded and single-stranded DNA as well as double-stranded and single-stranded RNA. These terms include analogues of RNA or DNA derived from nucleotide analogues and modified polynucleotides (such as, but not limited to, methylated, protected, and / or capped nucleotides or polynucleotides) as equivalents. The terms cover polynucleotides or oligonucleotides (RNA) and polydeoxynucleotides or oligodeoxynucleotides (DNA); RNA or DNA derived from N-glycosides or C-glycosides of nucleoside bases and / or modified nucleoside bases; nucleic acids derived from sugars and / or modified sugars; and nucleic acids derived from phosphate ester bridges and / or modified phosphorus bridges (also referred to herein as “nucleotide interlinking”). The terminology encompasses nucleic acids containing any combination of nucleoside bases, modified nucleoside bases, sugars, modified sugars, phosphate bridges, or modified phosphorus bridges. Examples include, but are not limited to, nucleic acids containing a ribose moiety, nucleic acids containing a deoxyribose moiety, nucleic acids containing both ribose and deoxyribose moieties, and nucleic acids containing both ribose and modified ribose moieties. The prefix "multiple" indicates that the nucleic acid contains 2 to approximately 10,000 nucleotide monomer units, and the prefix "oligo" indicates that the nucleic acid contains 2 to approximately 200 nucleotide monomer units.

[0080] Nucleotide: As used herein, the term "nucleotide" refers to a monomeric unit of a polynucleotide consisting of a heterocyclic base, a sugar, and one or more phosphate ester groups or phosphorus-containing nucleotides linked together. Naturally occurring bases (guanine (G), adenine (A), cytosine (C), thymine (T), and uracil (U)) are derivatives of purines or pyrimidines, but it should be understood that naturally occurring and non-naturally occurring base analogues are also included. Naturally occurring sugars are pentose (five-carbon sugars) deoxyribose (forming DNA) or ribose (forming RNA), but it should be understood that naturally occurring and non-naturally occurring sugar analogues are also included. Nucleotides are formed by the linkage of nucleotides to form nucleic acids or polynucleotides. Many nucleotide linkages are known in the art (e.g., but not limited to phosphate esters, thiophosphate esters, borophosphate esters, etc.). Artificial nucleic acids include PNA (peptide nucleic acid), phosphate triesters, thiophosphates, H-phosphonates, aminophosphates, borophosphates, methylphosphonates, phosphonoacetates, thiophosphonoacetates, and other variants of the phosphate ester backbone of natural nucleic acids, as described herein.

[0081] Nucleoside: The term "nucleoside" refers to the portion in which a nucleoside base or a modified nucleoside base is covalently bound to a sugar or a modified sugar.

[0082] Sugar: The term “sugar” refers to a monosaccharide in a closed and / or open form. Sugars include, but are not limited to, ribose, deoxyribose, furanopentose, pyranopentose, and pyranohexose moieties. As used herein, the term also covers structural analogs used in place of conventional sugar molecules, such as diols, whose polymers form the backbone of nucleic acid analogs diol nucleic acids (“GNA”).

[0083] Modified sugars: The term "modified sugar" refers to a portion of sugar that can be substituted. Modified sugars mimic the spatial arrangement, electronic properties, or other physicochemical properties of sugars.

[0084] Nucleoside base: The term "nucleoside base" refers to the portion of a nucleic acid involved in the hydrogen bond that causes one nucleic acid strand to bind to another complementary strand in a sequence-specific manner. The most common naturally occurring nucleoside bases are adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the naturally occurring nucleoside base is a modified adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the naturally occurring nucleoside base is methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the nucleoside base is a "modified nucleoside base," such as a nucleoside base other than adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the modified nucleoside base is methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the modified nucleoside bases mimic the spatial arrangement, electronic properties, or other physicochemical properties of nucleoside bases, and retain the hydrogen bonds that allow one nucleic acid strand to bind to another nucleic acid strand in a sequence-specific manner. In some embodiments, the modified nucleoside bases can pair with all five naturally occurring bases (uracil, thymine, adenine, cytosine, or guanine) without substantially affecting unwinding behavior, recognition by intracellular enzymes, or activity of the oligonucleotide duplex.

[0085] Chiral ligand: The term "chiral ligand" or "chiral auxiliary" refers to a portion that is chiral and can be incorporated into a reaction to enable the reaction to proceed with a certain stereoselectivity.

[0086] Condensation reagent: In a condensation reaction, the term "condensation reagent" refers to a reagent that activates a less reactive site and makes it more susceptible to attack by another reagent. In some embodiments, the other reagent is a nucleophile.

[0087] Blocking group: The term "blocking group" refers to a group that masks the reactivity of a functional group. The functional group can then be demasked by removing the blocking group. In some embodiments, the blocking group is a protecting group.

[0088] Part: The term "part" refers to a specific segment or functional group of a molecule. A chemical part is often considered to be a chemical entity embedded in or attached to a molecule.

[0089] Solid support: The term "solid support" refers to any support that enables the synthesis of nucleic acids. In some embodiments, the term refers to a glass or polymer that is insoluble in the medium used to perform the reaction steps for synthesizing nucleic acids and is derived to contain reactive groups. In some embodiments, the solid support is highly cross-linked polystyrene (HCP) or controlled-porosity glass (CPG). In some embodiments, the solid support is controlled-porosity glass (CPG). In some embodiments, the solid support is a hybrid support of controlled-porosity glass (CPG) and highly cross-linked polystyrene (HCP).

[0090] Linkage portion: The term “linkage portion” refers to any portion that is optionally located between the terminal nucleoside and the solid carrier or between the terminal nucleoside and another nucleoside, nucleotide or nucleic acid.

[0091] DNA molecule: "DNA molecule" refers to the polymeric form of deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in their single-stranded or double-stranded helical form. This term refers only to the primary and secondary structures of the molecule and does not limit it to any particular tertiary form. Therefore, this term includes double-stranded DNA, particularly found in linear DNA molecules (e.g., restriction fragments), viruses, plasmids, and chromosomes. When discussing the structure of a specific double-stranded DNA molecule, the sequence is described in this document according to the normal convention of giving the sequence along only the non-transcribed DNA strand (i.e., the strand with a sequence homologous to mRNA) in the 5' to 3' direction.

[0092] Coding sequence: A DNA “coding sequence” or “coding region” is a double-stranded DNA sequence that is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate expression control sequences. The boundaries of a coding sequence (“open reading frame” or “ORF”) are determined by a start codon at the 5′ (amino) end and a translation stop codon at the 3′ (carboxyl) end. Coding sequences can include, but are not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and synthetic DNA sequences. Polyadenylation signals and transcription termination sequences are typically located at the 3′ end of the coding sequence. The term “non-coding sequence” or “non-coding region” refers to regions of a polynucleotide sequence that are not translated into amino acids (e.g., untranslated regions at the 5′ and 3′ ends).

[0093] Reading frame: The term "reading frame" refers to one of the six possible reading frames (three in each direction) of a double-stranded DNA molecule. The reading frame used determines which codons are used to encode amino acids within the coding sequence of the DNA molecule.

[0094] Antisense: As used in this article, an "antisense" nucleic acid molecule contains a "sense" nucleic acid that is complementary to the coding strand of a protein, such as a nucleotide sequence complementary to the coding strand of a double-stranded cDNA molecule, an mRNA sequence, or a gene coding strand. Therefore, antisense nucleic acid molecules can associate with sense nucleic acid molecules via hydrogen bonds.

[0095] Wobble position: As used herein, a "wobble position" refers to the third position of a codon. In some embodiments, mutations in the DNA molecule at the wobble position of a codon produce silent or conserved mutations at the amino acid level. For example, there are four codons encoding glycine: GGU, GGC, GGA, and GGG. Therefore, any wobble position nucleotide mutation to any other nucleotide selected from A, U, C, and G does not result in a change in the encoded protein at the amino acid level and is thus a silent substitution.

[0096] Silent substitution: A "silent substitution" or "silent mutation" is a substitution or mutation in which a nucleotide within a codon is modified, but does not result in a change in the amino acid residue encoded by said codon. Examples include mutations at the third position of a codon and mutations at the first position of certain codons, such as in the codon "CGG," which still encodes Arg when mutated to AGG.

[0097] Gene: As used herein, the terms “gene,” “recombinant gene,” and “gene construct” refer to a DNA molecule or a portion thereof that encodes a protein or a portion thereof. A DNA molecule may contain open reading frames (such as exon sequences) that encode a protein and may also include intron sequences. As used herein, an intron is a DNA sequence present in a given gene that is not translated into a protein and is found between exons in some, but not all, cases. Where desirable, a gene may be operatively linked to (or may contain) one or more promoters, enhancers, repressors, and / or other regulatory sequences to regulate gene activity or expression, as is well known in the art.

[0098] Complementary DNA: As used herein, “complementary DNA” or “cDNA” includes recombinant polynucleotides synthesized by reverse transcription of mRNA from which intercalation sequences (introns) have been removed.

[0099] Homology: "Homology," "identity," or "similarity" refers to the sequence similarity between two nucleic acid molecules. Homology and identity can each be determined by comparing positions in sequences that can be compared for comparative purposes. When equivalent positions in the compared sequences are occupied by the same bases, then the molecules are identical at that position; when equivalent sites are occupied by the same or similar nucleic acid residues (e.g., similar in spatial and / or electronic properties), then the molecules can be said to be homologous (similar) at that position. Homology / similarity or identity percentages are expressed as a function of the number of identical or similar nucleic acids at positions shared by the compared sequences. "Irrelevant" or "non-homologous" sequences share less than 40%, less than 35%, less than 30%, or less than 25% identity with the sequences described herein. The absence of residues (amino acids or nucleic acids) or the presence of additional residues also reduces identity and homology / similarity when comparing two sequences.

[0100] In some embodiments, the term "homology" describes a mathematically based sequence similarity comparison used to identify genes with similar functions or motifs. The nucleic acid sequences described herein can be used as "query sequences" to search relative to public databases, for example, to identify other family members, related sequences, or homologs. In some embodiments, the search can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul et al. (1990) J. Mol. Biol. 215: 403-10. In some embodiments, a BLAST nucleotide search can be performed using the NBLAST program (score = 100, word length = 12) to obtain nucleotide sequences homologous to the nucleic acid molecules of the present invention. In some embodiments, for obtaining vacancy alignments for comparative purposes, vacancy BLAST can be used as described in Altschul et al., (1997) Nucleic Acids Res. 25(17): 3389-3402. When using the BLAST and vacancy BLAST procedures, the default parameters of the corresponding procedures (such as XBLAST and BLAST) can be used (see www.ncbi.nlm.nih.gov).

[0101] Identity: As used in this article, “identity” refers to the percentage of identical nucleotide residues at corresponding positions in two or more sequences when sequences are aligned to maximize sequence matching, i.e., taking into account gaps and insertions. Identity can be readily calculated by known methods, including but not limited to those described in Computational Molecular Biology, Lesk, AM ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, AM and Griffin, HG ed., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J. ed., M Stockton Press, New York, 1991; and Carillo, H. and Lipman, D., SIAM J. Applied Math., 48:1073 (1988). The methods used to determine identity are designed to give the maximum match between the tested sequences. Furthermore, the methods used to determine identity are compiled in publicly available computer programs. Computer program methods for determining identity between two sequences include, but are not limited to, the GCG package (Devereux, J. et al., Nucleic Acids Research 12(1):387(1984)), BLASTP, BLASTN, and FASTA (Altschul, SF et al., J. Molec. Biol. 215:403-410(1990) and Altschul et al. Nuc. Acids Res. 25:3389-3402(1997)). The BLAST X procedure is publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al., NCBINLM NIH Bethesda, Md. 20894; Altschul, S. et al., J.Mol.Biol. 215: 403-410 (1990)). The Smith-Waterman algorithm is also well-known and can be used to determine identity.

[0102] Heterologous: A "heterologous" region of a DNA sequence is an identifiable DNA segment of a larger DNA sequence that is not found in nature to be associated with that larger sequence. Therefore, when a heterologous region encodes a mammalian gene, the gene can typically be side-joined by DNA that is not side-joined with mammalian genomic DNA in the genome of the source organism. Another example of a heterologous coding sequence is a sequence in which the coding sequence itself is not found in nature (e.g., a cDNA containing introns or a synthetic sequence having codons or motifs different from those of an unmodified gene). Allelic variations or naturally occurring mutations do not produce heterologous DNA regions as defined herein.

[0103] Conversion mutation: The term "conversion mutation" refers to a base change in a DNA sequence in which a pyrimidine (cytidine (C) or thymidine (T)) is replaced by another pyrimidine, or a purine (adenosine (A) or guanosine (G)) is replaced by another purine.

[0104] Transversion mutation: The term “transversion mutation” refers to a base change in a DNA sequence in which a pyrimidine (cytidine (C) or thymidine (T)) is replaced by a purine (adenosine (A) or guanosine (G)), or a purine is replaced by a pyrimidine.

[0105] Oligonucleotide: The term “oligonucleotide” refers to a polymer or oligomer of nucleotide monomers containing any combination of nucleoside bases, modified nucleoside bases, sugars, modified sugars, phosphate ester bridges, or modified phosphorus bridges (also referred to herein as “nucleotide linkages”, which are further defined herein).

[0106] Oligonucleotides can be single-stranded or double-stranded. As used herein, the term "oligonucleotide chain" encompasses single-stranded oligonucleotides. Single-stranded oligonucleotides may have double-stranded regions, and double-stranded oligonucleotides may have single-stranded regions. Exemplary oligonucleotides include, but are not limited to, structural genes, genes including control and termination regions, self-replicating systems (such as viral or plasmid DNA), single-stranded and double-stranded siRNAs and other RNA interference agents (RNAi agents or iRNA agents), shRNA, antisense oligonucleotides, ribonucleases, microRNAs, microRNA mimics, supermicroRNAs, aptamers, antisense microRNAs, microRNA antagonists, Ul connectives, triple-stranded oligonucleotides, G-quadruplex oligonucleotides, RNA activators, immunostimulatory oligonucleotides, and decoy oligonucleotides.

[0107] Effectively inducing RNA interference, both double-stranded and single-stranded oligonucleotides, are also referred to herein as siRNA, RNAi agents, or iRNA agents. In some embodiments, these RNA interference-inducing oligonucleotides associate with a cytoplasmic multiprotein complex called an RNAi-induced silencing complex (RISC). In many embodiments, single-stranded and double-stranded RNAi agents are of sufficient length to be cleaved by endogenous molecules, such as Dicer, to produce smaller oligonucleotides that can enter the RISC mechanism and participate in RISC-mediated cleavage of target sequences (e.g., target mRNA).

[0108] The oligonucleotides of the present invention can have various lengths. In certain embodiments, the length of the oligonucleotide can range from about 2 to about 200 nucleotides. In various related embodiments, the lengths of single-stranded, double-stranded, and triple-stranded oligonucleotides can range from about 4 to about 10 nucleotides, about 10 to about 50 nucleotides, about 20 to about 50 nucleotides, about 15 to about 30 nucleotides, and about 20 to about 30 nucleotides. In some embodiments, the length of the oligonucleotide is about 9 to about 39 nucleotides. In some embodiments, the length of the oligonucleotide is at least 4 nucleotides. In some embodiments, the length of the oligonucleotide is at least 5 nucleotides. In some embodiments, the length of the oligonucleotide is at least 6 nucleotides. In some embodiments, the length of the oligonucleotide is at least 7 nucleotides. In some embodiments, the length of the oligonucleotide is at least 8 nucleotides. In some embodiments, the length of the oligonucleotide is at least 9 nucleotides. In some embodiments, the length of the oligonucleotide is at least 10 nucleotides. In some embodiments, the length of the oligonucleotide is at least 11 nucleotides. In some embodiments, the length of the oligonucleotide is at least 12 nucleotides. In some embodiments, the length of the oligonucleotide is at least 15 nucleotides. In some embodiments, the oligonucleotide is at least 20 nucleotides long. In some embodiments, the oligonucleotide is at least 25 nucleotides long. In some embodiments, the oligonucleotide is at least 30 nucleotides long. In some embodiments, the oligonucleotide is a duplex with a complementary strand of at least 18 nucleotides long. In some embodiments, the oligonucleotide is a duplex with a complementary strand of at least 21 nucleotides long.

[0109] Nucleotide linkage: As used herein, the phrase “nucleotide linkage” generally refers to a phosphorus-containing linkage between nucleotide units of an oligonucleotide and is interchangeable with “sugar linkage” and “phosphoatom bridge” as used above and herein. In some embodiments, nucleotide linkage is a phosphodiester linkage as found in naturally occurring DNA and RNA molecules. In some embodiments, nucleotide linkage is a “modified nucleotide linkage” in which the oxygen atoms of the phosphodiester linkage are optionally and independently replaced by an organic or inorganic portion. In some embodiments, the organic or inorganic portion is selected from, but not limited to, =S, =Se, =NR', -SR', -SeR', -N(R')2, B(R')3, -S-, -Se-, and -N(R')-, wherein each R' is independently defined and described below. In some embodiments, nucleotide linkage is a phosphotriester linkage or a phosphothiodiester linkage. Or modified thiophosphate triesters are used for linking. Those skilled in the art will understand that, due to the presence of acidic or basic moieties in the linking, nucleotide links can exist in anionic or cationic form at a given pH.

[0110] Unless otherwise specified, when used with oligonucleotide sequences, s, s1, s2, s3, s4, s5, s6 and s7 each independently represent the internucleotide linkages of the following modifications as described in Table 1.

[0111] Table 1. Exemplary modified nucleotide linkages.

[0112]

[0113]

[0114]

[0115] For example, (Rp,Sp)-ATsCs1GA has a phosphate thioester nucleotide linker between T and C. And 2) the structure between C and G The internucleotide linkages of phosphothiophosphate triesters. Unless otherwise specified, the Rp / Sp symbols preceding the oligonucleotide sequence, sequentially from 5' to 3' of the oligonucleotide sequence, describe the configuration of the chiral phosphorus atom in the internucleotide linkage. For example, in (Rp,Sp)-ATsCs1GA, the phosphorus in the "s" linkage between T and C has the Rp configuration, and the phosphorus in the "s1" linkage between C and G has the Sp configuration. In some embodiments, "all (Rp)" or "all (Sp)" is used to indicate that all chiral phosphorus atoms in the oligonucleotide have the same Rp or Sp configuration, respectively. For example, all(Rp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC indicates that all chiral phosphorus atoms in the oligonucleotide have the Rp configuration; all(Sp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC indicates that all chiral phosphorus atoms in the oligonucleotide have the Sp configuration.

[0116] Oligonucleotide type: As used herein, the phrase “oligonucleotide type” is used to define a specific base sequence, backbone linkage pattern (i.e., internucleotide linkage pattern, such as phosphate esters, thiophosphate esters, etc.), backbone chiral center pattern (i.e., linkage phosphorus stereochemistry pattern (Rp / Sp)), and backbone phosphorus modification pattern (e.g., “-XLR” in Formula I). 1 Oligonucleotides with a common specified "type" are structurally identical to each other.

[0117] Those skilled in the art will understand that the synthetic method of the present invention provides a degree of control during the synthesis of oligonucleotide chains so that each nucleotide unit of the oligonucleotide chain can be designed in advance to have a specific stereochemistry at the phosphate link and / or a specific modification at the phosphate link, and / or a specific base and / or a specific sugar. In some embodiments, the oligonucleotide chain is designed in advance to have a specific combination having a stereocenter at the phosphate link. In some embodiments, the oligonucleotide chain is designed and / or determined to have a specific combination having a modification at the phosphate link. In some embodiments, the oligonucleotide chain is designed and / or selected to have a specific combination having a base. In some embodiments, the oligonucleotide chain is designed and / or selected to have a specific combination having one or more structural features. The present invention provides compositions comprising a plurality of oligonucleotide molecules or compositions composed of a plurality of oligonucleotide molecules (e.g., chiral-controlled oligonucleotide compositions). In some embodiments, all said molecules are of the same type (i.e., structurally identical to each other). However, in many embodiments, the provided compositions typically contain a plurality of different types of oligonucleotides in predetermined relative amounts.

[0118] Chiral control: As used herein, “chiral control” refers to the stereochemical symbol that controls each chiral phosphorus link within the oligonucleotide chain. The phrase “chiral-controlled oligonucleotide” refers to an oligonucleotide in which the chiral phosphorus link exists in a single diastereomeric form.

[0119] Chiral-controlled oligonucleotide compositions: As used herein, the phrase "chiral-controlled oligonucleotide composition" refers to an oligonucleotide composition containing predetermined levels of individual oligonucleotide types. For example, in some embodiments, a chiral-controlled oligonucleotide composition comprises one oligonucleotide type. In some embodiments, a chiral-controlled oligonucleotide composition comprises more than one oligonucleotide type. In some embodiments, a chiral-controlled oligonucleotide composition comprises a mixture of multiple oligonucleotide types. Exemplary chiral-controlled oligonucleotide compositions are further described herein.

[0120] Chiral purity: As used herein, the phrase “chiral purity” is used to describe a chiral-controlled oligonucleotide composition in which all oligonucleotides exist in a single diastereomeric form with respect to the phosphate bond.

[0121] Chiral homogeneity: As used herein, the phrase “chiral homogeneity” describes an oligonucleotide molecule or type in which all nucleotide units have the same stereochemistry at the phosphorus-linked junction. For example, an oligonucleotide in which all nucleotide units have Rp stereochemistry at the phosphorus-linked junction is chiral homogeneous. Similarly, an oligonucleotide in which all nucleotide units have Sp stereochemistry at the phosphorus-linked junction is chiral homogeneous.

[0122] Predetermined: Predetermined means, for example, intentionally selected, as opposed to random occurrence or achievement. Those skilled in the art will understand upon reading this specification that the present invention provides novel and remarkable techniques that allow selection of specific oligonucleotide types to prepare and / or include in the provided compositions, and further allow precise control of the preparation of selected specific types optionally in selected specific relative amounts to prepare the provided compositions. The provided compositions are “predetermined” as described herein. Compositions that may contain certain individual oligonucleotide types happen to have been produced by processes that intentionally produce specific oligonucleotide types in a way that cannot be controlled, are not “predetermined” compositions. In some embodiments, a predetermined composition is a composition that can be intentionally reproduced (e.g., by repeating a controlled process).

[0123] Linked phosphorus: As defined herein, the phrase “linked phosphorus” is used to indicate that the specific phosphorus atom mentioned is a phosphorus atom present in an internucleotide link, said phosphorus atom corresponding to a phosphorus atom of a phosphodiester in an internucleotide link, such as that present in naturally occurring DNA and RNA. In some embodiments, the linked phosphorus atom is in a modified internucleotide link, wherein each oxygen atom of the phosphodiester link is optionally and independently replaced by an organic or inorganic portion. In some embodiments, the linked phosphorus atom is P* of Formula I. In some embodiments, the linked phosphorus atom is chiral. In some embodiments, the chiral linked phosphorus atom is P* of Formula I.

[0124] P-modification: As used herein, the term "P-modification" refers to any modification at the phosphorus bond other than stereochemical modification. In some embodiments, P-modification comprises adding, substituting, or removing a side-mounted portion covalently attached to the phosphorus bond. In some embodiments, "P-modification" is -XLR 1 X, L and R 1 Each is independent as defined and described herein and below.

[0125] Block polymer: As used herein, the term "block polymer" refers to an oligonucleotide chain characterized by the presence of at least two consecutive nucleotide units sharing a common structural feature at the internucleotide phosphorus bond. A common structural feature refers to a shared stereochemistry or common modification at the phosphorus bond. In some embodiments, the consecutive nucleotide units sharing a common structural feature at at least two internucleotide phosphorus bonds are referred to as a "block".

[0126] In some embodiments, the block polymer is a "stereoblock polymer," for example, at least two consecutive nucleotide units having the same stereochemistry at the phosphorus-linked junction. The at least two consecutive nucleotide units form a "stereoblock." For example, (Sp,Sp)-ATsCs1GA is a stereoblock polymer because at least two consecutive nucleotide units, Ts and Cs1, have the same stereochemistry (both Sp) at the phosphorus-linked junction. In the same oligonucleotide (Sp,Sp)-ATsCs1GA, TsCs1 forms the block, and it is a stereoblock.

[0127] In some embodiments, the block polymer is a "P-modified block polymer," for example, at least two consecutive nucleotide units have the same modification at the phosphorus linker. The at least two consecutive nucleotide units form a "P-modified block." For example, (Rp,Sp)-ATsCsGA is a P-modified block polymer because at least two consecutive nucleotide units, Ts and Cs, have the same P modification (i.e., both are phosphothioesters). In the same oligonucleotide (Rp,Sp)-ATsCsGA, TsCs forms the block, and it is a P-modified block.

[0128] In some embodiments, the block polymer is a "linked block polymer," for example, at least two consecutive nucleotide units having the same stereochemistry and the same modification at the phosphorus link. At least two consecutive nucleotide units form a "linked block." For example, (Rp,Rp)-ATsCsGA is a linked block polymer because at least two consecutive nucleotide units, Ts and Cs, have the same stereochemistry (both Rp) and P modification (both phosphate thioesters). In the same oligonucleotide (Rp,Rp)-ATsCsGA, TsCs forms the block, and it is a linked block.

[0129] In some embodiments, the block aggregate comprises one or more blocks independently selected from stereoblocks, P-modified blocks, and linked blocks. In some embodiments, the block aggregate is a stereoblock aggregate with respect to one block, and / or a P-modified block aggregate with respect to another block, and / or a linked block aggregate with respect to another block. For example, (Rp, Rp, Rp, Rp, Rp, Sp, Sp, Sp)-AAsTsCsGsAs1Ts1Cs1Gs1ATCG is a stereoblock polymer with respect to the stereoblock AsTsCsGsAs1 (all Rp at the phosphorus-linked sites) or Ts1Cs1Gs1 (all Sp at the phosphorus-linked sites). It is a P-modified block polymer with respect to the P-modified blocks AsTsCsGs (all s-linked) or As1Ts1Cs1Gs1 (all s1-linked). It is a bonded block polymer with respect to the bonded blocks AsTsCsGs (all Rp at the phosphorus-linked sites and all s-linked) or Ts1Cs1Gs1 (all Sp at the phosphorus-linked sites and all s1-linked).

[0130] Alternating polymers: As used herein, the term "alternating polymer" refers to an oligonucleotide chain characterized by two consecutive nucleotide units that do not share a specific structural feature at the phosphate bond between the nucleotides. In some embodiments, alternating polymers are designed to include repeating patterns. In some embodiments, alternating polymers are designed not to include repeating patterns.

[0131] In some implementations, the alternating polymer is a "stereo-alternating polymer," where two consecutive nucleotide units do not have the same stereochemistry at the phosphorus linker. For example, (Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC.

[0132] In some implementations, the alternating polymer is a "P-modified alternating polymer," where two consecutive nucleotide units do not have the same modification at the linking phosphorus. For example, all(Sp)-CAs1GsT, where each linking phosphorus has a P modification different from the others.

[0133] In some implementations, the alternating polymer is a “linked alternating polymer”, where two consecutive nucleotide units do not have the same stereochemistry or modification at the linking phosphorus. For example, (Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, SpRp, Sp, Rp, Sp, Rp, Sp, Rp)-GsCs1CsTs1CsAs1GsTs1CsTs1GsCs1TsTs2CsGs3CsAs4CsC.

[0134] Monomer: As used herein, a "monomer" refers to an oligonucleotide chain in which the structural features of individual nucleotide units are such that all nucleotide units within the chain share at least one common structural feature at the phosphorus-linked sites between nucleotides. A common structural feature refers to a shared stereochemistry at the phosphorus-linked sites or a shared modification at the phosphorus-linked sites.

[0135] In some implementations, the monomer is a "stereomonomer," meaning that all nucleotide units have the same stereochemistry at the phosphorus linker. For example, all(Sp)-CsAs1GsT, where all links have Sp phosphorus.

[0136] In some implementations, the monomer is a "P-modified monomer," where all nucleotide units have the same modification at the phosphorus linker. For example, (Rp,Sp,Rp,Sp,Rp,Sp,Rp,Sp,Rp,SpRp,Sp,Rp,Sp,Rp,Sp,Rp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC, where all internucleotide links are phosphothioesters.

[0137] In some implementations, the monomer is a "linked monomer," where all nucleotide units have the same stereochemistry and the same modification at the linked phosphorus. For example, all(Sp)-GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC, where all internucleotide linkages are phosphothioesters with Sp-linked phosphorus.

[0138] Gapmer: As used herein, the term "gapmer" refers to an oligonucleotide chain characterized in that at least one nucleotide in the oligonucleotide chain is a phosphodiester bond (as seen in naturally occurring DNA or RNA). In some embodiments, more than one nucleotide in the oligonucleotide chain is a phosphodiester bond, as seen in naturally occurring DNA or RNA. For example, all(Sp)-CAs1GsT, where the nucleotide bond between C and A is a phosphodiester bond.

[0139] Skipmer: As used herein, the term "skipmer" refers to a type of spacer polymer in which the phosphorus bonds between every other nucleotide of the oligonucleotide chain are phosphodiester bonds, such as those found in naturally occurring DNA or RNA, and the phosphorus bonds between every other nucleotide of the oligonucleotide chain are modified nucleotide bonds. For example, all-(Sp)-AsTCs1GAs2TCs3G.

[0140] For the purposes of this invention, chemical elements are identified according to the CAS version of the periodic table of elements on the inner cover of Handbook of Chemistry and Physics, 67th edition, 1986-87.

[0141] The methods and structures described herein for the compounds and compositions of the present invention are also applicable to pharmaceutically acceptable acid or base addition salts and all stereoisomers of these compounds and compositions. Attached Figure Description

[0142] Figure 1 Chiral-controlled oligonucleotides exhibit significantly different retention times on HPLC compared to stereorandom oligonucleotides. A: Crude chiral-controlled oligonucleotide (oligonucleotide 101); C: Corresponding stereorandom oligonucleotide (oligonucleotide 118).

[0143] Figure 2 HPLC analysis of chiral-controlled oligonucleotides and stereorandom oligonucleotides. A: Oligonucleotide 101 (all Rp); B: Oligonucleotide 102 (all Sp); and C: Oligonucleotide 118 (stereorandom).

[0144] Figure 3 Tm of chiral controlled oligonucleotides and stereorandom oligonucleotides.

[0145] Figure 4 Representative data: Analysis of melting curves for single amplicon production from the target and endogenous control pairs.

[0146] Figure 5 Representative data and IC50 of the compounds 50 curve.

[0147] Figure 6 HPLC analysis of crude (Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC]((RRS)6-R, stereoblock polymers and P-modified monomers (S-monomers)).

[0148] Figure 7 HPLC purification of (Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC]((RRS)6-R, stereoblock polymer and P-modified monomer (S-monomer)).

[0149] Figure 8 .(Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC]((RRS)6-R, stereoblock polymers and P-modified monomers (s-monomers)) of LCMS.

[0150] Figure 9 HPLC analysis of crude (Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC](S-(RRS)6, stereoblock polymers and P-modified monomers (S-monomers)).

[0151] Figure 10 HPLC purification of (Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC](S-(RRS)6, stereoblock polymer and P-modified monomer (S-monomer)).

[0152] Figure 11.(Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp,Rp,Rp,Sp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC](S-(RRS)6, stereoblock polymers and P-modified monomers (s-monomers)) of LCMS.

[0153] Figure 12 HPLC analysis of crude (Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp)d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC](RS-(RRS)5-RR, stereoblock polymer and P-modified monomer (S-monomer)).

[0154] Figure 13 HPLC purification of (Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp)d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC](RS-(RRS)5-RR, stereoblock polymer and P-modified monomer (S-monomer)).

[0155] Figure 14 LCMS of (Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Rp, Rp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGsCsAsCsC](RS-(RRS)5-RR, stereoblock polymers and P-modified monomers (s-monomers)).

[0156] Figure 15 HPLC analysis of crude (Rp, Rp, Rp, Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp)-d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G](3R-5S-3R, stereoblock polymer and P-modified monomer (s1-monomer)).

[0157] Figure 16HPLC purification of (Rp, Rp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp)-d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G](3R-5S-3R, stereoblock polymer and P-modified monomer (s1-monomer)).

[0158] Figure 17 LCMS of (Rp, Rp, Rp, Sp, Sp, Sp, Sp, Sp, Rp, Rp)-d[5mCs1As1Gs1Ts15mCs1Ts1Gs15mCs1Ts1Ts15mCs1G](3R-5S-3R, stereoblock polymers and P-modified monomers (s1-monomers)).

[0159] Figure 18 HPLC analysis of crude (Rp)-d[Cs3As3Gs3T] (P-modified monomers (s3-monomers), stereopolymers and linked monomers).

[0160] Figure 19 LCMS of all (Rp)-d[Cs3As3Gs3T](P-modified monomers (s3-monomers), stereo monomers and linked monomers).

[0161] Figure 20 HPLC analysis of crude (Rp)-d[Cs2As2Gs2T] (P-modified monomers (s2-monomers), stereopolymers and linked monomers).

[0162] Figure 21 LCMS of all (Rp)-d[Cs2As2Gs2T](P-modified monomers (s2-monomers), stereo monomers and linked monomers).

[0163] Figure 22 HPLC analysis of crude (Sp)-d[Cs1AGs1T] (spacer polymer, stereoalternating polymer, P-modified alternating polymer and bonded alternating polymer).

[0164] Figure 23 LCMS of all (Sp)-d[Cs1AGs1T] (spaced polymer, stereoalternating polymer, P-modified alternating polymer and bonded alternating polymer).

[0165] Figure 24 .Rough total (Rp)-d[TsCs1AsT](stereomonomer, P-modified alternating polymer and bonded alternating polymer).

[0166] Figure 25LCMS of all (Rp)-d[TsCs1AsT] (stereo-monomer, p-modified alternating polymer and bonded alternating polymer).

[0167] Figure 26 As described in WO2012 / 030683, and covering exemplary oligonucleotides synthesized using the methods of the present invention.

[0168] Figure 27 As described in WO2012 / 030683, and covering exemplary oligonucleotides synthesized using the methods of the present invention.

[0169] Figure 28 As described in WO2012 / 030683, and covering exemplary oligonucleotides synthesized using the methods of the present invention.

[0170] Figure 29 As described in WO2012 / 030683, and covering exemplary oligonucleotides synthesized using the methods of the present invention.

[0171] Figure 30 As described in WO2012 / 030683, and covering exemplary oligonucleotides synthesized using the methods of the present invention.

[0172] Figure 31 The exemplary connector used in the method of the present invention as described in WO2012 / 030683.

[0173] Figure 32 The exemplary connector used in the method of the present invention as described in WO2012 / 030683.

[0174] Figure 33 The exemplary connector used in the method of the present invention as described in WO2012 / 030683.

[0175] Figure 34 The exemplary connector used in the method of the present invention as described in WO2012 / 030683.

[0176] Figure 35 RP-HPLC of crude DMT-protected oligonucleotides: ONT-75 (Panel A); ONT-80 (Panel B); ONT-77 (Panel C); ONT-81 (Panel D); ONT-87 (Panel E); ONT-88 (Panel F); ONT-89 (Panel G); ONT-82 (Panel H); ONT-84 (Panel I); ONT-85 (Panel J); ONT-86 (Panel K).

[0177] Figure 36RP-HPLC of purified DMT-removed oligonucleotides: ONT-75 (Figure A); ONT-80 (Figure B); ONT-77 (Figure C); ONT-81 (Figure D); ONT-87 (Figure E); ONT-88 (Figure F); ONT-89 (Figure G); ONT-82 (Figure H); ONT-84 (Figure I); ONT-85 (Figure J); ONT-86 (Figure K).

[0178] Figure 37 Overlapping RP-HPLC traces of purified DMT-removed oligonucleotides: ONT-75, ONT-77, ONT-80, ONT-81, ONT-87, ONT-88, ONT-89, and ONT-41 (Figure A); Extended overlap view of ONT-75, ONT-77, ONT-80, ONT-81, ONT-87, ONT-88, ONT-89, and ONT-41 (Figure B).

[0179] Figure 38 Overlapping RP-HPLC traces of purified DMT-removed oligonucleotides: ONT-82, ONT-84, ONT-85, ONT-86, and ONT-83 (Figure A); Extended overlap view of ONT-82, ONT-84, ONT-85, ONT-86, and ONT-83 (Figure B).

[0180] Figure 39 Tm overlap diagram of chiral controlled oligonucleotides ONT-81, ONT-41, ONT-75, ONT-77 and ONT-80.

[0181] Figure 40 A graphical representation of the time-series serum human apolipoprotein B protein levels in huApoB mice relative to PBS after administration of 5 mg / kg stereoisomer or mipomethasone IP for ONT-41, ONT-75, ONT-80, ONT-77, and ONT-81. Downward arrows indicate the number of days of administration.

[0182] Figure 41 A graphical representation of the time-series serum human apolipoprotein B protein levels in huApoB mice relative to PBS following administration of 5 mg / kg stereoisomers or imipoprotein B intraperitoneal (IP) for mipoprotein B, "Complete R" mipoprotein B, "Complete S" mipoprotein B, "RSR" mipoprotein B, and "SRS" mipoprotein B. Downward arrows indicate the number of days of administration.

[0183] Figure 42A graphical representation of the time-series serum human apolipoprotein B protein levels in huApoB mice relative to PBS following administration of mipomiran, “Complete R” mipomiran, “Complete S” mipomiran, “RSR” mipomiran, and “SRS” mipomiran, either in its 10 mg / kg stereoisomer or via intraperitoneal injection (IP). Downward arrows indicate the number of days of administration.

[0184] Figure 43 A graphical representation of the time-series serum human apolipoprotein B protein levels in huApoB mice relative to PBS after administration of 5 mg / kg stereoisomer or mipoprotein IP for mipoprotein B, ONT-87, ONT-88, and ONT-89. Downward arrows indicate the number of days of administration.

[0185] Figure 44 A graphical representation of the time-series serum human apolipoprotein B protein levels in huApoB mice relative to PBS following administration of the 10 mg / kg stereoisomer or mipomethasone IP for ONT-87, ONT-88, and ONT-89. Downward arrows indicate the number of days of administration.

[0186] Figure 45 A graphical representation of the percentage of PCSK-9 mRNA remaining after Hep3B treatment with siRNA duplexes.

[0187] Figure 46 A graphical representation of the percentage of PCSK-9 mRNA remaining after Hep3B treatment with siRNA duplexes.

[0188] Figure 47 A graphical representation of the percentage of PCSK-9 mRNA remaining after HeLa treatment with siRNA double strands.

[0189] Figure 48 A graphical representation of the percentage of PCSK-9 mRNA remaining after HeLa treatment with siRNA duplexes.

[0190] Figure 49 A diagram showing the percentage of PCSK-9 mRNA remaining after HeLa was treated with a double-stranded siRNA containing three thiophosphate stereocenters.

[0191] Figure 50 A graphical representation of the percentage of remaining PCSK-9 mRNA after HeLa was treated with a double-stranded siRNA containing three thiophosphate stereocenters.

[0192] Figure 51Overlapping RP-HPLC traces of purified DMT-removed oligonucleotides: ONT-108, ONT-109, and ONT-114.

[0193] Figure 52 Overlapping RP-HPLC traces of purified DMT-removed oligonucleotides: ONT-106, ONT-107, and ONT-114.

[0194] Figure 53 A graphical representation of the time-series serum human apolipoprotein B protein levels in huApoB mice relative to PBS following administration of the 10 mg / kg stereoisomer or mipomethasone IP. Downward arrows indicate the number of days of administration.

[0195] Figure 54 A graphical representation of the time course of serum human apolipoprotein B protein levels in huApoB mice relative to PBS after multiple doses of the stereoisomer or mipomethasone at an IP dose of 5 mg / kg. Downward arrows indicate the number of days of administration.

[0196] Figure 55 Serum human apolipoprotein B protein levels on day 17 in huApoB mice relative to PBS following administration of 10 mg / kg stereoisomers (ONT-87, ONT-88, or ONT-89) or mipomethasone IP.

[0197] Figure 56 Serum human apolipoprotein B protein levels on day 24 in huApoB mice relative to PBS following administration of 10 mg / kg stereoisomers (ONT-87, ONT-88, or ONT-89) or mipomethasone IP.

[0198] Figure 57 Serum human apolipoprotein B protein levels in huApoB mice relative to PBS after administration of 10 mg / kg stereoisomers (ONT-41, ONT-87, ONT-88, or ONT-89).

[0199] Figure 58 Serum human apolipoprotein B protein levels in huApoB mice relative to PBS after administration of 10 mg / kg stereoisomers (ONT-87, ONT-88, or ONT-89).

[0200] Figure 59 A Graph of IEX-HPLC quantitative analysis of oligonucleotides ONT-75, ONT-77, ONT-80, ONT-81, ONT-87, ONT-88, ONT-89 and ONT-41 in svPDE digestion studies.

[0201] Figure 60 Using nP1 to target oligonucleotide ONT-75 (full (Rp)) - Gs5mCs5mCsTs5mCs AsGsTs5mCsTsGs5mCsTsTs5mCs Gs5mCsAs5mCs5mC IEX-HPLC of the enzymatic digestion studies conducted.

[0202] Figure 61 Using nP1 to target oligonucleotide ONT-77 (Rp, Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp) Gs5mCs5mCsTs5mCs AsGsTs5mCsTsGs5mCsTsTs5mCs Gs5mCsAs5mCs5mC IEX-HPLC analysis of enzymatic digestion studies using (5R-10S-4R).

[0203] Figure 62 Using nP1 to target oligonucleotide ONT-80 (full (Sp)) - Gs5mCs5mCsTs5mCs AsGsTs5mCsTsGs5mCsTsTs5mCs Gs5mCsAs 5mCs5mC IEX-HPLC of the enzymatic digestion studies conducted.

[0204] Figure 63 Using nP1 to target oligonucleotide ONT-81 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, Rp, Sp, Sp, Sp, Sp) Gs5mCs5mCsTs5mCs AsGsTs5mCsTsGs5mCsTsTs5mCs Gs5mCsAs5mCs5mC IEX-HPLC analysis of enzymatic digestion studies using (5S-10R-4S).

[0205] Figure 64 . Use nP1 for oligonucleotide ONT-87 (Rp, Rp, Rp, Rp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Sp, Sp, Rp, Rp, Rp, Rp, Rp, Rp)- Gs5mCs5mCsTs5mCs AsGsTs5mCsTsGs5mCsTsTs5mCs Gs5mCsAs5mCs5mC IEX-HPLC of enzymatic digestion studies using (5R-(SSR)3-5R).

[0206] Figure 65 Using nP1 to target oligonucleotide ONT-88 (Sp, Sp, Sp, Sp, Sp, Rp, Rp, Sp, Rp, Rp, Sp, Sp, Sp, Sp, Sp, Sp) Gs5mCs5mCsTs5mCsAsGsTs5mCsTsGs5mCsTsTs5mCs Gs5mCsAs 5mCs5mC IEX-HPLC analysis of enzymatic digestion of (5S-(RRS)3-5S).

[0207] Figure 66 Using nP1 to target oligonucleotide ONT-89 (Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp, Rp, Sp) Gs5mCs5mCsTs5mCs AsGsTs5mCsTsGs5mCsTsTs5mCs Gs5mCsAs5mCs5mC IEX-HPLC of enzymatic digestion studies of (SR)9S.

[0208] Figure 67 Using nP1 to target oligonucleotide ONT-41 (a mixture of diastereomers) Gs5mCs5mCsTs5mCs AsGsTs5mCsTsGs 5mCsTsTs5mCs Gs5mCsAs5mCs5mC IEX-HPLC of the enzymatic digestion studies conducted.

[0209] Figure 68 Comparison of the stability of chiral pure oligonucleotides ONT-75 and ONT-77 with the stereorandom "parent" oligonucleotide ONT-41 (MipoMexen) in pre-incubated rat complete liver homogenate.

[0210] Figure 69 UPLC maps of oligonucleotide derivatives generated using monomer 13b.

[0211] Figure 70 UPLC maps of oligonucleotide derivatives generated using monomer 27.

[0212] Figure 71 After transfecting primary mouse hepatocytes with stereoisomers (ONT-82, ONT-83, ONT-84, ONT-85, or ONT-86), mouse apolipoprotein B / GAPDH mRNA levels were compared with mimic and untreated controls.

[0213] Figure 72 After transfecting primary mouse hepatocytes with stereoisomers (ONT-83, ONT-84, ONT-85, or ONT-86), mouse apolipoprotein B / GAPDH mRNA levels were compared with those of mimics and untreated controls. Detailed Implementation

[0214] Synthetic oligonucleotides provide molecular tools applicable to a wide range of applications. For example, oligonucleotides are suitable for therapeutic, diagnostic, research, and novel nanomaterial applications. The use of naturally occurring nucleic acids (e.g., unmodified DNA or RNA) is limited, for example, by their susceptibility to endonucleases and exonucleases. Therefore, various synthetic counterparts have been developed to circumvent these drawbacks. These include synthetic oligonucleotides containing backbone modifications that make these molecules less susceptible to degradation. From a structural point of view, such modifications to the phosphate ester bonds between nucleotides introduce chirality. It has become clear that certain properties of oligonucleotides can be affected by the conformation of the phosphorus atom in the backbone forming the oligonucleotide. For example, in vitro studies have shown that the properties of antisense nucleotides (such as binding affinity, sequence specificity for binding complementary RNA, and stability to nucleases) are particularly affected by the chirality of the backbone (e.g., the conformation of the phosphorus atom). Therefore, this invention covers the recognition of the need for chiral control of nucleic acids containing phosphorus atom modifications, as well as related compositions and methods. In some embodiments, the present invention provides chiral controlled oligonucleotides that are structurally optimized to exhibit certain features suitable for in vitro and / or in vivo applications, such as increased stability and improved efficacy.

[0215] Oligonucleotides in which one or both of the two non-bridging oxygen atoms of the internucleotide phosphate ester are replaced by different types of atoms or substituents are known to be suitable as therapeutic agents and probes for elucidating enzymatic reaction mechanisms. However, these oligonucleotides often exhibit undesirable properties that prevent them from being used in many applications (e.g., susceptibility to nuclease degradation, poor cell membrane permeability). Therefore, various types of chemical modifications have been developed in an attempt to improve their properties and / or endow them with new functionalities.

[0216] Modified oligonucleotide structure

[0217] As indicated above, given the suitability of oligonucleotide compositions for a wide range of applications and indications, those skilled in the art have dedicated themselves to developing modified forms of oligonucleotide structures that, compared to naturally occurring oligonucleotide molecules, may have preferred or desired characteristics or properties (e.g., for specific applications and indications). Exemplary modifications are described below.

[0218] WO2010 / 141471 (referred to herein as "Traversa I") teaches modifications to different types of nucleic acid constructs having reduced net polyanionic charges. WO2010 / 039543 (referred to herein as "Traversa II") teaches compositions and methods for preparing neutral polynucleotides (NN) with reduced polyanionic charges. WO2008 / 008476 (referred to herein as "Traversa III") describes the synthesis of SATE (Imbach type) phosphate prodrugs. Traversa I, II, and III do not teach chiral-controlled oligonucleotides, compositions thereof, or methods for preparing and using said oligonucleotides and compositions as described in this invention.

[0219] WO2010 / 072831 (referred to herein as "Girindus et al.") also teaches the modification of oligonucleotides. Specifically, Girindus et al. teach the use of sulfiding agents to generate trithiophosphate as a prodrug. Girindus et al. do not teach chiral controlled oligonucleotides, compositions thereof, or methods for preparing and using said oligonucleotides and compositions as described in this invention.

[0220] Similarly, WO2004 / 085454 (referred to herein as "Avecia I") teaches the preparation of thiophosphate oligonucleotides by, for example, transient silanization of poly(H-phosphonate diester). WO2001 / 027126 (referred to herein as "Avecia II") teaches a method for the solid-phase synthesis of phosphate triester oligonucleotides by coupling an H-phosphonate monomer to a solid-supported 5'-hydroxy oligonucleotide and further sulfidating the resulting H-phosphonate diester to a thiophosphate triester. WO2001 / 064702 (referred to herein as "Avecia III") is similar to Avecia II and further describes solid-phase synthesis on different solid supports. Avecia I, II, and III do not teach chiral-controlled oligonucleotides, compositions thereof, or methods for preparing and using said oligonucleotides and compositions as described in this invention.

[0221] WO1997 / 006183 (referred to herein as "Chiron") discloses oligonucleotides containing asymmetric phosphorus in the intercational linkages of cationic nucleotides, such as stereopure amidates. Chiron discloses stereopure oligonucleotides obtained by crystallizing mixtures of diastereomers or by resolution using, for example, column chromatography. Chiron does not disclose chiral-controlled oligonucleotides, compositions thereof, or methods for preparing and using said oligonucleotides and compositions as described in this invention.

[0222] WO2009 / 146123 (referred to herein as "Spring Bank I") discloses compositions and methods for treating viral infections using substituted phosphate oligonucleotides and trithiophosphates. WO2007 / 070598 (referred to herein as "Spring Bank II") discloses triphosphate prodrugs as antiviral nucleic acids and the synthesis of trithiophosphate prodrugs. Spring Bank I and II do not disclose chiral-controlled oligonucleotides as described in this invention, compositions thereof, or methods for preparing and using said oligonucleotides and compositions.

[0223] EP0779893 (referred to herein as "Hybridon") discloses a lipophilic prodrug for increasing cellular uptake of antisense oligonucleotides and observes that Rp and Sp phosphate thioesters and phosphate thioester dimers can have different enzymatic stability properties. Hybridon does not disclose chiral-controlled oligonucleotides as described in this invention, compositions thereof, or methods for preparing and using said oligonucleotides and compositions.

[0224] WO1997 / 047637 (referred to herein as "Imbach I") generally teaches Imbach "SATE" (S-acylthioethyl) prodrug oligonucleotide compositions and methods. Imbach I describes, for example, biologically reversible phosphate triester prodrugs and the preparation of certain prodrug oligonucleotides using post-synthetic alkylation or phosphoramidites containing prodrug groups. US 6,124,445 (referred to herein as "Imbach II") teaches modified antisense and chimeric prodrug oligonucleotides. Imbach I and II do not teach chiral-controlled oligonucleotides as described in this invention, their compositions, or methods for preparing and using said oligonucleotides and compositions.

[0225] WO2006 / 065751 (referred to herein as "Beaucage") teaches CpG oligonucleotide phosphate thioester prodrugs containing thermally unstable substituents (introduced via phosphoramidite monomers) and their applications. Beaucage does not teach chiral-controlled oligonucleotides as described in this invention, compositions thereof, or methods for preparing and using said oligonucleotides and compositions.

[0226] Takeshi Wada et al. developed novel methods for the stereocontrolled synthesis of p-chiral nucleic acids using imide chiral auxiliaries (JP4348077, WO2005 / 014609, WO2005 / 092909, and WO2010 / 064146, collectively referred to herein as "Wada I"). Specifically, WO2010 / 064146 (referred to herein as "Wada II") discloses a method for synthesizing phosphorus-modified nucleic acids, wherein the stereochemical configuration at the phosphorus is controlled. However, the methods of Wada II are limited because they do not provide for the individual p-modification of each chiral linking phosphorus in a controlled and designed manner. That is, the linking method of Wada II for p-modification provides the production of condensed intermediate poly-H-phosphonate oligonucleotide chains, which, once constructed to the desired length, are extensively modified at the linking phosphorus to provide, for example, the desired thiophosphate diester, aminophosphate, or borophosphate, or other phosphorus-modified nucleic acids (referred to as pathway B in scheme 6 on page 36 of the document). Furthermore, the H-phosphonate oligonucleotide chains of Wada II have relatively short lengths (e.g., dimers, trimers, or tetramers). Combined with the fact that a capping step is absent in pathway B (which typically results in low crude purity due to the accumulation of "n-1" type byproducts), the Wada II pathway presents limitations for the synthesis of longer oligonucleotides. Although Wada II generally covers specific oligonucleotides that can be conceived to contain different modifications at each linking phosphorus, Wada II does not describe or indicate methods for the controlled iterative placement of such modifications as described herein. As WadaII describes, the synthetic cycle for which the H-phosphonate intermediate oligonucleotide is fully assembled prior to modification at the phosphate linker (referred to therein as Route A, page 35, Scheme 5, "Synthesis of a nucleic acid comprising a chiral X-phosphonate moiety of Formula 1 via Route A") does not impart certain key steps required for arranging certain P modifications as provided by the present invention, and in particular lacks any degree of efficiency and versatility to make this cycle applicable to the synthesis of chiral-controlled P-modified oligonucleotides, and especially longer oligonucleotides.

[0227] At least one of the aforementioned inefficiencies of Wada II was indicated by Wada et al. in WO2012 / 039448 (referred to herein as "Wada III"). Wada III discloses novel chiral auxiliaries for the production of H-phosphonate oligonucleotides in the Wada II method, which, once constructed, can be subsequently modified to provide, in particular, thiophosphates, etc. Wada et al. observed in Wada III that the four types of chiral auxiliaries disclosed in Wada II form strong bonds with phosphorus at the phosphorus-linked sites and therefore do not allow for efficient removal. Wada III indicates that removal of Wada II chiral auxiliaries requires harsh conditions that tend to impair the integrity of the product oligonucleotide. Wada III observed that this is particularly problematic in the synthesis of long-chain oligonucleotides because, at least as one or more degradation reactions proceed, additional byproducts are generated that can further react with and degrade the product oligonucleotide. Therefore, Wada III provides S-type auxiliaries that can be released under mildly acidic conditions by releasing the bonds between H-phosphonate nucleotides. N Mechanism 1 (Pathway B), or a chiral auxiliary agent that more efficiently cleaves oligonucleotides via the β-elimination pathway under relatively mild alkaline conditions.

[0228] Those skilled in the art of chemistry and synthesis will immediately understand the complexities associated with the production of chiral controlled oligonucleotides (such as those provided by this invention). For example, for the synthesis and isolation of chiral controlled oligonucleotides, the conditions for the addition of each monomer must be designed such that (1) the chemistry is compatible with each part of the growing oligonucleotide; (2) byproducts generated during the addition of each monomer do not impair the structural and stereochemical integrity of the growing oligonucleotide; and (3) the crude final product composition is a composition that allows for the isolation of the desired chiral controlled oligonucleotide product.

[0229] Oligonucleotide phosphates have shown therapeutic potential (Stein et al., Science (1993), 261:1004-12; Agrawal et al., Antisense Res. and Dev. (1992), 2:261-66; Bayever et al., Antisense Res. and Dev. (1993), 3:383-390). Oligonucleotide phosphates prepared without considering the stereochemistry of phosphates exist as a mixture of 2n diastereomers, where n is the number of phosphate-thioester bonds between nucleotides. These diastereomers of phosphates can have different chemical and biological properties. For example, Wada et al. (Nucleic Acids Symposium Series, Vol. 51, pp. 119-120; doi: 10.1093 / nass / nrm060) found that the stereodetermined (Rp)-(Ups)9U / (Ap)9A duplex showed T mThe values ​​are higher than those of the natural (Up)9U / (Ap)9A, and the stereodefined (Sp)-(Ups)9U does not form a double strand. In another instance, in a study by Tang et al. (Nucleosides Nucleotides (1995), 14: 985-990), it was found that stereopure Rp-oligodeoxyribonucleoside thiophosphates exhibited lower stability to human serum endogenous nucleases than the parent oligodeoxyribonucleoside thiophosphates with undetermined chirality.

[0230] Chiral controlled oligonucleotides and chiral controlled oligonucleotide compositions

[0231] This invention provides chiral-controlled oligonucleotides and chiral-controlled oligonucleotide compositions with high crude purity and high diastereomeric purity. In some embodiments, this invention provides chiral-controlled oligonucleotides and chiral-controlled oligonucleotide compositions with high crude purity. In some embodiments, this invention provides chiral-controlled oligonucleotides and chiral-controlled oligonucleotide compositions with high diastereomeric purity.

[0232] In some embodiments, the present invention provides compositions comprising a plurality of oligonucleotides having chiral control of at least one type, wherein each type is determined by: 1) a base sequence; 2) a backbone linking pattern; 3) a backbone chiral center pattern; and 4) a backbone P modification pattern.

[0233] In some embodiments, the present invention provides compositions comprising chiral control of a plurality of oligonucleotides having the same type, wherein each type is determined by: 1) a base sequence; 2) a backbone linking pattern; 3) a backbone chiral center pattern; and 4) a backbone P modification pattern. In some embodiments, the present invention provides compositions comprising a plurality of oligonucleotides having chiral control of two or more types, wherein each type is determined by: 1) a base sequence; 2) a backbone linking pattern; 3) a backbone chiral center pattern; and 4) a backbone P modification pattern.

[0234] In some embodiments, the present invention provides oligonucleotides comprising one or more diastereomeric pure nucleotide links with respect to a chiral phosphorus. In some embodiments, the present invention provides oligonucleotides comprising one or more diastereomeric pure nucleotide links having the structure of Formula I. In some embodiments, the present invention provides oligonucleotides comprising one or more diastereomeric pure nucleotide links with respect to a chiral phosphorus and one or more phosphodiester-linked oligonucleotides. In some embodiments, the present invention provides oligonucleotides comprising one or more diastereomeric pure nucleotide links having the structure of Formula I and one or more phosphodiester-linked oligonucleotides. In some embodiments, the present invention provides oligonucleotides comprising one or more diastereomeric pure nucleotide links having the structure of Formula Ic and one or more phosphodiester-linked oligonucleotides. In some embodiments, the oligonucleotides are prepared by using stereoselective oligonucleotide synthesis as described in this application to form pre-designed diastereomeric pure nucleotide links with respect to a chiral phosphorus. For example, in an exemplary oligonucleotide (Rp / Sp, Rp / Sp, Rp / Sp, Rp, Rp, Sp, Sp, Sp, SpSp, Sp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp)-d[GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGs1Cs1As1CsC], the first three nucleotides are linked using conventional oligonucleotide synthesis methods, and the diastereomeric pure nucleotide links are constructed under stereochemical control as described in this application. Exemplary nucleotide links, including those having the structure of Formula I, are further described below. In some embodiments, the oligonucleotide comprises sequences further described in this application, including but not limited to those described in Tables 2 and 4 and Appendices A, B, and C.

[0235] In some embodiments, the provided oligonucleotide comprises a combination of stereopure and stereorandom nucleotide linkages with respect to chirality at the linking phosphorus. For example, in some embodiments, it is desirable to have a block within the oligonucleotide containing one or more stereodefined nucleotide linkages with chirality at the linking phosphorus. In some embodiments, it is desirable to have a block within the oligonucleotide containing one or more stereorandom nucleotide linkages with chirality at the linking phosphorus.

[0236] In some embodiments, at least one nucleotide unit of the provided oligonucleotide is arranged using stereoselective oligonucleotide synthesis as described in this application to form a pre-designed diastereomeric pure nucleotide link with respect to a chiral phosphorus. In some embodiments, at least two nucleotide units of the provided oligonucleotide are arranged using stereoselective oligonucleotide synthesis as described in this application to form at least two pre-designed diastereomeric pure nucleotide links with respect to a chiral phosphorus. In some embodiments, at least three nucleotide units of the provided oligonucleotide are arranged using stereoselective oligonucleotide synthesis as described in this application to form at least three pre-designed diastereomeric pure nucleotide links with respect to a chiral phosphorus. In some embodiments, at least one, two, or three pre-designed diastereomeric pure nucleotide links are adjacent to each other. In some embodiments, at least one, two, or three pre-designed diastereomeric pure nucleotide links are not adjacent to each other.

[0237] In some embodiments, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% of the nucleotide units of the provided oligonucleotide are arranged using stereoselective oligonucleotide synthesis as described in this application to form a pre-designed diastereoisomeric pure internucleotide link with respect to chiral linking phosphorus. As described herein, in some embodiments, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% of the nucleotide units are present in one or more block forms to provide block polymers. In some embodiments, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% of the nucleotide units are present in an alternating pattern to provide alternating polymers. Those skilled in the art will recognize that any desired pattern can be achieved using the methods of the present invention and is covered herein.

[0238] In some embodiments, the present invention provides a chiral controlled oligonucleotide, wherein at least two individual nucleotides within the oligonucleotide are linked by a steric chemistry and / or a different P modification relative to each other. In some embodiments, the present invention provides a chiral controlled oligonucleotide, wherein at least two individual nucleotides within the oligonucleotide are linked by a P modification different to each other. In some embodiments, the present invention provides a chiral controlled oligonucleotide, wherein at least two individual nucleotides within the oligonucleotide are linked by a P modification different to each other, and wherein the chiral controlled oligonucleotide comprises at least one phosphodiester nucleotide link. In some embodiments, the present invention provides a chiral controlled oligonucleotide, wherein at least two individual nucleotides within the oligonucleotide are linked by a P modification different to each other, and wherein the chiral controlled oligonucleotide comprises at least one phosphodiester nucleotide link and at least one phosphothiodiester nucleotide link. In some embodiments, the present invention provides a chiral controlled oligonucleotide, wherein at least two individual nucleotides within the oligonucleotide are linked by a P modification different to each other, and wherein the chiral controlled oligonucleotide comprises at least one phosphothiotriester nucleotide link. In some embodiments, the present invention provides a chiral controlled oligonucleotide, wherein at least two individual nucleotides within the oligonucleotide are linked by a P modification that is different from each other, and wherein the chiral controlled oligonucleotide comprises at least one phosphodiester nucleotide link and at least one phosphothiotriester nucleotide link.

[0239] In some embodiments, the present invention provides a chiral-controlled oligonucleotide comprising one or more nucleotides independently having modified structures of Formula I:

[0240]

[0241] The variables are defined and described below. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising one or more nucleotide links modified by Formula I, wherein the individual Formula I nucleotide links within the oligonucleotide have a P modification that is different from each other. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising one or more nucleotide links modified by Formula I, wherein the individual Formula I nucleotide links within the oligonucleotide have a -XLR modification that is different from each other. 1In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising one or more nucleotide links modified by formula I, wherein the individual formula I nucleotide links within the oligonucleotide have an X that is different from each other. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising one or more nucleotide links modified by formula I, wherein the individual formula I nucleotide links within the oligonucleotide have a -LR that is different from each other. 1 .

[0242] In some embodiments, the present invention provides a chiral controlled oligonucleotide, wherein at least two individual nucleotides within the oligonucleotide are linked together having stereochemistry and / or different P modifications relative to each other. In some embodiments, the present invention provides a chiral controlled oligonucleotide, wherein at least two individual nucleotides within the oligonucleotide are linked together having stereochemistry relative to each other, and wherein at least a portion of the structure of the chiral controlled oligonucleotide is characterized by having a repeating pattern of alternating stereochemistry.

[0243] In some embodiments, the present invention provides a chiral-controlled oligonucleotide, wherein at least two individual nucleotides within the oligonucleotide are linked by a p modification that is different from each other because they are in the -XLR region. 1 The parts have different X atoms, and / or because they are in -XLR 1 The parts have different L groups, and / or because they are in -XLR 1 Some have different R 1 atom.

[0244] In some embodiments, the present invention provides a chiral-controlled oligonucleotide, wherein at least two individual nucleotides within the oligonucleotide are linked together having different stereochemistry and / or different P modifications relative to each other, and the oligonucleotide has a structure represented by the following formula:

[0245] [S B n1R B n2S B n3R B n4...S B nxR B ny]

[0246] in:

[0247] Each R B A block of nucleotide units with an R configuration at the phosphate linker;

[0248] Each S B A block of nucleotide units that independently represent nucleotide units with an S configuration at the phosphate linker;

[0249] n1-ny are each zero or an integer, wherein at least one odd number n and at least one even number n must be non-zero so that the oligonucleotide comprises at least two individual nucleotides with different stereochemistry relative to each other; and

[0250] Where the sum of n1-ny is between 2 and 200, and in some embodiments, it is between the lower limit of the group consisting of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more and the upper limit of the group consisting of 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 and 200, wherein the upper limit is greater than the lower limit.

[0251] In some embodiments, each n has the same value; in some embodiments, each even number n has the same value as each other even number n; in some embodiments, each odd number n has the same value as each other odd number n; in some embodiments, at least two even numbers n have different values ​​from each other; in some embodiments, at least two odd numbers n have different values ​​from each other.

[0252] In some embodiments, at least two adjacent n are equal to each other, such that the provided oligonucleotide comprises adjacent blocks having equal lengths of S- and R-stereochemically linked segments. In some embodiments, the provided oligonucleotide comprises repeating blocks having equal lengths of S- and R-stereochemically linked segments. In some embodiments, the provided oligonucleotide comprises repeating blocks having S- and R-stereochemically linked segments, wherein at least two of the blocks have different lengths from each other; in some embodiments, each S-stereochemical block has the same length and a length different from each R-stereochemical length, which may optionally be the same length as each other.

[0253] In some embodiments, at least two jump neighbors n are equal to each other, such that the provided oligonucleotide comprises at least two linking blocks having a first stereochemistry that are equal to each other in length and separated by a linking block having another stereochemistry, the separating block and the block having the first stereochemistry may have the same length or different length.

[0254] In some embodiments, the n associated with the terminal binding block of the provided oligonucleotide has the same length. In some embodiments, the provided oligonucleotide has terminal blocks with the same binding stereochemistry. In some embodiments, the terminal blocks are separated from each other by intermediate blocks having a different binding stereochemistry.

[0255] In some implementation schemes, the provided formula [S] B n1R B n2S B n3R B n4...S B nxR B [ny] oligonucleotides are stereoblock polymers. In some embodiments, the provided formula [S] B n1R B n2S B n3R B n4...S B nxR B [ny] oligonucleotides are stereohopping polymers. In some implementations, the provided formula [S] B n1R B n2S B n3R B n4...S B nxR B [ny] oligonucleotides are stereoalloy polymers. In some embodiments, the provided formula [S] B n1R B n2S B n3R B n4...S B nxR B Oligonucleotides are spacer polymers.

[0256] In some implementation schemes, the provided formula [S] B n1R B n2S B n3R B n4...S B nxR B [ny] oligonucleotides have any of the above-described patterns and also include P-modified patterns. For example, in some embodiments, the provided formula [S] B n1R B n2S B n3R B n4...S B nxR B [ny] oligonucleotides are stereohopping polymers and P-modified jumping polymers. In some embodiments, the provided formula [S B n1R B n2S B n3RB n4...S B nxR B [ny] oligonucleotides are stereoblock polymers and alternating P-modified polymers. In some embodiments, the provided formula [S] B n1R B n2S B n3R B n4...S B nxR B [ny] Oligonucleotides are stereoalternating polymers and P-modified block polymers.

[0257] In some implementation schemes, the provided formula [S] B n1R B n2S B n3R B n4...S B nxR B [ny]Oligonucleotides are chiral controlled oligonucleotides that comprise one or more nucleotides independently having modified structures of formula I:

[0258]

[0259]

[0260] in:

[0261] P* is an asymmetric phosphorus atom, and is either Rp or Sp;

[0262] W is O, S, or Se;

[0263] X, Y, and Z are each independently -O-, -S-, -N(-LR) 1 )- or L;

[0264] L is a covalently bonded or optionally substituted straight chain or branch C1-C. 10 Alkylene, wherein one or more methylene units of L are optionally and independently substituted with the following: optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -c≡c-, -C(R′)2-, -Cy-, -O-, -S-, -SS-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -C(O)N(R′)-, -N(R′)C(O)N(R′)-, -N(R′)C(O)-, -N(R′)C(O)O-, -OC(O)N(R′)-, -S(O)-, -S(O)2-, -S(O)2N(R′)-, -N(R′)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)- or -C(O)O-;

[0265] R 1It is a halogen, R, or optionally substituted C1-C 50 Aliphatic, wherein one or more methylene units are optionally and independently substituted with: optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -c≡c-, -C(R′)2-, -Cy-, -O-, -S-, -SS-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -C(O)N(R′)-, -N(R′)C(O)N(R′)-, -N(R′)C(O)-, -N(R′)C(O)O-, -OC(O)N(R′)-, -S(O)-, -S(O)2-, -S(O)2N(R′)-, -N(R′)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)- or -C(O)O-;

[0266] Each R′ is independently -R, -C(O)R, -CO2R, or -SO2R, or:

[0267] The two R′ atoms on the same nitrogen atom, together with their intercalated atoms, form an optionally substituted heterocyclic or heteroaryl ring, or

[0268] Two R′ on the same carbon atom, together with their intercalated atoms, form optionally substituted aryl, carbocyclic, heterocyclic or heteroaryl rings;

[0269] -Cy- is a divalent ring selected from phenylene, carbocycloidene, arylene, heteroarylene or heterocycloidene, which is optionally substituted;

[0270] Each R is independently hydrogen or an optionally substituted group selected from C1-C6 aliphatic, phenyl, carbocyclic, aryl, heteroaryl, or heterocyclic groups; and

[0271] each Independently represent the connection with nucleosides.

[0272] In some embodiments, the chiral-controlled oligonucleotide comprises one or more modified internucleotide phosphate linkages. In some embodiments, the chiral-controlled oligonucleotide comprises, for example, phosphate thioester or phosphate triester linkages. In some embodiments, the chiral-controlled oligonucleotide comprises phosphate triester linkages. In some embodiments, the chiral-controlled oligonucleotide comprises at least two phosphate triester linkages. In some embodiments, the chiral-controlled oligonucleotide comprises at least three phosphate triester linkages. In some embodiments, the chiral-controlled oligonucleotide comprises at least four phosphate triester linkages. In some embodiments, the chiral-controlled oligonucleotide comprises at least five phosphate triester linkages. Exemplary modified internucleotide phosphate linkages are further described herein.

[0273] In some embodiments, the chiral-controlled oligonucleotide comprises different nucleotide-to-nucleotide phosphorus links. In some embodiments, the chiral-controlled oligonucleotide comprises at least one phosphodiester nucleotide link and at least one modified nucleotide link. In some embodiments, the chiral-controlled oligonucleotide comprises at least one phosphodiester nucleotide link and at least one thiophosphate-triester link. In some embodiments, the chiral-controlled oligonucleotide comprises at least one phosphodiester nucleotide link and at least two thiophosphate-triester links. In some embodiments, the chiral-controlled oligonucleotide comprises at least one phosphodiester nucleotide link and at least three thiophosphate-triester links. In some embodiments, the chiral-controlled oligonucleotide comprises at least one phosphodiester nucleotide link and at least four thiophosphate-triester links. In some embodiments, the chiral-controlled oligonucleotide comprises at least one phosphodiester nucleotide link and at least five thiophosphate-triester links. Exemplary modified nucleotide-to-nucleotide phosphorus links are further described herein.

[0274] In some embodiments, the trithiophosphate linker includes, for example, a chiral auxiliary agent for controlling the stereoselectivity of the reaction. In some embodiments, the trithiophosphate linker does not include a chiral auxiliary agent. In some embodiments, the trithiophosphate linker is intentionally maintained until administration to the subject, and / or intentionally maintained during administration to the subject.

[0275] In some embodiments, the chiral-controlled oligonucleotide is linked to a solid support. In some embodiments, the chiral-controlled oligonucleotide is cleaved from the solid support.

[0276] In some embodiments, the chiral-controlled oligonucleotide comprises at least one phosphodiester nucleotide link and at least two consecutive modified nucleotide links. In some embodiments, the chiral-controlled oligonucleotide comprises at least one phosphodiester nucleotide link and at least two consecutive phosphothiotriester nucleotide links.

[0277] In some embodiments, the chiral-controlled oligonucleotide is a block copolymer. In some embodiments, the chiral-controlled oligonucleotide is a stereoblock copolymer. In some embodiments, the chiral-controlled oligonucleotide is a P-modified block copolymer. In some embodiments, the chiral-controlled oligonucleotide is a linked block copolymer.

[0278] In some embodiments, the chiral-controlled oligonucleotide is an alternating polymer. In some embodiments, the chiral-controlled oligonucleotide is a stereoalternating polymer. In some embodiments, the chiral-controlled oligonucleotide is a P-modified alternating polymer. In some embodiments, the chiral-controlled oligonucleotide is a bonded alternating polymer.

[0279] In some embodiments, the chiral-controlled oligonucleotide is a monomer. In some embodiments, the chiral-controlled oligonucleotide is a stereopolymer. In some embodiments, the chiral-controlled oligonucleotide is a P-modified monomer. In some embodiments, the chiral-controlled oligonucleotide is a linker monomer.

[0280] In some implementations, the chiral-controlled oligonucleotides are spacer polymers.

[0281] In some implementations, the chiral-controlled oligonucleotides are jumping polymers.

[0282] In some embodiments, the present invention provides a chiral-controlled oligonucleotide comprising one or more nucleotides independently having modified structures of Formula I:

[0283]

[0284] in:

[0285] P* is an asymmetric phosphorus atom, and is either Rp or Sp;

[0286] W is O, S, or Se;

[0287] X, Y, and Z are each independently -O-, -S-, -N(-LR) 1 )- or L;

[0288] L is a covalently bonded or optionally substituted straight chain or branch C1-C. 10 Alkylene, wherein one or more methylene units of L are optionally and independently substituted with the following: optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -c≡c-, -C(R′)2-, -Cy-, -O-, -S-, -SS-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -C(O)N(R′)-, -N(R′)C(O)N(R′)-, -N(R′)C(O)-, -N(R′)C(O)O-, -OC(O)N(R′)-, -S(O)-, -S(O)2-, -S(O)2N(R′)-, -N(R′)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)- or -C(O)O-;

[0289] R 1 It is a halogen, R, or optionally substituted C1-C 50Aliphatic, wherein one or more methylene units are optionally and independently substituted with: optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -c≡c-, -C(R′)2-, -Cy-, -O-, -S-, -SS-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -C(O)N(R′)-, -N(R′)C(O)N(R′)-, -N(R′)C(O)-, -N(R′)C(O)O-, -OC(O)N(R′)-, -S(O)-, -S(O)2-, -S(O)2N(R′)-, -N(R′)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)- or -C(O)O-;

[0290] Each R′ is independently -R, -C(O)R, -CO2R, or -SO2R, or:

[0291] The two R′ atoms on the same nitrogen atom, together with their intercalated atoms, form an optionally substituted heterocyclic or heteroaryl ring, or

[0292] Two R′ on the same carbon atom, together with their intercalated atoms, form optionally substituted aryl, carbocyclic, heterocyclic or heteroaryl rings;

[0293] -Cy- is a divalent ring selected from phenylene, carbocycloidene, arylene, heteroarylene or heterocycloidene, which is optionally substituted;

[0294] Each R is independently hydrogen or an optionally substituted group selected from C1-C6 aliphatic, phenyl, carbocyclic, aryl, heteroaryl, or heterocyclic groups; and

[0295] each Independently represent the connection with nucleosides.

[0296] As defined above and herein, P* is an asymmetric phosphorus atom and is either Rp or Sp. In some embodiments, P* is Rp. In other embodiments, P* is Sp. In some embodiments, the oligonucleotide comprises one or more internucleotide links of formula I, wherein each P* is independently Rp or Sp. In some embodiments, the oligonucleotide comprises one or more internucleotide links of formula I, wherein each P* is Rp. In some embodiments, the oligonucleotide comprises one or more internucleotide links of formula I, wherein each P* is Sp. In some embodiments, the oligonucleotide comprises at least one internucleotide link of formula I, wherein P* is Rp. In some embodiments, the oligonucleotide comprises at least one internucleotide link of formula I, wherein P* is Sp. In some embodiments, the oligonucleotide comprises at least one internucleotide link of formula I, wherein P* is Rp, and at least one internucleotide link of formula I, wherein P* is Sp.

[0297] As defined above and herein, W is O, S, or Se. In some embodiments, W is O. In some embodiments, W is S. In some embodiments, W is Se. In some embodiments, the oligonucleotide comprises at least one internucleotide link of formula I, wherein W is O. In some embodiments, the oligonucleotide comprises at least one internucleotide link of formula I, wherein W is S. In some embodiments, the oligonucleotide comprises at least one internucleotide link of formula I, wherein W is Se.

[0298] As defined above and generally herein, each R is independently hydrogen or an optionally substituted group selected from C1-C6 aliphatic, phenyl, carbocyclic, aryl, heteroaryl, or heterocyclic groups.

[0299] In some embodiments, R is hydrogen. In some embodiments, R is an optionally substituted group selected from C1-C6 aliphatic, phenyl, carbocyclic, aryl, heteroaryl, or heterocyclic groups.

[0300] In some embodiments, R is an optionally substituted C1-C6 aliphatic compound. In some embodiments, R is an optionally substituted C1-C6 alkyl compound. In some embodiments, R is an optionally substituted linear or branched hexyl compound. In some embodiments, R is an optionally substituted linear or branched pentyl compound. In some embodiments, R is an optionally substituted linear or branched butyl compound. In some embodiments, R is an optionally substituted linear or branched propyl compound. In some embodiments, R is an optionally substituted ethyl compound. In some embodiments, R is an optionally substituted methyl compound.

[0301] In some embodiments, R is an optionally substituted phenyl group. In some embodiments, R is a substituted phenyl group. In some embodiments, R is a phenyl group.

[0302] In some embodiments, R is an optionally substituted carbocyclic group. In some embodiments, R is an optionally substituted C3-C group. 10 Carbocyclic group. In some embodiments, R is an optionally substituted monocyclic carbocyclic group. In some embodiments, R is an optionally substituted cycloheptyl group. In some embodiments, R is an optionally substituted cyclohexyl group. In some embodiments, R is an optionally substituted cyclopentyl group. In some embodiments, R is an optionally substituted cyclobutyl group. In some embodiments, R is an optionally substituted cyclopropyl group. In some embodiments, R is an optionally substituted bicyclic carbocyclic group.

[0303] In some embodiments, R is an optionally substituted aryl group. In some embodiments, R is an optionally substituted bicyclic aryl ring.

[0304] In some embodiments, R is an optionally substituted heteroaryl group. In some embodiments, R is a 5-6 membered monocyclic heteroaryl ring having 1-3 independently selected heteroatoms chosen from nitrogen, sulfur, or oxygen. In some embodiments, R is a substituted 5-6 membered monocyclic heteroaryl ring having 1-3 independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur. In some embodiments, R is an unsubstituted 5-6 membered monocyclic heteroaryl ring having 1-3 independently selected heteroatoms chosen from nitrogen, sulfur, or oxygen.

[0305] In some embodiments, R is a 5-membered monocyclic heteroaryl ring having 1-3 independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur, with optional substitution. In some embodiments, R is a 6-membered monocyclic heteroaryl ring having 1-3 independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur, with optional substitution.

[0306] In some embodiments, R is an optionally substituted 5-membered monocyclic heteroaryl ring having one heteroatom selected from nitrogen, oxygen, or sulfur. In some embodiments, R is selected from pyrrole, furanyl, or thiophene.

[0307] In some embodiments, R is an optionally substituted 5-membered heteroaryl ring having two independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur. In some embodiments, R is an optionally substituted 5-membered heteroaryl ring having one nitrogen atom and another heteroatom chosen from sulfur or oxygen. Exemplary R groups include optionally substituted pyrazolyl, imidazolyl, thiazolyl, isothiazolyl, oxazolyl, or isoxazolyl groups.

[0308] In some embodiments, R is a 6-membered heteroaryl ring having 1-3 nitrogen atoms. In other embodiments, R is an optionally substituted 6-membered heteroaryl ring having 1-2 nitrogen atoms. In some embodiments, R is an optionally substituted 6-membered heteroaryl ring having 2 nitrogen atoms. In some embodiments, R is an optionally substituted 6-membered heteroaryl ring having 1 nitrogen atom. Exemplary R groups include optionally substituted pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, triazinyl, or tetraazinyl groups.

[0309] In some embodiments, R is an 8-10 membered bicyclic heteroaryl ring having 1-4 independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur, with optional substitution. In some embodiments, R is a 5,6-fused heteroaryl ring having 1-4 independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur, with optional substitution. In other embodiments, R is a 5,6-fused heteroaryl ring having 1-2 independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur, with optional substitution. In some embodiments, R is a 5,6-fused heteroaryl ring having 1 independently selected heteroatomium, chosen from nitrogen, oxygen, or sulfur, with optional substitution. In some embodiments, R is an optionally substituted indole group. In some embodiments, R is an optionally substituted azabicyclic [3.2.1]octyl group. In some embodiments, R is a 5,6-fused heteroaryl ring having 2 independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur, with optional substitution. In some embodiments, R is an optionally substituted azaindole group. In some embodiments, R is an optionally substituted benzimidazolyl group. In some embodiments, R is an optionally substituted benzothiazolyl group. In some embodiments, R is an optionally substituted benzoxazolyl group. In some embodiments, R is an optionally substituted indazole group. In some embodiments, R is an optionally substituted 5,6-fused heteroaryl ring having three heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0310] In some embodiments, R is a fused heteroaryl ring having 1-4 independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur. In some embodiments, R is a fused heteroaryl ring having 1-2 independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur. In other embodiments, R is a fused heteroaryl ring having 1 independently selected heteroatom chosen from nitrogen, oxygen, or sulfur. In some embodiments, R is an optionally substituted quinolinyl group. In some embodiments, R is an optionally substituted isoquinolinyl group. According to one aspect, R is a fused heteroaryl ring having 2 independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur. In some embodiments, R is quinazoline or quinoxaline.

[0311] In some embodiments, R is an optionally substituted heterocyclic group. In some embodiments, R is a 3-7 membered saturated or partially unsaturated heterocycle having 1-2 independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur. In some embodiments, R is a 3-7 membered saturated or partially unsaturated heterocycle having 1-2 independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur. In some embodiments, R is an unsubstituted 3-7 membered saturated or partially unsaturated heterocycle having 1-2 independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur.

[0312] In some embodiments, R is an optionally substituted heterocyclic group. In some embodiments, R is a 6-membered saturated or partially unsaturated heterocycle having 1-2 independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur. In some embodiments, R is a 6-membered partially unsaturated heterocycle having 2 independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur. In some embodiments, R is a 6-membered partially unsaturated heterocycle having 2 oxygen atoms.

[0313] In some embodiments, R is a 3- to 7-membered saturated or partially unsaturated heterocycle having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R is ethylene oxide, oxetane, tetrahydrofuranyl, tetrahydropyranyl, oxetane, aziridinyl, aziridane, pyrrolyl, piperidinyl, aziridane, thiohepane, thiohepane, tetrahydrophenylthio, tetrahydrothiaranyl, thiohepane, dioxapentane, oxothiohepane, oxazolyl, imidazoyl, thiazoyl, dithiohepane, dioxazoyl, morpholinyl, oxothiohexyl, piperazine, thiomorpholinyl, dithiohexyl, dioxetane, oxaazahepane, oxothiohepane, dithiohepane, diazahepane, dihydrofuranone, tetrahydropyranone, oxetanehepone, pyrrolidone, piperidinone, nitrogen Heterocyclic heptanone, dihydrothiophenone, tetrahydrothioranone, thiocyclic heptanone, oxazolidinone, oxazinone, oxazolidinone, oxazolidinone, dioxapentaneone, dioxazolidinone, dioxazolidinone, oxathiolinone, oxathiocyclohexaneone, oxathiocyclic heptanone, thiazolidinone, thiazinone, thiazolidinone, imidazolidinone The compounds R are: tetrahydropyrimidinone, diazacycloheptanone, imidazolidinedione, oxazolidinedione, thiazolidinone, dioxocyclopentanedione, oxathionecyclopentanedione, piperazinedione, morpholinone, thiomorpholinone, tetrahydropyranyl, tetrahydrofuranyl, morpholinyl, thiomorpholinyl, piperidinyl, piperazine, pyrrolidinyl, tetrahydrophenylthio, or tetrahydrothiaranyl. In some embodiments, R is an optionally substituted 5-membered saturated or partially unsaturated heterocycle having 1-2 independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur.

[0314] In some embodiments, R is a 5-6 membered partially unsaturated monocyclic ring having 1-2 independently substituted heteroatoms selected from nitrogen, oxygen, or sulfur. In some embodiments, R is a tetrahydropyridyl, dihydrothiazolyl, dihydrooxazolyl, or oxazolinyl group that is optionally substituted.

[0315] In some embodiments, R is an optionally substituted 8-10 membered bicyclic saturated or partially unsaturated heterocycle having 1-4 independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur. In some embodiments, R is an optionally substituted indololinyl group. In some embodiments, R is an optionally substituted isoindololinyl group. In some embodiments, R is an optionally substituted 1,2,3,4-tetrahydroquinoline. In some embodiments, R is an optionally substituted 1,2,3,4-tetrahydroisoquinoline.

[0316] As defined above and in general terms throughout this document, each R′ is independently -R, -C(O)R, -CO2R, or -SO2R, or:

[0317] The two R′ atoms on the same nitrogen atom, together with their intercalated atoms, form an optionally substituted heterocyclic or heteroaryl ring, or

[0318] Two R′ on the same carbon atom, together with their intercalated atoms, form optionally substituted aryl, carbocyclic, heterocyclic, or heteroaryl rings.

[0319] In some implementations, R' is -R, -C(O)R, -CO2R, or -SO2R, where R is as defined above and as described herein.

[0320] In some embodiments, R' is -R, where R is as defined and described above and herein. In some embodiments, R' is hydrogen.

[0321] In some embodiments, R' is -C(O)R, where R is as defined above and as described herein. In some embodiments, R' is -CO2R, where R is as defined above and as described herein. In some embodiments, R' is -SO2R, where R is as defined above and as described herein.

[0322] In some embodiments, the two R′ on the same nitrogen atom, together with their intercalation atoms, form an optionally substituted heterocyclic or heteroaryl ring. In some embodiments, the two R′ on the same carbon atom, together with their intercalation atoms, form an optionally substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring.

[0323] As defined above and generally in this document, -Cy- is a divalent ring selected from phenylene, carbocyclotrimonium, arylene, heteroarylene or heterocyclotrimonium, which is optionally substituted.

[0324] In some embodiments, -Cy- is an optionally substituted phenylene group. In some embodiments, -Cy- is an optionally substituted carbocyclic group. In some embodiments, -Cy- is an optionally substituted aryl group. In some embodiments, -Cy- is an optionally substituted heterocyclic group. In some embodiments, -Cy- is an optionally substituted heterocyclic group.

[0325] As defined above and in general throughout this article, X, Y, and Z are each independently -O-, -S-, -N(-LR). 1 )- or L, where L and R 1 Each is independent as defined above and described below.

[0326] In some embodiments, X is -O-. In some embodiments, X is -S-. In some embodiments, X is -O- or -S-. In some embodiments, the oligonucleotide comprises at least one internucleotide link of formula I, wherein X is -O-. In some embodiments, the oligonucleotide comprises at least one internucleotide link of formula I, wherein X is -S-. In some embodiments, the oligonucleotide comprises at least one internucleotide link of formula I, wherein X is -O-, and at least one internucleotide link of formula I, wherein X is -S-. In some embodiments, the oligonucleotide comprises at least one internucleotide link of formula I, wherein X is -O-, and at least one internucleotide link of formula I, wherein X is -S-, and at least one internucleotide link of formula I, wherein L is optionally substituted straight-chain or branched C1-C. 10 Alkylene, wherein one or more methylene units of L are optionally and independently substituted with the following: optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -c≡c-, -C(R′)2-, -Cy-, -O-, -S-, -SS-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -C(O)N(R′)-, -N(R′)C(O)N(R′)-, -N(R′)C(O)-, -N(R′)C(O)O-, -OC(O)N(R′)-, -S(O)-, -S(O)2-, -S(O)2N(R′)-, -N(R′)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)- or -C(O)O-.

[0327] In some implementations, X is -N (-LR) 1 In some implementations, X is -N(R). 1 In some implementations, X is -N(R')-. In some implementations, X is -N(R)-. In some implementations, X is -NH-.

[0328] In some embodiments, X is L. In some embodiments, X is a covalent bond. In some embodiments, X is, or optionally substituted, a straight-chain or branched C1-C. 10Alkylene, wherein one or more methylene units of L are optionally and independently substituted with the following: optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -c≡c-, -C(R′)2-, -Cy-, -O-, -S-, -SS-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -C(O)N(R′)-, -N(R′)C(O)N(R′)-, -N(R′)C(O)-, -N(R′)C(O)O-, -OC(O)N(R′)-, -S(O)-, -S(O)2-, -S(O)2N(R′)-, -N(R′)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)- or -C(O)O-. In some implementations, X is optionally replaced by C1-C. 10 Alkylene or C1-C 10 Alkenyl group. In some embodiments, X is methylene.

[0329] In some implementations, Y is -O-. In some implementations, Y is -S-.

[0330] In some implementations, Y is -N(-LR) 1 In some implementations, Y is -N(R). 1 In some implementations, Y is -N(R')-. In some implementations, Y is -N(R)-. In some implementations, Y is -NH-.

[0331] In some embodiments, Y is L. In some embodiments, Y is a covalent bond. In some embodiments, Y is or optionally substituted a straight-chain or branched C1-C. 10 Alkylene, wherein one or more methylene units of L are optionally and independently substituted with the following: optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -c≡c-, -C(R′)2-, -Cy-, -O-, -S-, -SS-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -C(O)N(R′)-, -N(R′)C(O)N(R′)-, -N(R′)C(O)-, -N(R′)C(O)O-, -OC(O)N(R′)-, -S(O)-, -S(O)2-, -S(O)2N(R′)-, -N(R′)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)- or -C(O)O-. In some implementations, Y is optionally replaced by C1-C. 10 Alkylene or C1-C 10 Alkenyl group. In some embodiments, Y is methylene.

[0332] In some implementations, Z is -O-. In some implementations, Z is -S-.

[0333] In some implementations, Z is -N (-LR) 1 In some implementations, Z is -N(R). 1 In some implementations, Z is -N(R')-. In some implementations, Z is -N(R)-. In some implementations, Z is -NH-.

[0334] In some embodiments, Z is L. In some embodiments, Z is a covalent bond. In some embodiments, Z is, or optionally substituted, a straight-chain or branched C1-C. 10 Alkylene, wherein one or more methylene units of L are optionally and independently substituted with the following: optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -c≡c-, -C(R′)2-, -Cy-, -O-, -S-, -SS-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -C(O)N(R′)-, -N(R′)C(O)N(R′)-, -N(R′)C(O)-, -N(R′)C(O)O-, -OC(O)N(R′)-, -S(O)-, -S(O)2-, -S(O)2N(R′)-, -N(R′)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)- or -C(O)O-. In some implementations, Z is optionally replaced by C1-C. 10 Alkylene or C1-C 10 Alkenyl group. In some embodiments, Z is methylene.

[0335] As defined above and generally in this document, L is a covalently bonded or optionally substituted straight chain or branch C1-C. 10 Alkylene, wherein one or more methylene units of L are optionally and independently substituted with the following: optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -c≡c-, -C(R′)2-, -Cy-, -O-, -S-, -SS-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -C(O)N(R′)-, -N(R′)C(O)N(R′)-, -N(R′)C(O)-, -N(R′)C(O)O-, -OC(O)N(R′)-, -S(O)-, -S(O)2-, -S(O)2N(R′)-, -N(R′)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)- or -C(O)O-.

[0336] In some implementations, L is a covalent bond. In some implementations, L is an optionally substituted straight-chain or branched C1-C. 10 Alkylene, wherein one or more methylene units of L are optionally and independently substituted with the following: optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -c≡c-, -C(R′)2-, -Cy-, -O-, -S-, -SS-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -C(O)N(R′)-, -N(R′)C(O)N(R′)-, -N(R′)C(O)-, -N(R′)C(O)O-, -OC(O)N(R′)-, -S(O)-, -S(O)2-, -S(O)2N(R′)-, -N(R′)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)- or -C(O)O-.

[0337] In some implementations, L has a structure -L 1 -V-, where:

[0338] L 1 It is a group selected from the following optionally substituted groups: C1-C6 alkylene, C1-C6 alkenylene, carbocycloylene, arylene, C1-C6 heteroalkylene, heterocycloylene, and heteroarylene;

[0339] V is selected from -O-, -S-, -NR'-, C(R')2, -SS-, -BSSC-, Or selected from the following optionally substituted groups: C1-C6 alkylene, arylene, C1-C6 heteroalkylene, heterocyclic and heteroarylene;

[0340] A is =O, =S, =NR' or =C(R')2;

[0341] B and C are each independently -O-, -S-, -NR', -C(R')2- or optionally substituted groups selected from: C1-C6 alkylene, carbocycloidene, arylene, heterocycloidene, or heteroarylene; and

[0342] Each R' is independent as defined above and as described in this article.

[0343] In some implementations, L 1 yes

[0344] In some implementations, L 1 yes Wherein the cyclic Cy' is optionally substituted with an arylene, carbocyclic, heterocyclic, or heterocyclic group. In some embodiments, L 1 It is an optional replacement In some implementations, L 1 yes

[0345] In some implementations, L 1 Connected to X. In some implementations, L 1 It is a group selected from the following optionally substituted groups: Furthermore, the sulfur atom is bonded to V. In some embodiments, L 1 It is a group selected from the following optionally substituted groups: And the carbon atom is attached to X.

[0346] In some implementations, L has the following structure:

[0347]

[0348] in:

[0349] E is -O-, -S-, -NR'-, or -C(R')2-;

[0350] Is it a single bond or a double bond?

[0351] Two Rs L1 Together with the two carbon atoms to which they are bonded, they form optionally substituted aryl, carbocyclic, heteroaryl, or heterocyclic groups; and each R' is independently as defined above and as described herein.

[0352] In some implementations, L has the following structure:

[0353]

[0354] in:

[0355] G is -O-, -S-, or -NR';

[0356] It is either a single bond or a double bond; and

[0357] Two Rs L1 Together with the two carbon atoms they bond with, they form an optionally substituted aryl group, C3-C. 10 Carbon ring, heteroaryl or heterocyclic.

[0358] In some implementations, L has the following structure:

[0359]

[0360] in:

[0361] E is -O-, -S-, -NR'-, or -C(R')2-;

[0362] D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO2)-, =C(CO2-(C1-C6 aliphatic))- or =C(CF3)-; and

[0363] Each R' is independent as defined above and as described in this article.

[0364] In some implementations, L has the following structure:

[0365]

[0366] in:

[0367] G is -O-, -S-, or -NR';

[0368] D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO2)-, =C(CO2-(C1-C6 aliphatic))- or =C(CF3)-.

[0369] In some implementations, L has the following structure:

[0370]

[0371] in:

[0372] E is -O-, -S-, -NR'-, or -C(R')2-;

[0373] D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO2)-, =C(CO2-(C1-C6 aliphatic))- or =C(CF3)-; and

[0374] Each R' is independent as defined above and as described in this article.

[0375] In some implementations, L has the following structure:

[0376]

[0377] in:

[0378] G is -O-, -S-, or -NR';

[0379] D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO2)-, =C(CO2-(C1-C6 aliphatic))- or =C(CF3)-.

[0380] In some implementations, L has the following structure:

[0381]

[0382] in:

[0383] E is -O-, -S-, -NR'-, or -C(R')2-;

[0384] Is it a single bond or a double bond?

[0385] Two Rs L1 Together with the two carbon atoms they bond with, they form an optionally substituted aryl group, C3-C. 10 Carbocyclic, heteroaryl, or heterocyclic;

[0386] Furthermore, each R' is independent as defined above and as described in this article.

[0387] In some implementations, L has the following structure:

[0388]

[0389] in:

[0390] G is -O-, -S-, or -NR';

[0391] Is it a single bond or a double bond?

[0392] Two Rs L1 Together with the two carbon atoms they bond with, they form an optionally substituted aryl group, C3-C. 10 Carbocyclic, heteroaryl, or heterocyclic;

[0393] Furthermore, each R' is independent as defined above and as described in this article.

[0394] In some implementations, L has the following structure:

[0395]

[0396] in:

[0397] E is -O-, -S-, -NR'-, or -C(R')2-;

[0398] D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO2)-, =C(CO2-(C1-C6 aliphatic))- or =C(CF3)-; and

[0399] Each R' is independent as defined above and as described in this article.

[0400] In some implementations, L has the following structure:

[0401]

[0402] in:

[0403] G is -O-, -S-, or -NR';

[0404] D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO2)-, =C(CO2-(C1-C6 aliphatic))- or =C(CF3)-; and

[0405] Each R' is independent as defined above and as described in this article.

[0406] In some implementations, L has the following structure:

[0407]

[0408] in:

[0409] E is -O-, -S-, -NR'-, or -C(R')2-;

[0410] D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO2)-, =C(CO2-(C1-C6 aliphatic))- or =C(CF3)-; and

[0411] Each R' is independent as defined above and as described in this article.

[0412] In some implementations, L has the following structure:

[0413]

[0414] in:

[0415] G is -O-, -S-, or -NR';

[0416] D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO2)-, =C(CO2-(C1-C6 aliphatic))- or =C(CF3)-; and

[0417] Each R' is independent as defined above and as described in this article.

[0418] In some implementations, L has the following structure:

[0419]

[0420] in:

[0421] E is -O-, -S-, -NR'-, or -C(R')2-;

[0422] Is it a single bond or a double bond?

[0423] Two Rs L1 Together with the two carbon atoms they bond with, they form an optionally substituted aryl group, C3-C. 10 Carbocyclic, heteroaryl, or heterocyclic; and each R' is independently as defined above and as described herein.

[0424] In some implementations, L has the following structure:

[0425]

[0426] in:

[0427] G is -O-, -S-, or -NR';

[0428] Is it a single bond or a double bond?

[0429] Two Rs L1 Together with the two carbon atoms they bond with, they form an optionally substituted aryl group, C3-C. 10 Carbocyclic, heteroaryl, or heterocyclic; and each R' is independently as defined above and as described herein.

[0430] In some implementations, L has the following structure:

[0431]

[0432] in:

[0433] E is -O-, -S-, -NR'-, or -C(R')2-;

[0434] D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO2)-, =C(CO2-(C1-C6 aliphatic))- or =C(CF3)-; and

[0435] Each R' is independent as defined above and as described in this article.

[0436] In some implementations, L has the following structure:

[0437]

[0438] in:

[0439] G is -O-, -S-, or -NR';

[0440] D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO2)-, =C(CO2-(C1-C6 aliphatic))- or =C(CF3)-; and

[0441] R' is as defined above and as described in this article.

[0442] In some implementations, L has the following structure:

[0443]

[0444] in:

[0445] E is -O-, -S-, -NR'-, or -C(R')2-;

[0446] D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO2)-, =C(CO2-(Cl-C6 aliphatic))- or =C(CF3)-; and

[0447] Each R' is independent as defined above and as described in this article.

[0448] In some implementations, L has the following structure:

[0449]

[0450] in:

[0451] G is -O-, -S-, or -NR';

[0452] D is =N-, =C(F)-, =C(Cl)-, =C(Br)-, =C(I)-, =C(CN)-, =C(NO2)-, =C(CO2-(C1-C6 aliphatic))- or =C(CF3)-; and

[0453] R' is as defined above and as described in this article.

[0454] In some implementations, L has the following structure:

[0455]

[0456] The phenyl ring is optionally substituted. In some embodiments, the phenyl ring is not substituted. In some embodiments, the phenyl ring is substituted.

[0457] In some implementations, L has the following structure:

[0458]

[0459] The phenyl ring is optionally substituted. In some embodiments, the phenyl ring is not substituted. In some embodiments, the phenyl ring is substituted.

[0460] In some implementations, L has the following structure:

[0461]

[0462] in:

[0463] It is either a single bond or a double bond; and

[0464] Two Rs L1 Together with the two carbon atoms they bond with, they form an optionally substituted aryl group, C3-C. 10 Carbon ring, heteroaryl or heterocyclic.

[0465] In some implementations, L has the following structure:

[0466]

[0467] in:

[0468] G is -O-, -S-, or -NR';

[0469] It is either a single bond or a double bond; and

[0470] Two Rs L1 Together with the two carbon atoms they bond with, they form an optionally substituted aryl group, C3-C. 10 Carbon ring, heteroaryl or heterocyclic.

[0471] As defined above and generally herein, E is -O-, -S-, -NR'-, or -C(R')2-, where each R' is independently as defined above and as described herein. In some embodiments, E is -O-, -S-, or -NR'-. In some embodiments, E is -O-, -S-, or -NH-. In some embodiments, E is -O-. In some embodiments, E is -S-. In some embodiments, E is -NH-.

[0472] As defined above and generally herein, G is -O-, -S-, or -NR', where each R' is independently as defined above and as described herein. In some embodiments, G is -O-, -S-, or -NH-. In some embodiments, G is -O-. In some embodiments, G is -S-. In some embodiments, G is -NH-.

[0473] In some implementations, L is -L 3 -G-, where:

[0474] L 3 It is an optionally substituted C1-C5 alkylene or alkenylene group, wherein one or more methylene units are optionally and independently substituted with: -O-, -S-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -S(O)-, -S(O)2- or and

[0475] G, R', and Cy' are each independently defined as above and as described in this article.

[0476] In some implementations, L is -L 3 -S-, where L 3 It is as defined above and as described herein. In some implementations, L is -L 3 -O-, where L 3 It is as defined above and as described herein. In some implementations, L is -L 3 -N(R')-, where L 3 R and R' are each independent as defined above and as described herein. In some implementations, L is -L 3 -NH-, where L 3 R and R' are each independently defined as above and as described in this article.

[0477] In some implementations, L 3It is an optionally substituted C5 alkylene or alkenylene group, wherein one or more methylene units are optionally and independently substituted with: -O-, -S-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -S(O)-, -S(O)2- or Furthermore, R' and Cy' are each independently defined as above and as described herein. In some implementations, L 3 It is an optionally substituted C5 alkylene group. In some embodiments, -L 3 -G- is

[0478] In some implementations, L 3 It is an optionally substituted C4 alkylene or alkenylene group, wherein one or more methylene units are optionally and independently substituted with: -O-, -S-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -S(O)-, -S(O)2- or Furthermore, R' and Cy' are each independently defined as above and as described in this article.

[0479] In some implementations, -L 3 -G- is

[0480] In some implementations, L 3 It is an optionally substituted C3 alkylene or alkenylene group, wherein one or more methylene units are optionally and independently substituted with: -O-, -S-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -S(O)-, -S(O)2- or Furthermore, R' and Cy' are each independently defined as above and as described in this article.

[0481] In some implementations, -L 3 -G- is

[0482] In some implementations, L is In some implementations, L is In some implementations, L is

[0483] In some implementations, L 3 It is an optionally substituted C2 alkylene or alkenylene group, wherein one or more methylene units are optionally and independently substituted with: -O-, -S-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -S(O)-, -S(O)2- or Furthermore, R' and Cy' are each independently defined as above and as described in this article.

[0484] In some implementations, -L 3 -G- is Where G and Cy' are each independently as defined above and as described herein. In some implementations, L is

[0485] In some implementations, L is -L 4 -G-, where L 4 It is an optionally substituted C1-C2 alkylene group; and G is as defined above and as described herein. In some embodiments, L is -L 4 -G-, where L 4 It is an optionally substituted C1-C2 alkylene group; G is as defined above and as described herein; and G is attached to R. 1 In some implementations, L is -L 4 -G-, where L 4 It is an optionally substituted methylene group; G is as defined above and as described herein; and G is attached to R. 1 In some implementations, L is -L 4 -G-, where L 4 It is a methylene group; G is as defined above and as described herein; and G is attached to R. 1 In some implementations, L is -L 4 -G-, where L 4 It is optionally substituted -(CH2)2-; G is as defined above and as described herein; and G is connected to R. 1 In some implementations, L is -L 4 -G-, where L 4 It is -(CH2)2-; G is as defined above and as described herein; and G is connected to R. 1 .

[0486] In some implementations, L is Where G is as defined above and as described in this article, and G is connected to R. 1 In some implementations, L is... Where G is as defined above and as described in this article, and G is connected to R. 1 In some implementations, L is... Where G is as defined above and as described in this article, and G is connected to R. 1 In some implementations, L is... The sulfur atom is attached to R. 1 In some implementations, L is... The oxygen atom is attached to R. 1 .

[0487] In some implementations, L is Where G is as defined above and as described in this article.

[0488] In some implementations, L is -SR L3 -or-SC(O)-R L3 -, where R L3 It is an optionally substituted straight-chain or branched C1-C9 alkylene group, wherein one or more methylene units are optionally and independently substituted with: optionally substituted C1-C6 alkylene, C1-C6 alkenyl, -c≡c-, -C(R′)2-, -Cy-, -O-, -S-, -SS-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -C(O)N(R′)-, -N(R -C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)2-, -S(O)2N(R')-, -N(R')S(O)2-, -SC(O)-, -C(O)S-, -OC(O)- or -C(O)O-, where R' and -Cy- are each independently as defined above and as described herein. In some embodiments, L is -SR L3 -or-SC(O)-R L3 , where R L3 It is an optionally substituted C1-C6 alkylene group. In some embodiments, L is -SR. L3 -or-SC(O)-R L3 -, where R L3 It is an optionally substituted C1-C6 alkenyl group. In some embodiments, L is -SR. L3 -or-SC(O)-R L3 -, where R L3 It is an optionally substituted C1-C6 alkylene group, wherein one or more methylene units are optionally and independently replaced by: optionally substituted C1-C6 alkenyl, arylene, or heteroarylene. In some embodiments, R L3 It is optionally substituted with -S-(C1-C6 alkenyl)-, -S-(C1-C6 alkylene)-, -S-(C1-C6 alkylene)-arylene-(C1-C6 alkylene)-, -S-CO-arylene-(C1-C6 alkylene)- or -S-CO-(C1-C6 alkylene)-arylene-(C1-C6 alkylene)-.

[0489] In some implementations, L is

[0490] In some implementations, L is In some implementations, L is In some implementation schemes,

[0491] In some embodiments, the sulfur atom in the L embodiments described above and herein is attached to X. In some embodiments, the sulfur atom in the L embodiments described above and herein is attached to R. 1 .

[0492] As defined above and generally in this article, R 1 It is a halogen, R, or optionally substituted C1-C 50 Aliphatic, wherein one or more methylene units are optionally and independently substituted with: optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -c≡c-, -C(R′)2-, -Cy-, -O-, -S-, -SS-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -C(O)N(R′)-, -N(R′)C(O) N(R′)-, -N(R′)C(O)-, -N(R′)C(O)O-, -OC(O)N(R′)-, -S(O)-, -S(O)2-, -S(O)2N(R′)-, -N(R′)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, or -C(O)O-, where each variable is independent as defined above and as described herein. In some implementations, R 1 It is a halogen, R, or optionally substituted C1-C 10 Aliphatic, wherein one or more methylene units are optionally and independently substituted with: optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -c≡c-, -C(R′)2-, -Cy-, -O-, -S-, -SS-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -C(O)N(R′)-, -N(R′)C(O) N(R′)-, -N(R′)C(O)-, -N(R′)C(O)O-, -OC(O)N(R′)-, -S(O)-, -S(O)2-, -S(O)2N(R′)-, -N(R′)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)- or -C(O)O-, where each variable is independent as defined above and as described herein.

[0493] In some implementation schemes, R 1 It is hydrogen. In some implementations, R1 It is a halogen. In some implementations, R 1 Yes -F. In some implementations, R 1 Yes -Cl. In some implementations, R 1 Yes -Br. In some implementations, R 1 Yes-I.

[0494] In some implementation schemes, R 1 Let R be R, where R is as defined above and as described in this article.

[0495] In some implementation schemes, R 1 It is hydrogen. In some implementations, R 1 It is a group selected from the following optionally substituted groups: C1-C 50 Aliphatic, phenyl, carbocyclic, aryl, heteroaryl or heterocyclic.

[0496] In some implementation schemes, R 1 It is the optional substitution of C1-C 50 Aliphatic. In some implementations, R 1 It is the optional substitution of C1-C 10 Aliphatic. In some implementations, R 1 It is an optionally substituted C1-C6 aliphatic compound. In some embodiments, R 1 It is an optionally substituted C1-C6 alkyl group. In some embodiments, R 1 It is an optional substitution of linear or branched hexyl groups. In some implementations, R 1 It is an optionally substituted linear or branched pentyl group. In some embodiments, R 1 It is an optional substitution of linear or branched butyl. In some embodiments, R 1 It is optionally replaced by a linear or branched propyl group. In some embodiments, R 1 It is an optionally substituted ethyl group. In some embodiments, R 1 It is an optionally substituted methyl group.

[0497] In some implementation schemes, R 1 It is an optionally substituted phenyl group. In some embodiments, R 1 It is a substituted phenyl group. In some embodiments, R 1 It is a phenyl group.

[0498] In some implementation schemes, R 1 It is an optionally substituted carbocyclic group. In some embodiments, R 1 It is an optional replacement of C3-C 10 Carbocyclic group. In some embodiments, R 1It is an optionally substituted monocyclic carbocyclic group. In some embodiments, R 1 It is an optionally substituted cycloheptanyl. In some embodiments, R 1 It is an optionally substituted cyclohexyl group. In some embodiments, R 1 It is an optionally substituted cyclopentyl group. In some embodiments, R 1 It is an optionally substituted cyclobutyl group. In some embodiments, R 1 It is an optionally substituted cyclopropyl group. In some embodiments, R 1 It is an optionally substituted bicyclic carbocyclic group.

[0499] In some implementation schemes, R 1 It is the optional substitution of C1-C 50 Polycyclic hydrocarbons. In some implementations, R 1 It is the optional substitution of C1-C 50 A polycyclic hydrocarbon, wherein one or more methylene units are optionally and independently substituted with: optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -c≡c-, -C(R′)2-, -Cy-, -O-, -S-, -SS-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -C(O)N(R′)-, -N(R′)C(O) N(R′)-, -N(R′)C(O)-, -N(R′)C(O)O-, -OC(O)N(R′)-, -S(O)-, -S(O)2-, -S(O)2N(R′)-, -N(R′)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, or -C(O)O-, where each variable is independent as defined above and as described herein. In some implementations, R 1 It is an optional replacement In some implementation schemes, R 1 yes In some implementation schemes, R 1 It is an optional replacement

[0500] In some implementation schemes, R 1 It is an optionally substituted C1-C moiety containing one or more optionally substituted polycyclic hydrocarbon moieties. 50 Aliphatic. In some implementations, R 1 It is an optionally substituted C1-C moiety containing one or more optionally substituted polycyclic hydrocarbon moieties. 50Aliphatic, wherein one or more methylene units are optionally and independently substituted with: optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -c≡c-, -C(R′)2-, -Cy-, -O-, -S-, -SS-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -C(O)N(R′)-, -N(R′)C(O) N(R′)-, -N(R′)C(O)-, -N(R′)C(O)O-, -OC(O)N(R′)-, -S(O)-, -S(O)2-, -S(O)2N(R′)-, -N(R′)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, or -C(O)O-, where each variable is independent as defined above and as described herein. In some implementations, R 1 It includes one or more optional substitutions The optional substitution of C1-C 50 Aliphatic. In some implementations, R 1 yes In some implementation schemes, R 1 yes In some implementation schemes, R 1 yes In some implementation schemes, R 1 yes In some implementation schemes, R 1 yes

[0501] In some implementation schemes, R 1 It is an optionally substituted aryl group. In some embodiments, R 1 It is a selectively substituted bicyclic aryl ring.

[0502] In some implementation schemes, R 1 It is an optionally substituted heteroaryl group. In some embodiments, R 1 It is a 5-6 membered monocyclic heteroaryl ring having 1-3 independently substituted heteroatoms selected from nitrogen, sulfur, or oxygen. In some embodiments, R 1 It is a 5-6 membered monocyclic heteroaryl ring having 1-3 independently substituted heteroatoms selected from nitrogen, oxygen, or sulfur. In some embodiments, R 1 It is an unsubstituted 5-6 membered monocyclic heteroaryl ring having 1-3 heteroatoms independently selected from nitrogen, sulfur or oxygen.

[0503] In some implementation schemes, R 1 It is a optionally substituted 5-membered monocyclic heteroaryl ring having 1-3 independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur. In some embodiments, R 1It is a 6-membered monocyclic heteroaryl ring with 1 to 3 independently substituted heteroatoms selected from nitrogen, oxygen or sulfur.

[0504] In some implementation schemes, R 1 It is a 5-membered monocyclic heteroaryl ring having one optionally substituted heteroatom selected from nitrogen, oxygen, or sulfur. In some embodiments, R 1 Selected from pyrrole, furanyl, or thiophene.

[0505] In some implementation schemes, R 1 It is a optionally substituted 5-membered heteroaryl ring having two independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur. In some embodiments, R 1 It is a 5-membered heteroaryl ring having one nitrogen atom and another heteroatom selected from sulfur or oxygen, which is optionally substituted. Example R 1 The groups include optionally substituted pyrazolyl, imidazole, thiazolyl, isothiazolyl, oxazolyl, or isoxazolyl groups.

[0506] In some implementation schemes, R 1 It is a 6-membered heteroaryl ring having 1-3 nitrogen atoms. In other embodiments, R 1 It is an optionally substituted 6-membered heteroaryl ring having 1-2 nitrogen atoms. In some embodiments, R 1 It is an optionally substituted 6-membered heteroaryl ring having 2 nitrogen atoms. In some embodiments, R 1 It is a 6-membered heteroaryl ring with one nitrogen atom, optionally substituted. Example R 1 The groups include optionally substituted pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, triazinyl, or tetraazinyl groups.

[0507] In some implementations, R 1 It is an 8-10 membered bicyclic heteroaryl ring having 1-4 independently substituted heteroatoms selected from nitrogen, oxygen, or sulfur. In some embodiments, R 1 It is a optionally substituted 5,6-fused heteroaryl ring having 1-4 independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur. In other embodiments, R 1 It is a optionally substituted 5,6-fused heteroaryl ring having one or two independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur. In some embodiments, R 1 It is a optionally substituted 5,6-fused heteroaryl ring having a heteroatom independently selected from nitrogen, oxygen, or sulfur. In some embodiments, R 1 It is an optionally substituted indole group. In some embodiments, R 1 It is optionally substituted with azabicyclo[3.2.1]octyl. In some embodiments, R 1It is a optionally substituted 5,6-fused heteroaryl ring having two independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur. In some embodiments, R 1 It is an optionally substituted aza-indole group. In some embodiments, R 1 It is optionally substituted with a benzimidazole group. In some embodiments, R 1 It is optionally substituted with a benzothiazolyl group. In some embodiments, R 1 It is optionally substituted with a benzoxazolyl group. In some embodiments, R 1 It is an optionally substituted indazole group. In some embodiments, R 1 It is a 5,6-fused heteroaryl ring having three independently selected heteroatoms chosen from nitrogen, oxygen or sulfur, which are optionally substituted.

[0508] In some implementations, R 1 It is a 6,6-fused heteroaryl ring having 1-4 independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur, with optional substitution. In some embodiments, R 1 It is an optionally substituted 6,6-fused heteroaryl ring having one or two independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur. In other embodiments, R 1 It is a 6,6-fused heteroaryl ring having one independently selected heteroatom of nitrogen, oxygen, or sulfur, optionally substituted. In some embodiments, R 1 It is an optionally substituted quinolinyl group. In some embodiments, R 1 It is an optionally substituted isoquinolinyl group. According to one aspect, R 1 It is a 6,6-fused heteroaryl ring having two independently selected heteroatoms chosen from nitrogen, oxygen, or sulfur, with optional substitution. In some embodiments, R 1 It is quinazoline or quinoxaline.

[0509] In some implementation schemes, R 1 It is an optionally substituted heterocyclic group. In some embodiments, R 1 It is a 3-7 membered saturated or partially unsaturated heterocycle having 1-2 independently substituted heteroatoms selected from nitrogen, oxygen, or sulfur. In some embodiments, R 1 It is a 3-7 member saturated or partially unsaturated heterocycle having 1-2 independently substituted heteroatoms selected from nitrogen, oxygen, or sulfur. In some embodiments, R 1 It is an unsubstituted 3-7 member saturated or partially unsaturated heterocycle having 1-2 heteroatoms independently selected from nitrogen, oxygen or sulfur.

[0510] In some implementation schemes, R 1 It is an optionally substituted heterocyclic group. In some embodiments, R 1It is a 6-membered saturated or partially unsaturated heterocycle having 1-2 independently substituted heteroatoms selected from nitrogen, oxygen, or sulfur. In some embodiments, R 1 It is a 6-membered partially unsaturated heterocycle with two independently substituted heteroatoms selected from nitrogen, oxygen, or sulfur. In some embodiments, R 1 It is a 6-membered partially unsaturated heterocycle with 2 oxygen atoms that is optionally substituted.

[0511] In some implementations, R 1 It is a 3-7 member saturated or partially unsaturated heterocycle having 1-2 independent heteroatoms selected from nitrogen, oxygen, or sulfur. In some embodiments, R 1 It is ethylene oxide, oxetane, tetrahydrofuranyl, tetrahydropyranyl, oxetane, aziridinyl, aziridane, pyrrolyl, piperidinyl, aziridane, thiohepane, thiohepane, tetrahydrophenylthio, tetrahydrothiaranyl, thiohepane, dioxapentane, oxothiohepane, oxazolyl, imidazoyl, thiazoyl, dithiohepane, dioxalyl, morpholinyl, oxothiohexyl, piperazine, thiomorpholinyl, dithiohexyl, dioxetane, oxaazahepane, oxothiohepane, dithiohepane, diazolyl, dihydrofuranone, tetrahydropyranone, oxetaneheptanone, pyrrolidone, piperidinone, aziridaneheptanone. Dihydrothiophenone, tetrahydrothioranone, thioheptanone, oxazolidinone, oxazinone, oxazolidinone, oxazolidinone, dioxapentanone, dioxanone, dioxazolidinone, oxazolidinone, oxazolidinone, oxazolidinone, oxazolidinone, oxazolidinone, thiazolidinone, thiazolidinone, thiazolidinone, imidazolidinone, tetrahydrothiophenone Hydropyrimidinone, diazacycloheptanone, imidazolidinedione, oxazolidinedione, thiazolidinone, dioxocyclopentanedione, oxathionecyclopentanedione, piperazinedione, morpholinone, thiomorpholinone, tetrahydropyranyl, tetrahydrofuranyl, morpholinyl, thiomorpholinyl, piperidinyl, piperazine, pyrrolidinyl, tetrahydrophenylthio, or tetrahydrothiaranyl. In some embodiments, R 1 It is a 5-membered saturated or partially unsaturated heterocycle having 1-2 independently selected heteroatoms chosen from nitrogen, oxygen or sulfur.

[0512] In some implementations, R 1 It is a 5-6 membered partially unsaturated monocyclic ring having 1-2 independently substituted heteroatoms selected from nitrogen, oxygen, or sulfur. In some embodiments, R 1 It is optionally substituted with tetrahydropyridinyl, dihydrothiazolyl, dihydrooxazolyl, or oxazolinyl.

[0513] In some implementation schemes, R1 It is an 8-10 membered bicyclic saturated or partially unsaturated heterocycle having 1-4 independently substituted heteroatoms selected from nitrogen, oxygen, or sulfur. In some embodiments, R 1 It is an optionally substituted indololinyl group. In some embodiments, R 1 It is an optionally substituted isoindoline group. In some embodiments, R 1 It is optionally substituted with 1,2,3,4-tetrahydroquinoline. In some embodiments, R 1 It is a 1,2,3,4-tetrahydroisoquinoline with optional substitution.

[0514] In some implementation schemes, R 1 It is the optional substitution of C1-C 10 Aliphatic, wherein one or more methylene units are optionally and independently substituted with: optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -c≡c-, -C(R′)2-, -Cy-, -O-, -S-, -SS-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -C(O)N(R′)-, -N(R′)C(O) N(R′)-, -N(R′)C(O)-, -N(R′)C(O)O-, -OC(O)N(R′)-, -S(O)-, -S(O)2-, -S(O)2N(R′)-, -N(R′)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, or -C(O)O-, where each variable is independent as defined above and as described herein. In some implementations, R 1 It is the optional substitution of C1-C 10 Aliphatic, wherein one or more methylene units are optionally and independently substituted with the following: optionally -Cy-, -O-, -S-, -SS-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -C(O)N(R′)-, -N(R′)C(O)N(R′)-, -N(R′)C(O)O-, -OC(O)N(R′)-, -S(O)-, -S(O)2-, -S(O)2N(R′)-, -N(R′)S(O)2-, -OC(O)-, or -C(O)O-, wherein each R' is independently as defined above and as described herein. In some embodiments, R 1 It is the optional substitution of C1-C 10 Aliphatic, wherein one or more methylene units are optionally and independently substituted with the following: optionally -Cy-, -O-, -S-, -SS-, -N(R′)-, -C(O)-, -OC(O)- or -C(O)O-, wherein each R′ is independently as defined above and as described herein.

[0515] In some implementation schemes, R 1 yes

[0516] In some implementation schemes, R 1 It is CH3-,

[0517] In some implementation schemes, R 1 Includes a -(CH2)2- portion optionally replaced at the end of L. The following describes an exemplary R. 1 Group:

[0518]

[0519] In some implementation schemes, R 1 Includes a -(CH2)- portion optionally replaced at the end of L. The following describes an exemplary R. 1 Group:

[0520]

[0521] In some implementation schemes, R 1 It is -SR L2 , where R L2 It is an optionally substituted C1-C9 aliphatic compound, wherein one or more methylene units are optionally and independently substituted with: optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -c≡c-, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -C(O)N(R′)-, -N(R′)C (O)N(R′)-, -N(R′)C(O)-, -N(R′)C(O)O-, -OC(O)N(R′)-, -S(O)-, -S(O)2-, -S(O)2N(R′)-, -N(R′)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)- or -C(O)O-, and R' and -Cy- are each independently as defined above and as described herein. In some embodiments, R 1 It is -SR L2 The sulfur atom is connected to the sulfur atom in the L group.

[0522] In some implementation schemes, R 1 It is -C(O)-R L2 , where R L2It is an optionally substituted C1-C9 aliphatic compound, wherein one or more methylene units are optionally and independently substituted with: optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -c≡c-, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -C(O)N(R′)-, -N(R′)C (O)N(R′)-, -N(R′)C(O)-, -N(R′)C(O)O-, -OC(O)N(R′)-, -S(O)-, -S(O)2-, -S(O)2N(R′)-, -N(R′)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)- or -C(O)O-, and R' and -Cy- are each independently as defined above and as described herein. In some embodiments, R 1 It is -C(O)-R L2 In this embodiment, the carbonyl group is attached to the G group in the L group. In some embodiments, R... 1 It is -C(O)-R L2 The carbonyl group is connected to the sulfur atom in the L group.

[0523] In some implementation schemes, R L2 It is an optionally substituted C1-C9 aliphatic compound. In some embodiments, R L2 It is an optionally substituted C1-C9 alkyl group. In some embodiments, R L2 It is an optionally substituted C1-C9 alkenyl group. In some embodiments, R L2 It is an optionally substituted C1-C9 ynyl group. In some embodiments, R L2 It is an optionally substituted C1-C9 aliphatic compound, wherein one or more methylene units are optionally and independently replaced by -Cy- or -C(O)-. In some embodiments, R L2 It is an optionally substituted C1-C9 aliphatic compound, wherein one or more methylene units are optionally and independently replaced by -Cy-. In some embodiments, R L2 It is an optionally substituted C1-C9 aliphatic compound, wherein one or more methylene units are optionally and independently replaced by an optionally substituted heterocyclic group. In some embodiments, R L2 It is an optionally substituted C1-C9 aliphatic compound, wherein one or more methylene units are optionally and independently replaced by an optionally substituted arylene group. In some embodiments, R L2 It is an optionally substituted C1-C9 aliphatic compound, wherein one or more methylene units are optionally and independently replaced by an optionally substituted heteroaryl group. In some embodiments, R L2It is an optionally substituted C1-C9 aliphatic compound, wherein one or more methylene units are optionally and independently substituted with: optionally substituted C3-C 10 Carbocyclic group. In some embodiments, R L2 It is an optionally substituted C1-C9 aliphatic compound, wherein the two methylene units are optionally and independently replaced by -Cy- or -C(O)-. In some embodiments, R L2 It is an optionally substituted C1-C9 aliphatic compound, wherein the two methylene units are optionally and independently replaced by -Cy- or -C(O)-. The following describes an exemplary R. L2 Group:

[0524]

[0525] In some implementation schemes, R 1 It is hydrogen or a group optionally substituted from the following: -S-(C1-C 10 (Aliphatic), C1-C 10 Aliphatic, aryl, C1-C6 heteroalkyl, heteroaryl, and heterocyclic groups. In some embodiments, R 1 yes or -S-(C1-C 10 (Aliphatic). In some implementations, R 1 yes

[0526] In some implementation schemes, R 1 It is a group optionally substituted from the following: -S- (C1-C6 aliphatic), C1-C 10 Aliphatic, C1-C6 heteroaliphatic, aryl, heterocyclic and heteroaryl.

[0527] In some implementation schemes, R 1 yes

[0528] In some implementations, the R described above and herein 1 In the embodiments, the sulfur atom is connected to the sulfur atom, G, E, or -C(O)- portion of the L embodiments described above and herein. In some embodiments, the R... 1 The -C(O)- portion in the implementation scheme is connected to the sulfur atom, G, E or -C(O)- portion in the L implementation scheme described above and herein.

[0529] In some implementations, -LR 1The above and the L implementation scheme and R described in this article 1 Any combination of implementation plans.

[0530] In some implementations, -LR 1 Yes -L 3 -GR 1 The variables are independent as defined above and as described in this article.

[0531] In some implementations, -LR 1 Yes -L 4 -GR 1 The variables are independent as defined above and as described in this article.

[0532] In some implementations, -LR 1 Yes -L 3 -GSR L2 The variables are independent as defined above and as described in this article.

[0533] In some implementations, -LR 1 Yes -L 3 -GC(O)-R L2 The variables are independent as defined above and as described in this article.

[0534] In some implementations, -LR 1 yes Where R L2 It is an optionally substituted C1-C9 aliphatic compound, wherein one or more methylene units are optionally and independently substituted with: optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -c≡c-, -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -C(O)N(R′)-, -N(R -N(R′)C(O)N(R′)-, -N(R′)C(O)-, -N(R′)C(O)O-, -OC(O)N(R′)-, -S(O)-, -S(O)2-, -S(O)2N(R′)-, -N(R′)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)- or -C(O)O-, and each G is independent as defined above and as described herein.

[0535] In some implementations, -LR 1 Yes -R L3 -SSR L2 The variables are independent as defined above and as described herein. In some implementations, -LR 1 Yes -RL3 -C(O)-SSR L2 The variables are independent as defined above and as described in this article.

[0536] In some implementations, -LR 1 It has the following structure:

[0537]

[0538] The variables are independent as defined above and as described in this article.

[0539] In some implementations, -LR 1 It has the following structure:

[0540]

[0541] The variables are independent as defined above and as described in this article.

[0542] In some implementations, -LR 1 It has the following structure:

[0543]

[0544] The variables are independent as defined above and as described in this article.

[0545] In some implementations, -LR 1 It has the following structure:

[0546]

[0547] The variables are independent as defined above and as described in this article.

[0548] In some implementations, -LR 1 It has the following structure:

[0549]

[0550] The variables are independent as defined above and as described in this article.

[0551] In some implementations, -LR 1 It has the following structure:

[0552]

[0553] The variables are independent as defined above and as described in this article.

[0554] In some implementations, -LR 1 It has the following structure:

[0555]

[0556] The variables are independent as defined above and as described in this article.

[0557] In some implementations, -LR 1 It has the following structure:

[0558]

[0559] The variables are independent as defined above and as described in this article.

[0560] In some implementations, -LR 1 It has the following structure:

[0561]

[0562] The variables are independent as defined above and as described in this article.

[0563] In some implementations, -LR 1 It has the following structure:

[0564]

[0565] The variables are independent as defined above and as described in this article.

[0566] In some implementations, -LR 1 It has the following structure:

[0567]

[0568] The variables are independent as defined above and as described in this article.

[0569] In some implementations, -LR 1 It has the following structure:

[0570]

[0571] The variables are independent as defined above and as described in this article.

[0572] In some implementations, -LR 1 It has the following structure:

[0573]

[0574] The variables are independent as defined above and as described in this article.

[0575] In some implementations, -LR 1 It has the following structure:

[0576]

[0577] The variables are independent as defined above and as described in this article.

[0578] In some implementations, -LR 1 It has the following structure:

[0579]

[0580] The variables are independent as defined above and as described in this article.

[0581] In some implementations, -LR 1 It has the following structure:

[0582]

[0583] The variables are independent as defined above and as described in this article.

[0584] In some implementations, -LR 1 It has the following structure:

[0585]

[0586] The variables are independent as defined above and as described in this article.

[0587] In some implementations, -LR 1 It has the following structure:

[0588]

[0589] The variables are independent as defined above and as described in this article.

[0590] In some implementations, -LR 1 It has the following structure:

[0591]

[0592] The variables are independent as defined above and as described in this article.

[0593] In some implementations, -LR 1 It has the following structure:

[0594]

[0595] The variables are independent as defined above and as described in this article.

[0596] In some implementations, -LR1 It has the following structure:

[0597]

[0598] The variables are independent as defined above and as described in this article.

[0599] In some implementations, L has the following structure:

[0600]

[0601] The variables are independent as defined above and as described in this article.

[0602] In some implementations, -XLR 1 It has the following structure:

[0603]

[0604] in:

[0605] The phenyl ring is optionally substituted, and

[0606] R 1 X and X are each independently defined as above and as described in this article.

[0607] In some implementations, -LR 1 yes

[0608]

[0609]

[0610] In some implementations, -LR 1 yes:

[0611]

[0612] In some implementations, -LR 1 It is CH3-, In some implementations, -LR 1 yes

[0613] In some implementations, -LR 1 Includes the -(CH2)2- portion optionally substituted at the end of X. In some embodiments, -LR 1 Includes the terminal (CH2)2- portion connected to X. The following describes an exemplary -LR. 1 part:

[0614]

[0615] In some implementations, -LR 1 Includes a -(CH2)- portion optionally replaced at the end of X. In some embodiments, -LR 1 Includes the terminal (CH2)- portion connected to X. The following describes an exemplary -LR. 1 part:

[0616]

[0617] In some implementations, -LR 1 yes

[0618]

[0619] In some implementations, -LR 1 It is CH3-, And X is -S-.

[0620] In some implementations, -LR 1 It is CH3-, X is -S-, W is O, Y is -O-, and Z is -O-.

[0621] In some implementation schemes, R 1 yes or -S-(C1-C 10 (Aliphatic).

[0622] In some implementation schemes, R 1 yes

[0623] In some implementations, X is -O- or -S-, and R 1 yes or -S-(C1-C 10 (Aliphatic).

[0624] In some implementations, X is -O- or -S-, and R 1 yes -S-(C1-C 10 Aliphatic) or -S-(C1-C 50 (Aliphatic).

[0625] In some implementations, L is a covalent bond, and -LR 1 It is R 1 .

[0626] In some implementations, -LR 1 It's not hydrogen.

[0627] In some implementations, -XLR 1 It is R 1 yes -S-(C1-C 10 Aliphatic) or -S-(C1-C 50 (Aliphatic).

[0628] In some implementations, -XLR 1 Having structure in Partially, it is optionally replaced. In some implementations, -XLR 1 yes In some implementations, -XLR 1 yes

[0629] In some implementations, -XLR 1 yes In some implementations, -XLR 1 Having structure Where X' is O or S, Y' is -O-, -S-, or -NR', and Partially, it may be replaced. In some embodiments, Y' is -O-, -S-, or -NH-. In some embodiments, yes In some implementation schemes, yes In some implementation schemes, yes In some implementations, -XLR 1 Having structure Where X' is O or S, and Some parts are optionally replaced. In some implementations, yes In some implementations, -XLR 1 yes in Optionally replaced. In some implementations, -XLR 1 yes in Replaced. In some implementations, -XLR 1 yes in It has not been replaced.

[0630] In some implementations, -XLR 1 It is R 1 -C(O)-SL x -S-, where L x It is selected from the following optionally substituted groups: In some implementations, L x yes In some implementations, -XLR 1 It is (CH3)3C-SSL x -S-. In some implementations, -XLR 1 It is R 1 -C(=X')-Y'-C(R)2-SL x -S-. In some implementations, -XLR 1 It is RC(=X')-Y'-CH2-SL x -S-. In some implementations, -XLR 1 yes

[0631] As those skilled in the art will understand, many of the -XLRs described herein 1 The group is cleavable and can be converted to -X after administration to the subject. - In some implementations, -XLR 1 It is pyrolytic. In some implementations, -XLR 1 It is -SLR 1 And after being administered to the subject, it transforms into -S - In some implementations, the conversion is promoted by an enzyme in the subject. As those skilled in the art will understand, determining -SLR 1 Does the group convert to -S after application? - The methods are widely known and practiced in the field, including those used to study drug metabolism and pharmacokinetics.

[0632] In some implementations, the internucleotide linkage having the Formula I structure is

[0633] In some implementations, the internucleotide linkage of formula I has the structure of formula Ia:

[0634]

[0635] The variables are independent as defined above and as described in this article.

[0636] In some implementations, the internucleotide linkage of formula I has the structure of formula Ib:

[0637]

[0638] The variables are independent as defined above and as described in this article.

[0639] In some implementations, the internucleotide linkage of formula I is a phosphate-thioester linkage having the structure of formula Ic:

[0640]

[0641] in:

[0642] P* is an asymmetric phosphorus atom, and is either Rp or Sp;

[0643] L is a covalently bonded or optionally substituted straight chain or branch C1-C. 10 Alkylene, wherein one or more methylene units of L are optionally and independently substituted with the following: optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -c≡c-, -C(R′)2-, -Cy-, -O-, -S-, -SS-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -C(O)N(R′)-, -N(R′)C(O)N(R′)-, -N(R′)C(O)-, -N(R′)C(O)O-, -OC(O)N(R′)-, -S(O)-, -S(O)2-, -S(O)2N(R′)-, -N(R′)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)- or -C(O)O-;

[0644] R 1 It is a halogen, R, or optionally substituted C1-C 50Aliphatic, wherein one or more methylene units are optionally and independently substituted with: optionally substituted C1-C6 alkylene, C1-C6 alkenylene, -c≡c-, -C(R′)2-, -Cy-, -O-, -S-, -SS-, -N(R′)-, -C(O)-, -C(S)-, -C(NR′)-, -C(O)N(R′)-, -N(R′)C(O)N(R′)-, -N(R′)C(O)-, -N(R′)C(O)O-, -OC(O)N(R′)-, -S(O)-, -S(O)2-, -S(O)2N(R′)-, -N(R′)S(O)2-, -SC(O)-, -C(O)S-, -OC(O)- or -C(O)O-;

[0645] Each R′ is independently -R, -C(O)R, -CO2R, or -SO2R, or:

[0646] The two R′ atoms on the same nitrogen atom, together with their intercalated atoms, form an optionally substituted heterocyclic or heteroaryl ring, or

[0647] Two R′ on the same carbon atom, together with their intercalated atoms, form optionally substituted aryl, carbocyclic, heterocyclic or heteroaryl rings;

[0648] -Cy- is a divalent ring selected from phenylene, carbocycloidene, arylene, heteroarylene or heterocycloidene, which is optionally substituted;

[0649] Each R is independently hydrogen or an optionally substituted group selected from C1-C6 aliphatic, phenyl, carbocyclic, aryl, heteroaryl, or heterocyclic groups;

[0650] each Independently representing the connection with nucleosides; and

[0651] When L is a covalent bond, R 1 Not -H.

[0652] In some implementations, the internucleotide linkage having the Formula I structure is

[0653] In some implementations, the internucleotide linkage having the Ic structure is

[0654]

[0655] In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising one or more phosphodiester bonds and one or more nucleotides modified with formula Ia, Ib or Ic.

[0656] In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising at least one phosphodiester nucleotide link and at least one thiophosphate triester link having the formula Ic. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising at least one phosphodiester nucleotide link and at least two thiophosphate triester links having the formula Ic. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising at least one phosphodiester nucleotide link and at least three thiophosphate triester links having the formula Ic. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising at least one phosphodiester nucleotide link and at least four thiophosphate triester links having the formula Ic. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising at least one phosphodiester nucleotide link and at least five thiophosphate triester links having the formula Ic.

[0657] In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising the sequence described in any appendix of this application. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising the sequence described in Appendix A. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising the sequence described in Appendix B. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising the sequence described in Appendix C. In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence described in any appendix of this application. In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence described in Appendix A. In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence described in Appendix B. In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence described in Appendix C.

[0658] In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising a sequence found in GCCTCAGCTGCTTCGCACC. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising a sequence found in GCCTCAGCTGCTTCGCACC, wherein said sequence has more than 50% identity with GCCTCAGCTGCTTCGCACC. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising a sequence found in GCCTCAGCTGCTTCGCACC, wherein said sequence has more than 60% identity with GCCTCAGCTGCTTCGCACC. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising a sequence found in GCCTCAGCTGCTTCGCACC, wherein said sequence has more than 70% identity with GCCTCAGCTGCTTCGCACC. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising a sequence found in GCCTCAGCTGCTTCGCACC, wherein said sequence has more than 80% identity with GCCTCAGCTGCTTCGCACC. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising the sequence GCCTCAGCTGCTTCGCACC, wherein said sequence has more than 90% identity with GCCTCAGCTGCTTCGCACC. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising the sequence GCCTCAGCTGCTTCGCACC, wherein said sequence has more than 95% identity with GCCTCAGCTGCTTCGCACC. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising the sequence GCCTCAGCTGCTTCGCACC. In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGCTGCTTCGCACC.

[0659] In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising a sequence found in GCCTCAGCTGCTTCGCACC, wherein at least one nucleotide link has a chiral linking phosphorus. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising a sequence found in GCCTCAGCTGCTTCGCACC, wherein at least one nucleotide link has a structure of Formula I. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising a sequence found in GCCTCAGCTGCTTCGCACC, wherein at least one nucleotide link has a structure of Formula Ic. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising a sequence found in GCCTCAGCTGCTTCGCACC, wherein at least one nucleotide link has a structure of Formula Ic. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising a sequence found in GCCTCAGTCTGCTTCGCACC, wherein at least one nucleotide is linked by a specific bond. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising a sequence found in GCCTCAGTCTGCTTCGCACC, wherein the internucleotide linkages are In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising a sequence found in GCCTCAGTCTGCTTCGCACC, wherein at least one nucleotide is linked by a specific bond. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising a sequence found in GCCTCAGTCTGCTTCGCACC, wherein the internucleotide linkages are

[0660] In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein at least one nucleotide is linked by a chiral phosphorus. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein at least one nucleotide is linked by a structure of Formula I. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein the nucleotides are linked by a structure of Formula I. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein at least one nucleotide is linked by a structure of Formula Ic. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein the nucleotides are linked by a structure of Formula Ic. In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein at least one nucleotide is linked by a chiral phosphorus. In some embodiments, the present invention provides a chiral-controlled oligonucleotide comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein the internucleotide linkages are In some embodiments, the present invention provides a chiral controlled oligonucleotide comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein at least one nucleotide is linked in a specific manner. In some embodiments, the present invention provides a chiral-controlled oligonucleotide comprising the sequence GCCTCAGTCTGCTTCGCACC, wherein the internucleotide linkages are

[0661] In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein at least one nucleotide link has a chiral linking phosphorus. In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein at least one nucleotide link has a structure of Formula I. In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein the nucleotide links have a structure of Formula I. In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein at least one nucleotide link has a structure of Formula Ic. In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein the nucleotide links have a structure of Formula Ic. In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein at least one nucleotide link is... In some embodiments, the present invention provides a chiral-controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein the internucleotide linkages are In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein at least one nucleotide is linked in a specific manner. In some embodiments, the present invention provides a chiral-controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein the internucleotide linkages are

[0662] In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein at least one copula is Rp. It is understood by those skilled in the art that in some embodiments in which the chiral controlled oligonucleotide comprises an RNA sequence, each T is independently and optionally substituted with U. In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein each copula is Rp. In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein at least one copula is Sp. In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein each copula is Sp. In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is a block polymer. In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is a stereoblock polymer. In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is a P-modified block copolymer. In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is a linked block copolymer. In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is an alternating copolymer. In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is a stereoalternating copolymer. In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is a P-modified alternating copolymer. In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is a linked alternating copolymer. In some embodiments, the present invention provides a chiral-controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is a monomer. In some embodiments, the present invention provides a chiral-controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is a stereomonomer.In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is a P-modified monomer. In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is a linked monomer. In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is a spacer monomer. In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein the oligonucleotide is a skipping monomer.

[0663] In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein each cytosine is optionally and independently substituted with 5-methylcytosine. In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein at least one cytosine is optionally and independently substituted with 5-methylcytosine. In some embodiments, the present invention provides a chiral controlled oligonucleotide having the sequence GCCTCAGTCTGCTTCGCACC, wherein each cytosine is optionally and independently substituted with 5-methylcytosine. Exemplary chiral controlled oligonucleotides having the sequence GCCTCAGTCTGCTTCGCACC are depicted in Table 2 below:

[0664] Table 2. Exemplary chiral-controlled oligonucleotides.

[0665]

[0666]

[0667]

[0668]

[0669]

[0670] In some embodiments, chiral-controlled oligonucleotides are designed such that one or more nucleotides contain a phosphorus modification that tends to "auto-release" under certain conditions. That is, under certain conditions, specific phosphorus modifications are designed to cause the oligonucleotide to self-cleave to provide, for example, phosphodiesters, as seen in naturally occurring DNA and RNA. In some embodiments, the phosphorus modification has a structure -OLR. 1 L and R 1Each is independently defined as above and as described herein. In some embodiments, the auto-release group includes a morpholino group. In some embodiments, the auto-release group is characterized by its ability to deliver a reagent to the internucleotide phosphorus linker, said reagent facilitating further modification of the phosphorus atom, such as desulfurization. In some embodiments, the reagent is water, and further modification is hydrolysis to form a phosphodiester as found in naturally occurring DNA and RNA.

[0671] In some implementations, chiral-controlled oligonucleotides are designed to improve the properties of the resulting drug through one or more specific modifications at the phosphorus. It is well documented in the art that some oligonucleotides are rapidly degraded by nucleases and exhibit poor cellular uptake across the cytoplasm and cell membrane (Poijarvi-Virta et al., Curr. Med. Chem. (2006), 13(28): 3441-65; Wagner et al., Med. Res. Rev. (2000), 20(6): 417-51; Peyrottes et al., Mini Rev. Med. Chem. (2004), 4(4): 395-408; Gosselin et al., (1996), 43(1): 196-208; Bologna et al., (2002), Antisense & Nucleic Acid Drug Development 12: 33-41). For example, Vives et al. (Nucleic Acids Research (1999), 27(20): 4071-76) found that tert-butyl SATE pre-oligonucleotides showed a significant increase in cell penetration compared to maternal oligonucleotides.

[0672] In some embodiments, the modification at the phosphate linker is characterized by its ability to be converted into a phosphodiester by one or more esterases, nucleases, and / or cytochrome P450 enzymes (including, but not limited to, those listed in Table 3 below), such as those naturally present in DNA and RNA.

[0673] Table 3. Exemplary enzymes.

[0674]

[0675]

[0676] In some embodiments, the modification at the phosphorus site is characterized by the P-modification moiety acting as a prodrug, which, for example, facilitates the delivery of the oligonucleotide to the desired location before removal. For instance, in some embodiments, the P-modification moiety is generated by PEGylation at the linked phosphorus site. Those skilled in the art will understand that various PEG chain lengths are applicable, and the choice of chain length will be determined in part by the outcome that PEGylation attempts to achieve. For example, in some embodiments, PEGylation is performed to reduce RES uptake and prolong the in vivo circulation life of the oligonucleotide.

[0677] In some embodiments, the PEGylation agent used according to the present invention has a molecular weight of about 300 g / mol to about 100,000 g / mol. In some embodiments, the PEGylation agent has a molecular weight of about 300 g / mol to about 10,000 g / mol. In some embodiments, the PEGylation agent has a molecular weight of about 300 g / mol to about 5,000 g / mol. In some embodiments, the PEGylation agent has a molecular weight of about 500 g / mol. In some embodiments, the PEGylation agent has a molecular weight of about 1000 g / mol. In some embodiments, the PEGylation agent has a molecular weight of about 3000 g / mol. In some embodiments, the PEGylation agent has a molecular weight of about 5000 g / mol.

[0678] In some embodiments, the PEGylation agent is PEG500. In some embodiments, the PEGylation agent is PEG1000. In some embodiments, the PEGylation agent is PEG3000. In some embodiments, the PEGylation agent is PEG5000.

[0679] In some implementations, the P-modified portion is characterized by acting as a PK enhancer, such as lipids, PEGylated lipids, etc.

[0680] In some implementations, the P-modified portion is characterized by acting as an agent that promotes cell entry and / or endosome escape, such as membrane-disrupting lipids or peptides.

[0681] In some embodiments, the P-modified portion is characterized in that it acts as a targeting agent. In some embodiments, the P-modified portion is or comprises a targeting agent. As used herein, the term "targeting agent" refers to an entity that associates with a target payload (e.g., with an oligonucleotide or a combination of oligonucleotides) and also interacts with a target target site such that, when associated with the targeting agent, the target payload targets the target target site to a substantially greater extent than observed under other similar conditions when the target payload is not associated with the targeting agent. A targeting agent may be or comprise any of a variety of chemical moieties, including, for example, small molecule moieties, nucleic acids, peptides, carbohydrates, etc. Targeting agents are further described by Adarsh ​​et al., "Organelle Specific Targeted Drug Delivery - A Review," International Journal of Research in Pharmaceutical and Biomedical Sciences, 2011, p. 895.

[0682] Exemplary targeting agents include, but are not limited to, proteins (e.g., transferrin), oligopeptides (e.g., cyclic and acyclic RGD-containing oligopeptides), antibodies (monoclonal and polyclonal antibodies, such as IgG, IgA, IgM, IgD, IgE antibodies), sugars / carbohydrates (e.g., monosaccharides and / or oligosaccharides (mannose, mannose-6-phosphate, galactose, etc.)), vitamins (e.g., folate), or other small biomolecules. In some embodiments, the targeting portion is a steroid molecule (e.g., bile acids, including cholic acid, deoxycholic acid, dehydrocholic acid; cortisone; digoxigenin; testosterone; cholesterol; cationic steroids, such as cortisone having a trimethylaminomethylhydrazine group linked by a double bond at the 3-position of the cortisone ring). In some embodiments, the targeting moiety is a lipophilic molecule (e.g., alicyclic hydrocarbons, saturated and unsaturated fatty acids, waxes, terpenes, and polyalicyclic hydrocarbons such as adamantane and buckminsterfullerene). In some embodiments, the lipophilic molecule is a terpene, such as vitamin A, retinoic acid, retinal, or dehydroretinal. In some embodiments, the targeting moiety is a peptide.

[0683] In some implementations, the P-modified portion is a targeting agent of formula -XL-R1, wherein X, L, and R 1 Each is defined as shown in Equation I above.

[0684] In some implementations, the P-modified portion is characterized by its ability to facilitate cell-specific delivery.

[0685] In some embodiments, the P-modified portion is characterized in that it belongs to one or more of the aforementioned categories. For example, in some embodiments, the P-modified portion acts as a PK enhancer and a targeting ligand. In some embodiments, the P-modified portion acts as a prodrug and an endosomal escape agent. Those skilled in the art will recognize that numerous other combinations described are possible and are covered by this invention.

[0686] nucleoside bases

[0687] In some embodiments, the nucleoside bases present in the provided oligonucleotides are native nucleoside bases or modified nucleoside bases derived from native nucleoside bases. Examples include, but are not limited to, uracil, thymine, adenine, cytosine, and guanine, whose corresponding amino groups are protected by acyl protecting groups; 2-fluorouracil, 2-fluorocytosine, 5-bromouracil, 5-iodouracil, 2,6-diaminopurine, azacytosine, pyrimidine analogs (such as pseudoisocytosine and pseudouracil), and other modified nucleoside bases, such as 8-substituted purines, xanthines, or hypoxanthines (the latter two being natural degradation products). Exemplary modified nucleoside bases are disclosed in Chiu and Rana, RNA, 2003, 9, 1034-1048; Limbach et al., Nucleic Acid Research, 1994, 22, 2183-2196; and Revankar and Rao, Comprehensive Natural Products Chemistry, Vol. 7, 313.

[0688] Compounds represented by the following general formula are also included as modified nucleoside bases:

[0689]

[0690] Where R 8 It is a selectively substituted straight-chain or branched group selected from aliphatic, aryl, aralkyl, aryloxyalkyl, carbocyclic, heterocyclic, or heteroaryl groups having 1 to 15 carbon atoms, including, for example, methyl, isopropyl, phenyl, benzyl, or phenoxymethyl; and R 9 and R 10 Each group is independently selected from linear or branched aliphatic, carbocyclic, aryl, heterocyclic, and heteroaryl groups, which are optionally substituted.

[0691] Modified nucleoside bases also include size-enlarged nucleoside bases in which one or more aryl rings (such as phenyl rings) have been added. Nucleic acid base substitutions described in Glen Research Catalogue (www.glenresearch.com); Krueger AT et al., Acc. Chem. Res., 2007, 40, 141-150; Kool, ET, Acc. Chem. Res., 2002, 35, 936-943; Benner SA et al., Nat. Rev. Genet., 2005, 6, 553-543; Romesberg, FE et al., Curr. Opin. Chem. Biol., 2003, 7, 723-733; Hirao, I., Curr. Opin. Chem. Biol., 2006, 10, 622-627 are covered as suitable for the synthesis of the nucleic acids described herein. Some examples of these size-enlarged nucleoside bases are shown below:

[0692]

[0693] In this paper, modified nucleoside bases also encompass structures that are not considered nucleoside bases but rather other parts, such as, but not limited to, corrin or porphyrin-derived rings. Porphyrin-derived base substitutions have been described in Morales-Rojas, H and Kool, ET, Org. Lett., 2002, 4, 4377-4380. The following shows an example of a porphyrin-derived ring that can be used as a base substitution:

[0694]

[0695] In some embodiments, the modified nucleoside bases have a structure with any of the following optional substitutions:

[0696]

[0697] In some embodiments, the modified nucleoside bases are fluorescent. Exemplary fluorescent modified nucleoside bases include phenanthrene, pyrene, stilbene, isoxanthine, isoflavone, terphenyl, trithiophene, benzotrithiophene, coumarin, 2,4-dioxatetrahydropteridine, tethered stilbene, benzouracil, and naphthouracil, as shown below:

[0698]

[0699] In some embodiments, the modified nucleoside base is not substituted. In some embodiments, the modified nucleoside base is substituted. In some embodiments, the modified nucleoside base is substituted to contain, for example, a heteroatom, alkyl group, or linker group attached to a fluorescent moiety, biotinylate moiety, or other protein or peptide. In some embodiments, the modified nucleoside base is a "universal base" that is not a nucleoside base in the most classical sense but functions similarly to a nucleoside base. A representative example of such a universal base is 3-nitropyrrole.

[0700] In some embodiments, other nucleosides may also be used in the methods disclosed herein, including nucleosides with modified nucleoside bases or nucleoside bases covalently bound to the modified sugar. Examples of nucleosides with modified nucleoside bases include 4-acetylcytidine; 5-(carboxyhydroxymethyl)uridine; 2′-O-methylcytidine; 5-carboxymethylaminomethyl-2-thiouridine; 5-carboxymethylaminomethyluridine; dihydrouridine; 2′-O-methylpseudouridine; β,D-galactosylQ nucleoside; 2′-O-methylguanosine; N 6 -Isopentenyl adenosine; 1-methyl adenosine; 1-methyl pseudouridine; 1-methylguanosine; 1-methylinosine; 2,2-dimethylguanosine; 2-methyl adenosine; 2-methylguanosine; N 7 -Methylguanosine; 3-methyl-cytidine; 5-methylcytidine; 5-hydroxymethylcytidine; 5-formylcytidine; 5-carboxycytidine; N 6 -Methyladenosine; 7-methylguanosine; 5-methylaminoethyluridine; 5-methoxyaminomethyl-2-thiouridine; β,D-mannosyl-Q nucleoside; 5-methoxycarbonylmethyluridine; 5-methoxyuridine; 2-methylthio-N 6 -Isopentenyl adenosine; N-((9-β,D-furanosyl-2-methylthiopurine-6-yl)carbamoyl)threonine; N-((9-β,D-furanosylpurine-6-yl)-N-methylcarbamoyl)threonine; uridine-5-oxyacetic acid methyl ester; uridine-5-oxyacetic acid (v); pseudouridine; Q nucleoside; 2-thiocytidine; 5-methyl-2-thiouridine; 2-thiouridine; 4-thiouridine; 5-methyluridine; 2′-O-methyl-5-methyluridine; and 2′-O-methyluridine.

[0701] In some embodiments, the nucleoside comprises a 6′-modified bicyclic nucleoside analog having (R) or (S) chirality at the 6′ position, and includes the analog described in U.S. Patent No. 7,399,845. In other embodiments, the nucleoside comprises a 5′-modified bicyclic nucleoside analog having (R) or (S) chirality at the 5′ position, and includes the analog described in U.S. Patent Application Publication No. 20070287831.

[0702] In some embodiments, the nucleoside base or modified nucleoside base comprises one or more biomolecular binding moieties, such as antibodies, antibody fragments, biotin, antibiotic proteins, streptokinin, receptor ligands, or chelating moieties. In other embodiments, the nucleoside base or modified nucleoside base is 5-bromouracil, 5-iodouracil, or 2,6-diaminopurine. In some embodiments, the nucleoside base or modified nucleoside base is modified by substitution with a fluorescent or biomolecular binding moieties. In some embodiments, the substituents on the nucleoside base or modified nucleoside base are fluorescent moieties. In some embodiments, the substituents on the nucleoside base or modified nucleoside base are biotin or antibiotic proteins.

[0703] Representative U.S. patents teaching the preparation of certain of the above-indicated modified nucleoside bases and other modified nucleoside bases include, but are not limited to, U.S. Patent Nos. 3,687,808 and 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,457,191; 5,459,255; 5,484,908; 5,502,177; 5,525,711; and 5,552,540. ; 5,587,469; 5,594,121; 5,596,091; 5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, each of which is incorporated herein by reference in its entirety.

[0704] sugar

[0705] The most common naturally occurring nucleotides comprise ribose linked to the nucleoside bases adenosine (A), cytosine (C), guanine (G), and thymine (T) or uracil (U). Modified nucleotides are also included, wherein the phosphate ester group or linked phosphorus in the nucleotide may be linked to various positions of the sugar or modified sugar. As a non-limiting example, the phosphate ester group or linked phosphorus may be linked to the 2′, 3′, 4′, or 5′ hydroxyl portion of the sugar or modified sugar. In this context, nucleotides with modified nucleoside bases as described herein are also included. In some embodiments, nucleotides or modified nucleotides comprising an unprotected -OH moiety are used according to the method of the invention.

[0706] Other modified sugars may also be incorporated into the provided oligonucleotide. In some embodiments, the modified sugar contains one or more substituents at the 2′ position, including one of the following: -F; -CF3, -CN, -N3, -NO, -NO2, -OR', -SR', or -N(R')2, wherein each R' is independently as defined above and as described herein; -O-(Cl-C 10 alkyl), -S-(C1-C 10 alkyl), -NH-(C1-C 10 Alkyl) or -N (C1-C 10 alkyl)2;-O-(C2-C 10 alkenyl), -S-(C2-C) 10 alkenyl), -NH-(C2-C) 10 alkenyl) or -N(C2-C 10 alkenyl)2;-O-(C2-C 10 ynyl group), -S-(C2-C 10 ynyl group), -NH-(C2-C 10 ynyl group) or -N(C2-C 10 ynyl group)2; or -O--(C1-C 10 alkylene)-O--(C1-C 10 alkyl), -O-(C1-C 10 alkylene)-NH-(C1-C 10 Alkyl) or -O-(C1-C 10 alkylene)-NH(C1-C 10 alkyl)2、-NH-(C1-C 10 alkylene)-O-(C1-C 10 Alkyl) or -N (C1-C 10 alkyl)-(C1-C 10 alkylene)-O-(C1-C 10 Alkyl groups, wherein the alkyl, alkylene, alkenyl, and ynyl groups may be substituted or unsubstituted. Examples of substituents include, but are not limited to, -O(CH2). n OCH3 and -O(CH2) nNH2 (where n is 1 to about 10), MOE, DMAOE, DMAEOE. This document also covers modified sugars as described in WO 2001 / 088198; and Martin et al., Helv. Chim. Acta, 1995, 78, 486-504. In some embodiments, the modified sugar comprises one or more substituents selected from: substituted silyl groups, RNA cleavage groups, reporter groups, fluorescent labels, intercalators, groups for improving the pharmacokinetic properties of nucleic acids, groups for improving the pharmacodynamic properties of nucleic acids, or other substituents having similar properties. In some embodiments, the modification is performed at one or more of the 2′, 3′, 4′, 5′, or 6′ positions of the sugar or the modified sugar, including at the 3′ position of the sugar on the 3′ terminal nucleotide or at the 5′ position of the 5′ terminal nucleotide.

[0707] In some embodiments, the 2'-OH of the ribose is replaced by a substituent comprising one of the following: -H, -F; -CF3, -CN, -N3, -NO, -NO2, -OR', -SR', or -N(R')2, wherein each R' is independently as defined above and as described herein; -O-(C1-C 10 alkyl), -S-(C1-C 10 alkyl), -NH-(C1-C 10 Alkyl) or -N (C1-C 10 alkyl)2;-O-(C2-C 10 alkenyl), -S-(C2-C) 10 alkenyl), -NH-(C2-C) 10 alkenyl) or -N(C2-C 10 alkenyl)2;-O-(C2-C 10 ynyl group), -S-(C2-C 10 ynyl group), -NH-(C2-C 10 ynyl group) or -N(C2-C 10 ynyl group)2; or -O--(C1-C 10 alkylene)-O--(C1-C 10 alkyl), -O-(C1-C 10 alkylene)-NH-(C1-C 10 Alkyl) or -O-(C1-C 10 alkylene)-NH(C1-C 10 alkyl)2、-NH-(C1-C 10 alkylene)-O-(C1-C 10 Alkyl) or -N (C1-C 10 alkyl)-(C1-C 10 alkylene)-O-(C1-C 10Alkyl groups, wherein the alkyl, alkylene, alkenyl, and alkynyl groups may be substituted or unsubstituted. In some embodiments, 2'-OH is substituted with -H (deoxyribose). In some embodiments, 2'-OH is substituted with -F. In some embodiments, 2'-OH is substituted with -OR'. In some embodiments, 2'-OH is substituted with -OMe. In some embodiments, 2'-OH is substituted with -OCH2CH2OMe.

[0708] Modified sugars also include locked nucleic acids (LNAs). In some embodiments, the locked nucleic acid has the structure indicated below. The locked nucleic acid indicates the structure shown below, where Ba represents a nucleoside base or a modified nucleoside base as described herein, and where R... 2s It is -OCH2C4'-.

[0709]

[0710] In some embodiments, the modified sugar is an ENA, such as those described, for example, in Seth et al., J Am Chem Soc. 2010 Oct 27; 132(42): 14942-14950. In some embodiments, the modified sugar is any of those found in XNAs (heteronucleotides), such as arabinose, dehydrated hexitol, threonose, 2'-fluoroarabinose, or cyclohexene.

[0711] Modified sugars include sugar analogs, such as cyclobutyl or cyclopentyl moieties replacing the cyclobutyl or cyclopentyl portions of pentofuranosyl sugars. Representative U.S. patents teaching the preparation of said modified sugar structures include, but are not limited to, U.S. Patent Nos. 4,981,957; 5,118,800; 5,319,080; and 5,359,044. Some of the modified sugars covered include sugars in which the oxygen atom in the ribose ring is replaced by nitrogen, sulfur, selenium, or carbon. In some embodiments, the modified sugar is a modified ribose in which the oxygen atom in the ribose ring is replaced by nitrogen, and wherein the nitrogen is optionally replaced by an alkyl group (e.g., methyl, ethyl, isopropyl, etc.).

[0712] Non-limiting examples of modified sugars include glycerol that forms glycerol nucleic acid (GNA) analogs. An example of a GNA analog is shown below and described in Zhang, R et al., J. Am. Chem. Soc., 2008, 130, 5846-5847; Zhang L et al., J. Am. Chem. Soc., 2005, 127, 4174-4175; and Tsai CH et al., PNAS, 2007, 14598-14603 (X = O - ):

[0713]

[0714] Another example of GNA-derived analogues, namely flexible nucleic acids (FNAs) based on mixed acetal amines of formylglycerol, is described in Joyce GF et al., PNAS, 1987, 84, 4398-4402 and Heuberger BD and Switcher C, J. Am. Chem. Soc., 2008, 130, 412-413, and is shown below:

[0715]

[0716] Other non-limiting examples of modified sugars include hexopyranosyl (6' to 4'), pentopyranosyl (4' to 2'), pentopyranosyl (4' to 3'), or butyranosyl (3' to 2') sugars. In some embodiments, the hexopyranosyl (6' to 4') sugar has any of the following formula:

[0717]

[0718] Where X s Corresponding to the P-modified group "-XLR" described in this article 1 ", and Ba is as defined in this article.

[0719] In some embodiments, the pentopyranosyl (4' to 2') sugar has any of the following formula:

[0720]

[0721] Where X s Corresponding to the P-modified group "-XLR" described in this article 1 ", and Ba is as defined in this article.

[0722] In some embodiments, the pentopyranosyl (4' to 3') sugar has any of the following formula:

[0723]

[0724] Where X s Corresponding to the P-modified group "-XLR" described in this article 1 ", and Ba is as defined in this article.

[0725] In some embodiments, the butyrylfuranosyl (3' to 2') sugar has any of the following formulas:

[0726]

[0727] Where X s Corresponding to the P-modified group "-XLR" described in this article 1 ", and Ba is as defined in this article.

[0728] In some implementations, the modified sugar has any of the following formulas:

[0729]

[0730] Where X s Corresponding to the P-modified group "-XLR" described in this article 1 ", and Ba is as defined in this article.

[0731] In some embodiments, one or more hydroxyl groups in the sugar moiety are optionally and independently replaced by halogen, R', -N(R')2, -OR', or -SR', wherein each R' is independently as defined above and as described herein.

[0732] In some implementations, the sugar mimic is as described below, wherein X s Corresponding to the P-modified group "-XLR" described in this article 1 Ba is as defined in this article, and X 1 Selected from -S-, -Se-, -CH2-, -NMe-, -NEt-, or -NiPr-.

[0733]

[0734] In some embodiments, the chiral-controlled oligonucleotide composition contains at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, or 31% of the nucleotides. Sugars of 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, or more (e.g., 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more) (including end values) are modified. In some embodiments, only purine residues are modified (e.g., about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%). 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50% or more [e.g., 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more] of purine residues are modified. In some embodiments, only pyrimidine residues are modified (e.g., about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%). 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, or more than 50% [e.g., 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more than 95%] of purine residues are modified. In some embodiments, both purine and pyrimidine residues are modified.

[0735] Modified sugars and sugar mimics can be prepared by methods known in the art, including but not limited to: A. Eschenmoser, Science (1999), 284: 2118; M. Bohringer et al., Helv. Chim. Acta (1992), 75: 1416-1477; M. Egli et al., J. Am. Chem. Soc. (2006), 128(33): 10847-56; A. Eschenmoser in Chemical Synthesis: Gnosis to Prognosis, C. Chatgilialoglu and V. Sniekus (eds.), (Kluwer Academic, Netherlands, 1996), p. 293; K.-U. Schoning et al., Science (2000), 290: 1347-1351; A. Eschenmoser et al., Helv. Chim. Acta (1992), 75: 218; J. Hunziker et al., Helv. Chim. Acta (1993), 76: 259; G. Otting et al., Helv. Chim. Acta (1993), 76: 2701; K. Groebke et al., Helv. Chim. Acta (1998), 81: 375; and A. Eschenmoser, Science (1999), 284: 2118. Modifications relating to the 2′ modification can be found in Verma, S. et al., Annu. Rev. Biochem. 1998, 67, 99-134 and all references therein. Specific modifications to ribose can be found in the following references: 2′-fluorine (Kawasaki et al., J. Med. Chem., 1993, 36, 831-841), 2′-MOE (Martin, P. Helv. Chim. Acta 1996, 79, 1930-1938), and “LNA” (Wengel, J. Acc. Chem. Res. 1999, 32, 301-310). In some embodiments, the modified sugar is described by reference in PCT Publication No. WO2012 / 030683, which is incorporated herein by reference, and is depicted in this application. Figure 26-30 Any one of those.

[0736] Oligonucleotides

[0737] In some embodiments, the present invention provides chiral-controlled oligonucleotides and oligonucleotide compositions. For example, in some embodiments, the provided compositions contain one or more individual oligonucleotide types at predetermined levels, wherein the oligonucleotide type is determined by: 1) a base sequence; 2) a backbone linking pattern; 3) a backbone chiral center pattern; and 4) a backbone P-modification pattern.

[0738] In some embodiments, the provided oligonucleotide is a monomer. In some embodiments, the provided oligonucleotide is a P-modified monomer. In some embodiments, the provided oligonucleotide is a stereopolymer. In some embodiments, the provided oligonucleotide is a stereopolymer having the configuration Rp. In some embodiments, the provided oligonucleotide is a stereopolymer having the configuration Sp.

[0739] In some embodiments, the provided oligonucleotide is an alternating polymer. In some embodiments, the provided oligonucleotide is a P-modified alternating polymer. In some embodiments, the provided oligonucleotide is a stereoalternating polymer.

[0740] In some embodiments, the provided oligonucleotide is a block copolymer. In some embodiments, the provided oligonucleotide is a P-modified block copolymer. In some embodiments, the provided oligonucleotide is a stereoblock copolymer.

[0741] In some implementations, the provided oligonucleotides are spacer polymers.

[0742] In some implementations, the provided oligonucleotides are jumping polymers.

[0743] In some embodiments, the provided oligonucleotide is a combination of one or more of monomers, alternating polymers, block polymers, spacer polymers, and skip polymers. For example, in some embodiments, the provided oligonucleotide is both an alternating polymer and a spacer polymer. In some embodiments, the provided nucleotide is both a spacer polymer and a skip polymer. Those skilled in the art of chemistry and synthesis will recognize that numerous other combinations are available and are limited only by the commercial availability and / or synthetic accessibility of the components required for the synthesis of the provided oligonucleotide according to the method of the invention.

[0744] In some embodiments, the provided oligonucleotide comprises one or more optionally substituted nucleotides. In some embodiments, the provided oligonucleotide comprises one or more modified nucleotides. In some embodiments, the provided oligonucleotide comprises one or more optionally substituted nucleosides. In some embodiments, the provided oligonucleotide comprises one or more modified nucleosides. In some embodiments, the provided oligonucleotide comprises one or more optionally substituted LNAs.

[0745] In some embodiments, the provided oligonucleotide comprises one or more optionally substituted nucleoside bases. In some embodiments, the provided oligonucleotide comprises one or more optionally substituted native nucleoside bases. In some embodiments, the provided oligonucleotide comprises one or more optionally substituted modified nucleoside bases. In some embodiments, the provided oligonucleotide comprises one or more 5-methylcytidine; 5-hydroxymethylcytidine, 5-formylcytosine, or 5-carboxycytosine. In some embodiments, the provided oligonucleotide comprises one or more 5-methylcytidine.

[0746] In some embodiments, the provided oligonucleotide comprises one or more optionally substituted sugars. In some embodiments, the provided oligonucleotide comprises one or more optionally substituted sugars found in naturally occurring DNA and RNA. In some embodiments, the provided oligonucleotide comprises one or more optionally substituted ribose or deoxyribose. In some embodiments, the provided oligonucleotide comprises one or more optionally substituted ribose or deoxyribose, wherein one or more hydroxyl groups of the ribose or deoxyribose moiety are optionally and independently substituted with: halogen, R', -N(R')2, -OR', or -SR', wherein each R' is independently as defined above and as described herein. In some embodiments, the provided oligonucleotide comprises one or more optionally substituted deoxyribose, wherein the 2' position of the deoxyribose is optionally and independently substituted with: halogen, R', -N(R')2, -OR', or -SR', wherein each R' is independently as defined above and as described herein. In some embodiments, the provided oligonucleotide comprises one or more optionally substituted deoxyribose sugars, wherein the 2' position of the deoxyribose is optionally and independently substituted with a halogen. In some embodiments, the provided oligonucleotide comprises one or more optionally substituted deoxyribose sugars, wherein the 2' position of the deoxyribose is optionally and independently substituted with one or more -F halogens. In some embodiments, the provided oligonucleotide comprises one or more optionally substituted deoxyribose sugars, wherein the 2' position of the deoxyribose is optionally and independently substituted with -OR', wherein each R' is independently substituted with a C1-C6 aliphatic sugar. In some embodiments, the provided oligonucleotide comprises one or more optionally substituted deoxyriboses, wherein the 2' position of the deoxyribose is optionally and independently substituted with -OR', wherein each R' is independently a optionally substituted C1-C6 alkyl group. In some embodiments, the provided oligonucleotide comprises one or more optionally substituted deoxyriboses, wherein the 2' position of the deoxyribose is optionally and independently substituted with -OMe. In some embodiments, the provided oligonucleotide comprises one or more optionally substituted deoxyriboses, wherein the 2' position of the deoxyribose is optionally and independently substituted with -O-methoxyethyl.

[0747] In some implementations, the oligonucleotides provided are single-stranded oligonucleotides.

[0748] In some embodiments, the provided oligonucleotide is a hybridized oligonucleotide chain. In some embodiments, the provided oligonucleotide is a partially hybridized oligonucleotide chain. In some embodiments, the provided oligonucleotide is a fully hybridized oligonucleotide chain. In some embodiments, the provided oligonucleotide is a double-stranded oligonucleotide. In some embodiments, the provided oligonucleotide is a triple-stranded oligonucleotide (e.g., a triplet).

[0749] In some embodiments, the provided oligonucleotides are chimeric. For example, in some embodiments, the provided oligonucleotides are DNA-RNA chimeras, DNA-LNA chimeras, etc.

[0750] In some embodiments, any structure comprising the oligonucleotide described in WO2012 / 030683 can be modified according to the method of the present invention to provide chiral-controlled variants thereof. For example, in some embodiments, chiral-controlled variants include stereochemical modifications at any one or more phosphorus linkages and / or P modifications at any one or more phosphorus linkages. For example, in some embodiments, a specific nucleotide unit of the oligonucleotide of WO2012 / 030683 is pre-selected for stereochemical modification at the phosphorus linkage of that nucleotide unit, and / or P modification at the phosphorus linkage of that nucleotide unit. In some embodiments, the chiral-controlled oligonucleotide has Figure 26-30 Any of the structures depicted. In some embodiments, the chiral-controlled oligonucleotide is Figure 26-30 Variations of any structure described herein (e.g., modified forms). The disclosure of WO2012 / 030683 is incorporated herein by reference in its entirety.

[0751] In some implementations, the provided oligonucleotides are therapeutic agents.

[0752] In some implementations, the provided oligonucleotide is an antisense oligonucleotide.

[0753] In some implementations, the provided oligonucleotide is an anti-gene oligonucleotide.

[0754] In some implementations, the provided oligonucleotide is a decoy oligonucleotide.

[0755] In some implementations, the provided oligonucleotides are part of a DNA vaccine.

[0756] In some implementations, the provided oligonucleotides are immunomodulatory oligonucleotides, such as immunostimulatory oligonucleotides and immunosuppressive oligonucleotides.

[0757] In some implementations, the provided oligonucleotide is an adjuvant.

[0758] In some implementations, the provided oligonucleotide is an aptamer.

[0759] In some implementations, the provided oligonucleotide is a ribonuclease.

[0760] In some implementations, the oligonucleotide provided is a deoxyribonuclease (DNAzyme / DNAenzyme).

[0761] In some implementations, the oligonucleotide provided is siRNA.

[0762] In some implementations, the oligonucleotides provided are microRNAs or miRNAs.

[0763] In some implementations, the oligonucleotides provided are ncRNAs (non-coding RNAs), including long non-coding RNAs (lncRNAs) and small non-coding RNAs, such as piwi-interacting RNAs (piRNAs).

[0764] In some implementations, the provided oligonucleotides are complementary to structural RNA, such as tRNA.

[0765] In some implementations, the provided oligonucleotides are nucleic acid analogs, such as GNA, LNA, PNA, TNA, and morpholino oligonucleotides.

[0766] In some implementations, the provided oligonucleotide is a P-modified prodrug.

[0767] In some embodiments, the provided oligonucleotides are primers. In some embodiments, the primers are used to amplify nucleic acids in polymerase-based chain reactions (i.e., PCR). In some embodiments, the primers are used in any known variation of PCR, such as reverse transcription PCR (RT-PCR) and real-time PCR.

[0768] In some embodiments, the provided oligonucleotides are characterized as being capable of modulating RNase H activation. For example, in some embodiments, RNase H activation is modulated by the presence of stereocontrolled phosphate-thioester nucleic acid analogs, wherein the native DNA / RNA is more or equally susceptible than the Rp stereoisomer, which in turn is more susceptible than the corresponding Sp stereoisomer.

[0769] In some embodiments, the provided oligonucleotides are characterized as capable of indirectly or directly increasing or decreasing protein activity or inhibiting or promoting protein expression. In some embodiments, the provided oligonucleotides are characterized in that they are suitable for controlling cell proliferation, viral replication, and / or any other cell signaling processes.

[0770] In some embodiments, the provided oligonucleotide is about 2 to about 200 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 2 to about 180 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 2 to about 160 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 2 to about 140 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 2 to about 120 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 2 to about 100 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 2 to about 90 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 2 to about 80 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 2 to about 70 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 2 to about 60 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 2 to about 50 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 2 to about 40 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 2 to about 30 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 2 to about 29 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 2 to about 28 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 2 to about 27 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 2 to about 26 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 2 to about 25 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 2 to about 24 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 2 to about 23 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 2 to about 22 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 2 to about 21 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 2 to about 20 nucleotide units in length.

[0771] In some embodiments, the provided oligonucleotide is about 4 to about 200 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 4 to about 180 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 4 to about 160 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 4 to about 140 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 4 to about 120 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 4 to about 100 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 4 to about 90 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 4 to about 80 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 4 to about 70 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 4 to about 60 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 4 to about 50 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 4 to about 40 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 4 to about 30 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 4 to about 29 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 4 to about 28 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 4 to about 27 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 4 to about 26 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 4 to about 25 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 4 to about 24 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 4 to about 23 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 4 to about 22 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 4 to about 21 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 4 to about 20 nucleotide units in length.

[0772] In some embodiments, the provided oligonucleotide is about 5 to about 10 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 10 to about 30 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 15 to about 25 nucleotide units in length. In some embodiments, the provided oligonucleotide is about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotide units in length.

[0773] In some embodiments, the oligonucleotide is at least 2 nucleotide units long. In some embodiments, the oligonucleotide is at least 3 nucleotide units long. In some embodiments, the oligonucleotide is at least 4 nucleotide units long. In some embodiments, the oligonucleotide is at least 5 nucleotide units long. In some embodiments, the oligonucleotide is at least 6 nucleotide units long. In some embodiments, the oligonucleotide is at least 7 nucleotide units long. In some embodiments, the oligonucleotide is at least 8 nucleotide units long. In some embodiments, the oligonucleotide is at least 9 nucleotide units long. In some embodiments, the oligonucleotide is at least 10 nucleotide units long. In some embodiments, the oligonucleotide is at least 11 nucleotide units long. In some embodiments, the oligonucleotide is at least 12 nucleotide units long. In some embodiments, the oligonucleotide is at least 15 nucleotide units long. In some embodiments, the oligonucleotide is at least 20 nucleotide units long. In some embodiments, the oligonucleotide is at least 25 nucleotide units long. In some other embodiments, the oligonucleotide is at least 30 nucleotide units long. In some other embodiments, the oligonucleotide is a duplex with a complementary strand of at least 18 nucleotide units in length. In some other embodiments, the oligonucleotide is a duplex of complementary strands with a length of at least 21 nucleotide units.

[0774] In some embodiments, the 5' and / or 3' ends of the provided oligonucleotide are modified. In some embodiments, the 5' and / or 3' ends of the provided oligonucleotide are modified with a terminal cap portion. Exemplary modifications, including terminal cap portions, are described herein and in the art extensively, such as, but not limited to, those described in U.S. Patent Application Publication US2009 / 0023675A1.

[0775] Types of oligonucleotides

[0776] In some embodiments, the oligonucleotide of formula I has any one of the structures shown in Table 2 above and the structures described in the examples.

[0777] In some embodiments, the provided chiral-controlled oligonucleotide comprises a mipomersen sequence or a portion thereof. Mipomersen is based on the following base sequence: GCCT / UCAGT / UCT / UGCT / UT / UCGCACC. In some embodiments, one or more of any nucleotides or linkages may be modified according to the present invention. In some embodiments, the present invention provides a chiral-controlled oligonucleotide having a sequence G *- C *-C*- U *-C*-dA -dG-d T -dC-dT-dG-d mC -dT-dT-dmC-G*-C*-A*-C*-C*[d=2′-deoxy, *=2′-O-(2-methoxyethyl)], said sequence having 3′→5′ thiophosphate bonds. Exemplary modified mipommelsen sequences are described throughout this application, including but not limited to those in Table 4.

[0778] In some embodiments, the provided oligonucleotide is a mipomme monomer. In some embodiments, the provided oligonucleotide is a mipomme monomer with configuration Rp. In some embodiments, the provided oligonucleotide is a mipomme monomer with configuration Sp.

[0779] Table 4 below depicts exemplary chiral-controlled oligonucleotides that contain a mipomeranian sequence or a portion thereof.

[0780] Table 4. Exemplary mipoemen-related sequences.

[0781]

[0782]

[0783]

[0784]

[0785]

[0786]

[0787] Oligonucleotide Composition

[0788] This invention provides compositions comprising a variety of provided oligonucleotides or composed of a variety of provided oligonucleotides (e.g., chiral-controlled oligonucleotide compositions). In some embodiments, all the provided oligonucleotides are of the same type, i.e., all have the same base sequence, backbone linking pattern (i.e., internucleotide linking type pattern, such as phosphate ester, thiophosphate ester, etc.), backbone chiral center pattern (i.e., linked phosphorus stereochemistry pattern (Rp / Sp)), and backbone phosphorus modification pattern (e.g., "-XLR" in Formula I). 1 (“group pattern”). However, in many embodiments, the provided composition typically contains multiple oligonucleotide types in predetermined relative amounts.

[0789] In some embodiments, the provided chiral-controlled oligonucleotide composition is a chiral pure mipommex composition. That is, in some embodiments, the provided chiral-controlled oligonucleotide composition provides mipommex in a single diastereomer form with respect to the configuration of the linked phosphorus.

[0790] In some embodiments, the provided chiral-controlled oligonucleotide composition is a chiral homogeneous mipoisen composition. That is, in some embodiments, each linking phosphate of the mipoisen is in the Rp configuration, or each linking phosphate of the mipoisen is in the Sp configuration.

[0791] In some embodiments, the provided chiral-controlled oligonucleotide composition comprises a combination of one or more provided oligonucleotide types. Those skilled in the art of chemistry and medicine will recognize that the choice and amount of each of the one or more types of provided oligonucleotides in the provided composition will depend on the intended use of that composition. That is, those skilled in the art will design the provided chiral-controlled oligonucleotide composition such that the amount and type of provided oligonucleotides contained therein results in the composition generally possessing certain desired characteristics (e.g., biodesirable characteristics, therapeutically desirable characteristics, etc.).

[0792] In some embodiments, the provided chiral-controlled oligonucleotide composition comprises a combination of two or more provided oligonucleotide types. In some embodiments, the provided chiral-controlled oligonucleotide composition comprises a combination of three or more provided oligonucleotide types. In some embodiments, the provided chiral-controlled oligonucleotide composition comprises a combination of four or more provided oligonucleotide types. In some embodiments, the provided chiral-controlled oligonucleotide composition comprises a combination of five or more provided oligonucleotide types. In some embodiments, the provided chiral-controlled oligonucleotide composition comprises a combination of six or more provided oligonucleotide types. In some embodiments, the provided chiral-controlled oligonucleotide composition comprises a combination of seven or more provided oligonucleotide types. In some embodiments, the provided chiral-controlled oligonucleotide composition comprises a combination of eight or more provided oligonucleotide types. In some embodiments, the provided chiral-controlled oligonucleotide composition comprises a combination of nine or more provided oligonucleotide types. In some embodiments, the provided chiral-controlled oligonucleotide composition comprises a combination of ten or more provided oligonucleotide types. In some embodiments, the provided chiral-controlled oligonucleotide composition comprises a combination of fifteen or more provided oligonucleotide types.

[0793] In some embodiments, the provided chiral-controlled oligonucleotide composition is a combination of a certain amount of chiral homogeneous mipomethasone with the Rp conformation and a certain amount of chiral homogeneous mipomethasone with the Sp conformation.

[0794] In some embodiments, the provided chiral-controlled oligonucleotide composition is a combination of a certain amount of chiral homogeneous mipoemone with the Rp configuration, a certain amount of chiral homogeneous mipoemone with the Sp configuration, and a certain amount of one or more chiral pure mipoemones having the desired diastereomeric forms.

[0795] Methods for preparing chiral controlled oligonucleotides and compositions thereof

[0796] This invention provides a method for preparing chiral-controlled oligonucleotides comprising one or more specific nucleotide types and chiral-controlled compositions. As indicated above, the phrase "oligonucleotide type" as used herein is defined as having a specific base sequence, backbone linking pattern, backbone chiral center pattern, and backbone phosphorus modification pattern (e.g., "-XLR"). 1 Oligonucleotides with a common designated "type" are structurally identical to each other in terms of base sequence, backbone linking pattern, backbone chiral center pattern, and backbone phosphorus modification pattern.

[0797] In some embodiments, the chiral-controlled oligonucleotides provided in this invention have properties different from those of the corresponding stereorandom oligonucleotide mixtures. In some embodiments, the chiral-controlled oligonucleotides have lipophilicity different from those of the stereorandom oligonucleotide mixtures. In some embodiments, the chiral-controlled oligonucleotides have different retention times on HPLC. In some embodiments, the chiral-controlled oligonucleotides may have peak retention times significantly different from those of the corresponding stereorandom oligonucleotide mixtures. During the purification of oligonucleotides using HPLC as generally practiced in the art, some chiral-controlled oligonucleotides will be largely lost, even if not completely. One consequence is that certain diastereomers (certain chiral-controlled oligonucleotides) of the stereorandom oligonucleotide mixture are not tested in the assay. Another consequence is that, between batches, the assumed "pure" stereorandom oligonucleotides will have inconsistent compositions due to unavoidable instrumental and human errors, because the diastereomers in the composition and their relative and absolute amounts differ between batches. The chiral controlled oligonucleotides and chiral controlled oligonucleotide compositions provided in this invention overcome the aforementioned problems because the chiral controlled oligonucleotides are synthesized in a chiral controlled manner in a single diastereomer form, and the chiral controlled oligonucleotide compositions contain a predetermined level of one or more individual oligonucleotide types.

[0798] Those skilled in the art of chemistry and synthesis will appreciate that the synthetic method of the present invention provides a degree of control during the various steps of synthesizing the provided oligonucleotides so that the nucleotide units of the oligonucleotide can be designed in advance to have a specific stereochemistry at the linking phosphorus and / or to have a specific modification at the linking phosphorus, and / or specific bases and / or specific sugars. In some embodiments, the provided oligonucleotides are designed in advance to have a specific combination of stereocenters at the linking phosphorus of the internucleotide bonds.

[0799] In some embodiments, the oligonucleotides provided using the methods of the present invention are designed and / or determined to have specific combinations of phosphate-linked modifications. In some embodiments, the oligonucleotides provided using the methods of the present invention are designed and / or determined to have specific combinations of bases. In some embodiments, the oligonucleotides provided using the methods of the present invention are designed and / or determined to have specific combinations of sugars. In some embodiments, the oligonucleotides provided using the methods of the present invention are designed and / or determined to have specific combinations of one or more structural features.

[0800] The method of the present invention exhibits a high degree of chiral control. For example, the method of the present invention helps to control the stereochemical configuration of each individual linked phosphorus within the provided oligonucleotide. In some embodiments, the method of the present invention provides an oligonucleotide comprising one or more nucleotides independently having modified structures of Formula I.

[0801] In some embodiments, the method of the present invention provides an oligonucleotide that is a mipomesen monomer. In some embodiments, the method of the present invention provides an oligonucleotide that is a mipomesen monomer having the configuration Rp. In some embodiments, the method of the present invention provides an oligonucleotide that is a mipomesen monomer having the configuration Sp.

[0802] In some embodiments, the method of the present invention provides a chiral-controlled oligonucleotide composition, i.e., an oligonucleotide composition containing predetermined levels of individual oligonucleotide types. In some embodiments, the chiral-controlled oligonucleotide composition comprises one oligonucleotide type. In some embodiments, the chiral-controlled oligonucleotide composition comprises more than one oligonucleotide type. In some embodiments, the chiral-controlled oligonucleotide composition comprises multiple oligonucleotide types. Exemplary chiral-controlled oligonucleotide compositions prepared according to the present invention are described herein.

[0803] In some embodiments, the method of the present invention provides a chiral pure mipommex composition with respect to the configuration of the linked phosphorus. That is, in some embodiments, the method of the present invention provides a mipommex composition wherein the mipommex with respect to the configuration of the linked phosphorus is present in the composition in a single diastereomer.

[0804] In some embodiments, the method of the present invention provides a mipommex composition with chiral homogeneity regarding the phosphorus-linked configuration. That is, in some embodiments, the method of the present invention provides a mipommex composition in which all nucleotide units have the same stereochemistry with respect to the phosphorus-linked configuration, for example, all nucleotide units have an Rp configuration at the phosphorus-linked configuration, or all nucleotide units have an Sp configuration at the phosphorus-linked configuration.

[0805] In some embodiments, the provided chiral controlled oligonucleotide has a purity exceeding 50%. In some embodiments, the provided chiral controlled oligonucleotide has a purity exceeding about 55%. In some embodiments, the provided chiral controlled oligonucleotide has a purity exceeding about 60%. In some embodiments, the provided chiral controlled oligonucleotide has a purity exceeding about 65%. In some embodiments, the provided chiral controlled oligonucleotide has a purity exceeding about 70%. In some embodiments, the provided chiral controlled oligonucleotide has a purity exceeding about 75%. In some embodiments, the provided chiral controlled oligonucleotide has a purity exceeding about 80%. In some embodiments, the provided chiral controlled oligonucleotide has a purity exceeding about 85%. In some embodiments, the provided chiral controlled oligonucleotide has a purity exceeding about 90%. In some embodiments, the provided chiral controlled oligonucleotide has a purity exceeding about 91%. In some embodiments, the provided chiral controlled oligonucleotide has a purity exceeding about 92%. In some embodiments, the provided chiral controlled oligonucleotide has a purity exceeding about 93%. In some embodiments, the provided chiral controlled oligonucleotide has a purity exceeding about 94%. In some embodiments, the provided chiral controlled oligonucleotide has a purity exceeding about 95%. In some embodiments, the provided chiral controlled oligonucleotide has a purity exceeding about 96%. In some embodiments, the provided chiral controlled oligonucleotide has a purity exceeding about 97%. In some embodiments, the provided chiral controlled oligonucleotide has a purity exceeding about 98%. In some embodiments, the provided chiral controlled oligonucleotide has a purity exceeding about 99%. In some embodiments, the provided chiral controlled oligonucleotide has a purity exceeding about 99.5%. In some embodiments, the provided chiral controlled oligonucleotide has a purity exceeding about 99.6%. In some embodiments, the provided chiral controlled oligonucleotide has a purity exceeding about 99.7%. In some embodiments, the provided chiral controlled oligonucleotide has a purity exceeding about 99.8%. In some embodiments, the provided chiral controlled oligonucleotide has a purity exceeding about 99.9%. In some embodiments, the provided chiral controlled oligonucleotide has a purity exceeding at least about 99%.

[0806] In some embodiments, the chiral-controlled oligonucleotide composition is designed to comprise a single oligonucleotide type. In some embodiments, the composition is about 50% diastereomeric. In some embodiments, the composition is about 50% diastereomeric. In some embodiments, the composition is about 50% diastereomeric. In some embodiments, the composition is about 55% diastereomeric. In some embodiments, the composition is about 60% diastereomeric. In some embodiments, the composition is about 65% diastereomeric. In some embodiments, the composition is about 70% diastereomeric. In some embodiments, the composition is about 75% diastereomeric. In some embodiments, the composition is about 80% diastereomeric. In some embodiments, the composition is about 85% diastereomeric. In some embodiments, the composition is about 90% diastereomeric. In some embodiments, the composition is about 91% diastereomeric. In some embodiments, the composition is about 92% diastereoisomeric. In some embodiments, the composition is about 93% diastereoisomeric. In some embodiments, the composition is about 94% diastereoisomeric. In some embodiments, the composition is about 95% diastereoisomeric. In some embodiments, the composition is about 96% diastereoisomeric. In some embodiments, the composition is about 97% diastereoisomeric. In some embodiments, the composition is about 98% diastereoisomeric. In some embodiments, the composition is about 99% diastereoisomeric. In some embodiments, the composition is about 99% diastereoisomeric. In some embodiments, the composition is about 99.5% diastereoisomeric. In some embodiments, the composition is about 99.6% diastereoisomeric. In some embodiments, the composition is about 99.7% diastereoisomeric. In some embodiments, the composition is about 99.8% diastereoisomeric. In some embodiments, the composition is about 99.9% diastereoisomeric. In some embodiments, the composition is at least about 99% diastereoisopure.

[0807] In some embodiments, the chiral-controlled oligonucleotide composition is a composition designed to comprise multiple oligonucleotide types. In some embodiments, the method of the present invention allows the generation of a chiral-controlled oligonucleotide library such that pre-selected amounts of any one or more chiral-controlled oligonucleotide types can be mixed with any one or more other chiral-controlled oligonucleotide types to generate a chiral-controlled oligonucleotide composition. In some embodiments, the pre-selected amount of oligonucleotide types is a composition having any of the above-described diastereomeric purities.

[0808] In some embodiments, the present invention provides a method for preparing chiral-controlled oligonucleotides, comprising the following steps:

[0809] (1) Coupling;

[0810] (2) Add a hat;

[0811] (3) Modification;

[0812] (4) Remove the closure; and

[0813] (5) Repeat steps (1)-(4) until the desired length is achieved.

[0814] When describing the provided methods, the term "loop" has its common meaning as understood by one of ordinary skill in the art. In some implementations, a round of steps (1)-(4) is referred to as a loop.

[0815] In some embodiments, the present invention provides a method for preparing chiral-controlled oligonucleotide compositions, comprising the following steps:

[0816] (a) Providing a certain amount of oligonucleotides with first-chirality control; and

[0817] (b) Optionally provide a certain amount of one or more other chiral controlled oligonucleotides.

[0818] In some embodiments, the first chiral-controlled oligonucleotide is of the type of oligonucleotide as described herein. In some embodiments, one or more other chiral-controlled oligonucleotides are of the type of oligonucleotide as described herein.

[0819] Those skilled in the art of chemistry and synthesis will recognize that the structural variations and stereochemical configurations of the oligonucleotides synthesized using the methods of this invention offer a degree of versatility and control. For example, after the first cycle is completed, subsequent cycles can be performed using nucleotide units individually selected for that subsequent cycle, which in some embodiments contain nucleotide bases and / or sugars different from those in the first cycle. Similarly, the chiral auxiliaries used in the coupling steps of subsequent cycles may differ from those used in the first cycle to produce phosphorus linkages with different stereochemical configurations in the second cycle. In some embodiments, the stereochemistry of the linking phosphorus in the newly formed internucleotide linkages is controlled by using stereochemically pure phosphoramide. Additionally, the modifying agents used in the modification steps of subsequent cycles may differ from those used in the first or previous cycles. The cumulative effect of this iterative assembly method is that the components of the provided oligonucleotides can be highly customized both structurally and conformally. Another advantage of this method is that the capping step minimizes the formation of “n-1” impurities, which would otherwise make the isolation of the provided oligonucleotides extremely challenging, especially for longer oligonucleotides.

[0820] In some embodiments, exemplary cycles of methods for preparing chiral-controlled oligonucleotides are illustrated in Scheme I. In Scheme I, ○ represents a solid support and optionally a portion of the chiral-controlled oligonucleotide linked to the solid support for growth. An illustrative chiral auxiliary has the structure of Formula 3-I:

[0821]

[0822] The following is a further description. A “cap” is any chemical part introduced to the nitrogen atom via a capping step, and in some embodiments, is an amino protecting group. Those skilled in the art will understand that in the first cycle, only one nucleoside may be attached to the solid support at the beginning, and cycle exit may optionally occur before deblocking. As those skilled in the art will understand, B PRO These are protected bases used in oligonucleotide synthesis. The steps of the above cycle in Scheme I are further described below.

[0823] Option I. Synthesize chiral-controlled oligonucleotides.

[0824]

[0825] Synthesis on a solid support

[0826] In some embodiments, the synthesis of the provided oligonucleotide is carried out on a solid phase. In some embodiments, reactive groups present on the solid support are protected. In some embodiments, reactive groups present on the solid support are not protected. During oligonucleotide synthesis, the solid support is treated with various reagents in several synthetic cycles to achieve stepwise elongation of the oligonucleotide chain with individual nucleotide units. The nucleoside unit directly attached to the solid support at the chain end is referred to as the “first nucleoside” as used herein. The first nucleoside is bound to the solid support via a linker portion, which is a divalent group having a covalent bond between the CPG, polymer, or other solid support and the nucleoside. The linker remains intact during the synthetic cycles in which the oligonucleotide chain is assembled and is cleaved after chain assembly to release the oligonucleotide from the support.

[0827] Solid supports for solid-phase nucleic acid synthesis include, for example, those described in U.S. Patents 4,659,774, 5,141,813, and 4,458,066; U.S. Patents to Caruthers 4,415,732, 4,458,066, 4,500,707, 4,668,777, 4,973,679, and 5,132,418; U.S. Patents to Andrus et al. 5,047,524 and 5,262,530; and U.S. Patent to Koster 4,725,677 (reissued as Re34,069). In some embodiments, the solid phase is an organic polymer support. In some embodiments, the solid phase is an inorganic polymer support. In some embodiments, the organic polymer carrier is polystyrene, aminomethyl polystyrene, polyethylene glycol-polystyrene graft copolymer, polyacrylamide, polymethacrylate, polyvinyl alcohol, highly cross-linked polymer (HCP), or other synthetic polymers, carbohydrates (such as cellulose and starch or other polymeric carbohydrates), or other organic polymers and any copolymers, composite materials, or combinations of the above inorganic or organic materials. In some embodiments, the inorganic polymer carrier is silica, alumina, controllable polymerizable glass (CPG) as a silica gel carrier, or aminopropyl CPG. Other suitable solid supports include fluorinated solid supports (see, for example, WO / 2005 / 070859), and long-chain alkylamine (LCAA) controlled-porosity glass (CPG) solid supports (see, for example, SPAdams, KSKavka, EJWykes, SBHolder, and GRGalluppi, J. Am. Chem. Soc., 1983, 105, 661-663; GRGough, MJBruden, and P.T. Gilham, Tetrahedron Lett., 1981, 22, 4177-4180). Membrane supports and polymeric membranes (see, for example, Innovation and Perspectives in Solid Phase Synthesis, Peptides, Proteins and Nucleic Acids, Chapter 21, pp. 157-162, 1994, Roger Epton, ed., and U.S. Patent No. 4,923,901) are also suitable for nucleic acid synthesis. Once formed, the membrane can be chemically functionalized for use in nucleic acid synthesis. In addition to functional groups being attached to the membrane, connectors or spacer groups attached to the membrane are also used in some embodiments to minimize steric hindrance between the membrane and the synthesized chain.

[0828] Other suitable solid supports include those commonly known in the art for use in solid-phase methods, including, for example, glasses sold as Primer™ 200 supports, controlled-porosity glasses (CPG), oxalyl-controlled-porosity glasses (see, for example, Alul et al., Nucleic Acid Research, 1991, 19, 1527), TentaGel supports—an amino-polyethylene glycol derivatized support (see, for example, Wright et al., Tetrahedron Lett., 1993, 34, 3373), and Poros—a polystyrene / divinylbenzene copolymer.

[0829] Surface-activated polymers have been shown to be used for the synthesis of natural and modified nucleic acids and proteins on a variety of solid support media. Solid support materials can be any polymer suitably homogeneous in porosity, with sufficient amine content and sufficient flexibility to withstand any accompanying manipulations without loss of integrity. Examples of suitable materials include nylon, polypropylene, polyester, polytetrafluoroethylene, polystyrene, polycarbonate, and nitrocellulose. Other materials may serve as solid supports depending on the researcher's design. For some designs, metal plating (particularly gold or platinum) may be chosen (see, for example, US Publication No. 20010055761). In one embodiment of oligonucleotide synthesis, nucleosides are anchored to a solid support functionalized with hydroxyl or amino residues, for example. Alternatively, the solid support is derived to provide acid-instantaneous ...

Claims

1. A chirally controlled oligonucleotide composition comprising a double stranded RNAi agent, wherein: the RNAi agent comprises a sense strand and an antisense strand; the sense strand is 5'-uucuAGAccuGuuuuGcuudTsdT-3', wherein the "s" at the 3' terminus is a phosphorothioate internucleotide linkage in the Rp or Sp configuration; the antisense strand is 5'-asAGcAAAAcAGGUCuAGAAdTsdT-3', wherein the "s" at the 3' terminus is a phosphorothioate internucleotide linkage in the Sp configuration and the "s" at the 5' terminus is a phosphorothioate internucleotide linkage in the Rp configuration; each capital nucleotide is independently a RNA nucleotide; each lowercase nucleotide is independently a 2'-OMe nucleotide; and d represents 2'-deoxy.

2. The composition of claim 1, wherein the double stranded RNAi agent has a purity of more than about 50%.

3. The composition of claim 1, wherein the double stranded RNAi agent has a purity of more than about 60%.

4. The composition of claim 1, wherein the double stranded RNAi agent has a purity of more than about 70%.

5. The composition of claim 1, wherein the double stranded RNAi agent has a purity of more than about 80%.

6. The composition of claim 1, wherein the double stranded RNAi agent has a purity of more than about 85%.

7. The composition of claim 1, wherein the double stranded RNAi agent has a purity of more than about 90%.

8. The composition of claim 1, wherein the double stranded RNAi agent has a purity of more than about 95%.

9. The composition of claim 1, wherein the double stranded RNAi agent has a purity of more than about 98%.

10. The composition of claim 1, wherein the double stranded RNAi agent has a purity of more than about 99%.

11. A pharmaceutical composition comprising a therapeutically effective amount of the composition of any one of claims 1-10 and a pharmaceutically acceptable excipient.

12. Use of the composition of any one of claims 1-10 or the pharmaceutical composition of claim 11 for the manufacture of a medicament for the treatment of a disease, wherein the disease is hypercholesterolemia.

13. A conjugate of the double stranded RNAi agent of any one of claims 1-10 and a ligand.

Images